Research ArticleArtemisia princeps Inhibits Biofilm Formation andVirulence-Factor Expression of Antibiotic-Resistant Bacteria
Na-Young Choi1 Sun-Young Kang2 and Kang-Ju Kim34
1College of Education Wonkwang University Iksan 570-749 Republic of Korea2Department of Oral Biochemistry School of Dentistry Wonkwang University Iksan 570-749 Republic of Korea3Wonkwang Research Institute for Food Industry Iksan 570-749 Republic of Korea4Department of Oral Microbiology School of Dentistry Wonkwang University Iksan 570-749 Republic of Korea
Correspondence should be addressed to Kang-Ju Kim kjkimomwkuackr
Received 20 January 2015 Accepted 13 February 2015
Academic Editor Seung-Il Jeong
Copyright copy 2015 Na-Young Choi et alThis is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited
In this study we used ethanol extract of A princeps and investigated its antibacterial effects against MRSA Ethanol extract of Aprinceps significantly inhibited MRSA growth and organic acid production during glucose metabolism at concentrations greaterthan 1mgmL (P lt 005) MRSA biofilm formation was observed using scanning electron microscopy (SEM) and safranin stainingA princeps extract was found to inhibit MRSA biofilm formation at concentrations higher than 2mgmL significantly (P lt 005)Bactericidal effects of theA princepswere observed using confocal lasermicroscopy which showed thatA princepswas bactericidalin a dose-dependent manner Using real-time PCR expression of mecA an antibiotic-resistance gene of MRSA was observedalong with that of sea agrA and sarA A princeps significantly inhibited mecA sea agrA and sarA mRNA expression at theconcentrations greater than 1mgmL (P lt 005) The phytochemical analysis of A princeps showed a relatively high content oforganic acids and glycosides The results of this study suggest that the ethanol extract of A princepsmay inhibit proliferation acidproduction biofilm formation and virulence gene expressions of MRSA which may be related to organic acids and glycosides themajor components in the extract
1 Introduction
The appearance of antibiotic-resistant bacteria has led todifficulties in treating infectious diseases Therefore newantibiotics have been developed but bacteria rapidly evolveresistance to the new treatments neutralizing their efficacyMethicillin-resistant Staphylococcus aureus (MRSA) is one ofsuch resistant strains S aureus is a bacterium commonlyobserved in nature as well as in normal skin the nasal cavityand the oral cavity The bacterium causes diseases in manyorgans including the skin when an individual is immuno-compromised this can result in serious diseases such asendocarditis and septicemia [1]
When antibiotics such as penicillin were developedtreatments for S aureus infection were effective because ofthe high sensitivity of the bacterium to antibiotics howeverthe frequency of resistant bacteria has increased with theutilization of penicillin [2 3] The bacteria show resistance
by producing120573-lactamase and inactivating antibiotics such aspenicillin Subsequently methicillin which is not inactivatedby 120573-lactamase was developed and utilized for treatingpenicillin-resistant bacteria However since MRSA emergedin the early 1960s its frequency has gradually increased[4] MRSA is resistant to not only 120573-lactamase antibioticsbut also many other antibiotics making effective treatmentdifficult [5 6] Mechanisms of MRSA antibiotic resistanceare not clearly understood However it is known that MRSApossesses mecA genes and produces PBP 21015840 a derivative ofpenicillin-binding protein (PBP) which reduces the affinityof PBP to 120573-lactamase antibiotics such as methicillin Inaddition resistance is reported to occur through the acqui-sition of resistant plasmid (R plasmid) with 120573-lactamase-expressing genes [2] MRSA can form biofilms in implantsthat are injected into patients in medical supplies or inmedical devices [7 8] Once biofilms are formed they cannotbe easily neutralized by antibiotics paving the way to serious
Hindawi Publishing CorporationBioMed Research InternationalVolume 2015 Article ID 239519 7 pageshttpdxdoiorg1011552015239519
2 BioMed Research International
pathogenic infection [9] MRSA can produce organic acidsvia carbohydrate metabolism pathways It has been reportedthat organic acids produced by MRSA decrease pH and canfacilitate biofilm formation [10 11] MRSA possesses severalvirulence factors sea encodes staphylococcal enterotoxin A(SEA) SEA one of major virulence factors of S aureus [12]is known to induce staphylococcal gastroenteritis secrete T-cell-derived cytokines and stimulate T-cell activation owingto the presence of immunomodulatory properties of super-antigens In S aureus production of virulence factors isregulated by global regulators such as agr and sarA [13]
MRSA has emerged to be one of the most importantpathogenic bacteria because of its characteristics such asmul-tidrug resistance and biofilm formationTherefore newdrugscapable of treating an MRSA infection must be developedHistorically many scientists have identified antibacterialsubstances in natural products which is currently an activefield of study [14 15]
Artemisia princeps (A princeps) a perennial herb belong-ing to the Asteraceae family is distributed throughout EastAsia and iswidely used tomaintain hemostasis and in treatingpain hypermenorrhea amenorrhea uterine hemorrhagehemorrhoids inflammation and menopausal diseases [16]
However few studies have examined the effects of Aprinceps on MRSA In studies conducted to discover naturalproducts with antibacterial effects against MRSA it wasfound that ethanol extract of A princeps showed antibac-terial effects against MRSA In this study we investigatedthe inhibitory effect of A princeps on proliferation acidproduction biofilm formation and virulence gene expressionof MRSA Phytochemical analyses were also performed toinvestigate detailed chemical constituents of ethanol extractof A princeps
2 Materials and Methods
21 Material Brain heart infusion (BHI) broth was pur-chased from Difco Laboratories (Detroit MI USA) Glucoseand dimethyl sulfoxide (DMSO) were obtained from SigmaCo (St Louis MO USA)MRSAATCC 33591 was purchasedfrom the American Type Culture Collection (ATCC Manas-sas VA USA)
22 Plant Material and Extraction The leaves of A princepswere obtained from the oriental drug store Dae Hak YakKuk (Iksan South Korea) The identity of the specimen wasconfirmed by Young-Hoi Kim at the College of Environmen-tal and Bioresource sciences Chonbuk National University(Jeonju South Korea) A voucher specimen (number 8-10-13) has been deposited at the Herbarium of the Departmentof Oral Biochemistry in Wonkwang University Dried leaves(250 g) of A princeps were soaked in 3500mL of 70ethanol for 72 h at room temperature The extracted solutionwas filtered and evaporated under reduced pressure to yieldan ethanol extract of 57 g (228) After the extract wasthoroughly dried to facilitate complete removal of the solventthe dry extract was dissolved in DMSO to give the desiredstock solution The final concentration of DMSO applied to
culture systems was adjusted to 01 (vv) which did notinterfere with the testing system Control groups were treatedwith media containing 01 DMSO
23 Bacterial Growth and Acid Production Bacterial growthwas determined using a modification of a previouslydescribed method [3 8]The growth of MRSA was examinedat 37∘C in 095mL of BHI broth containing various concen-trations of the ethanol extract ofA princepsThese tubes wereinoculated with 005mL of an overnight culture grown inBHI broth [final 5 times 105 colony-forming units (CFU)mL]and incubated at 37∘C After 24 h of incubation the opticaldensity (OD) of cells was measured spectrophotometricallyat 550 nm and the pH of the cultures was determined using apHmeter (Corning Inc Corning NYUSA)Three replicatesweremeasured for each concentration of the test extract NaF(01) was used as a positive control
24 Biofilm Assay The biofilm assay was based on a methoddescribed previously [6 11] A princeps extract was addedto BHI broth containing 1 glucose in 35mm polystyrenedishes or 24-well plates (Nunc Copenhagen Denmark)The cultures were then inoculated with a seed culture ofMRSA (final 5 times 105 CFUmL) After cultivating for 48 hat 37∘C the supernatant was removed completely and thedishes wells or wells containing resin teeth were rinsed withdistilled waterThe amount of biofilm formed in the wells wasmeasured by staining with 01 safraninThe bound safraninwas released from the stained cells with 30 acetic acid andthe absorbance of the solution was measured at 530 nm Thebiofilm formed on the surface of the resin teeth was alsostained with 01 safranin and photographed
25 Scanning Electron Microscopy (SEM) The biofilm on35mm polystyrene dishes was also determined by SEM usinga modification of a previously described method [4] Thebiofilm formed on the dishes was rinsed with distilled waterand fixed with 25 glutaraldehyde in 01M sodium cacody-late buffer (pH 72) at 4∘C for 24 h After gradual dehydrationwith ethyl alcohol 60 70 80 90 95 and 100 the sample wasfreeze-dried The specimens were then sputter-coated withgold (108A sputter coater Cressington Scientific InstrumentsIncWatford UK) For observation a JSM-6360 SEM (JEOLTokyo Japan) was used
26 Confocal Laser Scanning Microscopy Bactericidal effectof A princeps extract was determined by confocal laserscanningmicroscopyThe culturedMRSA in BHIwas dilutedusing BHI media to approximately 1 times 107 CFUmLThe bac-teria (1 times 107 CFUmL) were treated with high concentrations(8ndash64mgmL) of A princeps extract at 37∘C under aerobicconditions After 30min of incubation the bacteria werewashed with PBS and stained with LIVEDEAD BacLightBacterial Viability Kit (Molecular Probes Eugene OR USA)prepared according to the manufacturerrsquos instructions for15min Stained bacteria were observed confocal laser scan-ning microscopy (LSM 510 Zeiss Germany) This methodis based on two nucleic acid stains green fluorescent SYTO
BioMed Research International 3
Table 1 Nucleotide sequences of primer used for real-time PCR in this study
Gene Gene description Primer sequences (51015840-31015840)Forward Reverse
16srRNA Normalizing internal standard ACTGGGATAACTTCGGGAAA CGTTGCCTTGGTAAGCCmecA Penicillin binding protein 21015840 GTTAGATTGGGATCATAGCGTCATT TGCCTAATCTCATATGTGTTCCTGTATSea Staphylococcal enterotoxin A ATGGTGCTTATTATGGTTATC CGTTTCCAAAGGTACTGTATTagrA Accessory gene regulator A TGATAATCCTTATGAGGTGCTT CACTGTGACTCGTAACGAAAAsarA Staphylococcal accessary regulator A TGTTATCAATGGTCACTTATGCTG TCTTTGTTTTCGCTGATGTATGTC
9 stain and red fluorescent propidium iodide stain whichdiffer in their ability to penetrate healthy bacterial cells SYTO9 stain labels live bacteria in contrast propidium iodidepenetrates only bacteria with damaged membranes
27 Real-Time Polymerase Chain Reaction (PCR) Analysis Todetermine the effect ofA princeps extract on gene expressiona real-time PCR assay was performed The subminimalinhibitory concentration (1ndash4mgmL) of A princeps extractwas used to treat and culture MRSA for 24 h Total RNAwas isolated from S mutans by using Trizol reagent (Gibco-BRL) according to the manufacturerrsquos instructions ThencDNA was synthesized using a reverse transcriptase reaction(Superscript Gibco-BRL) The DNA amplifications werecarried out using an ABI-Prism 7000 Sequence DetectionSystemwithAbsoluteQPCR SYBRGreenMixes (Applied Biosystems Inc Foster City CA USA) The primer pairs thatwere used in this studywere described by previous report [17ndash20] and are listed in Table 1 16S rRNAwas used as an internalcontrol
28 Phytochemical Screening Phytochemical tests of theextract were performed as previously described [21 22]Mayerrsquos reagent was used for alkaloids ferric chloride reagentfor phenolics Molish test for glycosides Biuret reagentfor peptides Mg-HCl reagent for flavonoids Liebermann-Burchard reagent for steroids and silver nitrate reagent fororganic acids
29 Statistical Analysis All experiments were performed intriplicate Data were analyzed using the Statistical Packagefor Social Sciences (SPSS Chicago IL USA) The data areexpressed as the mean plusmn standard deviation values Thedifferences between the means of the experimental andcontrol groups were evaluated by Studentrsquos 119905-test Values of119875 lt 005 were considered statistically significant
3 Results
In the present study after performing ethanol extractionof A princeps the antibacterial effects against MRSA weretested The results are shown in Figure 1 After treatingMRSA with 1 2 4 and 8mgmL of ethanol extract of Aprinceps showed a dose-dependent manner the antibacterialeffects of A princeps ethanol extract against MRSA wereobserved Compared to controls the ethanol extract of Aprinceps showed significant inhibition of MRSA growth at
0000
0100
0200
0300
0400
Control 1 2 4 8 NaF (01)Artemisia princeps (mgmL)
lowast
lowast
lowast
lowastlowast
Opt
ical
den
sity
A550
Figure 1 Effect of ethanol extract of A princeps on the growthof MRSA MRSA was inoculated into BHI broth with variousconcentrations of A princeps and incubated for 24 h at 37∘C Theoptical density (A
550) was read using a spectrophotometer Data are
mean plusmn standard deviation lowast119875 lt 005 compared to the controlgroup
concentrations higher than 1mgmL The positive controlused in this study 01NaF also showed antibacterial effectsThe minimum inhibitory concentration (MIC) of ethanolextract of A princeps against MRSA was confirmed to be8mgmLThese results indicate that the ethanol extract of Aprinceps has antibacterial effects against MRSA
MRSA generates organic acids by metabolizing carbo-hydrates To investigate whether the ethanol extract of Aprinceps can suppress organic acid production in MRSAthe ethanol extract of A princeps was added to MRSAculture medium and the change in pH was measured ThepH of the control culture medium was approximately 72before the incubation which decreased to approximately 587after culturing (Table 2) However this decrease in pH wassuppressed in the group treated with the ethanol extract ofA princeps (1ndash8mgmL) The positive control 01 NaF alsoshowed suppression in pH reductionThese results reveal thatorganic acid production in MRSA can be inhibited by theethanol extract of A princeps
MRSA forms biofilms on implants medical suppliesor on medical devices which eventually increases the bac-teriumrsquos antibiotic resistance In this study we examinedwhether an ethanol extract of A princeps was able to inhibitthe biofilm formation of MRSA Using safranin staining theethanol extract ofA princeps at concentrations of 2ndash8mgmLwas seen to inhibit MRSA biofilm formation (Figure 2) Thepositive control used in this study 01 NaF also inhibited
4 BioMed Research International
Table 2 Effect of ethanol extract of A princeps on acid productionby MRSA
Date (pH) are represented as mean plusmn standard deviationlowast119875 lt 005 when compared with the control group after incubation
0000
0200
0400
0600
