Research ArticleComparative Genomic Analysis of Delftia tsuruhatensisMTQ3 and the Identification of Functional NRPS Genes forSiderophore Production
Haimeng Guo1 Yanan Yang1 Kai Liu1 Wenfeng Xu2 Jianyong Gao3
Hairong Duan3 Binghai Du1 Yanqin Ding1 and Chengqiang Wang1
1College of Life SciencesShandong Key Laboratory of Agricultural Microbiology Shandong Agricultural University Tairsquoan China2State Key Laboratory of Nutrition Resources Integrated Utilization Linyi China3GENEWIZ Suzhou China
Correspondence should be addressed to Yanqin Ding dyqsdaueducn and Chengqiang Wang wangcqsdaueducn
Received 28 April 2016 Revised 17 September 2016 Accepted 3 October 2016
Academic Editor Dilfuza Egamberdieva
Copyright copy 2016 Haimeng Guo et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited
Plant growth-promoting rhizobacteria (PGPR) are a group of rhizosphere bacteria that promote plant growthDelftia tsuruhatensisMTQ3 is amember of PGPR that produces siderophoresThedraft genome sequence ofMTQ3has been reportedHere we analyzedthe genome sequence of MTQ3 and performed a comparative genome analysis of four sequenced Delftia strains revealing geneticrelationships among these strains In addition genes responsible for bacteriocin and nonribosomal peptide synthesis were detectedin the genomes of each strain To reveal the functions of NRPS genes in siderophore production in D tsuruhatensisMTQ3 threeNRPS genes were knocked out to obtain the three mutants MTQ3-Δ1941 MTQ3-Δ1945 and MTQ3-Δ1946 which were comparedwith the wild-type strain In qualitative and quantitative analyses using CAS assay the mutants failed to produce siderophoresAccordingly the NRPS genes in MTQ3 were functionally related to siderophore production These results clarify one mechanismby which plant growth is promoted in MTQ3 and have important applications in agricultural production
1 Introduction
Plant growth-promoting rhizobacteria (PGPR) could pro-mote plant growth by a variety ofmechanisms such as sidero-phore production [1] antibiotics secretion phytohormonegeneration and the induction of systemic resistance [2 3]PGPR have an important value in agricultural production
Iron is essential to the growth of plants but soluble iron isoften insufficient in soil Siderophores which are low-molec-ular-weight molecules with a high affinity for ferric iron[4] secreted by PGPR can mitigate that limitation to someextent Many microorganisms including bacteria and fungican secrete siderophores [5] In general siderophores can beseparated into two types based on their biosynthetic mecha-nism One type depends on the nonribosomal peptide syn-thetase (NRPS) pathway and the other is NRPS-independent[6]
Delftia has the ability to biodegrade organic pollutantssuch as aniline [7] phenolic compounds [8] 24-dichloro-phenoxyacetic acid (24-d) [9] and acetochlor Delftia tsu-ruhatensisMTQ3 (MTQ3 for short) has been isolated by ourgroup from the rhizosphere of tobacco in Guizhou ChinaAs an environmentally friendly PGPR MTQ3 exhibits thepotential to produce siderophores Although species in thegenus Delftia have been described as PGPR [10] their abilityto produce siderophores has not been verified The draftgenome sequence of MTQ3 was formerly reported [11] butthe mechanism of siderophore production is unclear
In this work a comparative genomic analysis of MTQ3and the related genome sequences ofDelftia sp Cs1-4D aci-dovorans SPH-1 andD tsuruhatensis 391 was performed Wecharacterized the genetic differences between the fourDelftiastrains According to the genome annotation of MTQ3 agene cluster that included three NRPS genes on scaffold 2
Hindawi Publishing CorporationBioMed Research InternationalVolume 2016 Article ID 3687619 8 pageshttpdxdoiorg10115520163687619
2 BioMed Research International
Table 1 Bacterial strains and plasmids used in this work
E coliDH5120572 Host of recombinant plasmids TransGenPlasmidspJQ200SK Suicide plasmid carrying sacB Gmr selecting double crossover MTQ
3[12]
pk-1941 pJQ200SK carrying Km and the fragment of orf-1941 Gmr Kmr This workpk-1945 pJQ200SK carrying Km and the fragment of orf-1945 Gmr Kmr This workpk-1946 pJQ200SK carrying Km and the fragment of orf-1946 Gmr Kmr This workpUC4K Carrying Km cassette (Pst I) Kmr [13]pRK2013 Helper plasmid used in triparental mating Kmr Rif s [14]pGEM-T easy TA cloning vector Ampr Promega
Table 2 Oligonucleotides used in this study
Primers Sequence (51015840-31015840) PurposeJ1941F GGACTAGTCTTTGGCGTGCCCGATGT (Spe I) Cloning the fragment of orf-1941J1941R CCGCTCGAGTCGTTGGCGATGAGGTTGC (Xho I)J1945F GGACTAGTTCCCTGAACGATCTCGATTCCC (Spe I) Cloning the fragment of orf-1945J1945R CCGCTCGAGCATAGGTGCCACCGGCCTTG (Xho I)J1946F GGACTAGTGCTTCCGCTGATCGACCTCA (Spe I) Cloning the fragment of orf-1946J1946R CCGCTCGAGCGCCTTCTTCATCCTGCTCC (Xho I)KF1 CCCATCATCCAGCCAGAAAGTG Cloning the fragment of KnaKR1 ATAATGTCGGGCAATCAGGTGC27F AGA GTT TGA TCC TGG CTC AG Cloning the fragment of 16 srDNA1492R TAC GGC TAC CTT GTT ACG ACTT
was found The NRPS modular organizations were predictedusing the PKSNRPS Analysis website [15] We constructedNRPS gene knockout mutants to analyze gene function withrespect to siderophore biosynthesis
2 Materials and Methods
21 Bacterial Strains and Plasmids Bacterial strains andplasmids used in this study are presented in Table 1 DtsuruhatensisMTQ3 was used as the wild-type strain to con-ductmutantsThreeNRPSs (AA671 12415 AA671 12425 andAA671 12430) were knocked out to generate three mutantsMTQ3-Δ1941 MTQ3-Δ1945 andMTQ3-Δ1946 respectivelyEscherichia coli strains were used for the construction ofplasmids
22 DNA Extraction Chromosomal DNA of MTQ3 wasextracted from 1mL of overnight culture using the TIANampBacteria DNA Kit (TIANGEN Beijing China) according tothe manufacturerrsquos instructions
23 Primers and Gene Amplification All primers used inthis study are presented in Table 2 The target genes orf-1941 (AA671 12415) orf-1945 (AA671 12425) and orf-1946(AA671 12430) were amplified from the genomic DNA ofMTQ3 by PCR using relevant primers PCR fragments wereelectrophoresed excised and purified using the TIANgelMidi Purification Kit (TIANGEN) [16]
24 Molecular Phylogenetic Analysis To make phylogeneticinferences the 16S rRNA gene was amplified from thegenomic DNA using the universal bacterial 16S rRNA geneprimers 27F and 1492R PCR products were sequenced byGENEWIZ (Jiangsu China) The 16S rRNA gene sequencewas Blast-searched [17 18] against the NCBI database [19] toidentify homologous sequences from other species A phylo-genetic tree were generated using MEGA5 [20]
25 Comparative Genome Analysis The three Delftia geno-mes Delftia sp Cs1-4 (NC-015563) D acidovorans SPH-1(NC-010002) and D tsuruhatensis 391 (JNWH00000000)
BioMed Research International 3
Delftia tsuruhatensis 391 (GY14_31935)
Delftia tsuruhatensis T7 (NR_024786)
Delftia tsuruhatensis AD9 (AY899912)
Delftia acidovorans HL4-7 (KC292489)
Delftia tsuruhatensis MTQ3 (HQ327477)
Delftia acidovorans IAM 12409 (NR_024711)
Delftia acidovorans SPH-1 (NR_074691)
Delftia sp Cs1-4 (NR_074626)
Delftia acidovorans VH240351 (AY753653)
Delftia litopenaei wsw-7 (GU721027)
67
87
97
0002
Figure 1 Phylogenetic tree based on the 16S rRNA gene sequence of MTQ3 and related strains The phylogenetic tree was constructed usingthe maximum likelihood method with 1000 bootstrap replications GenBank accession numbers are presented in brackets next to the speciesnames
obtained from GenBank were used for a comparativegenome analysis with MTQ3 (LCZH00000000) The clustersof orthologous groups (COG) functional categories were ana-lyzed by exploring all predicted proteins in the COGdatabaseusing BLASTP [21] Nonribosomal peptide and polyketidesynthesis gene clusters were recognized using anti-SMASH(httpantismashsecondarymetabolitesorghelphtml) [22]and their structures were compared to those of other knownclusters
26 Gene Knockout All molecular genetic procedures forthe genes orf-1941 orf-1945 and orf-1946 were performedaccording to the methods described in [23]
27 Medium and Cultivation For plasmid construction Ecoli strains were cultured in Luria-Bertani (LB) mediumwith gentamycin (50 120583gmL) or kanamycin (100 120583gmL) asneeded at 37∘C D tsuruhatensis MTQ3 and the mutantswere grown in LB medium with rifampicin (10 120583gmL) The5 sucrose plus LB plates with kanamycin and rifampicinwere used to screen the recombinant strains A CAS-agarplate [24] was used to qualitatively detect siderophores Forthe quantitative analysis of siderophores sucrose-asparagine(SA) medium was necessary which included (per liter) 20 gof sucrose 20 g of l-asparagine 05 g of K
2HPO4 and 05 g
of MgSO4sdot7H2O [25]
28 Qualitative and Quantitative Analyses of SiderophoresSingle clones of strains MTQ3 MTQ3-Δ1941 MTQ3-Δ1945and MTQ3-Δ1946 were cultivated in LB plates at 37∘Covernight Then the bacterial lawn was inoculated on aCAS-agar plate for cultivation at 37∘C for 2-3 days and thedevelopment of a color ring was monitored
Single clones of MTQ3 MTQ3-Δ1941 MTQ3-Δ1945and MTQ3-Δ1946 were inoculated into 10mL of sucrose-asparagine (SA) liquid medium and incubated at 180 rpmand 37∘C for two days SA liquid medium [25] contains
20 g Lminus1 sucrose 20 g Lminus1 l-asparagine 05 g Lminus1 K2HPO4
and 05 g Lminus1 MgSO4sdot7H2O The supernatants of liquid cul-
tures (119860119904) were collected by centrifugation at 10000 rpm for
15min and then mixed with the CAS assay solution (at avolume ratio of 1 1) [26] Uninoculated SA liquid mediumwas also treated following the same protocol as a reference(119860119903) After a 1-hour reaction period the absorbances of 119860
119904
and119860119903were detected at 630 nm [27] Siderophore units were
estimated as [(119860119903minus 119860119904)119860119903] times 100 = siderophore units ()
[24] Units not exceeding 10 were regarded as negative andno color change was found in the mixture
3 Results
31 Phylogenetic Analyses A phylogenetic tree was con-structed based on the 16S rRNA sequences of Delftia spp[28] in MEGA5 (Figure 1) These results suggested that strainMTQ3 had high homology with D tsuruhatensis