0800
1000
1200
Control 1 2 4 8 NaF (01)Artemisia princeps Pamp (mgmL)
lowast
lowast
lowast
lowast
Opt
ical
den
sity
A530
of b
iofil
m
Figure 2 Effect of ethanol extract of A princeps on biofilmformation by MRSA MRSA was inoculated into BHI broth withvarious concentrations ofA princeps and incubated for 48 h at 37∘CThe biofilms that formed on the dish surface were measured bystaining with 01 safranin The bound safranin was released fromthe stained cells with 30 acetic acid and the absorbance of thesolution was measured at 530 nm Data are represented as mean plusmnstandard deviation lowast119875 lt 005 compared to the control group
biofilm formation These results were confirmed by SEMimages (Figure 3) which showed similar outcomes to theresults of safranin staining In the control that was nottreatedwith the ethanol extract ofA princepsMRSA adhereddensely to the surface of the polystyrene 35mm dish andformed biofilms whereas biofilm formation decreased inproportion to the ethanol extract concentration when theextract was introduced Biofilm formation also decreased inthe positive control
Using a confocal laser microscopy the bactericidal effectsof ethanol extract of A princeps were examined The ethanolextract of A princeps was observed to be bactericidal in adose-dependent manner (8ndash64mgmL) (Figure 4) Expres-sion of mecA an antibiotic-resistant gene of MRSA as wellthat of sea agrA and sarA and virulence-factor genes wasestimated using real-time PCR in sub-MIC The ethanolextract of A princeps inhibited mecA sea agrA and sarAmRNA expression at concentrations greater than 1mgmL(Figure 5)
Phytochemical analysis of princeps showed relatively highorganic acid content medium glycosides content and weak
Table 3 Phytochemical analysis of the ethanol extract of Artemisiaprinceps
Plant constituents Ethanol extractAlkaloids minus
Phenolics +Flavonoids minus
Glycosides ++Peptides minus
Steroids terpenoids minus
Organic acids ++++++ strong ++ moderate + poor minus absent
phenolic content Alkaloid flavonoid and peptides weredetected only at very low levels (Table 3)
4 Discussion
MRSA is a typical antibiotic-resistant strain Development ofnew antibiotics is necessary for treating such strains Naturalproducts can be utilized as raw materials in the developmentof new antibacterial substances
A princeps is used as a digestive medicine in treatingfever as an anthelmintic and as an antihemorrhagic agent inoriental medicines and is known to be effective for treatinggynecological and gastrointestinal diseases In addition itsconstituents are known to have various physiological effectssuch as insecticidal antibacterial and antitumor effects [2324]
In this study we investigated the antibacterial effects ofan ethanol extract of A princeps against MRSA The ethanolextract of A princeps at 1ndash8mgmL was found to inhibitMRSA growth The evidence of antibacterial effects of theethanol extract of A princeps supports the use of A princepsas a traditional medicine to treat patients with infectiousdiseases in Korea According to previous studies on thearoma constituents of A princeps thujone caryophylleneand farnesol showed antibacterial effects against Escherichiacoli Enterobacter aerogenes Vibrio parahaemolyticus Pseu-domonas aeruginosa Bacillus subtilis and Staphylococcusaureus [23]
MRSA is known to produce organic acids through carbo-hydrate metabolism pathways [10 11] Acetic acid is the mainorganic acid produced by MRSA which lowers pH in theinfected area this lowered pH facilitates biofilm formationby microorganisms [10] Our results showed that the ethanolextract of A princeps inhibited the pH reduction induced byMRSA This result indicates that the ethanol extract of Aprinceps inhibits carbohydrate metabolism in MRSA
MRSA adheres to and proliferates in damaged tissueimplanted medical and prosthetic devices and is capableof forming biofilms [7 8] Biofilms constitute bacterialcommunities that form on the surface of living and nonlivingsubstances Biofilms are surrounded by a self-produced extra-cellular matrix that consists of polysaccharides and proteinsThese biofilms are very difficult to remove and are a causeof intractable infection Biofilms formed on the surface of
BioMed Research International 5
(a) (b) (c) (d) (e) (f)
Figure 3 Scanning electron microscopy of MRSA biofilms grown in ethanol extract of A princeps (a) Control (b) 1mgmL (c) 2mgmL(d) 4mgmL (e) 8mgmL (f) positive control (01 NaF) Bar = 10120583m
SYTO
PIM
erge
(a) (b) (c) (d) (e) (f)
Figure 4 Bactericidal effect of ethanol extract of A princeps Cultured MRSA was treated with high concentration (8ndash64mgmL) of Aprinceps extract and stained with LIVEDEAD BacLight Bacterial Viability Kit The stained bacteria were observed confocal laser scanningmicroscopy Treatment with ethanol extract of A princeps decreased green-labeled living bacteria (SYTO 9 stain) and increased red-labeleddead bacteria (PI stain) in a dose-dependent manner (a) Control (b) 8mgmL (c) 16mgmL (d) 32mgmL (e) 64mgmL (f) positivecontrol (01 NaF) Bar = 50 120583m
implanted medical devices cannot be removed by antibioticinjection and can only be removed by surgery in most casesAfter excising the peripheral tissues of biofilms antibioticsneed to be utilized for a long period of time [7 8] Themost well-known method for analyzing biofilm formationis a tissue culture plate assay method [9] In this studybiofilm formation was observed via safranin staining Theresult showed that A princeps inhibited biofilm formation ofMRSA at concentrations of 1ndash8mgmL Similar results wereobserved when MRSA biofilm formation was measured bySEM A previous study reported that biofilm culture andplanktonic culture showed different physiological character-istics even when the same types of bacteria were culturedBiofilm formation reportedly increases the immune responseof bacteria and their resistance to antibacterial substances[17] However comparing biofilm culture data and planktonicculture data in the present study there were no considerabledifferences in their resistance to ethanol extract ofA princepsbetween the two groups
Bactericidal effects of ethanol extract of A princeps wereobserved using confocal lasermicroscopy the ethanol extractA princeps showed bactericidal activity in a dose-dependentmanner
In MRSA PBP 21015840 produced by the mecA gene has lowaffinity to 120573-lactams antibiotics such as methicillin and it isknown to be antibiotic-resistant for cell-wall synthesis evenin the presence of 120573-lactamase antibiotics [2] In this studymecA expression an antibiotic-resistant gene of MRSA wasexamined using real-time PCR The ethanol extract of Aprinceps inhibited mecA expression at concentrations higherthan 1mgmL
In MRSA sea encodes SEA which is a major viru-lence factor of S aureus [12] SEA induces staphylococcalgastroenteritis secretion of T-cell-derived cytokines and T-cell activation because SEA possesses immunomodulatoryproperties of superantigensThe ethanol extract ofA princepswas observed to inhibit sea expression at concentrationshigher than 1mgmL
6 BioMed Research International
Artemisia princeps (mgmL)
0
05
1
15
Control 1 2 4 NaF
agrA
mRN
A(r
elat
ive q
uant
ity)
lowastlowast
lowastlowast
(a)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
sarA
mRN
A(r
elat
ive q
uant
ity)
lowastlowast
lowast
lowast
(b)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
lowast
lowast
lowast
lowast
mec
Am
RNA
(rel
ativ
e qua
ntity
)
(c)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
lowast lowast
lowast lowast
sea
mRN
A(r
elat
ive q
uant
ity)
(d)
Figure 5 Real-time PCR analysis of expression of several virulence-factor genesMRSAwas cultured and treated with subminimal inhibitoryconcentration (1ndash4mgmL) of A princeps extract and real-time PCR analysis was then performed as described in Section 2 Expression ofmecA sea and agrAwas significantly inhibited at concentration higher than 1mgmL Each value is expressed as amean plusmn standard deviationSignificance was determined at lowast119875 lt 005 when compared with the control
Production of virulence factors in S aureus is con-trolled by global regulators such as agr and sarA [13] agrAencodes accessory gene regulator A when agrA expressionis inhibited production of virulence factors is also inhibitedIn addition sarA regulates the production of some matrixadhesion genes (eg fnbA) and exotoxin genes (eg hla)the virulence factors associated with adherence of S aureus[25] Our investigation of the expression of the agrA andsarA genes in this study showed that A princeps inhibited seaexpression at concentrations higher than 1mgmL
According to a previous study Artemisia spp containmany components with strong antioxidant effects such ascaffeic acid catechol protocatechuic acid vanillin umbellif-erone and ferulic acid [26]
Moreover cineol thujone caryophyllene humulenelinalool artemisia alcohol camphor farnesol and borneolare present in A princeps tetracosanol 120573-sitosterol l-chebulachitol and l-inositol are present in the organismrsquosleaves with caryophyllene and farnesol known to haveantibacterial effects
Based on our phytochemical analysis in the present studythe ethanol extract of A princeps was confirmed to con-tain organic acids glycosides and phenolics In particularorganic acids and glycosides showed an intense reactionand are thought to be the active components in the MRSAinhibitionmechanismsTherefore further studies to examinethe specific effects of the components present in A princepsare necessary Furthermore additional studies should beconducted to identify antibacterial substances againstMRSA
In conclusion we show that the ethanol extract of Aprinceps may inhibit proliferation acid production biofilmformation and virulence gene expressions of MRSA which
may be related to organic acids and glycosides the majorcomponents in the extract of A princeps
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Authorsrsquo Contribution
Na-Young Choi and Sun-Young Kang are contributed equallyto this paper Data were acquired by Sun-Young KangWriting reviewing and revision of the paper were performedby Na-Young Choi Conception and design were performedby Kang-Ju Kim
Acknowledgment
This research was supported by Basic Science ResearchProgram through theNational Research Foundation of Korea(NRF) funded by the Ministry of Education Science andTechnology (no 2012R1A1A4A01012680)
References
[1] A Al-Habib E Al-Saleh A-M Safer and M Afzal ldquoBacterici-dal effect of grape seed extract on methicillin-resistant Staphy-lococcus aureus (MRSA)rdquo Journal of Toxicological Sciences vol35 no 3 pp 357ndash364 2010
[2] C C S Fuda J F Fisher and S Mobashery ldquo120573-Lactamresistance in Staphylococcus aureus the adaptive resistance of
BioMed Research International 7
a plastic genomerdquo Cellular and Molecular Life Sciences vol 62no 22 pp 2617ndash2633 2005
[3] L B Rice ldquoAntimicrobial resistance in gram-positive bacteriardquoThe American Journal of Medicine vol 119 no 6 pp S11ndashS192006
[4] H Tsuchiya M Sato T Miyazaki et al ldquoComparative studyon the antibacterial activity of phytochemical flavanonesagainst methicillin-resistant Staphylococcus aureusrdquo Journal ofEthnopharmacology vol 50 no 1 pp 27ndash34 1996
[5] H B Kim H-C Jang H J Nam et al ldquoIn vitro activities of28 antimicrobial agents against Staphylococcus aureus isolatesfrom tertiary-care hospitals in Korea a Nationwide SurveyrdquoAntimicrobial Agents and Chemotherapy vol 48 no 4 pp 1124ndash1127 2004
[6] S Stefani and P E Varaldo ldquoEpidemiology of methicillin-resistant staphylococci in Europerdquo Clinical Microbiology andInfection vol 9 no 12 pp 1179ndash1186 2003
[7] D G Conrady C C Brescia K Horii A A Weiss D JHassett and A B Herr ldquoA zinc-dependent adhesion mod-ule is responsible for intercellular adhesion in staphylococcalbiofilmsrdquo Proceedings of the National Academy of Sciences of theUnited States of America vol 105 no 49 pp 19456ndash19461 2008
[8] C L Quave L R W Plano T Pantuso and B C BennettldquoEffects of extracts from Italian medicinal plants on plank-tonic growth biofilm formation and adherence of methicillin-resistant Staphylococcus aureusrdquo Journal of Ethnopharmacologyvol 118 no 3 pp 418ndash428 2008
[9] P Jia Y J Xue X JDuan and S-H Shao ldquoEffect of cinnamalde-hyde on biofilm formation and sarA expression by methicillin-resistant Staphylococcus aureusrdquo Letters inAppliedMicrobiologyvol 53 no 4 pp 409ndash416 2011
[10] A G O Manetti T Koller M Becherelli et al ldquoEnviron-mental acidification drives S pyogenes pilus expression andmicrocolony formation on epithelial cells in a FCT-dependentmannerrdquo PLoS ONE vol 5 no 11 Article ID e13864 2010
[11] T M Rode T Moslashretroslash S Langsrud Oslash Langsrud G Vogt andA Holck ldquoResponses of Staphylococcus aureus exposed to HCLand organic acid stressrdquo Canadian Journal of Microbiology vol56 no 9 pp 777ndash792 2010
[12] J Qiu D Wang H Xiang et al ldquoSubinhibitory concentrationsof thymol reduce enterotoxins A and B and 120572-hemolysinproduction in Staphylococcus aureus isolatesrdquo PLoS ONE vol5 no 3 Article ID e9736 2010
[13] J Qiu X Zhang M Luo et al ldquoSubinhibitory concentrationsof perilla oil affect the expression of secreted virulence factorgenes in Staphylococcus aureusrdquo PLoS ONE vol 6 no 1 ArticleID e16160 2011
[14] S Faizi N R Mughal R A Khan et al ldquoEvaluation of theantimicrobial property of Polyalthia longifolia var pendulaisolation of a lactone as the active antibacterial agent from theethanol extract of the stemrdquo Phytotherapy Research vol 17 no10 pp 1177ndash1181 2003
[15] S Gibbons J Leimkugel M Oluwatuyi and M HeinrichldquoActivity of Zanthoxylum clava-herculis extracts againstmulti-drug resistant methicillin-resistant Staphylococcusaureus (mdr-MRSA)rdquo Phytotherapy Research vol 17 no 3 pp274ndash275 2003
[16] K H Bae The Medicinal Plants of Korea Kyo-hak PublishingSeoul Republic of Korea 2007
[17] A Yoshida and H K Kuramitsu ldquoMultiple Streptococcusmutans genes are involved in biofilm formationrdquo Applied and
Environmental Microbiology vol 68 no 12 pp 6283ndash62912002
[18] J Qiu X Zhang M Luo et al ldquoSubinhibitory concentrationsof perilla oil affect the expression of secreted virulence factorgenes in Staphylococcus aureusrdquo PLoS ONE vol 6 no 1 ArticleID e16160 2011
[19] P Jia Y J Xue X JDuan and S-H Shao ldquoEffect of cinnamalde-hyde on biofilm formation and sarA expression by methicillin-resistant Staphylococcus aureusrdquo Letters inAppliedMicrobiologyvol 53 no 4 pp 409ndash416 2011
[20] A E Rosato W A Craig and G L Archer ldquoQuantitiation ofmecA transcription in oxacillin-resistant Staphylococcus aureusclinical isolatesrdquo Journal of Bacteriology vol 185 no 11 pp3446ndash3452 2003
[21] P J Houghton and A Raman Laboratory Handbook for theFractionation of Natural Extracts Chapman amp Hall LondonUK 1998
[22] W S Woo Experimental Methods for Phytochemistry SeoulNational University Press Seoul Republic of Korea 2001