32 Comparative Analysis with Strains Cs1-4 SPH-1 and 391The general features of the four genomes are summarized inTable 3There was clear variation in genome size Specificallythe genome size varied from 57Mb in MTQ3 to 67Mb inSPH-1 Chromosomal coding DNA sequences (CDS) variedbetween 4103 in strain 391 and 6040 in SPH-1 The (G + C)mol of the species shared a mean value of 6660 and nostrain differed from the mean value by gt03 These resultsindicated a genetic relationship between the species to someextent
To compare these genomes the orthologous and uniquegenes among the four genomes were analyzed (Figure 2)[21]The orthologous genes are contained in all strains whilethe unique genes are owned by only one strain A total of2540 orthologous genes were shared and represented 51054334 4205 and 6191 of all genes in MTQ3 Cs1-4SPH-1 and 391 respectively MTQ3 shared 4470 4414 and2782 orthologous genes with Cs1-4 SPH-1 and strain 391
4 BioMed Research International
Table 3 General features of D tsuruhatensisMTQ3 and other related genomes
D tsuruhatensis Delftia sp D acidovorans D tsuruhatensisMTQ3 Cs1-4 SPH-1 391
Genome size 5737182 6685842 6767514 6732149CDS number 4976 5861 6040 4103G + C percentage 6690 6671 6647 6630RNA number 92 98 98 76
Figure 2 Comparison of the gene contents of MTQ3 Cs1-4 SPH-1and strain 391
respectively Meanwhile MTQ3 possessed the least uniquegenes and accounted for 514 of all genes in its genome butstrain 391 contained the most unique genes and accountedfor 2094 in its genome That might indicate that the genesof MTQ3 presented more conserved core genome for Dtsuruhatensis
Based on the COG-based analysis the genes of these fourgenomes showed some similarities with respect to the distri-butions of COG categories (Figure 3) For the four genomesgenes related to transcription amino acid transport andmetabolism and lipid transport and metabolism (COG cate-gories K E and I resp) were relatively abundant functionalcategories in addition to R and S which represent generalpredicted functions and unknown functions respectivelyand provide little information regarding protein function[29] The genome of MTQ3 included a larger proportion ofgenes involved in carbohydrate transport and metabolismcompared with the other three genomes
Bacteriocins which are antimicrobial peptides or pro-teins produced by bacteria could enhance environmentaladaption Enzymes related to the synthesis of nonribosomalpeptides (NRP) and polyketides (PK) are modular andcomposed of a series of domains including adenylationthiolation condensation and esterification domains [29]Wecompared the NRPS gene cluster between the four genomesof Delftia which are summarized in Figure 4 Bacteriocinsynthetic gene clusters are also listed in Figure 4(b) Thequery sequence refers to the sequence ofMTQ3These resultsshowed that not all Delftia genomes have identical clustersof NRPS and bacteriocin synthesis genes These differences
1000
800
600
400
200
000
of g
enes
()
FSTNKEVZQMCLAJOWPBHDRIGU
F S T N K E V Z Q M C L A J O W P B H D R I G UCOG categories
COG Description
Nucleotide transport and metabolismFunction unknown
Signal transduction mechanismsCell motilityTranscription
Amino acid transport and metabolismDefense mechanisms
CytoskeletonSecondary metabolites biosynthesis transport and catabolism
Cell wallmembraneenvelope biogenesisEnergy production and conversion
Replication recombination and repairRNA processing and modification
Translation and ribosomal structure and biogenesisPosttranslational modification protein turnover and chaperones
Extracellular structuresInorganic ion transport and metabolism
Chromatin structure and dynamicsCoenzyme transport and metabolism
Cell cycle control cell division and chromosome partitioningGeneral function prediction onlyLipid transport and metabolism
Carbohydrate transport and metabolismIntracellular trafficking secretion and vesicular transport
Delftia acidovorans SPH-1Delftia sp Cs1-4
Delftia tsuruhatensis 391
Delftia tsuruhatensis MTQ3
Figure 3 COG functional categorization of sequenced Delftiagenomes
may reflect adaptations of the strains to their specific envi-ronments
33 The Knockout of NRPSs in MTQ3 To reveal the functionof the NRPS genes (Figure 4(a)) gene knockouts were
BioMed Research International 5
Query sequence
CP002735_c2 Delftia sp Cs1-4 complete genome (71 of genes show similarity)
CP000884_c3 Delftia acidovorans SPH-1 complete genome (65 of genes show similarity)
(a)
Query sequence
CP000884_c2 Delftia acidovorans SPH-1 complete genome (24 genes show similarity)
CP002735_c3 Delftia spCs1-4 complete genome (24 of genes show similarity)
AGYY01000003_c1 Delftia acidovorans CCUG 15835 acHMM-supercont12C3 whol (21 of genes show similarity)
JOUB01000003_c1 Delftia acidovorans strain 2167 DR66 Contig240 whole geno (24 of genes show similarity)
AGYX01000005_c1 Delftia acidovorans CCUG 274B acHMQ-supercont14C5 whole (24 of genes show similarity)
(b)
Figure 4 Nonribosomal peptide and polyketide synthesis clusters (a) NRPS gene cluster (b) Bacitracin synthesis clusterThe query sequencerefers to the sequence of MTQ3 (httpantismashsecondarymetabolitesorghelphtml)
performed The amplified target fragments of three NRPSswere ligated into the pGEM-T easy vector between sites Spe Iand Xho I which were then religated to the suicide plasmidpJQ200SK using the same restriction endonucleases for cut-ting The resulting suicide plasmids were then linearized byPst I Km fragments were cloned from the plasmid pUC4k byPst I digestion and then ligated into the above linearized sui-cide plasmids Finally the resulting three plasmids pk-1941pk-1945 and pk-1946 were transformed into E coli DH5120572[30] With the help of plasmid pRK2013 triparental mating[31] was used to generate the recombinant strains MTQ3-Δ1941 MTQ3-Δ1945 andMTQ3-Δ1946 (Figure 5)The threemutants were selected by 5 sucrose plus LB plates withkanamycin and rifampicin and further confirmed by PCRusing primers for Km and sequencing
34 Qualitative and Quantitative Analyses of SiderophoresOn the CAS-agar plates we observed an orange halo aroundthe colony of MTQ3 after 2-3 days of incubation but noorange ring around the mutants (Figure 6) The presence ofthe orange ring suggested that MTQ3 can produce sidero-phores to chelate iron in themedium thus resulting in a colorchange of the medium surrounding the colony The mutantslost the ability to produce siderophores
The quantitative measurements of siderophores (Table 4)indicated that the siderophore units of the wild-type strain
MTQ3 were 478 However production levels by MTQ3-Δ1941 MTQ3-Δ1945 and MTQ3-Δ1946 were just less than5 which were regarded as negative results In addition weobserved a color change from blue to orange when mixingthe MTQ3 culture with the CAS assay solution but this phe-nomenon was not observed for MTQ3-Δ1941 MTQ3-Δ1945and MTQ3-Δ1946 This further demonstrated that NRPSmutants MTQ3-Δ1941 MTQ3-Δ1945 and MTQ3-Δ1946failed to produce siderophores
4 Discussion
In this study D tsuruhatensis MTQ3 was examined as aPGPR The phylogenetic analyses showed that MTQ3 hashigh homology with D tsuruhatensis General features anda comparative genomic analysis with Delftia Cs1-4 SPH-1and strain 391 suggested that D tsuruhatensis MTQ3 shows
6 BioMed Research International
Genomic DNA of MTQ3
Target gene (TE)
TEKm
Genomic DNA of MTQ3-Km
pk-194119451946
KmRTE
mob
oriT
sacB
GmR sim7000 bp
Figure 5 Knockout target genes with the Km cassette The target genes orf-1941 orf-1945 and orf-1946 were amplified from the genomicDNA ofMTQ3 after a series of enzyme digestions and ligation to form the recombinant plasmids pK-1941 pK-1945 and pK-1946 Triparentalmating was used to generate homologous recombinant strains
1 2
3 4
Figure 6 Qualitative analysis of siderophores on the CAS-agarplate The bacterial lawn was inoculated on the CAS-agar plate forcultivation at 37∘C for 2-3 days followed by monitoring for a colorring (1) MTQ
3-Δ1941 (2) MTQ3 (3) MTQ
3-Δ1945 and (4) MTQ
3-
Δ1946
some similarities with respect to COG categories but theproportions are somehow different MTQ3 contains a largerproportion of genes involved in carbohydrate transport andmetabolism which indicates its better potential for carbohy-drate utilization For secondary metabolite prediction usinganti-SMASH the gene clusters of NRPS and bacteriocinsynthesis genes are not identical in the Delftia genomes Thedifferent features of the four genomes may be explained byadaptations of strains to their specific environments
As PGPR MTQ3 exhibits the potential to producesiderophores To determine the genes involved in siderophoreproduction three NRPS genes orf-1941 orf-1945 and orf-1946 of MTQ3 were figured out to test the functionThey belong to one gene cluster the genes of which show85 similarity to the nonribosomal peptide metallophoredelftibactin [32 33] Compared with the wild-type strainMTQ3 three obtained mutants lost their ability to producesiderophoresThese results indicated that siderophores couldbe biosynthesized by the NRPS modular multienzymes inMTQ3 Siderophores could improve the absorption of ironby plants therefore promoting growth [4] The ability ofsiderophores produced by bacteria to repress phytopathogenscould be of significant importance in agriculture This mayexplain why D tsuruhatensis MTQ3 could stimulate plantgrowth To the best of our knowledge this is the first studyto verify the gene cluster for siderophore production in Dtsuruhatensis Meanwhile the PGPR of MTQ3 may haveimportant applications in agriculture
Competing Interests
All authors declare that they have no competing interests
Authorsrsquo Contributions
HaimengGuo andYananYangwere equal contributors to thiswork
Acknowledgments
This work was supported by the National Science and Tech-nology Pillar ProgramofChina (2014BAD16B02) the Science
BioMed Research International 7
and Technology Major Projects of Shandong Province(2015ZDXX0502B02) and the National Natural ScienceFoundation of China (31100005)
References
[1] A Beneduzi A Ambrosini and L M P Passaglia ldquoPlantgrowth-promoting rhizobacteria (PGPR) their potential asantagonists and biocontrol agentsrdquo Genetics and MolecularBiology vol 35 no 4 pp 1044ndash1051 2012
[2] G H Zheng J CWang and XHWang ldquoMechanisms of plantgrowth promoting rhizobacteriardquo JIANGXI Science vol 30 no4 pp 454ndash458 2012
[3] M Ahemad and M Kibret ldquoMechanisms and applications ofplant growth promoting rhizobacteria current perspectiverdquoJournal of King Saud UniversitymdashScience vol 26 no 1 pp 1ndash20 2014
[4] M Miethke and M A Marahiel ldquoSiderophore-based ironacquisition and pathogen controlrdquoMicrobiology and MolecularBiology Reviews vol 71 no 3 pp 413ndash451 2007
[5] Y Zhang W Zhang X Chen and F Zhang ldquoThe structurefunction and progress of siderophores produced by bacteriardquoChinese Journal of Health Laboratory Technology vol 22 no 9pp 2249ndash2251 2012
[6] S M Barry and G L Challis ldquoRecent advances in siderophorebiosynthesisrdquo Current Opinion in Chemical Biology vol 13 no2 pp 205ndash215 2009
[7] H Yan X Yang J Chen C Yin C Xiao and H ChenldquoSynergistic removal of aniline by carbon nanotubes and theenzymes ofDelftia sp XYJ6rdquo Journal of Environmental Sciencesvol 23 no 7 pp 1165ndash1170 2011
[8] B J Jimenez P Reboleiro Rivas J G Lopez C Pesciaroli PBarghini andM Fenice ldquoImmobilization ofDelftia tsuruhaten-sis in macro-porous cellulose and biodegradation of phenoliccompounds in repeated batch processrdquo Journal of Biotechnologyvol 157 no 1 pp 148ndash153 2012
[9] H Yoon S Leibeling C Zhang R H Muller C J Werth andJ L Zilles ldquoAdaptation ofDelftia acidovorans for degradation of24-dichlorophenoxyacetate in a microfluidic porous mediumrdquoBiodegradation vol 25 no 4 pp 595ndash604 2014
[10] J Han L Sun X Dong et al ldquoCharacterization of a novel plantgrowth-promoting bacteria strain Delftia tsuruhatensis HR4both as a diazotroph and a potential biocontrol agent againstvarious plant pathogensrdquo Systematic and Applied Microbiologyvol 28 no 1 pp 66ndash76 2005
[11] Q Hou C Wang H Guo et al ldquoDraft genome sequence ofDelftia tsuruhatensisMTQ3 a strain of plant growth-promotingrhizobacteriumwith antimicrobial activityrdquoGenomeAnnounce-ment vol 3 no 4 p e00822-15 2015
[12] J Quandt and M F Hynes ldquoVersatile suicide vectors whichallow direct selection for gene replacement in Gram-negativebacteriardquo Gene vol 127 no 1 pp 15ndash21 1993
[13] J Vieira and J Messing ldquoThe pUC plasmids an M13mp7-derived system for insertion mutagenesis and sequencing withsynthetic universal primersrdquo Gene vol 19 no 3 pp 259ndash2681982
[14] D H Figurski and D R Helinski ldquoReplication of an origin-containing derivative of plasmid RK2 dependent on a plas-mid function provided in transrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 76 no4 pp 1648ndash1652 1979
[15] B O Bachmann and J Ravel ldquoChapter 8 methods for in silicoprediction of microbial polyketide and nonribosomal peptidebiosynthetic pathways from DNA sequence datardquo Methods inEnzymology vol 458 pp 181ndash217 2009
[16] P Shen H Chao C Jiang Z Long C Wang and B WuldquoEnhancing production of l-serine by increasing the glyA geneexpression in Methylobacterium sp MB200rdquo Applied Biochem-istry and Biotechnology vol 160 no 3 pp 740ndash750 2010
[17] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[18] C Camacho G Coulouris V Avagyan et al ldquoBLAST+ archi-tecture and applicationsrdquo BMC Bioinformatics vol 10 article421 2009
[19] DA BensonMCavanaugh K Clark et al ldquoGenBankrdquoNucleicAcids Research vol 41 no 1 pp D36ndashD42 2013
[20] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011
[21] H Kang X Xu K Fu et al ldquoCharacterization and genomicanalysis of quinolone-resistant Delftia sp 670 isolated from apatient who died from severe pneumoniardquo Current Microbiol-ogy vol 71 no 1 pp 54ndash61 2015
[22] K BlinMHMedemaD Kazempour et al ldquoantiSMASH20mdasha versatile platform for genomemining of secondarymetaboliteproducersrdquo Nucleic Acids Research vol 41 pp W204ndashW2122013
[23] J Sambrook andDW RussellMolecular Cloning A LaboratoryManual Cold Spring Harbor Laboratory Press New York NYUSA 3rd edition 2001
[24] AMachuca andAM FMilagres ldquoUse of CAS-agar platemod-ified to study the effect of different variables on the siderophoreproduction by Aspergillusrdquo Letters in Applied Microbiology vol36 no 3 pp 177ndash181 2003
[25] M Manninen and T Mattila-Sandholm ldquoMethods for thedetection of Pseudomonas siderophoresrdquo Journal of Microbio-logical Methods vol 19 no 3 pp 223ndash234 1994
[26] B Schwyn and J B Neilands ldquoUniversal chemical assay forthe detection and determination of siderophoresrdquo AnalyticalBiochemistry vol 160 no 1 pp 47ndash56 1987
[27] A Baakza A K Vala B P Dave and H C Dube ldquoAcomparative study of siderophore production by fungi frommarine and terrestrial habitatsrdquo Journal of Experimental MarineBiology and Ecology vol 311 no 1 pp 1ndash9 2004
[28] J Felsenstein ldquoEvolutionary trees from DNA sequences amaximum likelihood approachrdquo Journal ofMolecular Evolutionvol 17 no 6 pp 368ndash376 1981
[29] A W Eastman D E Heinrichs and Z-C Yuan ldquoCompara-tive and genetic analysis of the four sequenced Paenibacilluspolymyxa genomes reveals a diverse metabolism and con-servation of genes relevant to plant-growth promotion andcompetitivenessrdquo BMC genomics vol 15 article 851 2014
[30] D Lu J Liu and Z Mao ldquoEngineering of Corynebacteriumglutamicum to enhance L-ornithine production by gene knock-out and comparative proteomic analysisrdquo Chinese Journal ofChemical Engineering vol 20 no 4 pp 731ndash739 2012
[31] F Xia L Zhang S Liang et al ldquoStudy on root colonizationof flowering Chinese cabbage by LuxAB gene-marked Pseu-domonas flurosecensrdquo Biotechnology vol 20 no 1 pp 25ndash272010
8 BioMed Research International
[32] M A Wyatt C W Johnston and N A MagarveyldquoGold nanoparticle formation via microbial metallophorechemistriesrdquo Journal of Nanoparticle Research vol 16 no 3 pp1ndash7 2014
[33] C W Johnston M A Wyatt X Li et al ldquoGold biomineraliza-tion by a metallophore from a gold-associated microberdquoNatureChemical Biology vol 9 no 4 pp 241ndash243 2013
E coliDH5120572 Host of recombinant plasmids TransGenPlasmidspJQ200SK Suicide plasmid carrying sacB Gmr selecting double crossover MTQ
3[12]
pk-1941 pJQ200SK carrying Km and the fragment of orf-1941 Gmr Kmr This workpk-1945 pJQ200SK carrying Km and the fragment of orf-1945 Gmr Kmr This workpk-1946 pJQ200SK carrying Km and the fragment of orf-1946 Gmr Kmr This workpUC4K Carrying Km cassette (Pst I) Kmr [13]pRK2013 Helper plasmid used in triparental mating Kmr Rif s [14]pGEM-T easy TA cloning vector Ampr Promega
Table 2 Oligonucleotides used in this study
Primers Sequence (51015840-31015840) PurposeJ1941F GGACTAGTCTTTGGCGTGCCCGATGT (Spe I) Cloning the fragment of orf-1941J1941R CCGCTCGAGTCGTTGGCGATGAGGTTGC (Xho I)J1945F GGACTAGTTCCCTGAACGATCTCGATTCCC (Spe I) Cloning the fragment of orf-1945J1945R CCGCTCGAGCATAGGTGCCACCGGCCTTG (Xho I)J1946F GGACTAGTGCTTCCGCTGATCGACCTCA (Spe I) Cloning the fragment of orf-1946J1946R CCGCTCGAGCGCCTTCTTCATCCTGCTCC (Xho I)KF1 CCCATCATCCAGCCAGAAAGTG Cloning the fragment of KnaKR1 ATAATGTCGGGCAATCAGGTGC27F AGA GTT TGA TCC TGG CTC AG Cloning the fragment of 16 srDNA1492R TAC GGC TAC CTT GTT ACG ACTT
was found The NRPS modular organizations were predictedusing the PKSNRPS Analysis website [15] We constructedNRPS gene knockout mutants to analyze gene function withrespect to siderophore biosynthesis
2 Materials and Methods
21 Bacterial Strains and Plasmids Bacterial strains andplasmids used in this study are presented in Table 1 DtsuruhatensisMTQ3 was used as the wild-type strain to con-ductmutantsThreeNRPSs (AA671 12415 AA671 12425 andAA671 12430) were knocked out to generate three mutantsMTQ3-Δ1941 MTQ3-Δ1945 andMTQ3-Δ1946 respectivelyEscherichia coli strains were used for the construction ofplasmids
22 DNA Extraction Chromosomal DNA of MTQ3 wasextracted from 1mL of overnight culture using the TIANampBacteria DNA Kit (TIANGEN Beijing China) according tothe manufacturerrsquos instructions
23 Primers and Gene Amplification All primers used inthis study are presented in Table 2 The target genes orf-1941 (AA671 12415) orf-1945 (AA671 12425) and orf-1946(AA671 12430) were amplified from the genomic DNA ofMTQ3 by PCR using relevant primers PCR fragments wereelectrophoresed excised and purified using the TIANgelMidi Purification Kit (TIANGEN) [16]
24 Molecular Phylogenetic Analysis To make phylogeneticinferences the 16S rRNA gene was amplified from thegenomic DNA using the universal bacterial 16S rRNA geneprimers 27F and 1492R PCR products were sequenced byGENEWIZ (Jiangsu China) The 16S rRNA gene sequencewas Blast-searched [17 18] against the NCBI database [19] toidentify homologous sequences from other species A phylo-genetic tree were generated using MEGA5 [20]
25 Comparative Genome Analysis The three Delftia geno-mes Delftia sp Cs1-4 (NC-015563) D acidovorans SPH-1(NC-010002) and D tsuruhatensis 391 (JNWH00000000)
BioMed Research International 3
Delftia tsuruhatensis 391 (GY14_31935)
Delftia tsuruhatensis T7 (NR_024786)
Delftia tsuruhatensis AD9 (AY899912)
Delftia acidovorans HL4-7 (KC292489)
Delftia tsuruhatensis MTQ3 (HQ327477)
Delftia acidovorans IAM 12409 (NR_024711)
Delftia acidovorans SPH-1 (NR_074691)
Delftia sp Cs1-4 (NR_074626)
Delftia acidovorans VH240351 (AY753653)
Delftia litopenaei wsw-7 (GU721027)
67
87
97
0002
Figure 1 Phylogenetic tree based on the 16S rRNA gene sequence of MTQ3 and related strains The phylogenetic tree was constructed usingthe maximum likelihood method with 1000 bootstrap replications GenBank accession numbers are presented in brackets next to the speciesnames
obtained from GenBank were used for a comparativegenome analysis with MTQ3 (LCZH00000000) The clustersof orthologous groups (COG) functional categories were ana-lyzed by exploring all predicted proteins in the COGdatabaseusing BLASTP [21] Nonribosomal peptide and polyketidesynthesis gene clusters were recognized using anti-SMASH(httpantismashsecondarymetabolitesorghelphtml) [22]and their structures were compared to those of other knownclusters
26 Gene Knockout All molecular genetic procedures forthe genes orf-1941 orf-1945 and orf-1946 were performedaccording to the methods described in [23]