[23] Y S Kim M N Kim J O Kim and J H Lee ldquoThe effectof hot water-extract and flavor compounds of Mugwort onmicrobial growthrdquo Journal of the Korean Society of Food Scienceand Nutrition vol 23 no 6 pp 994ndash1000 1994
[24] S J Lee ldquoStudies on the origin of Korean folk medicinesrdquoKorean Journal of Pharmacognosy vol 6 no 2 pp 75ndash92 1975
[25] L I Kupferwasser M R Yeaman C C Nast et al ldquoSalicylicacid attenuates virulence in endovascular infections by target-ing global regulatory pathways in Staphylococcus aureusrdquo TheJournal of Clinical Investigation vol 112 no 2 pp 222ndash2332003
[26] K D Lee J S Kim B Jo and H S Yoon ldquoAntioxidativeeffectiveness of water extract and ether extract in wormwood(Artemisia Montana Pampan)rdquo Journal of the Korean Society ofFood Science and Nutrition vol 21 no 1 pp 17ndash22 1992
Submit your manuscripts athttpwwwhindawicom
PainResearch and TreatmentHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
pathogenic infection [9] MRSA can produce organic acidsvia carbohydrate metabolism pathways It has been reportedthat organic acids produced by MRSA decrease pH and canfacilitate biofilm formation [10 11] MRSA possesses severalvirulence factors sea encodes staphylococcal enterotoxin A(SEA) SEA one of major virulence factors of S aureus [12]is known to induce staphylococcal gastroenteritis secrete T-cell-derived cytokines and stimulate T-cell activation owingto the presence of immunomodulatory properties of super-antigens In S aureus production of virulence factors isregulated by global regulators such as agr and sarA [13]
MRSA has emerged to be one of the most importantpathogenic bacteria because of its characteristics such asmul-tidrug resistance and biofilm formationTherefore newdrugscapable of treating an MRSA infection must be developedHistorically many scientists have identified antibacterialsubstances in natural products which is currently an activefield of study [14 15]
Artemisia princeps (A princeps) a perennial herb belong-ing to the Asteraceae family is distributed throughout EastAsia and iswidely used tomaintain hemostasis and in treatingpain hypermenorrhea amenorrhea uterine hemorrhagehemorrhoids inflammation and menopausal diseases [16]
However few studies have examined the effects of Aprinceps on MRSA In studies conducted to discover naturalproducts with antibacterial effects against MRSA it wasfound that ethanol extract of A princeps showed antibac-terial effects against MRSA In this study we investigatedthe inhibitory effect of A princeps on proliferation acidproduction biofilm formation and virulence gene expressionof MRSA Phytochemical analyses were also performed toinvestigate detailed chemical constituents of ethanol extractof A princeps
2 Materials and Methods
21 Material Brain heart infusion (BHI) broth was pur-chased from Difco Laboratories (Detroit MI USA) Glucoseand dimethyl sulfoxide (DMSO) were obtained from SigmaCo (St Louis MO USA)MRSAATCC 33591 was purchasedfrom the American Type Culture Collection (ATCC Manas-sas VA USA)
22 Plant Material and Extraction The leaves of A princepswere obtained from the oriental drug store Dae Hak YakKuk (Iksan South Korea) The identity of the specimen wasconfirmed by Young-Hoi Kim at the College of Environmen-tal and Bioresource sciences Chonbuk National University(Jeonju South Korea) A voucher specimen (number 8-10-13) has been deposited at the Herbarium of the Departmentof Oral Biochemistry in Wonkwang University Dried leaves(250 g) of A princeps were soaked in 3500mL of 70ethanol for 72 h at room temperature The extracted solutionwas filtered and evaporated under reduced pressure to yieldan ethanol extract of 57 g (228) After the extract wasthoroughly dried to facilitate complete removal of the solventthe dry extract was dissolved in DMSO to give the desiredstock solution The final concentration of DMSO applied to
culture systems was adjusted to 01 (vv) which did notinterfere with the testing system Control groups were treatedwith media containing 01 DMSO
23 Bacterial Growth and Acid Production Bacterial growthwas determined using a modification of a previouslydescribed method [3 8]The growth of MRSA was examinedat 37∘C in 095mL of BHI broth containing various concen-trations of the ethanol extract ofA princepsThese tubes wereinoculated with 005mL of an overnight culture grown inBHI broth [final 5 times 105 colony-forming units (CFU)mL]and incubated at 37∘C After 24 h of incubation the opticaldensity (OD) of cells was measured spectrophotometricallyat 550 nm and the pH of the cultures was determined using apHmeter (Corning Inc Corning NYUSA)Three replicatesweremeasured for each concentration of the test extract NaF(01) was used as a positive control
24 Biofilm Assay The biofilm assay was based on a methoddescribed previously [6 11] A princeps extract was addedto BHI broth containing 1 glucose in 35mm polystyrenedishes or 24-well plates (Nunc Copenhagen Denmark)The cultures were then inoculated with a seed culture ofMRSA (final 5 times 105 CFUmL) After cultivating for 48 hat 37∘C the supernatant was removed completely and thedishes wells or wells containing resin teeth were rinsed withdistilled waterThe amount of biofilm formed in the wells wasmeasured by staining with 01 safraninThe bound safraninwas released from the stained cells with 30 acetic acid andthe absorbance of the solution was measured at 530 nm Thebiofilm formed on the surface of the resin teeth was alsostained with 01 safranin and photographed
25 Scanning Electron Microscopy (SEM) The biofilm on35mm polystyrene dishes was also determined by SEM usinga modification of a previously described method [4] Thebiofilm formed on the dishes was rinsed with distilled waterand fixed with 25 glutaraldehyde in 01M sodium cacody-late buffer (pH 72) at 4∘C for 24 h After gradual dehydrationwith ethyl alcohol 60 70 80 90 95 and 100 the sample wasfreeze-dried The specimens were then sputter-coated withgold (108A sputter coater Cressington Scientific InstrumentsIncWatford UK) For observation a JSM-6360 SEM (JEOLTokyo Japan) was used
26 Confocal Laser Scanning Microscopy Bactericidal effectof A princeps extract was determined by confocal laserscanningmicroscopyThe culturedMRSA in BHIwas dilutedusing BHI media to approximately 1 times 107 CFUmLThe bac-teria (1 times 107 CFUmL) were treated with high concentrations(8ndash64mgmL) of A princeps extract at 37∘C under aerobicconditions After 30min of incubation the bacteria werewashed with PBS and stained with LIVEDEAD BacLightBacterial Viability Kit (Molecular Probes Eugene OR USA)prepared according to the manufacturerrsquos instructions for15min Stained bacteria were observed confocal laser scan-ning microscopy (LSM 510 Zeiss Germany) This methodis based on two nucleic acid stains green fluorescent SYTO
BioMed Research International 3
Table 1 Nucleotide sequences of primer used for real-time PCR in this study
Gene Gene description Primer sequences (51015840-31015840)Forward Reverse
16srRNA Normalizing internal standard ACTGGGATAACTTCGGGAAA CGTTGCCTTGGTAAGCCmecA Penicillin binding protein 21015840 GTTAGATTGGGATCATAGCGTCATT TGCCTAATCTCATATGTGTTCCTGTATSea Staphylococcal enterotoxin A ATGGTGCTTATTATGGTTATC CGTTTCCAAAGGTACTGTATTagrA Accessory gene regulator A TGATAATCCTTATGAGGTGCTT CACTGTGACTCGTAACGAAAAsarA Staphylococcal accessary regulator A TGTTATCAATGGTCACTTATGCTG TCTTTGTTTTCGCTGATGTATGTC
9 stain and red fluorescent propidium iodide stain whichdiffer in their ability to penetrate healthy bacterial cells SYTO9 stain labels live bacteria in contrast propidium iodidepenetrates only bacteria with damaged membranes
27 Real-Time Polymerase Chain Reaction (PCR) Analysis Todetermine the effect ofA princeps extract on gene expressiona real-time PCR assay was performed The subminimalinhibitory concentration (1ndash4mgmL) of A princeps extractwas used to treat and culture MRSA for 24 h Total RNAwas isolated from S mutans by using Trizol reagent (Gibco-BRL) according to the manufacturerrsquos instructions ThencDNA was synthesized using a reverse transcriptase reaction(Superscript Gibco-BRL) The DNA amplifications werecarried out using an ABI-Prism 7000 Sequence DetectionSystemwithAbsoluteQPCR SYBRGreenMixes (Applied Biosystems Inc Foster City CA USA) The primer pairs thatwere used in this studywere described by previous report [17ndash20] and are listed in Table 1 16S rRNAwas used as an internalcontrol
28 Phytochemical Screening Phytochemical tests of theextract were performed as previously described [21 22]Mayerrsquos reagent was used for alkaloids ferric chloride reagentfor phenolics Molish test for glycosides Biuret reagentfor peptides Mg-HCl reagent for flavonoids Liebermann-Burchard reagent for steroids and silver nitrate reagent fororganic acids
29 Statistical Analysis All experiments were performed intriplicate Data were analyzed using the Statistical Packagefor Social Sciences (SPSS Chicago IL USA) The data areexpressed as the mean plusmn standard deviation values Thedifferences between the means of the experimental andcontrol groups were evaluated by Studentrsquos 119905-test Values of119875 lt 005 were considered statistically significant
3 Results
In the present study after performing ethanol extractionof A princeps the antibacterial effects against MRSA weretested The results are shown in Figure 1 After treatingMRSA with 1 2 4 and 8mgmL of ethanol extract of Aprinceps showed a dose-dependent manner the antibacterialeffects of A princeps ethanol extract against MRSA wereobserved Compared to controls the ethanol extract of Aprinceps showed significant inhibition of MRSA growth at
0000
0100
0200
0300
0400
Control 1 2 4 8 NaF (01)Artemisia princeps (mgmL)
lowast
lowast
lowast
lowastlowast
Opt
ical
den
sity
A550
Figure 1 Effect of ethanol extract of A princeps on the growthof MRSA MRSA was inoculated into BHI broth with variousconcentrations of A princeps and incubated for 24 h at 37∘C Theoptical density (A
550) was read using a spectrophotometer Data are
mean plusmn standard deviation lowast119875 lt 005 compared to the controlgroup
concentrations higher than 1mgmL The positive controlused in this study 01NaF also showed antibacterial effectsThe minimum inhibitory concentration (MIC) of ethanolextract of A princeps against MRSA was confirmed to be8mgmLThese results indicate that the ethanol extract of Aprinceps has antibacterial effects against MRSA
MRSA generates organic acids by metabolizing carbo-hydrates To investigate whether the ethanol extract of Aprinceps can suppress organic acid production in MRSAthe ethanol extract of A princeps was added to MRSAculture medium and the change in pH was measured ThepH of the control culture medium was approximately 72before the incubation which decreased to approximately 587after culturing (Table 2) However this decrease in pH wassuppressed in the group treated with the ethanol extract ofA princeps (1ndash8mgmL) The positive control 01 NaF alsoshowed suppression in pH reductionThese results reveal thatorganic acid production in MRSA can be inhibited by theethanol extract of A princeps
MRSA forms biofilms on implants medical suppliesor on medical devices which eventually increases the bac-teriumrsquos antibiotic resistance In this study we examinedwhether an ethanol extract of A princeps was able to inhibitthe biofilm formation of MRSA Using safranin staining theethanol extract ofA princeps at concentrations of 2ndash8mgmLwas seen to inhibit MRSA biofilm formation (Figure 2) Thepositive control used in this study 01 NaF also inhibited
4 BioMed Research International
Table 2 Effect of ethanol extract of A princeps on acid productionby MRSA
Date (pH) are represented as mean plusmn standard deviationlowast119875 lt 005 when compared with the control group after incubation
0000
0200
0400
0600
0800
1000
1200
Control 1 2 4 8 NaF (01)Artemisia princeps Pamp (mgmL)
lowast
lowast
lowast
lowast
Opt
ical
den
sity
A530
of b
iofil
m
Figure 2 Effect of ethanol extract of A princeps on biofilmformation by MRSA MRSA was inoculated into BHI broth withvarious concentrations ofA princeps and incubated for 48 h at 37∘CThe biofilms that formed on the dish surface were measured bystaining with 01 safranin The bound safranin was released fromthe stained cells with 30 acetic acid and the absorbance of thesolution was measured at 530 nm Data are represented as mean plusmnstandard deviation lowast119875 lt 005 compared to the control group
biofilm formation These results were confirmed by SEMimages (Figure 3) which showed similar outcomes to theresults of safranin staining In the control that was nottreatedwith the ethanol extract ofA princepsMRSA adhereddensely to the surface of the polystyrene 35mm dish andformed biofilms whereas biofilm formation decreased inproportion to the ethanol extract concentration when theextract was introduced Biofilm formation also decreased inthe positive control
Using a confocal laser microscopy the bactericidal effectsof ethanol extract of A princeps were examined The ethanolextract of A princeps was observed to be bactericidal in adose-dependent manner (8ndash64mgmL) (Figure 4) Expres-sion of mecA an antibiotic-resistant gene of MRSA as wellthat of sea agrA and sarA and virulence-factor genes wasestimated using real-time PCR in sub-MIC The ethanolextract of A princeps inhibited mecA sea agrA and sarAmRNA expression at concentrations greater than 1mgmL(Figure 5)
Phytochemical analysis of princeps showed relatively highorganic acid content medium glycosides content and weak
Table 3 Phytochemical analysis of the ethanol extract of Artemisiaprinceps
Plant constituents Ethanol extractAlkaloids minus
Phenolics +Flavonoids minus
Glycosides ++Peptides minus
Steroids terpenoids minus
Organic acids ++++++ strong ++ moderate + poor minus absent
phenolic content Alkaloid flavonoid and peptides weredetected only at very low levels (Table 3)
4 Discussion
MRSA is a typical antibiotic-resistant strain Development ofnew antibiotics is necessary for treating such strains Naturalproducts can be utilized as raw materials in the developmentof new antibacterial substances
A princeps is used as a digestive medicine in treatingfever as an anthelmintic and as an antihemorrhagic agent inoriental medicines and is known to be effective for treatinggynecological and gastrointestinal diseases In addition itsconstituents are known to have various physiological effectssuch as insecticidal antibacterial and antitumor effects [2324]
In this study we investigated the antibacterial effects ofan ethanol extract of A princeps against MRSA The ethanolextract of A princeps at 1ndash8mgmL was found to inhibitMRSA growth The evidence of antibacterial effects of theethanol extract of A princeps supports the use of A princepsas a traditional medicine to treat patients with infectiousdiseases in Korea According to previous studies on thearoma constituents of A princeps thujone caryophylleneand farnesol showed antibacterial effects against Escherichiacoli Enterobacter aerogenes Vibrio parahaemolyticus Pseu-domonas aeruginosa Bacillus subtilis and Staphylococcusaureus [23]