27 Medium and Cultivation For plasmid construction Ecoli strains were cultured in Luria-Bertani (LB) mediumwith gentamycin (50 120583gmL) or kanamycin (100 120583gmL) asneeded at 37∘C D tsuruhatensis MTQ3 and the mutantswere grown in LB medium with rifampicin (10 120583gmL) The5 sucrose plus LB plates with kanamycin and rifampicinwere used to screen the recombinant strains A CAS-agarplate [24] was used to qualitatively detect siderophores Forthe quantitative analysis of siderophores sucrose-asparagine(SA) medium was necessary which included (per liter) 20 gof sucrose 20 g of l-asparagine 05 g of K
2HPO4 and 05 g
of MgSO4sdot7H2O [25]
28 Qualitative and Quantitative Analyses of SiderophoresSingle clones of strains MTQ3 MTQ3-Δ1941 MTQ3-Δ1945and MTQ3-Δ1946 were cultivated in LB plates at 37∘Covernight Then the bacterial lawn was inoculated on aCAS-agar plate for cultivation at 37∘C for 2-3 days and thedevelopment of a color ring was monitored
Single clones of MTQ3 MTQ3-Δ1941 MTQ3-Δ1945and MTQ3-Δ1946 were inoculated into 10mL of sucrose-asparagine (SA) liquid medium and incubated at 180 rpmand 37∘C for two days SA liquid medium [25] contains
20 g Lminus1 sucrose 20 g Lminus1 l-asparagine 05 g Lminus1 K2HPO4
and 05 g Lminus1 MgSO4sdot7H2O The supernatants of liquid cul-
tures (119860119904) were collected by centrifugation at 10000 rpm for
15min and then mixed with the CAS assay solution (at avolume ratio of 1 1) [26] Uninoculated SA liquid mediumwas also treated following the same protocol as a reference(119860119903) After a 1-hour reaction period the absorbances of 119860
119904
and119860119903were detected at 630 nm [27] Siderophore units were
estimated as [(119860119903minus 119860119904)119860119903] times 100 = siderophore units ()
[24] Units not exceeding 10 were regarded as negative andno color change was found in the mixture
3 Results
31 Phylogenetic Analyses A phylogenetic tree was con-structed based on the 16S rRNA sequences of Delftia spp[28] in MEGA5 (Figure 1) These results suggested that strainMTQ3 had high homology with D tsuruhatensis
32 Comparative Analysis with Strains Cs1-4 SPH-1 and 391The general features of the four genomes are summarized inTable 3There was clear variation in genome size Specificallythe genome size varied from 57Mb in MTQ3 to 67Mb inSPH-1 Chromosomal coding DNA sequences (CDS) variedbetween 4103 in strain 391 and 6040 in SPH-1 The (G + C)mol of the species shared a mean value of 6660 and nostrain differed from the mean value by gt03 These resultsindicated a genetic relationship between the species to someextent
To compare these genomes the orthologous and uniquegenes among the four genomes were analyzed (Figure 2)[21]The orthologous genes are contained in all strains whilethe unique genes are owned by only one strain A total of2540 orthologous genes were shared and represented 51054334 4205 and 6191 of all genes in MTQ3 Cs1-4SPH-1 and 391 respectively MTQ3 shared 4470 4414 and2782 orthologous genes with Cs1-4 SPH-1 and strain 391
4 BioMed Research International
Table 3 General features of D tsuruhatensisMTQ3 and other related genomes
D tsuruhatensis Delftia sp D acidovorans D tsuruhatensisMTQ3 Cs1-4 SPH-1 391
Genome size 5737182 6685842 6767514 6732149CDS number 4976 5861 6040 4103G + C percentage 6690 6671 6647 6630RNA number 92 98 98 76
Figure 2 Comparison of the gene contents of MTQ3 Cs1-4 SPH-1and strain 391
respectively Meanwhile MTQ3 possessed the least uniquegenes and accounted for 514 of all genes in its genome butstrain 391 contained the most unique genes and accountedfor 2094 in its genome That might indicate that the genesof MTQ3 presented more conserved core genome for Dtsuruhatensis
Based on the COG-based analysis the genes of these fourgenomes showed some similarities with respect to the distri-butions of COG categories (Figure 3) For the four genomesgenes related to transcription amino acid transport andmetabolism and lipid transport and metabolism (COG cate-gories K E and I resp) were relatively abundant functionalcategories in addition to R and S which represent generalpredicted functions and unknown functions respectivelyand provide little information regarding protein function[29] The genome of MTQ3 included a larger proportion ofgenes involved in carbohydrate transport and metabolismcompared with the other three genomes
Bacteriocins which are antimicrobial peptides or pro-teins produced by bacteria could enhance environmentaladaption Enzymes related to the synthesis of nonribosomalpeptides (NRP) and polyketides (PK) are modular andcomposed of a series of domains including adenylationthiolation condensation and esterification domains [29]Wecompared the NRPS gene cluster between the four genomesof Delftia which are summarized in Figure 4 Bacteriocinsynthetic gene clusters are also listed in Figure 4(b) Thequery sequence refers to the sequence ofMTQ3These resultsshowed that not all Delftia genomes have identical clustersof NRPS and bacteriocin synthesis genes These differences
1000
800
600
400
200
000
of g
enes
()
FSTNKEVZQMCLAJOWPBHDRIGU
F S T N K E V Z Q M C L A J O W P B H D R I G UCOG categories
COG Description
Nucleotide transport and metabolismFunction unknown
Signal transduction mechanismsCell motilityTranscription
Amino acid transport and metabolismDefense mechanisms
CytoskeletonSecondary metabolites biosynthesis transport and catabolism
Cell wallmembraneenvelope biogenesisEnergy production and conversion
Replication recombination and repairRNA processing and modification
Translation and ribosomal structure and biogenesisPosttranslational modification protein turnover and chaperones
Extracellular structuresInorganic ion transport and metabolism
Chromatin structure and dynamicsCoenzyme transport and metabolism
Cell cycle control cell division and chromosome partitioningGeneral function prediction onlyLipid transport and metabolism
Carbohydrate transport and metabolismIntracellular trafficking secretion and vesicular transport
Delftia acidovorans SPH-1Delftia sp Cs1-4
Delftia tsuruhatensis 391
Delftia tsuruhatensis MTQ3
Figure 3 COG functional categorization of sequenced Delftiagenomes
may reflect adaptations of the strains to their specific envi-ronments
33 The Knockout of NRPSs in MTQ3 To reveal the functionof the NRPS genes (Figure 4(a)) gene knockouts were
BioMed Research International 5
Query sequence
CP002735_c2 Delftia sp Cs1-4 complete genome (71 of genes show similarity)
CP000884_c3 Delftia acidovorans SPH-1 complete genome (65 of genes show similarity)
(a)
Query sequence
CP000884_c2 Delftia acidovorans SPH-1 complete genome (24 genes show similarity)
CP002735_c3 Delftia spCs1-4 complete genome (24 of genes show similarity)
AGYY01000003_c1 Delftia acidovorans CCUG 15835 acHMM-supercont12C3 whol (21 of genes show similarity)
JOUB01000003_c1 Delftia acidovorans strain 2167 DR66 Contig240 whole geno (24 of genes show similarity)
AGYX01000005_c1 Delftia acidovorans CCUG 274B acHMQ-supercont14C5 whole (24 of genes show similarity)
(b)
Figure 4 Nonribosomal peptide and polyketide synthesis clusters (a) NRPS gene cluster (b) Bacitracin synthesis clusterThe query sequencerefers to the sequence of MTQ3 (httpantismashsecondarymetabolitesorghelphtml)
performed The amplified target fragments of three NRPSswere ligated into the pGEM-T easy vector between sites Spe Iand Xho I which were then religated to the suicide plasmidpJQ200SK using the same restriction endonucleases for cut-ting The resulting suicide plasmids were then linearized byPst I Km fragments were cloned from the plasmid pUC4k byPst I digestion and then ligated into the above linearized sui-cide plasmids Finally the resulting three plasmids pk-1941pk-1945 and pk-1946 were transformed into E coli DH5120572[30] With the help of plasmid pRK2013 triparental mating[31] was used to generate the recombinant strains MTQ3-Δ1941 MTQ3-Δ1945 andMTQ3-Δ1946 (Figure 5)The threemutants were selected by 5 sucrose plus LB plates withkanamycin and rifampicin and further confirmed by PCRusing primers for Km and sequencing
34 Qualitative and Quantitative Analyses of SiderophoresOn the CAS-agar plates we observed an orange halo aroundthe colony of MTQ3 after 2-3 days of incubation but noorange ring around the mutants (Figure 6) The presence ofthe orange ring suggested that MTQ3 can produce sidero-phores to chelate iron in themedium thus resulting in a colorchange of the medium surrounding the colony The mutantslost the ability to produce siderophores
The quantitative measurements of siderophores (Table 4)indicated that the siderophore units of the wild-type strain
MTQ3 were 478 However production levels by MTQ3-Δ1941 MTQ3-Δ1945 and MTQ3-Δ1946 were just less than5 which were regarded as negative results In addition weobserved a color change from blue to orange when mixingthe MTQ3 culture with the CAS assay solution but this phe-nomenon was not observed for MTQ3-Δ1941 MTQ3-Δ1945and MTQ3-Δ1946 This further demonstrated that NRPSmutants MTQ3-Δ1941 MTQ3-Δ1945 and MTQ3-Δ1946failed to produce siderophores
4 Discussion
In this study D tsuruhatensis MTQ3 was examined as aPGPR The phylogenetic analyses showed that MTQ3 hashigh homology with D tsuruhatensis General features anda comparative genomic analysis with Delftia Cs1-4 SPH-1and strain 391 suggested that D tsuruhatensis MTQ3 shows
6 BioMed Research International
Genomic DNA of MTQ3
Target gene (TE)
TEKm
Genomic DNA of MTQ3-Km
pk-194119451946
KmRTE
mob
oriT
sacB
GmR sim7000 bp
Figure 5 Knockout target genes with the Km cassette The target genes orf-1941 orf-1945 and orf-1946 were amplified from the genomicDNA ofMTQ3 after a series of enzyme digestions and ligation to form the recombinant plasmids pK-1941 pK-1945 and pK-1946 Triparentalmating was used to generate homologous recombinant strains
1 2
3 4
Figure 6 Qualitative analysis of siderophores on the CAS-agarplate The bacterial lawn was inoculated on the CAS-agar plate forcultivation at 37∘C for 2-3 days followed by monitoring for a colorring (1) MTQ
3-Δ1941 (2) MTQ3 (3) MTQ
3-Δ1945 and (4) MTQ
3-
Δ1946
some similarities with respect to COG categories but theproportions are somehow different MTQ3 contains a largerproportion of genes involved in carbohydrate transport andmetabolism which indicates its better potential for carbohy-drate utilization For secondary metabolite prediction usinganti-SMASH the gene clusters of NRPS and bacteriocinsynthesis genes are not identical in the Delftia genomes Thedifferent features of the four genomes may be explained byadaptations of strains to their specific environments
As PGPR MTQ3 exhibits the potential to producesiderophores To determine the genes involved in siderophoreproduction three NRPS genes orf-1941 orf-1945 and orf-1946 of MTQ3 were figured out to test the functionThey belong to one gene cluster the genes of which show85 similarity to the nonribosomal peptide metallophoredelftibactin [32 33] Compared with the wild-type strainMTQ3 three obtained mutants lost their ability to producesiderophoresThese results indicated that siderophores couldbe biosynthesized by the NRPS modular multienzymes inMTQ3 Siderophores could improve the absorption of ironby plants therefore promoting growth [4] The ability ofsiderophores produced by bacteria to repress phytopathogenscould be of significant importance in agriculture This mayexplain why D tsuruhatensis MTQ3 could stimulate plantgrowth To the best of our knowledge this is the first studyto verify the gene cluster for siderophore production in Dtsuruhatensis Meanwhile the PGPR of MTQ3 may haveimportant applications in agriculture
Competing Interests
All authors declare that they have no competing interests
Authorsrsquo Contributions
HaimengGuo andYananYangwere equal contributors to thiswork
Acknowledgments
This work was supported by the National Science and Tech-nology Pillar ProgramofChina (2014BAD16B02) the Science
BioMed Research International 7
and Technology Major Projects of Shandong Province(2015ZDXX0502B02) and the National Natural ScienceFoundation of China (31100005)
References
[1] A Beneduzi A Ambrosini and L M P Passaglia ldquoPlantgrowth-promoting rhizobacteria (PGPR) their potential asantagonists and biocontrol agentsrdquo Genetics and MolecularBiology vol 35 no 4 pp 1044ndash1051 2012
[2] G H Zheng J CWang and XHWang ldquoMechanisms of plantgrowth promoting rhizobacteriardquo JIANGXI Science vol 30 no4 pp 454ndash458 2012
[3] M Ahemad and M Kibret ldquoMechanisms and applications ofplant growth promoting rhizobacteria current perspectiverdquoJournal of King Saud UniversitymdashScience vol 26 no 1 pp 1ndash20 2014
[4] M Miethke and M A Marahiel ldquoSiderophore-based ironacquisition and pathogen controlrdquoMicrobiology and MolecularBiology Reviews vol 71 no 3 pp 413ndash451 2007
[5] Y Zhang W Zhang X Chen and F Zhang ldquoThe structurefunction and progress of siderophores produced by bacteriardquoChinese Journal of Health Laboratory Technology vol 22 no 9pp 2249ndash2251 2012
[6] S M Barry and G L Challis ldquoRecent advances in siderophorebiosynthesisrdquo Current Opinion in Chemical Biology vol 13 no2 pp 205ndash215 2009
[7] H Yan X Yang J Chen C Yin C Xiao and H ChenldquoSynergistic removal of aniline by carbon nanotubes and theenzymes ofDelftia sp XYJ6rdquo Journal of Environmental Sciencesvol 23 no 7 pp 1165ndash1170 2011
[8] B J Jimenez P Reboleiro Rivas J G Lopez C Pesciaroli PBarghini andM Fenice ldquoImmobilization ofDelftia tsuruhaten-sis in macro-porous cellulose and biodegradation of phenoliccompounds in repeated batch processrdquo Journal of Biotechnologyvol 157 no 1 pp 148ndash153 2012
[9] H Yoon S Leibeling C Zhang R H Muller C J Werth andJ L Zilles ldquoAdaptation ofDelftia acidovorans for degradation of24-dichlorophenoxyacetate in a microfluidic porous mediumrdquoBiodegradation vol 25 no 4 pp 595ndash604 2014
[10] J Han L Sun X Dong et al ldquoCharacterization of a novel plantgrowth-promoting bacteria strain Delftia tsuruhatensis HR4both as a diazotroph and a potential biocontrol agent againstvarious plant pathogensrdquo Systematic and Applied Microbiologyvol 28 no 1 pp 66ndash76 2005
[11] Q Hou C Wang H Guo et al ldquoDraft genome sequence ofDelftia tsuruhatensisMTQ3 a strain of plant growth-promotingrhizobacteriumwith antimicrobial activityrdquoGenomeAnnounce-ment vol 3 no 4 p e00822-15 2015
[12] J Quandt and M F Hynes ldquoVersatile suicide vectors whichallow direct selection for gene replacement in Gram-negativebacteriardquo Gene vol 127 no 1 pp 15ndash21 1993
[13] J Vieira and J Messing ldquoThe pUC plasmids an M13mp7-derived system for insertion mutagenesis and sequencing withsynthetic universal primersrdquo Gene vol 19 no 3 pp 259ndash2681982
[14] D H Figurski and D R Helinski ldquoReplication of an origin-containing derivative of plasmid RK2 dependent on a plas-mid function provided in transrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 76 no4 pp 1648ndash1652 1979
[15] B O Bachmann and J Ravel ldquoChapter 8 methods for in silicoprediction of microbial polyketide and nonribosomal peptidebiosynthetic pathways from DNA sequence datardquo Methods inEnzymology vol 458 pp 181ndash217 2009
[16] P Shen H Chao C Jiang Z Long C Wang and B WuldquoEnhancing production of l-serine by increasing the glyA geneexpression in Methylobacterium sp MB200rdquo Applied Biochem-istry and Biotechnology vol 160 no 3 pp 740ndash750 2010
[17] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[18] C Camacho G Coulouris V Avagyan et al ldquoBLAST+ archi-tecture and applicationsrdquo BMC Bioinformatics vol 10 article421 2009
[19] DA BensonMCavanaugh K Clark et al ldquoGenBankrdquoNucleicAcids Research vol 41 no 1 pp D36ndashD42 2013
[20] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011
[21] H Kang X Xu K Fu et al ldquoCharacterization and genomicanalysis of quinolone-resistant Delftia sp 670 isolated from apatient who died from severe pneumoniardquo Current Microbiol-ogy vol 71 no 1 pp 54ndash61 2015
[22] K BlinMHMedemaD Kazempour et al ldquoantiSMASH20mdasha versatile platform for genomemining of secondarymetaboliteproducersrdquo Nucleic Acids Research vol 41 pp W204ndashW2122013
[23] J Sambrook andDW RussellMolecular Cloning A LaboratoryManual Cold Spring Harbor Laboratory Press New York NYUSA 3rd edition 2001
[24] AMachuca andAM FMilagres ldquoUse of CAS-agar platemod-ified to study the effect of different variables on the siderophoreproduction by Aspergillusrdquo Letters in Applied Microbiology vol36 no 3 pp 177ndash181 2003
[25] M Manninen and T Mattila-Sandholm ldquoMethods for thedetection of Pseudomonas siderophoresrdquo Journal of Microbio-logical Methods vol 19 no 3 pp 223ndash234 1994
[26] B Schwyn and J B Neilands ldquoUniversal chemical assay forthe detection and determination of siderophoresrdquo AnalyticalBiochemistry vol 160 no 1 pp 47ndash56 1987
[27] A Baakza A K Vala B P Dave and H C Dube ldquoAcomparative study of siderophore production by fungi frommarine and terrestrial habitatsrdquo Journal of Experimental MarineBiology and Ecology vol 311 no 1 pp 1ndash9 2004
[28] J Felsenstein ldquoEvolutionary trees from DNA sequences amaximum likelihood approachrdquo Journal ofMolecular Evolutionvol 17 no 6 pp 368ndash376 1981
[29] A W Eastman D E Heinrichs and Z-C Yuan ldquoCompara-tive and genetic analysis of the four sequenced Paenibacilluspolymyxa genomes reveals a diverse metabolism and con-servation of genes relevant to plant-growth promotion andcompetitivenessrdquo BMC genomics vol 15 article 851 2014
[30] D Lu J Liu and Z Mao ldquoEngineering of Corynebacteriumglutamicum to enhance L-ornithine production by gene knock-out and comparative proteomic analysisrdquo Chinese Journal ofChemical Engineering vol 20 no 4 pp 731ndash739 2012
[31] F Xia L Zhang S Liang et al ldquoStudy on root colonizationof flowering Chinese cabbage by LuxAB gene-marked Pseu-domonas flurosecensrdquo Biotechnology vol 20 no 1 pp 25ndash272010
8 BioMed Research International
[32] M A Wyatt C W Johnston and N A MagarveyldquoGold nanoparticle formation via microbial metallophorechemistriesrdquo Journal of Nanoparticle Research vol 16 no 3 pp1ndash7 2014
[33] C W Johnston M A Wyatt X Li et al ldquoGold biomineraliza-tion by a metallophore from a gold-associated microberdquoNatureChemical Biology vol 9 no 4 pp 241ndash243 2013
Figure 1 Phylogenetic tree based on the 16S rRNA gene sequence of MTQ3 and related strains The phylogenetic tree was constructed usingthe maximum likelihood method with 1000 bootstrap replications GenBank accession numbers are presented in brackets next to the speciesnames
obtained from GenBank were used for a comparativegenome analysis with MTQ3 (LCZH00000000) The clustersof orthologous groups (COG) functional categories were ana-lyzed by exploring all predicted proteins in the COGdatabaseusing BLASTP [21] Nonribosomal peptide and polyketidesynthesis gene clusters were recognized using anti-SMASH(httpantismashsecondarymetabolitesorghelphtml) [22]and their structures were compared to those of other knownclusters
26 Gene Knockout All molecular genetic procedures forthe genes orf-1941 orf-1945 and orf-1946 were performedaccording to the methods described in [23]
27 Medium and Cultivation For plasmid construction Ecoli strains were cultured in Luria-Bertani (LB) mediumwith gentamycin (50 120583gmL) or kanamycin (100 120583gmL) asneeded at 37∘C D tsuruhatensis MTQ3 and the mutantswere grown in LB medium with rifampicin (10 120583gmL) The5 sucrose plus LB plates with kanamycin and rifampicinwere used to screen the recombinant strains A CAS-agarplate [24] was used to qualitatively detect siderophores Forthe quantitative analysis of siderophores sucrose-asparagine(SA) medium was necessary which included (per liter) 20 gof sucrose 20 g of l-asparagine 05 g of K
2HPO4 and 05 g
of MgSO4sdot7H2O [25]
28 Qualitative and Quantitative Analyses of SiderophoresSingle clones of strains MTQ3 MTQ3-Δ1941 MTQ3-Δ1945and MTQ3-Δ1946 were cultivated in LB plates at 37∘Covernight Then the bacterial lawn was inoculated on aCAS-agar plate for cultivation at 37∘C for 2-3 days and thedevelopment of a color ring was monitored
Single clones of MTQ3 MTQ3-Δ1941 MTQ3-Δ1945and MTQ3-Δ1946 were inoculated into 10mL of sucrose-asparagine (SA) liquid medium and incubated at 180 rpmand 37∘C for two days SA liquid medium [25] contains