MRSA is known to produce organic acids through carbo-hydrate metabolism pathways [10 11] Acetic acid is the mainorganic acid produced by MRSA which lowers pH in theinfected area this lowered pH facilitates biofilm formationby microorganisms [10] Our results showed that the ethanolextract of A princeps inhibited the pH reduction induced byMRSA This result indicates that the ethanol extract of Aprinceps inhibits carbohydrate metabolism in MRSA
MRSA adheres to and proliferates in damaged tissueimplanted medical and prosthetic devices and is capableof forming biofilms [7 8] Biofilms constitute bacterialcommunities that form on the surface of living and nonlivingsubstances Biofilms are surrounded by a self-produced extra-cellular matrix that consists of polysaccharides and proteinsThese biofilms are very difficult to remove and are a causeof intractable infection Biofilms formed on the surface of
BioMed Research International 5
(a) (b) (c) (d) (e) (f)
Figure 3 Scanning electron microscopy of MRSA biofilms grown in ethanol extract of A princeps (a) Control (b) 1mgmL (c) 2mgmL(d) 4mgmL (e) 8mgmL (f) positive control (01 NaF) Bar = 10120583m
SYTO
PIM
erge
(a) (b) (c) (d) (e) (f)
Figure 4 Bactericidal effect of ethanol extract of A princeps Cultured MRSA was treated with high concentration (8ndash64mgmL) of Aprinceps extract and stained with LIVEDEAD BacLight Bacterial Viability Kit The stained bacteria were observed confocal laser scanningmicroscopy Treatment with ethanol extract of A princeps decreased green-labeled living bacteria (SYTO 9 stain) and increased red-labeleddead bacteria (PI stain) in a dose-dependent manner (a) Control (b) 8mgmL (c) 16mgmL (d) 32mgmL (e) 64mgmL (f) positivecontrol (01 NaF) Bar = 50 120583m
implanted medical devices cannot be removed by antibioticinjection and can only be removed by surgery in most casesAfter excising the peripheral tissues of biofilms antibioticsneed to be utilized for a long period of time [7 8] Themost well-known method for analyzing biofilm formationis a tissue culture plate assay method [9] In this studybiofilm formation was observed via safranin staining Theresult showed that A princeps inhibited biofilm formation ofMRSA at concentrations of 1ndash8mgmL Similar results wereobserved when MRSA biofilm formation was measured bySEM A previous study reported that biofilm culture andplanktonic culture showed different physiological character-istics even when the same types of bacteria were culturedBiofilm formation reportedly increases the immune responseof bacteria and their resistance to antibacterial substances[17] However comparing biofilm culture data and planktonicculture data in the present study there were no considerabledifferences in their resistance to ethanol extract ofA princepsbetween the two groups
Bactericidal effects of ethanol extract of A princeps wereobserved using confocal lasermicroscopy the ethanol extractA princeps showed bactericidal activity in a dose-dependentmanner
In MRSA PBP 21015840 produced by the mecA gene has lowaffinity to 120573-lactams antibiotics such as methicillin and it isknown to be antibiotic-resistant for cell-wall synthesis evenin the presence of 120573-lactamase antibiotics [2] In this studymecA expression an antibiotic-resistant gene of MRSA wasexamined using real-time PCR The ethanol extract of Aprinceps inhibited mecA expression at concentrations higherthan 1mgmL
In MRSA sea encodes SEA which is a major viru-lence factor of S aureus [12] SEA induces staphylococcalgastroenteritis secretion of T-cell-derived cytokines and T-cell activation because SEA possesses immunomodulatoryproperties of superantigensThe ethanol extract ofA princepswas observed to inhibit sea expression at concentrationshigher than 1mgmL
6 BioMed Research International
Artemisia princeps (mgmL)
0
05
1
15
Control 1 2 4 NaF
agrA
mRN
A(r
elat
ive q
uant
ity)
lowastlowast
lowastlowast
(a)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
sarA
mRN
A(r
elat
ive q
uant
ity)
lowastlowast
lowast
lowast
(b)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
lowast
lowast
lowast
lowast
mec
Am
RNA
(rel
ativ
e qua
ntity
)
(c)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
lowast lowast
lowast lowast
sea
mRN
A(r
elat
ive q
uant
ity)
(d)
Figure 5 Real-time PCR analysis of expression of several virulence-factor genesMRSAwas cultured and treated with subminimal inhibitoryconcentration (1ndash4mgmL) of A princeps extract and real-time PCR analysis was then performed as described in Section 2 Expression ofmecA sea and agrAwas significantly inhibited at concentration higher than 1mgmL Each value is expressed as amean plusmn standard deviationSignificance was determined at lowast119875 lt 005 when compared with the control
Production of virulence factors in S aureus is con-trolled by global regulators such as agr and sarA [13] agrAencodes accessory gene regulator A when agrA expressionis inhibited production of virulence factors is also inhibitedIn addition sarA regulates the production of some matrixadhesion genes (eg fnbA) and exotoxin genes (eg hla)the virulence factors associated with adherence of S aureus[25] Our investigation of the expression of the agrA andsarA genes in this study showed that A princeps inhibited seaexpression at concentrations higher than 1mgmL
According to a previous study Artemisia spp containmany components with strong antioxidant effects such ascaffeic acid catechol protocatechuic acid vanillin umbellif-erone and ferulic acid [26]
Moreover cineol thujone caryophyllene humulenelinalool artemisia alcohol camphor farnesol and borneolare present in A princeps tetracosanol 120573-sitosterol l-chebulachitol and l-inositol are present in the organismrsquosleaves with caryophyllene and farnesol known to haveantibacterial effects
Based on our phytochemical analysis in the present studythe ethanol extract of A princeps was confirmed to con-tain organic acids glycosides and phenolics In particularorganic acids and glycosides showed an intense reactionand are thought to be the active components in the MRSAinhibitionmechanismsTherefore further studies to examinethe specific effects of the components present in A princepsare necessary Furthermore additional studies should beconducted to identify antibacterial substances againstMRSA
In conclusion we show that the ethanol extract of Aprinceps may inhibit proliferation acid production biofilmformation and virulence gene expressions of MRSA which
may be related to organic acids and glycosides the majorcomponents in the extract of A princeps
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Authorsrsquo Contribution
Na-Young Choi and Sun-Young Kang are contributed equallyto this paper Data were acquired by Sun-Young KangWriting reviewing and revision of the paper were performedby Na-Young Choi Conception and design were performedby Kang-Ju Kim
Acknowledgment
This research was supported by Basic Science ResearchProgram through theNational Research Foundation of Korea(NRF) funded by the Ministry of Education Science andTechnology (no 2012R1A1A4A01012680)
References
[1] A Al-Habib E Al-Saleh A-M Safer and M Afzal ldquoBacterici-dal effect of grape seed extract on methicillin-resistant Staphy-lococcus aureus (MRSA)rdquo Journal of Toxicological Sciences vol35 no 3 pp 357ndash364 2010
[2] C C S Fuda J F Fisher and S Mobashery ldquo120573-Lactamresistance in Staphylococcus aureus the adaptive resistance of
BioMed Research International 7
a plastic genomerdquo Cellular and Molecular Life Sciences vol 62no 22 pp 2617ndash2633 2005
[3] L B Rice ldquoAntimicrobial resistance in gram-positive bacteriardquoThe American Journal of Medicine vol 119 no 6 pp S11ndashS192006
[4] H Tsuchiya M Sato T Miyazaki et al ldquoComparative studyon the antibacterial activity of phytochemical flavanonesagainst methicillin-resistant Staphylococcus aureusrdquo Journal ofEthnopharmacology vol 50 no 1 pp 27ndash34 1996
[5] H B Kim H-C Jang H J Nam et al ldquoIn vitro activities of28 antimicrobial agents against Staphylococcus aureus isolatesfrom tertiary-care hospitals in Korea a Nationwide SurveyrdquoAntimicrobial Agents and Chemotherapy vol 48 no 4 pp 1124ndash1127 2004
[6] S Stefani and P E Varaldo ldquoEpidemiology of methicillin-resistant staphylococci in Europerdquo Clinical Microbiology andInfection vol 9 no 12 pp 1179ndash1186 2003
[7] D G Conrady C C Brescia K Horii A A Weiss D JHassett and A B Herr ldquoA zinc-dependent adhesion mod-ule is responsible for intercellular adhesion in staphylococcalbiofilmsrdquo Proceedings of the National Academy of Sciences of theUnited States of America vol 105 no 49 pp 19456ndash19461 2008
[8] C L Quave L R W Plano T Pantuso and B C BennettldquoEffects of extracts from Italian medicinal plants on plank-tonic growth biofilm formation and adherence of methicillin-resistant Staphylococcus aureusrdquo Journal of Ethnopharmacologyvol 118 no 3 pp 418ndash428 2008
[9] P Jia Y J Xue X JDuan and S-H Shao ldquoEffect of cinnamalde-hyde on biofilm formation and sarA expression by methicillin-resistant Staphylococcus aureusrdquo Letters inAppliedMicrobiologyvol 53 no 4 pp 409ndash416 2011
[10] A G O Manetti T Koller M Becherelli et al ldquoEnviron-mental acidification drives S pyogenes pilus expression andmicrocolony formation on epithelial cells in a FCT-dependentmannerrdquo PLoS ONE vol 5 no 11 Article ID e13864 2010
[11] T M Rode T Moslashretroslash S Langsrud Oslash Langsrud G Vogt andA Holck ldquoResponses of Staphylococcus aureus exposed to HCLand organic acid stressrdquo Canadian Journal of Microbiology vol56 no 9 pp 777ndash792 2010
[12] J Qiu D Wang H Xiang et al ldquoSubinhibitory concentrationsof thymol reduce enterotoxins A and B and 120572-hemolysinproduction in Staphylococcus aureus isolatesrdquo PLoS ONE vol5 no 3 Article ID e9736 2010
[13] J Qiu X Zhang M Luo et al ldquoSubinhibitory concentrationsof perilla oil affect the expression of secreted virulence factorgenes in Staphylococcus aureusrdquo PLoS ONE vol 6 no 1 ArticleID e16160 2011
[14] S Faizi N R Mughal R A Khan et al ldquoEvaluation of theantimicrobial property of Polyalthia longifolia var pendulaisolation of a lactone as the active antibacterial agent from theethanol extract of the stemrdquo Phytotherapy Research vol 17 no10 pp 1177ndash1181 2003
[15] S Gibbons J Leimkugel M Oluwatuyi and M HeinrichldquoActivity of Zanthoxylum clava-herculis extracts againstmulti-drug resistant methicillin-resistant Staphylococcusaureus (mdr-MRSA)rdquo Phytotherapy Research vol 17 no 3 pp274ndash275 2003
[16] K H Bae The Medicinal Plants of Korea Kyo-hak PublishingSeoul Republic of Korea 2007
[17] A Yoshida and H K Kuramitsu ldquoMultiple Streptococcusmutans genes are involved in biofilm formationrdquo Applied and
Environmental Microbiology vol 68 no 12 pp 6283ndash62912002
[18] J Qiu X Zhang M Luo et al ldquoSubinhibitory concentrationsof perilla oil affect the expression of secreted virulence factorgenes in Staphylococcus aureusrdquo PLoS ONE vol 6 no 1 ArticleID e16160 2011
[19] P Jia Y J Xue X JDuan and S-H Shao ldquoEffect of cinnamalde-hyde on biofilm formation and sarA expression by methicillin-resistant Staphylococcus aureusrdquo Letters inAppliedMicrobiologyvol 53 no 4 pp 409ndash416 2011
[20] A E Rosato W A Craig and G L Archer ldquoQuantitiation ofmecA transcription in oxacillin-resistant Staphylococcus aureusclinical isolatesrdquo Journal of Bacteriology vol 185 no 11 pp3446ndash3452 2003
[21] P J Houghton and A Raman Laboratory Handbook for theFractionation of Natural Extracts Chapman amp Hall LondonUK 1998
[22] W S Woo Experimental Methods for Phytochemistry SeoulNational University Press Seoul Republic of Korea 2001
[23] Y S Kim M N Kim J O Kim and J H Lee ldquoThe effectof hot water-extract and flavor compounds of Mugwort onmicrobial growthrdquo Journal of the Korean Society of Food Scienceand Nutrition vol 23 no 6 pp 994ndash1000 1994
[24] S J Lee ldquoStudies on the origin of Korean folk medicinesrdquoKorean Journal of Pharmacognosy vol 6 no 2 pp 75ndash92 1975
[25] L I Kupferwasser M R Yeaman C C Nast et al ldquoSalicylicacid attenuates virulence in endovascular infections by target-ing global regulatory pathways in Staphylococcus aureusrdquo TheJournal of Clinical Investigation vol 112 no 2 pp 222ndash2332003
[26] K D Lee J S Kim B Jo and H S Yoon ldquoAntioxidativeeffectiveness of water extract and ether extract in wormwood(Artemisia Montana Pampan)rdquo Journal of the Korean Society ofFood Science and Nutrition vol 21 no 1 pp 17ndash22 1992
Submit your manuscripts athttpwwwhindawicom
PainResearch and TreatmentHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Table 1 Nucleotide sequences of primer used for real-time PCR in this study
Gene Gene description Primer sequences (51015840-31015840)Forward Reverse
16srRNA Normalizing internal standard ACTGGGATAACTTCGGGAAA CGTTGCCTTGGTAAGCCmecA Penicillin binding protein 21015840 GTTAGATTGGGATCATAGCGTCATT TGCCTAATCTCATATGTGTTCCTGTATSea Staphylococcal enterotoxin A ATGGTGCTTATTATGGTTATC CGTTTCCAAAGGTACTGTATTagrA Accessory gene regulator A TGATAATCCTTATGAGGTGCTT CACTGTGACTCGTAACGAAAAsarA Staphylococcal accessary regulator A TGTTATCAATGGTCACTTATGCTG TCTTTGTTTTCGCTGATGTATGTC
9 stain and red fluorescent propidium iodide stain whichdiffer in their ability to penetrate healthy bacterial cells SYTO9 stain labels live bacteria in contrast propidium iodidepenetrates only bacteria with damaged membranes
27 Real-Time Polymerase Chain Reaction (PCR) Analysis Todetermine the effect ofA princeps extract on gene expressiona real-time PCR assay was performed The subminimalinhibitory concentration (1ndash4mgmL) of A princeps extractwas used to treat and culture MRSA for 24 h Total RNAwas isolated from S mutans by using Trizol reagent (Gibco-BRL) according to the manufacturerrsquos instructions ThencDNA was synthesized using a reverse transcriptase reaction(Superscript Gibco-BRL) The DNA amplifications werecarried out using an ABI-Prism 7000 Sequence DetectionSystemwithAbsoluteQPCR SYBRGreenMixes (Applied Biosystems Inc Foster City CA USA) The primer pairs thatwere used in this studywere described by previous report [17ndash20] and are listed in Table 1 16S rRNAwas used as an internalcontrol
28 Phytochemical Screening Phytochemical tests of theextract were performed as previously described [21 22]Mayerrsquos reagent was used for alkaloids ferric chloride reagentfor phenolics Molish test for glycosides Biuret reagentfor peptides Mg-HCl reagent for flavonoids Liebermann-Burchard reagent for steroids and silver nitrate reagent fororganic acids
29 Statistical Analysis All experiments were performed intriplicate Data were analyzed using the Statistical Packagefor Social Sciences (SPSS Chicago IL USA) The data areexpressed as the mean plusmn standard deviation values Thedifferences between the means of the experimental andcontrol groups were evaluated by Studentrsquos 119905-test Values of119875 lt 005 were considered statistically significant