20 g Lminus1 sucrose 20 g Lminus1 l-asparagine 05 g Lminus1 K2HPO4
and 05 g Lminus1 MgSO4sdot7H2O The supernatants of liquid cul-
tures (119860119904) were collected by centrifugation at 10000 rpm for
15min and then mixed with the CAS assay solution (at avolume ratio of 1 1) [26] Uninoculated SA liquid mediumwas also treated following the same protocol as a reference(119860119903) After a 1-hour reaction period the absorbances of 119860
119904
and119860119903were detected at 630 nm [27] Siderophore units were
estimated as [(119860119903minus 119860119904)119860119903] times 100 = siderophore units ()
[24] Units not exceeding 10 were regarded as negative andno color change was found in the mixture
3 Results
31 Phylogenetic Analyses A phylogenetic tree was con-structed based on the 16S rRNA sequences of Delftia spp[28] in MEGA5 (Figure 1) These results suggested that strainMTQ3 had high homology with D tsuruhatensis
32 Comparative Analysis with Strains Cs1-4 SPH-1 and 391The general features of the four genomes are summarized inTable 3There was clear variation in genome size Specificallythe genome size varied from 57Mb in MTQ3 to 67Mb inSPH-1 Chromosomal coding DNA sequences (CDS) variedbetween 4103 in strain 391 and 6040 in SPH-1 The (G + C)mol of the species shared a mean value of 6660 and nostrain differed from the mean value by gt03 These resultsindicated a genetic relationship between the species to someextent
To compare these genomes the orthologous and uniquegenes among the four genomes were analyzed (Figure 2)[21]The orthologous genes are contained in all strains whilethe unique genes are owned by only one strain A total of2540 orthologous genes were shared and represented 51054334 4205 and 6191 of all genes in MTQ3 Cs1-4SPH-1 and 391 respectively MTQ3 shared 4470 4414 and2782 orthologous genes with Cs1-4 SPH-1 and strain 391
4 BioMed Research International
Table 3 General features of D tsuruhatensisMTQ3 and other related genomes
D tsuruhatensis Delftia sp D acidovorans D tsuruhatensisMTQ3 Cs1-4 SPH-1 391
Genome size 5737182 6685842 6767514 6732149CDS number 4976 5861 6040 4103G + C percentage 6690 6671 6647 6630RNA number 92 98 98 76
Figure 2 Comparison of the gene contents of MTQ3 Cs1-4 SPH-1and strain 391
respectively Meanwhile MTQ3 possessed the least uniquegenes and accounted for 514 of all genes in its genome butstrain 391 contained the most unique genes and accountedfor 2094 in its genome That might indicate that the genesof MTQ3 presented more conserved core genome for Dtsuruhatensis
Based on the COG-based analysis the genes of these fourgenomes showed some similarities with respect to the distri-butions of COG categories (Figure 3) For the four genomesgenes related to transcription amino acid transport andmetabolism and lipid transport and metabolism (COG cate-gories K E and I resp) were relatively abundant functionalcategories in addition to R and S which represent generalpredicted functions and unknown functions respectivelyand provide little information regarding protein function[29] The genome of MTQ3 included a larger proportion ofgenes involved in carbohydrate transport and metabolismcompared with the other three genomes
Bacteriocins which are antimicrobial peptides or pro-teins produced by bacteria could enhance environmentaladaption Enzymes related to the synthesis of nonribosomalpeptides (NRP) and polyketides (PK) are modular andcomposed of a series of domains including adenylationthiolation condensation and esterification domains [29]Wecompared the NRPS gene cluster between the four genomesof Delftia which are summarized in Figure 4 Bacteriocinsynthetic gene clusters are also listed in Figure 4(b) Thequery sequence refers to the sequence ofMTQ3These resultsshowed that not all Delftia genomes have identical clustersof NRPS and bacteriocin synthesis genes These differences
1000
800
600
400
200
000
of g
enes
()
FSTNKEVZQMCLAJOWPBHDRIGU
F S T N K E V Z Q M C L A J O W P B H D R I G UCOG categories
COG Description
Nucleotide transport and metabolismFunction unknown
Signal transduction mechanismsCell motilityTranscription
Amino acid transport and metabolismDefense mechanisms
CytoskeletonSecondary metabolites biosynthesis transport and catabolism
Cell wallmembraneenvelope biogenesisEnergy production and conversion
Replication recombination and repairRNA processing and modification
Translation and ribosomal structure and biogenesisPosttranslational modification protein turnover and chaperones
Extracellular structuresInorganic ion transport and metabolism
Chromatin structure and dynamicsCoenzyme transport and metabolism
Cell cycle control cell division and chromosome partitioningGeneral function prediction onlyLipid transport and metabolism
Carbohydrate transport and metabolismIntracellular trafficking secretion and vesicular transport
Delftia acidovorans SPH-1Delftia sp Cs1-4
Delftia tsuruhatensis 391
Delftia tsuruhatensis MTQ3
Figure 3 COG functional categorization of sequenced Delftiagenomes
may reflect adaptations of the strains to their specific envi-ronments
33 The Knockout of NRPSs in MTQ3 To reveal the functionof the NRPS genes (Figure 4(a)) gene knockouts were
BioMed Research International 5
Query sequence
CP002735_c2 Delftia sp Cs1-4 complete genome (71 of genes show similarity)
CP000884_c3 Delftia acidovorans SPH-1 complete genome (65 of genes show similarity)
(a)
Query sequence
CP000884_c2 Delftia acidovorans SPH-1 complete genome (24 genes show similarity)
CP002735_c3 Delftia spCs1-4 complete genome (24 of genes show similarity)
AGYY01000003_c1 Delftia acidovorans CCUG 15835 acHMM-supercont12C3 whol (21 of genes show similarity)
JOUB01000003_c1 Delftia acidovorans strain 2167 DR66 Contig240 whole geno (24 of genes show similarity)
AGYX01000005_c1 Delftia acidovorans CCUG 274B acHMQ-supercont14C5 whole (24 of genes show similarity)
(b)
Figure 4 Nonribosomal peptide and polyketide synthesis clusters (a) NRPS gene cluster (b) Bacitracin synthesis clusterThe query sequencerefers to the sequence of MTQ3 (httpantismashsecondarymetabolitesorghelphtml)
performed The amplified target fragments of three NRPSswere ligated into the pGEM-T easy vector between sites Spe Iand Xho I which were then religated to the suicide plasmidpJQ200SK using the same restriction endonucleases for cut-ting The resulting suicide plasmids were then linearized byPst I Km fragments were cloned from the plasmid pUC4k byPst I digestion and then ligated into the above linearized sui-cide plasmids Finally the resulting three plasmids pk-1941pk-1945 and pk-1946 were transformed into E coli DH5120572[30] With the help of plasmid pRK2013 triparental mating[31] was used to generate the recombinant strains MTQ3-Δ1941 MTQ3-Δ1945 andMTQ3-Δ1946 (Figure 5)The threemutants were selected by 5 sucrose plus LB plates withkanamycin and rifampicin and further confirmed by PCRusing primers for Km and sequencing
34 Qualitative and Quantitative Analyses of SiderophoresOn the CAS-agar plates we observed an orange halo aroundthe colony of MTQ3 after 2-3 days of incubation but noorange ring around the mutants (Figure 6) The presence ofthe orange ring suggested that MTQ3 can produce sidero-phores to chelate iron in themedium thus resulting in a colorchange of the medium surrounding the colony The mutantslost the ability to produce siderophores
The quantitative measurements of siderophores (Table 4)indicated that the siderophore units of the wild-type strain
MTQ3 were 478 However production levels by MTQ3-Δ1941 MTQ3-Δ1945 and MTQ3-Δ1946 were just less than5 which were regarded as negative results In addition weobserved a color change from blue to orange when mixingthe MTQ3 culture with the CAS assay solution but this phe-nomenon was not observed for MTQ3-Δ1941 MTQ3-Δ1945and MTQ3-Δ1946 This further demonstrated that NRPSmutants MTQ3-Δ1941 MTQ3-Δ1945 and MTQ3-Δ1946failed to produce siderophores
4 Discussion
In this study D tsuruhatensis MTQ3 was examined as aPGPR The phylogenetic analyses showed that MTQ3 hashigh homology with D tsuruhatensis General features anda comparative genomic analysis with Delftia Cs1-4 SPH-1and strain 391 suggested that D tsuruhatensis MTQ3 shows
6 BioMed Research International
Genomic DNA of MTQ3
Target gene (TE)
TEKm
Genomic DNA of MTQ3-Km
pk-194119451946
KmRTE
mob
oriT
sacB
GmR sim7000 bp
Figure 5 Knockout target genes with the Km cassette The target genes orf-1941 orf-1945 and orf-1946 were amplified from the genomicDNA ofMTQ3 after a series of enzyme digestions and ligation to form the recombinant plasmids pK-1941 pK-1945 and pK-1946 Triparentalmating was used to generate homologous recombinant strains
1 2
3 4
Figure 6 Qualitative analysis of siderophores on the CAS-agarplate The bacterial lawn was inoculated on the CAS-agar plate forcultivation at 37∘C for 2-3 days followed by monitoring for a colorring (1) MTQ
3-Δ1941 (2) MTQ3 (3) MTQ
3-Δ1945 and (4) MTQ
3-
Δ1946
some similarities with respect to COG categories but theproportions are somehow different MTQ3 contains a largerproportion of genes involved in carbohydrate transport andmetabolism which indicates its better potential for carbohy-drate utilization For secondary metabolite prediction usinganti-SMASH the gene clusters of NRPS and bacteriocinsynthesis genes are not identical in the Delftia genomes Thedifferent features of the four genomes may be explained byadaptations of strains to their specific environments
As PGPR MTQ3 exhibits the potential to producesiderophores To determine the genes involved in siderophoreproduction three NRPS genes orf-1941 orf-1945 and orf-1946 of MTQ3 were figured out to test the functionThey belong to one gene cluster the genes of which show85 similarity to the nonribosomal peptide metallophoredelftibactin [32 33] Compared with the wild-type strainMTQ3 three obtained mutants lost their ability to producesiderophoresThese results indicated that siderophores couldbe biosynthesized by the NRPS modular multienzymes inMTQ3 Siderophores could improve the absorption of ironby plants therefore promoting growth [4] The ability ofsiderophores produced by bacteria to repress phytopathogenscould be of significant importance in agriculture This mayexplain why D tsuruhatensis MTQ3 could stimulate plantgrowth To the best of our knowledge this is the first studyto verify the gene cluster for siderophore production in Dtsuruhatensis Meanwhile the PGPR of MTQ3 may haveimportant applications in agriculture