3 Results
In the present study after performing ethanol extractionof A princeps the antibacterial effects against MRSA weretested The results are shown in Figure 1 After treatingMRSA with 1 2 4 and 8mgmL of ethanol extract of Aprinceps showed a dose-dependent manner the antibacterialeffects of A princeps ethanol extract against MRSA wereobserved Compared to controls the ethanol extract of Aprinceps showed significant inhibition of MRSA growth at
0000
0100
0200
0300
0400
Control 1 2 4 8 NaF (01)Artemisia princeps (mgmL)
lowast
lowast
lowast
lowastlowast
Opt
ical
den
sity
A550
Figure 1 Effect of ethanol extract of A princeps on the growthof MRSA MRSA was inoculated into BHI broth with variousconcentrations of A princeps and incubated for 24 h at 37∘C Theoptical density (A
550) was read using a spectrophotometer Data are
mean plusmn standard deviation lowast119875 lt 005 compared to the controlgroup
concentrations higher than 1mgmL The positive controlused in this study 01NaF also showed antibacterial effectsThe minimum inhibitory concentration (MIC) of ethanolextract of A princeps against MRSA was confirmed to be8mgmLThese results indicate that the ethanol extract of Aprinceps has antibacterial effects against MRSA
MRSA generates organic acids by metabolizing carbo-hydrates To investigate whether the ethanol extract of Aprinceps can suppress organic acid production in MRSAthe ethanol extract of A princeps was added to MRSAculture medium and the change in pH was measured ThepH of the control culture medium was approximately 72before the incubation which decreased to approximately 587after culturing (Table 2) However this decrease in pH wassuppressed in the group treated with the ethanol extract ofA princeps (1ndash8mgmL) The positive control 01 NaF alsoshowed suppression in pH reductionThese results reveal thatorganic acid production in MRSA can be inhibited by theethanol extract of A princeps
MRSA forms biofilms on implants medical suppliesor on medical devices which eventually increases the bac-teriumrsquos antibiotic resistance In this study we examinedwhether an ethanol extract of A princeps was able to inhibitthe biofilm formation of MRSA Using safranin staining theethanol extract ofA princeps at concentrations of 2ndash8mgmLwas seen to inhibit MRSA biofilm formation (Figure 2) Thepositive control used in this study 01 NaF also inhibited
4 BioMed Research International
Table 2 Effect of ethanol extract of A princeps on acid productionby MRSA
Date (pH) are represented as mean plusmn standard deviationlowast119875 lt 005 when compared with the control group after incubation
0000
0200
0400
0600
0800
1000
1200
Control 1 2 4 8 NaF (01)Artemisia princeps Pamp (mgmL)
lowast
lowast
lowast
lowast
Opt
ical
den
sity
A530
of b
iofil
m
Figure 2 Effect of ethanol extract of A princeps on biofilmformation by MRSA MRSA was inoculated into BHI broth withvarious concentrations ofA princeps and incubated for 48 h at 37∘CThe biofilms that formed on the dish surface were measured bystaining with 01 safranin The bound safranin was released fromthe stained cells with 30 acetic acid and the absorbance of thesolution was measured at 530 nm Data are represented as mean plusmnstandard deviation lowast119875 lt 005 compared to the control group
biofilm formation These results were confirmed by SEMimages (Figure 3) which showed similar outcomes to theresults of safranin staining In the control that was nottreatedwith the ethanol extract ofA princepsMRSA adhereddensely to the surface of the polystyrene 35mm dish andformed biofilms whereas biofilm formation decreased inproportion to the ethanol extract concentration when theextract was introduced Biofilm formation also decreased inthe positive control
Using a confocal laser microscopy the bactericidal effectsof ethanol extract of A princeps were examined The ethanolextract of A princeps was observed to be bactericidal in adose-dependent manner (8ndash64mgmL) (Figure 4) Expres-sion of mecA an antibiotic-resistant gene of MRSA as wellthat of sea agrA and sarA and virulence-factor genes wasestimated using real-time PCR in sub-MIC The ethanolextract of A princeps inhibited mecA sea agrA and sarAmRNA expression at concentrations greater than 1mgmL(Figure 5)
Phytochemical analysis of princeps showed relatively highorganic acid content medium glycosides content and weak
Table 3 Phytochemical analysis of the ethanol extract of Artemisiaprinceps
Plant constituents Ethanol extractAlkaloids minus
Phenolics +Flavonoids minus
Glycosides ++Peptides minus
Steroids terpenoids minus
Organic acids ++++++ strong ++ moderate + poor minus absent
phenolic content Alkaloid flavonoid and peptides weredetected only at very low levels (Table 3)
4 Discussion
MRSA is a typical antibiotic-resistant strain Development ofnew antibiotics is necessary for treating such strains Naturalproducts can be utilized as raw materials in the developmentof new antibacterial substances
A princeps is used as a digestive medicine in treatingfever as an anthelmintic and as an antihemorrhagic agent inoriental medicines and is known to be effective for treatinggynecological and gastrointestinal diseases In addition itsconstituents are known to have various physiological effectssuch as insecticidal antibacterial and antitumor effects [2324]
In this study we investigated the antibacterial effects ofan ethanol extract of A princeps against MRSA The ethanolextract of A princeps at 1ndash8mgmL was found to inhibitMRSA growth The evidence of antibacterial effects of theethanol extract of A princeps supports the use of A princepsas a traditional medicine to treat patients with infectiousdiseases in Korea According to previous studies on thearoma constituents of A princeps thujone caryophylleneand farnesol showed antibacterial effects against Escherichiacoli Enterobacter aerogenes Vibrio parahaemolyticus Pseu-domonas aeruginosa Bacillus subtilis and Staphylococcusaureus [23]
MRSA is known to produce organic acids through carbo-hydrate metabolism pathways [10 11] Acetic acid is the mainorganic acid produced by MRSA which lowers pH in theinfected area this lowered pH facilitates biofilm formationby microorganisms [10] Our results showed that the ethanolextract of A princeps inhibited the pH reduction induced byMRSA This result indicates that the ethanol extract of Aprinceps inhibits carbohydrate metabolism in MRSA
MRSA adheres to and proliferates in damaged tissueimplanted medical and prosthetic devices and is capableof forming biofilms [7 8] Biofilms constitute bacterialcommunities that form on the surface of living and nonlivingsubstances Biofilms are surrounded by a self-produced extra-cellular matrix that consists of polysaccharides and proteinsThese biofilms are very difficult to remove and are a causeof intractable infection Biofilms formed on the surface of
BioMed Research International 5
(a) (b) (c) (d) (e) (f)
Figure 3 Scanning electron microscopy of MRSA biofilms grown in ethanol extract of A princeps (a) Control (b) 1mgmL (c) 2mgmL(d) 4mgmL (e) 8mgmL (f) positive control (01 NaF) Bar = 10120583m
SYTO
PIM
erge
(a) (b) (c) (d) (e) (f)
Figure 4 Bactericidal effect of ethanol extract of A princeps Cultured MRSA was treated with high concentration (8ndash64mgmL) of Aprinceps extract and stained with LIVEDEAD BacLight Bacterial Viability Kit The stained bacteria were observed confocal laser scanningmicroscopy Treatment with ethanol extract of A princeps decreased green-labeled living bacteria (SYTO 9 stain) and increased red-labeleddead bacteria (PI stain) in a dose-dependent manner (a) Control (b) 8mgmL (c) 16mgmL (d) 32mgmL (e) 64mgmL (f) positivecontrol (01 NaF) Bar = 50 120583m
implanted medical devices cannot be removed by antibioticinjection and can only be removed by surgery in most casesAfter excising the peripheral tissues of biofilms antibioticsneed to be utilized for a long period of time [7 8] Themost well-known method for analyzing biofilm formationis a tissue culture plate assay method [9] In this studybiofilm formation was observed via safranin staining Theresult showed that A princeps inhibited biofilm formation ofMRSA at concentrations of 1ndash8mgmL Similar results wereobserved when MRSA biofilm formation was measured bySEM A previous study reported that biofilm culture andplanktonic culture showed different physiological character-istics even when the same types of bacteria were culturedBiofilm formation reportedly increases the immune responseof bacteria and their resistance to antibacterial substances[17] However comparing biofilm culture data and planktonicculture data in the present study there were no considerabledifferences in their resistance to ethanol extract ofA princepsbetween the two groups
Bactericidal effects of ethanol extract of A princeps wereobserved using confocal lasermicroscopy the ethanol extractA princeps showed bactericidal activity in a dose-dependentmanner
In MRSA PBP 21015840 produced by the mecA gene has lowaffinity to 120573-lactams antibiotics such as methicillin and it isknown to be antibiotic-resistant for cell-wall synthesis evenin the presence of 120573-lactamase antibiotics [2] In this studymecA expression an antibiotic-resistant gene of MRSA wasexamined using real-time PCR The ethanol extract of Aprinceps inhibited mecA expression at concentrations higherthan 1mgmL
In MRSA sea encodes SEA which is a major viru-lence factor of S aureus [12] SEA induces staphylococcalgastroenteritis secretion of T-cell-derived cytokines and T-cell activation because SEA possesses immunomodulatoryproperties of superantigensThe ethanol extract ofA princepswas observed to inhibit sea expression at concentrationshigher than 1mgmL
6 BioMed Research International
Artemisia princeps (mgmL)
0
05
1
15
Control 1 2 4 NaF
agrA
mRN
A(r
elat
ive q
uant
ity)
lowastlowast
lowastlowast
(a)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
sarA
mRN
A(r
elat
ive q
uant
ity)
lowastlowast
lowast
lowast
(b)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
lowast
lowast
lowast
lowast
mec
Am
RNA
(rel
ativ
e qua
ntity
)
(c)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
lowast lowast
lowast lowast
sea
mRN
A(r
elat
ive q
uant
ity)
(d)
Figure 5 Real-time PCR analysis of expression of several virulence-factor genesMRSAwas cultured and treated with subminimal inhibitoryconcentration (1ndash4mgmL) of A princeps extract and real-time PCR analysis was then performed as described in Section 2 Expression ofmecA sea and agrAwas significantly inhibited at concentration higher than 1mgmL Each value is expressed as amean plusmn standard deviationSignificance was determined at lowast119875 lt 005 when compared with the control
Production of virulence factors in S aureus is con-trolled by global regulators such as agr and sarA [13] agrAencodes accessory gene regulator A when agrA expressionis inhibited production of virulence factors is also inhibitedIn addition sarA regulates the production of some matrixadhesion genes (eg fnbA) and exotoxin genes (eg hla)the virulence factors associated with adherence of S aureus[25] Our investigation of the expression of the agrA andsarA genes in this study showed that A princeps inhibited seaexpression at concentrations higher than 1mgmL
According to a previous study Artemisia spp containmany components with strong antioxidant effects such ascaffeic acid catechol protocatechuic acid vanillin umbellif-erone and ferulic acid [26]
Moreover cineol thujone caryophyllene humulenelinalool artemisia alcohol camphor farnesol and borneolare present in A princeps tetracosanol 120573-sitosterol l-chebulachitol and l-inositol are present in the organismrsquosleaves with caryophyllene and farnesol known to haveantibacterial effects
Based on our phytochemical analysis in the present studythe ethanol extract of A princeps was confirmed to con-tain organic acids glycosides and phenolics In particularorganic acids and glycosides showed an intense reactionand are thought to be the active components in the MRSAinhibitionmechanismsTherefore further studies to examinethe specific effects of the components present in A princepsare necessary Furthermore additional studies should beconducted to identify antibacterial substances againstMRSA
In conclusion we show that the ethanol extract of Aprinceps may inhibit proliferation acid production biofilmformation and virulence gene expressions of MRSA which
may be related to organic acids and glycosides the majorcomponents in the extract of A princeps
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Authorsrsquo Contribution
Na-Young Choi and Sun-Young Kang are contributed equallyto this paper Data were acquired by Sun-Young KangWriting reviewing and revision of the paper were performedby Na-Young Choi Conception and design were performedby Kang-Ju Kim
Acknowledgment
This research was supported by Basic Science ResearchProgram through theNational Research Foundation of Korea(NRF) funded by the Ministry of Education Science andTechnology (no 2012R1A1A4A01012680)
References
[1] A Al-Habib E Al-Saleh A-M Safer and M Afzal ldquoBacterici-dal effect of grape seed extract on methicillin-resistant Staphy-lococcus aureus (MRSA)rdquo Journal of Toxicological Sciences vol35 no 3 pp 357ndash364 2010
[2] C C S Fuda J F Fisher and S Mobashery ldquo120573-Lactamresistance in Staphylococcus aureus the adaptive resistance of
BioMed Research International 7
a plastic genomerdquo Cellular and Molecular Life Sciences vol 62no 22 pp 2617ndash2633 2005
[3] L B Rice ldquoAntimicrobial resistance in gram-positive bacteriardquoThe American Journal of Medicine vol 119 no 6 pp S11ndashS192006
[4] H Tsuchiya M Sato T Miyazaki et al ldquoComparative studyon the antibacterial activity of phytochemical flavanonesagainst methicillin-resistant Staphylococcus aureusrdquo Journal ofEthnopharmacology vol 50 no 1 pp 27ndash34 1996
[5] H B Kim H-C Jang H J Nam et al ldquoIn vitro activities of28 antimicrobial agents against Staphylococcus aureus isolatesfrom tertiary-care hospitals in Korea a Nationwide SurveyrdquoAntimicrobial Agents and Chemotherapy vol 48 no 4 pp 1124ndash1127 2004
[6] S Stefani and P E Varaldo ldquoEpidemiology of methicillin-resistant staphylococci in Europerdquo Clinical Microbiology andInfection vol 9 no 12 pp 1179ndash1186 2003
[7] D G Conrady C C Brescia K Horii A A Weiss D JHassett and A B Herr ldquoA zinc-dependent adhesion mod-ule is responsible for intercellular adhesion in staphylococcalbiofilmsrdquo Proceedings of the National Academy of Sciences of theUnited States of America vol 105 no 49 pp 19456ndash19461 2008
[8] C L Quave L R W Plano T Pantuso and B C BennettldquoEffects of extracts from Italian medicinal plants on plank-tonic growth biofilm formation and adherence of methicillin-resistant Staphylococcus aureusrdquo Journal of Ethnopharmacologyvol 118 no 3 pp 418ndash428 2008
[9] P Jia Y J Xue X JDuan and S-H Shao ldquoEffect of cinnamalde-hyde on biofilm formation and sarA expression by methicillin-resistant Staphylococcus aureusrdquo Letters inAppliedMicrobiologyvol 53 no 4 pp 409ndash416 2011
[10] A G O Manetti T Koller M Becherelli et al ldquoEnviron-mental acidification drives S pyogenes pilus expression andmicrocolony formation on epithelial cells in a FCT-dependentmannerrdquo PLoS ONE vol 5 no 11 Article ID e13864 2010
[11] T M Rode T Moslashretroslash S Langsrud Oslash Langsrud G Vogt andA Holck ldquoResponses of Staphylococcus aureus exposed to HCLand organic acid stressrdquo Canadian Journal of Microbiology vol56 no 9 pp 777ndash792 2010
[12] J Qiu D Wang H Xiang et al ldquoSubinhibitory concentrationsof thymol reduce enterotoxins A and B and 120572-hemolysinproduction in Staphylococcus aureus isolatesrdquo PLoS ONE vol5 no 3 Article ID e9736 2010
[13] J Qiu X Zhang M Luo et al ldquoSubinhibitory concentrationsof perilla oil affect the expression of secreted virulence factorgenes in Staphylococcus aureusrdquo PLoS ONE vol 6 no 1 ArticleID e16160 2011
[14] S Faizi N R Mughal R A Khan et al ldquoEvaluation of theantimicrobial property of Polyalthia longifolia var pendulaisolation of a lactone as the active antibacterial agent from theethanol extract of the stemrdquo Phytotherapy Research vol 17 no10 pp 1177ndash1181 2003
[15] S Gibbons J Leimkugel M Oluwatuyi and M HeinrichldquoActivity of Zanthoxylum clava-herculis extracts againstmulti-drug resistant methicillin-resistant Staphylococcusaureus (mdr-MRSA)rdquo Phytotherapy Research vol 17 no 3 pp274ndash275 2003
[16] K H Bae The Medicinal Plants of Korea Kyo-hak PublishingSeoul Republic of Korea 2007
[17] A Yoshida and H K Kuramitsu ldquoMultiple Streptococcusmutans genes are involved in biofilm formationrdquo Applied and
Environmental Microbiology vol 68 no 12 pp 6283ndash62912002
[18] J Qiu X Zhang M Luo et al ldquoSubinhibitory concentrationsof perilla oil affect the expression of secreted virulence factorgenes in Staphylococcus aureusrdquo PLoS ONE vol 6 no 1 ArticleID e16160 2011
[19] P Jia Y J Xue X JDuan and S-H Shao ldquoEffect of cinnamalde-hyde on biofilm formation and sarA expression by methicillin-resistant Staphylococcus aureusrdquo Letters inAppliedMicrobiologyvol 53 no 4 pp 409ndash416 2011
[20] A E Rosato W A Craig and G L Archer ldquoQuantitiation ofmecA transcription in oxacillin-resistant Staphylococcus aureusclinical isolatesrdquo Journal of Bacteriology vol 185 no 11 pp3446ndash3452 2003
[21] P J Houghton and A Raman Laboratory Handbook for theFractionation of Natural Extracts Chapman amp Hall LondonUK 1998
[22] W S Woo Experimental Methods for Phytochemistry SeoulNational University Press Seoul Republic of Korea 2001
[23] Y S Kim M N Kim J O Kim and J H Lee ldquoThe effectof hot water-extract and flavor compounds of Mugwort onmicrobial growthrdquo Journal of the Korean Society of Food Scienceand Nutrition vol 23 no 6 pp 994ndash1000 1994
[24] S J Lee ldquoStudies on the origin of Korean folk medicinesrdquoKorean Journal of Pharmacognosy vol 6 no 2 pp 75ndash92 1975
[25] L I Kupferwasser M R Yeaman C C Nast et al ldquoSalicylicacid attenuates virulence in endovascular infections by target-ing global regulatory pathways in Staphylococcus aureusrdquo TheJournal of Clinical Investigation vol 112 no 2 pp 222ndash2332003
[26] K D Lee J S Kim B Jo and H S Yoon ldquoAntioxidativeeffectiveness of water extract and ether extract in wormwood(Artemisia Montana Pampan)rdquo Journal of the Korean Society ofFood Science and Nutrition vol 21 no 1 pp 17ndash22 1992
Submit your manuscripts athttpwwwhindawicom
PainResearch and TreatmentHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Date (pH) are represented as mean plusmn standard deviationlowast119875 lt 005 when compared with the control group after incubation
0000
0200
0400
0600
0800
1000
1200
Control 1 2 4 8 NaF (01)Artemisia princeps Pamp (mgmL)
lowast
lowast
lowast
lowast
Opt
ical
den
sity
A530
of b
iofil
m
Figure 2 Effect of ethanol extract of A princeps on biofilmformation by MRSA MRSA was inoculated into BHI broth withvarious concentrations ofA princeps and incubated for 48 h at 37∘CThe biofilms that formed on the dish surface were measured bystaining with 01 safranin The bound safranin was released fromthe stained cells with 30 acetic acid and the absorbance of thesolution was measured at 530 nm Data are represented as mean plusmnstandard deviation lowast119875 lt 005 compared to the control group
biofilm formation These results were confirmed by SEMimages (Figure 3) which showed similar outcomes to theresults of safranin staining In the control that was nottreatedwith the ethanol extract ofA princepsMRSA adhereddensely to the surface of the polystyrene 35mm dish andformed biofilms whereas biofilm formation decreased inproportion to the ethanol extract concentration when theextract was introduced Biofilm formation also decreased inthe positive control
Using a confocal laser microscopy the bactericidal effectsof ethanol extract of A princeps were examined The ethanolextract of A princeps was observed to be bactericidal in adose-dependent manner (8ndash64mgmL) (Figure 4) Expres-sion of mecA an antibiotic-resistant gene of MRSA as wellthat of sea agrA and sarA and virulence-factor genes wasestimated using real-time PCR in sub-MIC The ethanolextract of A princeps inhibited mecA sea agrA and sarAmRNA expression at concentrations greater than 1mgmL(Figure 5)
Phytochemical analysis of princeps showed relatively highorganic acid content medium glycosides content and weak
Table 3 Phytochemical analysis of the ethanol extract of Artemisiaprinceps
Plant constituents Ethanol extractAlkaloids minus
Phenolics +Flavonoids minus
Glycosides ++Peptides minus
Steroids terpenoids minus
Organic acids ++++++ strong ++ moderate + poor minus absent
phenolic content Alkaloid flavonoid and peptides weredetected only at very low levels (Table 3)
4 Discussion
MRSA is a typical antibiotic-resistant strain Development ofnew antibiotics is necessary for treating such strains Naturalproducts can be utilized as raw materials in the developmentof new antibacterial substances
A princeps is used as a digestive medicine in treatingfever as an anthelmintic and as an antihemorrhagic agent inoriental medicines and is known to be effective for treatinggynecological and gastrointestinal diseases In addition itsconstituents are known to have various physiological effectssuch as insecticidal antibacterial and antitumor effects [2324]
In this study we investigated the antibacterial effects ofan ethanol extract of A princeps against MRSA The ethanolextract of A princeps at 1ndash8mgmL was found to inhibitMRSA growth The evidence of antibacterial effects of theethanol extract of A princeps supports the use of A princepsas a traditional medicine to treat patients with infectiousdiseases in Korea According to previous studies on thearoma constituents of A princeps thujone caryophylleneand farnesol showed antibacterial effects against Escherichiacoli Enterobacter aerogenes Vibrio parahaemolyticus Pseu-domonas aeruginosa Bacillus subtilis and Staphylococcusaureus [23]
MRSA is known to produce organic acids through carbo-hydrate metabolism pathways [10 11] Acetic acid is the mainorganic acid produced by MRSA which lowers pH in theinfected area this lowered pH facilitates biofilm formationby microorganisms [10] Our results showed that the ethanolextract of A princeps inhibited the pH reduction induced byMRSA This result indicates that the ethanol extract of Aprinceps inhibits carbohydrate metabolism in MRSA
MRSA adheres to and proliferates in damaged tissueimplanted medical and prosthetic devices and is capableof forming biofilms [7 8] Biofilms constitute bacterialcommunities that form on the surface of living and nonlivingsubstances Biofilms are surrounded by a self-produced extra-cellular matrix that consists of polysaccharides and proteinsThese biofilms are very difficult to remove and are a causeof intractable infection Biofilms formed on the surface of
BioMed Research International 5
(a) (b) (c) (d) (e) (f)
Figure 3 Scanning electron microscopy of MRSA biofilms grown in ethanol extract of A princeps (a) Control (b) 1mgmL (c) 2mgmL(d) 4mgmL (e) 8mgmL (f) positive control (01 NaF) Bar = 10120583m
SYTO
PIM
erge
(a) (b) (c) (d) (e) (f)
Figure 4 Bactericidal effect of ethanol extract of A princeps Cultured MRSA was treated with high concentration (8ndash64mgmL) of Aprinceps extract and stained with LIVEDEAD BacLight Bacterial Viability Kit The stained bacteria were observed confocal laser scanningmicroscopy Treatment with ethanol extract of A princeps decreased green-labeled living bacteria (SYTO 9 stain) and increased red-labeleddead bacteria (PI stain) in a dose-dependent manner (a) Control (b) 8mgmL (c) 16mgmL (d) 32mgmL (e) 64mgmL (f) positivecontrol (01 NaF) Bar = 50 120583m
implanted medical devices cannot be removed by antibioticinjection and can only be removed by surgery in most casesAfter excising the peripheral tissues of biofilms antibioticsneed to be utilized for a long period of time [7 8] Themost well-known method for analyzing biofilm formationis a tissue culture plate assay method [9] In this studybiofilm formation was observed via safranin staining Theresult showed that A princeps inhibited biofilm formation ofMRSA at concentrations of 1ndash8mgmL Similar results wereobserved when MRSA biofilm formation was measured bySEM A previous study reported that biofilm culture andplanktonic culture showed different physiological character-istics even when the same types of bacteria were culturedBiofilm formation reportedly increases the immune responseof bacteria and their resistance to antibacterial substances[17] However comparing biofilm culture data and planktonicculture data in the present study there were no considerabledifferences in their resistance to ethanol extract ofA princepsbetween the two groups
Bactericidal effects of ethanol extract of A princeps wereobserved using confocal lasermicroscopy the ethanol extractA princeps showed bactericidal activity in a dose-dependentmanner
In MRSA PBP 21015840 produced by the mecA gene has lowaffinity to 120573-lactams antibiotics such as methicillin and it isknown to be antibiotic-resistant for cell-wall synthesis evenin the presence of 120573-lactamase antibiotics [2] In this studymecA expression an antibiotic-resistant gene of MRSA wasexamined using real-time PCR The ethanol extract of Aprinceps inhibited mecA expression at concentrations higherthan 1mgmL
In MRSA sea encodes SEA which is a major viru-lence factor of S aureus [12] SEA induces staphylococcalgastroenteritis secretion of T-cell-derived cytokines and T-cell activation because SEA possesses immunomodulatoryproperties of superantigensThe ethanol extract ofA princepswas observed to inhibit sea expression at concentrationshigher than 1mgmL
6 BioMed Research International
Artemisia princeps (mgmL)
0
05
1
15
Control 1 2 4 NaF
agrA
mRN
A(r
elat
ive q
uant
ity)
lowastlowast
lowastlowast
(a)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
sarA
mRN
A(r
elat
ive q
uant
ity)
lowastlowast
lowast
lowast
(b)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
lowast
lowast
lowast
lowast
mec
Am
RNA
(rel
ativ
e qua
ntity
)
(c)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
lowast lowast
lowast lowast
sea
mRN
A(r
elat
ive q
uant
ity)
(d)
Figure 5 Real-time PCR analysis of expression of several virulence-factor genesMRSAwas cultured and treated with subminimal inhibitoryconcentration (1ndash4mgmL) of A princeps extract and real-time PCR analysis was then performed as described in Section 2 Expression ofmecA sea and agrAwas significantly inhibited at concentration higher than 1mgmL Each value is expressed as amean plusmn standard deviationSignificance was determined at lowast119875 lt 005 when compared with the control
Production of virulence factors in S aureus is con-trolled by global regulators such as agr and sarA [13] agrAencodes accessory gene regulator A when agrA expressionis inhibited production of virulence factors is also inhibitedIn addition sarA regulates the production of some matrixadhesion genes (eg fnbA) and exotoxin genes (eg hla)the virulence factors associated with adherence of S aureus[25] Our investigation of the expression of the agrA andsarA genes in this study showed that A princeps inhibited seaexpression at concentrations higher than 1mgmL
According to a previous study Artemisia spp containmany components with strong antioxidant effects such ascaffeic acid catechol protocatechuic acid vanillin umbellif-erone and ferulic acid [26]
Moreover cineol thujone caryophyllene humulenelinalool artemisia alcohol camphor farnesol and borneolare present in A princeps tetracosanol 120573-sitosterol l-chebulachitol and l-inositol are present in the organismrsquosleaves with caryophyllene and farnesol known to haveantibacterial effects
Based on our phytochemical analysis in the present studythe ethanol extract of A princeps was confirmed to con-tain organic acids glycosides and phenolics In particularorganic acids and glycosides showed an intense reactionand are thought to be the active components in the MRSAinhibitionmechanismsTherefore further studies to examinethe specific effects of the components present in A princepsare necessary Furthermore additional studies should beconducted to identify antibacterial substances againstMRSA
In conclusion we show that the ethanol extract of Aprinceps may inhibit proliferation acid production biofilmformation and virulence gene expressions of MRSA which
may be related to organic acids and glycosides the majorcomponents in the extract of A princeps
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Authorsrsquo Contribution
Na-Young Choi and Sun-Young Kang are contributed equallyto this paper Data were acquired by Sun-Young KangWriting reviewing and revision of the paper were performedby Na-Young Choi Conception and design were performedby Kang-Ju Kim
Acknowledgment
This research was supported by Basic Science ResearchProgram through theNational Research Foundation of Korea(NRF) funded by the Ministry of Education Science andTechnology (no 2012R1A1A4A01012680)
References
[1] A Al-Habib E Al-Saleh A-M Safer and M Afzal ldquoBacterici-dal effect of grape seed extract on methicillin-resistant Staphy-lococcus aureus (MRSA)rdquo Journal of Toxicological Sciences vol35 no 3 pp 357ndash364 2010
[2] C C S Fuda J F Fisher and S Mobashery ldquo120573-Lactamresistance in Staphylococcus aureus the adaptive resistance of
BioMed Research International 7
a plastic genomerdquo Cellular and Molecular Life Sciences vol 62no 22 pp 2617ndash2633 2005
[3] L B Rice ldquoAntimicrobial resistance in gram-positive bacteriardquoThe American Journal of Medicine vol 119 no 6 pp S11ndashS192006
[4] H Tsuchiya M Sato T Miyazaki et al ldquoComparative studyon the antibacterial activity of phytochemical flavanonesagainst methicillin-resistant Staphylococcus aureusrdquo Journal ofEthnopharmacology vol 50 no 1 pp 27ndash34 1996