Competing Interests
All authors declare that they have no competing interests
Authorsrsquo Contributions
HaimengGuo andYananYangwere equal contributors to thiswork
Acknowledgments
This work was supported by the National Science and Tech-nology Pillar ProgramofChina (2014BAD16B02) the Science
BioMed Research International 7
and Technology Major Projects of Shandong Province(2015ZDXX0502B02) and the National Natural ScienceFoundation of China (31100005)
References
[1] A Beneduzi A Ambrosini and L M P Passaglia ldquoPlantgrowth-promoting rhizobacteria (PGPR) their potential asantagonists and biocontrol agentsrdquo Genetics and MolecularBiology vol 35 no 4 pp 1044ndash1051 2012
[2] G H Zheng J CWang and XHWang ldquoMechanisms of plantgrowth promoting rhizobacteriardquo JIANGXI Science vol 30 no4 pp 454ndash458 2012
[3] M Ahemad and M Kibret ldquoMechanisms and applications ofplant growth promoting rhizobacteria current perspectiverdquoJournal of King Saud UniversitymdashScience vol 26 no 1 pp 1ndash20 2014
[4] M Miethke and M A Marahiel ldquoSiderophore-based ironacquisition and pathogen controlrdquoMicrobiology and MolecularBiology Reviews vol 71 no 3 pp 413ndash451 2007
[5] Y Zhang W Zhang X Chen and F Zhang ldquoThe structurefunction and progress of siderophores produced by bacteriardquoChinese Journal of Health Laboratory Technology vol 22 no 9pp 2249ndash2251 2012
[6] S M Barry and G L Challis ldquoRecent advances in siderophorebiosynthesisrdquo Current Opinion in Chemical Biology vol 13 no2 pp 205ndash215 2009
[7] H Yan X Yang J Chen C Yin C Xiao and H ChenldquoSynergistic removal of aniline by carbon nanotubes and theenzymes ofDelftia sp XYJ6rdquo Journal of Environmental Sciencesvol 23 no 7 pp 1165ndash1170 2011
[8] B J Jimenez P Reboleiro Rivas J G Lopez C Pesciaroli PBarghini andM Fenice ldquoImmobilization ofDelftia tsuruhaten-sis in macro-porous cellulose and biodegradation of phenoliccompounds in repeated batch processrdquo Journal of Biotechnologyvol 157 no 1 pp 148ndash153 2012
[9] H Yoon S Leibeling C Zhang R H Muller C J Werth andJ L Zilles ldquoAdaptation ofDelftia acidovorans for degradation of24-dichlorophenoxyacetate in a microfluidic porous mediumrdquoBiodegradation vol 25 no 4 pp 595ndash604 2014
[10] J Han L Sun X Dong et al ldquoCharacterization of a novel plantgrowth-promoting bacteria strain Delftia tsuruhatensis HR4both as a diazotroph and a potential biocontrol agent againstvarious plant pathogensrdquo Systematic and Applied Microbiologyvol 28 no 1 pp 66ndash76 2005
[11] Q Hou C Wang H Guo et al ldquoDraft genome sequence ofDelftia tsuruhatensisMTQ3 a strain of plant growth-promotingrhizobacteriumwith antimicrobial activityrdquoGenomeAnnounce-ment vol 3 no 4 p e00822-15 2015
[12] J Quandt and M F Hynes ldquoVersatile suicide vectors whichallow direct selection for gene replacement in Gram-negativebacteriardquo Gene vol 127 no 1 pp 15ndash21 1993
[13] J Vieira and J Messing ldquoThe pUC plasmids an M13mp7-derived system for insertion mutagenesis and sequencing withsynthetic universal primersrdquo Gene vol 19 no 3 pp 259ndash2681982
[14] D H Figurski and D R Helinski ldquoReplication of an origin-containing derivative of plasmid RK2 dependent on a plas-mid function provided in transrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 76 no4 pp 1648ndash1652 1979
[15] B O Bachmann and J Ravel ldquoChapter 8 methods for in silicoprediction of microbial polyketide and nonribosomal peptidebiosynthetic pathways from DNA sequence datardquo Methods inEnzymology vol 458 pp 181ndash217 2009
[16] P Shen H Chao C Jiang Z Long C Wang and B WuldquoEnhancing production of l-serine by increasing the glyA geneexpression in Methylobacterium sp MB200rdquo Applied Biochem-istry and Biotechnology vol 160 no 3 pp 740ndash750 2010
[17] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[18] C Camacho G Coulouris V Avagyan et al ldquoBLAST+ archi-tecture and applicationsrdquo BMC Bioinformatics vol 10 article421 2009
[19] DA BensonMCavanaugh K Clark et al ldquoGenBankrdquoNucleicAcids Research vol 41 no 1 pp D36ndashD42 2013
[20] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011
[21] H Kang X Xu K Fu et al ldquoCharacterization and genomicanalysis of quinolone-resistant Delftia sp 670 isolated from apatient who died from severe pneumoniardquo Current Microbiol-ogy vol 71 no 1 pp 54ndash61 2015
[22] K BlinMHMedemaD Kazempour et al ldquoantiSMASH20mdasha versatile platform for genomemining of secondarymetaboliteproducersrdquo Nucleic Acids Research vol 41 pp W204ndashW2122013
[23] J Sambrook andDW RussellMolecular Cloning A LaboratoryManual Cold Spring Harbor Laboratory Press New York NYUSA 3rd edition 2001
[24] AMachuca andAM FMilagres ldquoUse of CAS-agar platemod-ified to study the effect of different variables on the siderophoreproduction by Aspergillusrdquo Letters in Applied Microbiology vol36 no 3 pp 177ndash181 2003
[25] M Manninen and T Mattila-Sandholm ldquoMethods for thedetection of Pseudomonas siderophoresrdquo Journal of Microbio-logical Methods vol 19 no 3 pp 223ndash234 1994
[26] B Schwyn and J B Neilands ldquoUniversal chemical assay forthe detection and determination of siderophoresrdquo AnalyticalBiochemistry vol 160 no 1 pp 47ndash56 1987
[27] A Baakza A K Vala B P Dave and H C Dube ldquoAcomparative study of siderophore production by fungi frommarine and terrestrial habitatsrdquo Journal of Experimental MarineBiology and Ecology vol 311 no 1 pp 1ndash9 2004
[28] J Felsenstein ldquoEvolutionary trees from DNA sequences amaximum likelihood approachrdquo Journal ofMolecular Evolutionvol 17 no 6 pp 368ndash376 1981
[29] A W Eastman D E Heinrichs and Z-C Yuan ldquoCompara-tive and genetic analysis of the four sequenced Paenibacilluspolymyxa genomes reveals a diverse metabolism and con-servation of genes relevant to plant-growth promotion andcompetitivenessrdquo BMC genomics vol 15 article 851 2014
[30] D Lu J Liu and Z Mao ldquoEngineering of Corynebacteriumglutamicum to enhance L-ornithine production by gene knock-out and comparative proteomic analysisrdquo Chinese Journal ofChemical Engineering vol 20 no 4 pp 731ndash739 2012
[31] F Xia L Zhang S Liang et al ldquoStudy on root colonizationof flowering Chinese cabbage by LuxAB gene-marked Pseu-domonas flurosecensrdquo Biotechnology vol 20 no 1 pp 25ndash272010
8 BioMed Research International
[32] M A Wyatt C W Johnston and N A MagarveyldquoGold nanoparticle formation via microbial metallophorechemistriesrdquo Journal of Nanoparticle Research vol 16 no 3 pp1ndash7 2014
[33] C W Johnston M A Wyatt X Li et al ldquoGold biomineraliza-tion by a metallophore from a gold-associated microberdquoNatureChemical Biology vol 9 no 4 pp 241ndash243 2013
Figure 2 Comparison of the gene contents of MTQ3 Cs1-4 SPH-1and strain 391
respectively Meanwhile MTQ3 possessed the least uniquegenes and accounted for 514 of all genes in its genome butstrain 391 contained the most unique genes and accountedfor 2094 in its genome That might indicate that the genesof MTQ3 presented more conserved core genome for Dtsuruhatensis
Based on the COG-based analysis the genes of these fourgenomes showed some similarities with respect to the distri-butions of COG categories (Figure 3) For the four genomesgenes related to transcription amino acid transport andmetabolism and lipid transport and metabolism (COG cate-gories K E and I resp) were relatively abundant functionalcategories in addition to R and S which represent generalpredicted functions and unknown functions respectivelyand provide little information regarding protein function[29] The genome of MTQ3 included a larger proportion ofgenes involved in carbohydrate transport and metabolismcompared with the other three genomes
Bacteriocins which are antimicrobial peptides or pro-teins produced by bacteria could enhance environmentaladaption Enzymes related to the synthesis of nonribosomalpeptides (NRP) and polyketides (PK) are modular andcomposed of a series of domains including adenylationthiolation condensation and esterification domains [29]Wecompared the NRPS gene cluster between the four genomesof Delftia which are summarized in Figure 4 Bacteriocinsynthetic gene clusters are also listed in Figure 4(b) Thequery sequence refers to the sequence ofMTQ3These resultsshowed that not all Delftia genomes have identical clustersof NRPS and bacteriocin synthesis genes These differences
1000
800
600
400
200
000
of g
enes
()
FSTNKEVZQMCLAJOWPBHDRIGU
F S T N K E V Z Q M C L A J O W P B H D R I G UCOG categories
COG Description
Nucleotide transport and metabolismFunction unknown
Signal transduction mechanismsCell motilityTranscription
Amino acid transport and metabolismDefense mechanisms
CytoskeletonSecondary metabolites biosynthesis transport and catabolism
Cell wallmembraneenvelope biogenesisEnergy production and conversion
Replication recombination and repairRNA processing and modification
Translation and ribosomal structure and biogenesisPosttranslational modification protein turnover and chaperones
Extracellular structuresInorganic ion transport and metabolism
Chromatin structure and dynamicsCoenzyme transport and metabolism
Cell cycle control cell division and chromosome partitioningGeneral function prediction onlyLipid transport and metabolism
Carbohydrate transport and metabolismIntracellular trafficking secretion and vesicular transport
Delftia acidovorans SPH-1Delftia sp Cs1-4
Delftia tsuruhatensis 391
Delftia tsuruhatensis MTQ3
Figure 3 COG functional categorization of sequenced Delftiagenomes
may reflect adaptations of the strains to their specific envi-ronments
33 The Knockout of NRPSs in MTQ3 To reveal the functionof the NRPS genes (Figure 4(a)) gene knockouts were
BioMed Research International 5
Query sequence
CP002735_c2 Delftia sp Cs1-4 complete genome (71 of genes show similarity)
CP000884_c3 Delftia acidovorans SPH-1 complete genome (65 of genes show similarity)