[5] H B Kim H-C Jang H J Nam et al ldquoIn vitro activities of28 antimicrobial agents against Staphylococcus aureus isolatesfrom tertiary-care hospitals in Korea a Nationwide SurveyrdquoAntimicrobial Agents and Chemotherapy vol 48 no 4 pp 1124ndash1127 2004
[6] S Stefani and P E Varaldo ldquoEpidemiology of methicillin-resistant staphylococci in Europerdquo Clinical Microbiology andInfection vol 9 no 12 pp 1179ndash1186 2003
[7] D G Conrady C C Brescia K Horii A A Weiss D JHassett and A B Herr ldquoA zinc-dependent adhesion mod-ule is responsible for intercellular adhesion in staphylococcalbiofilmsrdquo Proceedings of the National Academy of Sciences of theUnited States of America vol 105 no 49 pp 19456ndash19461 2008
[8] C L Quave L R W Plano T Pantuso and B C BennettldquoEffects of extracts from Italian medicinal plants on plank-tonic growth biofilm formation and adherence of methicillin-resistant Staphylococcus aureusrdquo Journal of Ethnopharmacologyvol 118 no 3 pp 418ndash428 2008
[9] P Jia Y J Xue X JDuan and S-H Shao ldquoEffect of cinnamalde-hyde on biofilm formation and sarA expression by methicillin-resistant Staphylococcus aureusrdquo Letters inAppliedMicrobiologyvol 53 no 4 pp 409ndash416 2011
[10] A G O Manetti T Koller M Becherelli et al ldquoEnviron-mental acidification drives S pyogenes pilus expression andmicrocolony formation on epithelial cells in a FCT-dependentmannerrdquo PLoS ONE vol 5 no 11 Article ID e13864 2010
[11] T M Rode T Moslashretroslash S Langsrud Oslash Langsrud G Vogt andA Holck ldquoResponses of Staphylococcus aureus exposed to HCLand organic acid stressrdquo Canadian Journal of Microbiology vol56 no 9 pp 777ndash792 2010
[12] J Qiu D Wang H Xiang et al ldquoSubinhibitory concentrationsof thymol reduce enterotoxins A and B and 120572-hemolysinproduction in Staphylococcus aureus isolatesrdquo PLoS ONE vol5 no 3 Article ID e9736 2010
[13] J Qiu X Zhang M Luo et al ldquoSubinhibitory concentrationsof perilla oil affect the expression of secreted virulence factorgenes in Staphylococcus aureusrdquo PLoS ONE vol 6 no 1 ArticleID e16160 2011
[14] S Faizi N R Mughal R A Khan et al ldquoEvaluation of theantimicrobial property of Polyalthia longifolia var pendulaisolation of a lactone as the active antibacterial agent from theethanol extract of the stemrdquo Phytotherapy Research vol 17 no10 pp 1177ndash1181 2003
[15] S Gibbons J Leimkugel M Oluwatuyi and M HeinrichldquoActivity of Zanthoxylum clava-herculis extracts againstmulti-drug resistant methicillin-resistant Staphylococcusaureus (mdr-MRSA)rdquo Phytotherapy Research vol 17 no 3 pp274ndash275 2003
[16] K H Bae The Medicinal Plants of Korea Kyo-hak PublishingSeoul Republic of Korea 2007
[17] A Yoshida and H K Kuramitsu ldquoMultiple Streptococcusmutans genes are involved in biofilm formationrdquo Applied and
Environmental Microbiology vol 68 no 12 pp 6283ndash62912002
[18] J Qiu X Zhang M Luo et al ldquoSubinhibitory concentrationsof perilla oil affect the expression of secreted virulence factorgenes in Staphylococcus aureusrdquo PLoS ONE vol 6 no 1 ArticleID e16160 2011
[19] P Jia Y J Xue X JDuan and S-H Shao ldquoEffect of cinnamalde-hyde on biofilm formation and sarA expression by methicillin-resistant Staphylococcus aureusrdquo Letters inAppliedMicrobiologyvol 53 no 4 pp 409ndash416 2011
[20] A E Rosato W A Craig and G L Archer ldquoQuantitiation ofmecA transcription in oxacillin-resistant Staphylococcus aureusclinical isolatesrdquo Journal of Bacteriology vol 185 no 11 pp3446ndash3452 2003
[21] P J Houghton and A Raman Laboratory Handbook for theFractionation of Natural Extracts Chapman amp Hall LondonUK 1998
[22] W S Woo Experimental Methods for Phytochemistry SeoulNational University Press Seoul Republic of Korea 2001
[23] Y S Kim M N Kim J O Kim and J H Lee ldquoThe effectof hot water-extract and flavor compounds of Mugwort onmicrobial growthrdquo Journal of the Korean Society of Food Scienceand Nutrition vol 23 no 6 pp 994ndash1000 1994
[24] S J Lee ldquoStudies on the origin of Korean folk medicinesrdquoKorean Journal of Pharmacognosy vol 6 no 2 pp 75ndash92 1975
[25] L I Kupferwasser M R Yeaman C C Nast et al ldquoSalicylicacid attenuates virulence in endovascular infections by target-ing global regulatory pathways in Staphylococcus aureusrdquo TheJournal of Clinical Investigation vol 112 no 2 pp 222ndash2332003
[26] K D Lee J S Kim B Jo and H S Yoon ldquoAntioxidativeeffectiveness of water extract and ether extract in wormwood(Artemisia Montana Pampan)rdquo Journal of the Korean Society ofFood Science and Nutrition vol 21 no 1 pp 17ndash22 1992
Submit your manuscripts athttpwwwhindawicom
PainResearch and TreatmentHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Figure 3 Scanning electron microscopy of MRSA biofilms grown in ethanol extract of A princeps (a) Control (b) 1mgmL (c) 2mgmL(d) 4mgmL (e) 8mgmL (f) positive control (01 NaF) Bar = 10120583m
SYTO
PIM
erge
(a) (b) (c) (d) (e) (f)
Figure 4 Bactericidal effect of ethanol extract of A princeps Cultured MRSA was treated with high concentration (8ndash64mgmL) of Aprinceps extract and stained with LIVEDEAD BacLight Bacterial Viability Kit The stained bacteria were observed confocal laser scanningmicroscopy Treatment with ethanol extract of A princeps decreased green-labeled living bacteria (SYTO 9 stain) and increased red-labeleddead bacteria (PI stain) in a dose-dependent manner (a) Control (b) 8mgmL (c) 16mgmL (d) 32mgmL (e) 64mgmL (f) positivecontrol (01 NaF) Bar = 50 120583m
implanted medical devices cannot be removed by antibioticinjection and can only be removed by surgery in most casesAfter excising the peripheral tissues of biofilms antibioticsneed to be utilized for a long period of time [7 8] Themost well-known method for analyzing biofilm formationis a tissue culture plate assay method [9] In this studybiofilm formation was observed via safranin staining Theresult showed that A princeps inhibited biofilm formation ofMRSA at concentrations of 1ndash8mgmL Similar results wereobserved when MRSA biofilm formation was measured bySEM A previous study reported that biofilm culture andplanktonic culture showed different physiological character-istics even when the same types of bacteria were culturedBiofilm formation reportedly increases the immune responseof bacteria and their resistance to antibacterial substances[17] However comparing biofilm culture data and planktonicculture data in the present study there were no considerabledifferences in their resistance to ethanol extract ofA princepsbetween the two groups
Bactericidal effects of ethanol extract of A princeps wereobserved using confocal lasermicroscopy the ethanol extractA princeps showed bactericidal activity in a dose-dependentmanner
In MRSA PBP 21015840 produced by the mecA gene has lowaffinity to 120573-lactams antibiotics such as methicillin and it isknown to be antibiotic-resistant for cell-wall synthesis evenin the presence of 120573-lactamase antibiotics [2] In this studymecA expression an antibiotic-resistant gene of MRSA wasexamined using real-time PCR The ethanol extract of Aprinceps inhibited mecA expression at concentrations higherthan 1mgmL
In MRSA sea encodes SEA which is a major viru-lence factor of S aureus [12] SEA induces staphylococcalgastroenteritis secretion of T-cell-derived cytokines and T-cell activation because SEA possesses immunomodulatoryproperties of superantigensThe ethanol extract ofA princepswas observed to inhibit sea expression at concentrationshigher than 1mgmL
6 BioMed Research International
Artemisia princeps (mgmL)
0
05
1
15
Control 1 2 4 NaF
agrA
mRN
A(r
elat
ive q
uant
ity)
lowastlowast
lowastlowast
(a)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
sarA
mRN
A(r
elat
ive q
uant
ity)
lowastlowast
lowast
lowast
(b)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
lowast
lowast
lowast
lowast
mec
Am
RNA
(rel
ativ
e qua
ntity
)
(c)
0
05
1
15
Artemisia princeps (mgmL)Control 1 2 4 NaF
lowast lowast
lowast lowast
sea
mRN
A(r
elat
ive q
uant
ity)
(d)
Figure 5 Real-time PCR analysis of expression of several virulence-factor genesMRSAwas cultured and treated with subminimal inhibitoryconcentration (1ndash4mgmL) of A princeps extract and real-time PCR analysis was then performed as described in Section 2 Expression ofmecA sea and agrAwas significantly inhibited at concentration higher than 1mgmL Each value is expressed as amean plusmn standard deviationSignificance was determined at lowast119875 lt 005 when compared with the control
Production of virulence factors in S aureus is con-trolled by global regulators such as agr and sarA [13] agrAencodes accessory gene regulator A when agrA expressionis inhibited production of virulence factors is also inhibitedIn addition sarA regulates the production of some matrixadhesion genes (eg fnbA) and exotoxin genes (eg hla)the virulence factors associated with adherence of S aureus[25] Our investigation of the expression of the agrA andsarA genes in this study showed that A princeps inhibited seaexpression at concentrations higher than 1mgmL
According to a previous study Artemisia spp containmany components with strong antioxidant effects such ascaffeic acid catechol protocatechuic acid vanillin umbellif-erone and ferulic acid [26]
Moreover cineol thujone caryophyllene humulenelinalool artemisia alcohol camphor farnesol and borneolare present in A princeps tetracosanol 120573-sitosterol l-chebulachitol and l-inositol are present in the organismrsquosleaves with caryophyllene and farnesol known to haveantibacterial effects
Based on our phytochemical analysis in the present studythe ethanol extract of A princeps was confirmed to con-tain organic acids glycosides and phenolics In particularorganic acids and glycosides showed an intense reactionand are thought to be the active components in the MRSAinhibitionmechanismsTherefore further studies to examinethe specific effects of the components present in A princepsare necessary Furthermore additional studies should beconducted to identify antibacterial substances againstMRSA
In conclusion we show that the ethanol extract of Aprinceps may inhibit proliferation acid production biofilmformation and virulence gene expressions of MRSA which
may be related to organic acids and glycosides the majorcomponents in the extract of A princeps
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Authorsrsquo Contribution
Na-Young Choi and Sun-Young Kang are contributed equallyto this paper Data were acquired by Sun-Young KangWriting reviewing and revision of the paper were performedby Na-Young Choi Conception and design were performedby Kang-Ju Kim
Acknowledgment
This research was supported by Basic Science ResearchProgram through theNational Research Foundation of Korea(NRF) funded by the Ministry of Education Science andTechnology (no 2012R1A1A4A01012680)
References
[1] A Al-Habib E Al-Saleh A-M Safer and M Afzal ldquoBacterici-dal effect of grape seed extract on methicillin-resistant Staphy-lococcus aureus (MRSA)rdquo Journal of Toxicological Sciences vol35 no 3 pp 357ndash364 2010
[2] C C S Fuda J F Fisher and S Mobashery ldquo120573-Lactamresistance in Staphylococcus aureus the adaptive resistance of
BioMed Research International 7
a plastic genomerdquo Cellular and Molecular Life Sciences vol 62no 22 pp 2617ndash2633 2005
[3] L B Rice ldquoAntimicrobial resistance in gram-positive bacteriardquoThe American Journal of Medicine vol 119 no 6 pp S11ndashS192006
[4] H Tsuchiya M Sato T Miyazaki et al ldquoComparative studyon the antibacterial activity of phytochemical flavanonesagainst methicillin-resistant Staphylococcus aureusrdquo Journal ofEthnopharmacology vol 50 no 1 pp 27ndash34 1996
[5] H B Kim H-C Jang H J Nam et al ldquoIn vitro activities of28 antimicrobial agents against Staphylococcus aureus isolatesfrom tertiary-care hospitals in Korea a Nationwide SurveyrdquoAntimicrobial Agents and Chemotherapy vol 48 no 4 pp 1124ndash1127 2004
[6] S Stefani and P E Varaldo ldquoEpidemiology of methicillin-resistant staphylococci in Europerdquo Clinical Microbiology andInfection vol 9 no 12 pp 1179ndash1186 2003
[7] D G Conrady C C Brescia K Horii A A Weiss D JHassett and A B Herr ldquoA zinc-dependent adhesion mod-ule is responsible for intercellular adhesion in staphylococcalbiofilmsrdquo Proceedings of the National Academy of Sciences of theUnited States of America vol 105 no 49 pp 19456ndash19461 2008
[8] C L Quave L R W Plano T Pantuso and B C BennettldquoEffects of extracts from Italian medicinal plants on plank-tonic growth biofilm formation and adherence of methicillin-resistant Staphylococcus aureusrdquo Journal of Ethnopharmacologyvol 118 no 3 pp 418ndash428 2008
[9] P Jia Y J Xue X JDuan and S-H Shao ldquoEffect of cinnamalde-hyde on biofilm formation and sarA expression by methicillin-resistant Staphylococcus aureusrdquo Letters inAppliedMicrobiologyvol 53 no 4 pp 409ndash416 2011
[10] A G O Manetti T Koller M Becherelli et al ldquoEnviron-mental acidification drives S pyogenes pilus expression andmicrocolony formation on epithelial cells in a FCT-dependentmannerrdquo PLoS ONE vol 5 no 11 Article ID e13864 2010
[11] T M Rode T Moslashretroslash S Langsrud Oslash Langsrud G Vogt andA Holck ldquoResponses of Staphylococcus aureus exposed to HCLand organic acid stressrdquo Canadian Journal of Microbiology vol56 no 9 pp 777ndash792 2010
[12] J Qiu D Wang H Xiang et al ldquoSubinhibitory concentrationsof thymol reduce enterotoxins A and B and 120572-hemolysinproduction in Staphylococcus aureus isolatesrdquo PLoS ONE vol5 no 3 Article ID e9736 2010
[13] J Qiu X Zhang M Luo et al ldquoSubinhibitory concentrationsof perilla oil affect the expression of secreted virulence factorgenes in Staphylococcus aureusrdquo PLoS ONE vol 6 no 1 ArticleID e16160 2011
[14] S Faizi N R Mughal R A Khan et al ldquoEvaluation of theantimicrobial property of Polyalthia longifolia var pendulaisolation of a lactone as the active antibacterial agent from theethanol extract of the stemrdquo Phytotherapy Research vol 17 no10 pp 1177ndash1181 2003
[15] S Gibbons J Leimkugel M Oluwatuyi and M HeinrichldquoActivity of Zanthoxylum clava-herculis extracts againstmulti-drug resistant methicillin-resistant Staphylococcusaureus (mdr-MRSA)rdquo Phytotherapy Research vol 17 no 3 pp274ndash275 2003
[16] K H Bae The Medicinal Plants of Korea Kyo-hak PublishingSeoul Republic of Korea 2007
[17] A Yoshida and H K Kuramitsu ldquoMultiple Streptococcusmutans genes are involved in biofilm formationrdquo Applied and
Environmental Microbiology vol 68 no 12 pp 6283ndash62912002
[18] J Qiu X Zhang M Luo et al ldquoSubinhibitory concentrationsof perilla oil affect the expression of secreted virulence factorgenes in Staphylococcus aureusrdquo PLoS ONE vol 6 no 1 ArticleID e16160 2011
[19] P Jia Y J Xue X JDuan and S-H Shao ldquoEffect of cinnamalde-hyde on biofilm formation and sarA expression by methicillin-resistant Staphylococcus aureusrdquo Letters inAppliedMicrobiologyvol 53 no 4 pp 409ndash416 2011
[20] A E Rosato W A Craig and G L Archer ldquoQuantitiation ofmecA transcription in oxacillin-resistant Staphylococcus aureusclinical isolatesrdquo Journal of Bacteriology vol 185 no 11 pp3446ndash3452 2003
[21] P J Houghton and A Raman Laboratory Handbook for theFractionation of Natural Extracts Chapman amp Hall LondonUK 1998
[22] W S Woo Experimental Methods for Phytochemistry SeoulNational University Press Seoul Republic of Korea 2001
[23] Y S Kim M N Kim J O Kim and J H Lee ldquoThe effectof hot water-extract and flavor compounds of Mugwort onmicrobial growthrdquo Journal of the Korean Society of Food Scienceand Nutrition vol 23 no 6 pp 994ndash1000 1994
[24] S J Lee ldquoStudies on the origin of Korean folk medicinesrdquoKorean Journal of Pharmacognosy vol 6 no 2 pp 75ndash92 1975
[25] L I Kupferwasser M R Yeaman C C Nast et al ldquoSalicylicacid attenuates virulence in endovascular infections by target-ing global regulatory pathways in Staphylococcus aureusrdquo TheJournal of Clinical Investigation vol 112 no 2 pp 222ndash2332003
[26] K D Lee J S Kim B Jo and H S Yoon ldquoAntioxidativeeffectiveness of water extract and ether extract in wormwood(Artemisia Montana Pampan)rdquo Journal of the Korean Society ofFood Science and Nutrition vol 21 no 1 pp 17ndash22 1992
Submit your manuscripts athttpwwwhindawicom
PainResearch and TreatmentHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Figure 5 Real-time PCR analysis of expression of several virulence-factor genesMRSAwas cultured and treated with subminimal inhibitoryconcentration (1ndash4mgmL) of A princeps extract and real-time PCR analysis was then performed as described in Section 2 Expression ofmecA sea and agrAwas significantly inhibited at concentration higher than 1mgmL Each value is expressed as amean plusmn standard deviationSignificance was determined at lowast119875 lt 005 when compared with the control
Production of virulence factors in S aureus is con-trolled by global regulators such as agr and sarA [13] agrAencodes accessory gene regulator A when agrA expressionis inhibited production of virulence factors is also inhibitedIn addition sarA regulates the production of some matrixadhesion genes (eg fnbA) and exotoxin genes (eg hla)the virulence factors associated with adherence of S aureus[25] Our investigation of the expression of the agrA andsarA genes in this study showed that A princeps inhibited seaexpression at concentrations higher than 1mgmL
According to a previous study Artemisia spp containmany components with strong antioxidant effects such ascaffeic acid catechol protocatechuic acid vanillin umbellif-erone and ferulic acid [26]
Moreover cineol thujone caryophyllene humulenelinalool artemisia alcohol camphor farnesol and borneolare present in A princeps tetracosanol 120573-sitosterol l-chebulachitol and l-inositol are present in the organismrsquosleaves with caryophyllene and farnesol known to haveantibacterial effects
Based on our phytochemical analysis in the present studythe ethanol extract of A princeps was confirmed to con-tain organic acids glycosides and phenolics In particularorganic acids and glycosides showed an intense reactionand are thought to be the active components in the MRSAinhibitionmechanismsTherefore further studies to examinethe specific effects of the components present in A princepsare necessary Furthermore additional studies should beconducted to identify antibacterial substances againstMRSA
In conclusion we show that the ethanol extract of Aprinceps may inhibit proliferation acid production biofilmformation and virulence gene expressions of MRSA which
may be related to organic acids and glycosides the majorcomponents in the extract of A princeps
Conflict of Interests
The authors declare that there is no conflict of interestsregarding the publication of this paper
Authorsrsquo Contribution
Na-Young Choi and Sun-Young Kang are contributed equallyto this paper Data were acquired by Sun-Young KangWriting reviewing and revision of the paper were performedby Na-Young Choi Conception and design were performedby Kang-Ju Kim
Acknowledgment
This research was supported by Basic Science ResearchProgram through theNational Research Foundation of Korea(NRF) funded by the Ministry of Education Science andTechnology (no 2012R1A1A4A01012680)
References
[1] A Al-Habib E Al-Saleh A-M Safer and M Afzal ldquoBacterici-dal effect of grape seed extract on methicillin-resistant Staphy-lococcus aureus (MRSA)rdquo Journal of Toxicological Sciences vol35 no 3 pp 357ndash364 2010
[2] C C S Fuda J F Fisher and S Mobashery ldquo120573-Lactamresistance in Staphylococcus aureus the adaptive resistance of
BioMed Research International 7
a plastic genomerdquo Cellular and Molecular Life Sciences vol 62no 22 pp 2617ndash2633 2005
[3] L B Rice ldquoAntimicrobial resistance in gram-positive bacteriardquoThe American Journal of Medicine vol 119 no 6 pp S11ndashS192006
[4] H Tsuchiya M Sato T Miyazaki et al ldquoComparative studyon the antibacterial activity of phytochemical flavanonesagainst methicillin-resistant Staphylococcus aureusrdquo Journal ofEthnopharmacology vol 50 no 1 pp 27ndash34 1996
[5] H B Kim H-C Jang H J Nam et al ldquoIn vitro activities of28 antimicrobial agents against Staphylococcus aureus isolatesfrom tertiary-care hospitals in Korea a Nationwide SurveyrdquoAntimicrobial Agents and Chemotherapy vol 48 no 4 pp 1124ndash1127 2004
[6] S Stefani and P E Varaldo ldquoEpidemiology of methicillin-resistant staphylococci in Europerdquo Clinical Microbiology andInfection vol 9 no 12 pp 1179ndash1186 2003
[7] D G Conrady C C Brescia K Horii A A Weiss D JHassett and A B Herr ldquoA zinc-dependent adhesion mod-ule is responsible for intercellular adhesion in staphylococcalbiofilmsrdquo Proceedings of the National Academy of Sciences of theUnited States of America vol 105 no 49 pp 19456ndash19461 2008
[8] C L Quave L R W Plano T Pantuso and B C BennettldquoEffects of extracts from Italian medicinal plants on plank-tonic growth biofilm formation and adherence of methicillin-resistant Staphylococcus aureusrdquo Journal of Ethnopharmacologyvol 118 no 3 pp 418ndash428 2008
[9] P Jia Y J Xue X JDuan and S-H Shao ldquoEffect of cinnamalde-hyde on biofilm formation and sarA expression by methicillin-resistant Staphylococcus aureusrdquo Letters inAppliedMicrobiologyvol 53 no 4 pp 409ndash416 2011
[10] A G O Manetti T Koller M Becherelli et al ldquoEnviron-mental acidification drives S pyogenes pilus expression andmicrocolony formation on epithelial cells in a FCT-dependentmannerrdquo PLoS ONE vol 5 no 11 Article ID e13864 2010
[11] T M Rode T Moslashretroslash S Langsrud Oslash Langsrud G Vogt andA Holck ldquoResponses of Staphylococcus aureus exposed to HCLand organic acid stressrdquo Canadian Journal of Microbiology vol56 no 9 pp 777ndash792 2010
[12] J Qiu D Wang H Xiang et al ldquoSubinhibitory concentrationsof thymol reduce enterotoxins A and B and 120572-hemolysinproduction in Staphylococcus aureus isolatesrdquo PLoS ONE vol5 no 3 Article ID e9736 2010
[13] J Qiu X Zhang M Luo et al ldquoSubinhibitory concentrationsof perilla oil affect the expression of secreted virulence factorgenes in Staphylococcus aureusrdquo PLoS ONE vol 6 no 1 ArticleID e16160 2011
[14] S Faizi N R Mughal R A Khan et al ldquoEvaluation of theantimicrobial property of Polyalthia longifolia var pendulaisolation of a lactone as the active antibacterial agent from theethanol extract of the stemrdquo Phytotherapy Research vol 17 no10 pp 1177ndash1181 2003
[15] S Gibbons J Leimkugel M Oluwatuyi and M HeinrichldquoActivity of Zanthoxylum clava-herculis extracts againstmulti-drug resistant methicillin-resistant Staphylococcusaureus (mdr-MRSA)rdquo Phytotherapy Research vol 17 no 3 pp274ndash275 2003
[16] K H Bae The Medicinal Plants of Korea Kyo-hak PublishingSeoul Republic of Korea 2007
[17] A Yoshida and H K Kuramitsu ldquoMultiple Streptococcusmutans genes are involved in biofilm formationrdquo Applied and
Environmental Microbiology vol 68 no 12 pp 6283ndash62912002
[18] J Qiu X Zhang M Luo et al ldquoSubinhibitory concentrationsof perilla oil affect the expression of secreted virulence factorgenes in Staphylococcus aureusrdquo PLoS ONE vol 6 no 1 ArticleID e16160 2011
[19] P Jia Y J Xue X JDuan and S-H Shao ldquoEffect of cinnamalde-hyde on biofilm formation and sarA expression by methicillin-resistant Staphylococcus aureusrdquo Letters inAppliedMicrobiologyvol 53 no 4 pp 409ndash416 2011
[20] A E Rosato W A Craig and G L Archer ldquoQuantitiation ofmecA transcription in oxacillin-resistant Staphylococcus aureusclinical isolatesrdquo Journal of Bacteriology vol 185 no 11 pp3446ndash3452 2003
[21] P J Houghton and A Raman Laboratory Handbook for theFractionation of Natural Extracts Chapman amp Hall LondonUK 1998
[22] W S Woo Experimental Methods for Phytochemistry SeoulNational University Press Seoul Republic of Korea 2001
[23] Y S Kim M N Kim J O Kim and J H Lee ldquoThe effectof hot water-extract and flavor compounds of Mugwort onmicrobial growthrdquo Journal of the Korean Society of Food Scienceand Nutrition vol 23 no 6 pp 994ndash1000 1994
[24] S J Lee ldquoStudies on the origin of Korean folk medicinesrdquoKorean Journal of Pharmacognosy vol 6 no 2 pp 75ndash92 1975
[25] L I Kupferwasser M R Yeaman C C Nast et al ldquoSalicylicacid attenuates virulence in endovascular infections by target-ing global regulatory pathways in Staphylococcus aureusrdquo TheJournal of Clinical Investigation vol 112 no 2 pp 222ndash2332003
[26] K D Lee J S Kim B Jo and H S Yoon ldquoAntioxidativeeffectiveness of water extract and ether extract in wormwood(Artemisia Montana Pampan)rdquo Journal of the Korean Society ofFood Science and Nutrition vol 21 no 1 pp 17ndash22 1992
Submit your manuscripts athttpwwwhindawicom
PainResearch and TreatmentHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
a plastic genomerdquo Cellular and Molecular Life Sciences vol 62no 22 pp 2617ndash2633 2005
[3] L B Rice ldquoAntimicrobial resistance in gram-positive bacteriardquoThe American Journal of Medicine vol 119 no 6 pp S11ndashS192006
[4] H Tsuchiya M Sato T Miyazaki et al ldquoComparative studyon the antibacterial activity of phytochemical flavanonesagainst methicillin-resistant Staphylococcus aureusrdquo Journal ofEthnopharmacology vol 50 no 1 pp 27ndash34 1996
[5] H B Kim H-C Jang H J Nam et al ldquoIn vitro activities of28 antimicrobial agents against Staphylococcus aureus isolatesfrom tertiary-care hospitals in Korea a Nationwide SurveyrdquoAntimicrobial Agents and Chemotherapy vol 48 no 4 pp 1124ndash1127 2004
[6] S Stefani and P E Varaldo ldquoEpidemiology of methicillin-resistant staphylococci in Europerdquo Clinical Microbiology andInfection vol 9 no 12 pp 1179ndash1186 2003
[7] D G Conrady C C Brescia K Horii A A Weiss D JHassett and A B Herr ldquoA zinc-dependent adhesion mod-ule is responsible for intercellular adhesion in staphylococcalbiofilmsrdquo Proceedings of the National Academy of Sciences of theUnited States of America vol 105 no 49 pp 19456ndash19461 2008
[8] C L Quave L R W Plano T Pantuso and B C BennettldquoEffects of extracts from Italian medicinal plants on plank-tonic growth biofilm formation and adherence of methicillin-resistant Staphylococcus aureusrdquo Journal of Ethnopharmacologyvol 118 no 3 pp 418ndash428 2008
[9] P Jia Y J Xue X JDuan and S-H Shao ldquoEffect of cinnamalde-hyde on biofilm formation and sarA expression by methicillin-resistant Staphylococcus aureusrdquo Letters inAppliedMicrobiologyvol 53 no 4 pp 409ndash416 2011
[10] A G O Manetti T Koller M Becherelli et al ldquoEnviron-mental acidification drives S pyogenes pilus expression andmicrocolony formation on epithelial cells in a FCT-dependentmannerrdquo PLoS ONE vol 5 no 11 Article ID e13864 2010
[11] T M Rode T Moslashretroslash S Langsrud Oslash Langsrud G Vogt andA Holck ldquoResponses of Staphylococcus aureus exposed to HCLand organic acid stressrdquo Canadian Journal of Microbiology vol56 no 9 pp 777ndash792 2010
[12] J Qiu D Wang H Xiang et al ldquoSubinhibitory concentrationsof thymol reduce enterotoxins A and B and 120572-hemolysinproduction in Staphylococcus aureus isolatesrdquo PLoS ONE vol5 no 3 Article ID e9736 2010
[13] J Qiu X Zhang M Luo et al ldquoSubinhibitory concentrationsof perilla oil affect the expression of secreted virulence factorgenes in Staphylococcus aureusrdquo PLoS ONE vol 6 no 1 ArticleID e16160 2011
[14] S Faizi N R Mughal R A Khan et al ldquoEvaluation of theantimicrobial property of Polyalthia longifolia var pendulaisolation of a lactone as the active antibacterial agent from theethanol extract of the stemrdquo Phytotherapy Research vol 17 no10 pp 1177ndash1181 2003
[15] S Gibbons J Leimkugel M Oluwatuyi and M HeinrichldquoActivity of Zanthoxylum clava-herculis extracts againstmulti-drug resistant methicillin-resistant Staphylococcusaureus (mdr-MRSA)rdquo Phytotherapy Research vol 17 no 3 pp274ndash275 2003
[16] K H Bae The Medicinal Plants of Korea Kyo-hak PublishingSeoul Republic of Korea 2007
[17] A Yoshida and H K Kuramitsu ldquoMultiple Streptococcusmutans genes are involved in biofilm formationrdquo Applied and
Environmental Microbiology vol 68 no 12 pp 6283ndash62912002
[18] J Qiu X Zhang M Luo et al ldquoSubinhibitory concentrationsof perilla oil affect the expression of secreted virulence factorgenes in Staphylococcus aureusrdquo PLoS ONE vol 6 no 1 ArticleID e16160 2011
[19] P Jia Y J Xue X JDuan and S-H Shao ldquoEffect of cinnamalde-hyde on biofilm formation and sarA expression by methicillin-resistant Staphylococcus aureusrdquo Letters inAppliedMicrobiologyvol 53 no 4 pp 409ndash416 2011
[20] A E Rosato W A Craig and G L Archer ldquoQuantitiation ofmecA transcription in oxacillin-resistant Staphylococcus aureusclinical isolatesrdquo Journal of Bacteriology vol 185 no 11 pp3446ndash3452 2003
[21] P J Houghton and A Raman Laboratory Handbook for theFractionation of Natural Extracts Chapman amp Hall LondonUK 1998
[22] W S Woo Experimental Methods for Phytochemistry SeoulNational University Press Seoul Republic of Korea 2001
[23] Y S Kim M N Kim J O Kim and J H Lee ldquoThe effectof hot water-extract and flavor compounds of Mugwort onmicrobial growthrdquo Journal of the Korean Society of Food Scienceand Nutrition vol 23 no 6 pp 994ndash1000 1994
[24] S J Lee ldquoStudies on the origin of Korean folk medicinesrdquoKorean Journal of Pharmacognosy vol 6 no 2 pp 75ndash92 1975
[25] L I Kupferwasser M R Yeaman C C Nast et al ldquoSalicylicacid attenuates virulence in endovascular infections by target-ing global regulatory pathways in Staphylococcus aureusrdquo TheJournal of Clinical Investigation vol 112 no 2 pp 222ndash2332003
[26] K D Lee J S Kim B Jo and H S Yoon ldquoAntioxidativeeffectiveness of water extract and ether extract in wormwood(Artemisia Montana Pampan)rdquo Journal of the Korean Society ofFood Science and Nutrition vol 21 no 1 pp 17ndash22 1992
Submit your manuscripts athttpwwwhindawicom
PainResearch and TreatmentHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