(a)
Query sequence
CP000884_c2 Delftia acidovorans SPH-1 complete genome (24 genes show similarity)
CP002735_c3 Delftia spCs1-4 complete genome (24 of genes show similarity)
AGYY01000003_c1 Delftia acidovorans CCUG 15835 acHMM-supercont12C3 whol (21 of genes show similarity)
JOUB01000003_c1 Delftia acidovorans strain 2167 DR66 Contig240 whole geno (24 of genes show similarity)
AGYX01000005_c1 Delftia acidovorans CCUG 274B acHMQ-supercont14C5 whole (24 of genes show similarity)
(b)
Figure 4 Nonribosomal peptide and polyketide synthesis clusters (a) NRPS gene cluster (b) Bacitracin synthesis clusterThe query sequencerefers to the sequence of MTQ3 (httpantismashsecondarymetabolitesorghelphtml)
performed The amplified target fragments of three NRPSswere ligated into the pGEM-T easy vector between sites Spe Iand Xho I which were then religated to the suicide plasmidpJQ200SK using the same restriction endonucleases for cut-ting The resulting suicide plasmids were then linearized byPst I Km fragments were cloned from the plasmid pUC4k byPst I digestion and then ligated into the above linearized sui-cide plasmids Finally the resulting three plasmids pk-1941pk-1945 and pk-1946 were transformed into E coli DH5120572[30] With the help of plasmid pRK2013 triparental mating[31] was used to generate the recombinant strains MTQ3-Δ1941 MTQ3-Δ1945 andMTQ3-Δ1946 (Figure 5)The threemutants were selected by 5 sucrose plus LB plates withkanamycin and rifampicin and further confirmed by PCRusing primers for Km and sequencing
34 Qualitative and Quantitative Analyses of SiderophoresOn the CAS-agar plates we observed an orange halo aroundthe colony of MTQ3 after 2-3 days of incubation but noorange ring around the mutants (Figure 6) The presence ofthe orange ring suggested that MTQ3 can produce sidero-phores to chelate iron in themedium thus resulting in a colorchange of the medium surrounding the colony The mutantslost the ability to produce siderophores
The quantitative measurements of siderophores (Table 4)indicated that the siderophore units of the wild-type strain
MTQ3 were 478 However production levels by MTQ3-Δ1941 MTQ3-Δ1945 and MTQ3-Δ1946 were just less than5 which were regarded as negative results In addition weobserved a color change from blue to orange when mixingthe MTQ3 culture with the CAS assay solution but this phe-nomenon was not observed for MTQ3-Δ1941 MTQ3-Δ1945and MTQ3-Δ1946 This further demonstrated that NRPSmutants MTQ3-Δ1941 MTQ3-Δ1945 and MTQ3-Δ1946failed to produce siderophores
4 Discussion
In this study D tsuruhatensis MTQ3 was examined as aPGPR The phylogenetic analyses showed that MTQ3 hashigh homology with D tsuruhatensis General features anda comparative genomic analysis with Delftia Cs1-4 SPH-1and strain 391 suggested that D tsuruhatensis MTQ3 shows
6 BioMed Research International
Genomic DNA of MTQ3
Target gene (TE)
TEKm
Genomic DNA of MTQ3-Km
pk-194119451946
KmRTE
mob
oriT
sacB
GmR sim7000 bp
Figure 5 Knockout target genes with the Km cassette The target genes orf-1941 orf-1945 and orf-1946 were amplified from the genomicDNA ofMTQ3 after a series of enzyme digestions and ligation to form the recombinant plasmids pK-1941 pK-1945 and pK-1946 Triparentalmating was used to generate homologous recombinant strains
1 2
3 4
Figure 6 Qualitative analysis of siderophores on the CAS-agarplate The bacterial lawn was inoculated on the CAS-agar plate forcultivation at 37∘C for 2-3 days followed by monitoring for a colorring (1) MTQ
3-Δ1941 (2) MTQ3 (3) MTQ
3-Δ1945 and (4) MTQ
3-
Δ1946
some similarities with respect to COG categories but theproportions are somehow different MTQ3 contains a largerproportion of genes involved in carbohydrate transport andmetabolism which indicates its better potential for carbohy-drate utilization For secondary metabolite prediction usinganti-SMASH the gene clusters of NRPS and bacteriocinsynthesis genes are not identical in the Delftia genomes Thedifferent features of the four genomes may be explained byadaptations of strains to their specific environments
As PGPR MTQ3 exhibits the potential to producesiderophores To determine the genes involved in siderophoreproduction three NRPS genes orf-1941 orf-1945 and orf-1946 of MTQ3 were figured out to test the functionThey belong to one gene cluster the genes of which show85 similarity to the nonribosomal peptide metallophoredelftibactin [32 33] Compared with the wild-type strainMTQ3 three obtained mutants lost their ability to producesiderophoresThese results indicated that siderophores couldbe biosynthesized by the NRPS modular multienzymes inMTQ3 Siderophores could improve the absorption of ironby plants therefore promoting growth [4] The ability ofsiderophores produced by bacteria to repress phytopathogenscould be of significant importance in agriculture This mayexplain why D tsuruhatensis MTQ3 could stimulate plantgrowth To the best of our knowledge this is the first studyto verify the gene cluster for siderophore production in Dtsuruhatensis Meanwhile the PGPR of MTQ3 may haveimportant applications in agriculture
Competing Interests
All authors declare that they have no competing interests
Authorsrsquo Contributions
HaimengGuo andYananYangwere equal contributors to thiswork
Acknowledgments
This work was supported by the National Science and Tech-nology Pillar ProgramofChina (2014BAD16B02) the Science
BioMed Research International 7
and Technology Major Projects of Shandong Province(2015ZDXX0502B02) and the National Natural ScienceFoundation of China (31100005)
References
[1] A Beneduzi A Ambrosini and L M P Passaglia ldquoPlantgrowth-promoting rhizobacteria (PGPR) their potential asantagonists and biocontrol agentsrdquo Genetics and MolecularBiology vol 35 no 4 pp 1044ndash1051 2012
[2] G H Zheng J CWang and XHWang ldquoMechanisms of plantgrowth promoting rhizobacteriardquo JIANGXI Science vol 30 no4 pp 454ndash458 2012
[3] M Ahemad and M Kibret ldquoMechanisms and applications ofplant growth promoting rhizobacteria current perspectiverdquoJournal of King Saud UniversitymdashScience vol 26 no 1 pp 1ndash20 2014
[4] M Miethke and M A Marahiel ldquoSiderophore-based ironacquisition and pathogen controlrdquoMicrobiology and MolecularBiology Reviews vol 71 no 3 pp 413ndash451 2007
[5] Y Zhang W Zhang X Chen and F Zhang ldquoThe structurefunction and progress of siderophores produced by bacteriardquoChinese Journal of Health Laboratory Technology vol 22 no 9pp 2249ndash2251 2012
[6] S M Barry and G L Challis ldquoRecent advances in siderophorebiosynthesisrdquo Current Opinion in Chemical Biology vol 13 no2 pp 205ndash215 2009
[7] H Yan X Yang J Chen C Yin C Xiao and H ChenldquoSynergistic removal of aniline by carbon nanotubes and theenzymes ofDelftia sp XYJ6rdquo Journal of Environmental Sciencesvol 23 no 7 pp 1165ndash1170 2011
[8] B J Jimenez P Reboleiro Rivas J G Lopez C Pesciaroli PBarghini andM Fenice ldquoImmobilization ofDelftia tsuruhaten-sis in macro-porous cellulose and biodegradation of phenoliccompounds in repeated batch processrdquo Journal of Biotechnologyvol 157 no 1 pp 148ndash153 2012
[9] H Yoon S Leibeling C Zhang R H Muller C J Werth andJ L Zilles ldquoAdaptation ofDelftia acidovorans for degradation of24-dichlorophenoxyacetate in a microfluidic porous mediumrdquoBiodegradation vol 25 no 4 pp 595ndash604 2014
[10] J Han L Sun X Dong et al ldquoCharacterization of a novel plantgrowth-promoting bacteria strain Delftia tsuruhatensis HR4both as a diazotroph and a potential biocontrol agent againstvarious plant pathogensrdquo Systematic and Applied Microbiologyvol 28 no 1 pp 66ndash76 2005
[11] Q Hou C Wang H Guo et al ldquoDraft genome sequence ofDelftia tsuruhatensisMTQ3 a strain of plant growth-promotingrhizobacteriumwith antimicrobial activityrdquoGenomeAnnounce-ment vol 3 no 4 p e00822-15 2015
[12] J Quandt and M F Hynes ldquoVersatile suicide vectors whichallow direct selection for gene replacement in Gram-negativebacteriardquo Gene vol 127 no 1 pp 15ndash21 1993
[13] J Vieira and J Messing ldquoThe pUC plasmids an M13mp7-derived system for insertion mutagenesis and sequencing withsynthetic universal primersrdquo Gene vol 19 no 3 pp 259ndash2681982
[14] D H Figurski and D R Helinski ldquoReplication of an origin-containing derivative of plasmid RK2 dependent on a plas-mid function provided in transrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 76 no4 pp 1648ndash1652 1979
[15] B O Bachmann and J Ravel ldquoChapter 8 methods for in silicoprediction of microbial polyketide and nonribosomal peptidebiosynthetic pathways from DNA sequence datardquo Methods inEnzymology vol 458 pp 181ndash217 2009
[16] P Shen H Chao C Jiang Z Long C Wang and B WuldquoEnhancing production of l-serine by increasing the glyA geneexpression in Methylobacterium sp MB200rdquo Applied Biochem-istry and Biotechnology vol 160 no 3 pp 740ndash750 2010
[17] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[18] C Camacho G Coulouris V Avagyan et al ldquoBLAST+ archi-tecture and applicationsrdquo BMC Bioinformatics vol 10 article421 2009
[19] DA BensonMCavanaugh K Clark et al ldquoGenBankrdquoNucleicAcids Research vol 41 no 1 pp D36ndashD42 2013
[20] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011
[21] H Kang X Xu K Fu et al ldquoCharacterization and genomicanalysis of quinolone-resistant Delftia sp 670 isolated from apatient who died from severe pneumoniardquo Current Microbiol-ogy vol 71 no 1 pp 54ndash61 2015
[22] K BlinMHMedemaD Kazempour et al ldquoantiSMASH20mdasha versatile platform for genomemining of secondarymetaboliteproducersrdquo Nucleic Acids Research vol 41 pp W204ndashW2122013
[23] J Sambrook andDW RussellMolecular Cloning A LaboratoryManual Cold Spring Harbor Laboratory Press New York NYUSA 3rd edition 2001
[24] AMachuca andAM FMilagres ldquoUse of CAS-agar platemod-ified to study the effect of different variables on the siderophoreproduction by Aspergillusrdquo Letters in Applied Microbiology vol36 no 3 pp 177ndash181 2003
[25] M Manninen and T Mattila-Sandholm ldquoMethods for thedetection of Pseudomonas siderophoresrdquo Journal of Microbio-logical Methods vol 19 no 3 pp 223ndash234 1994
[26] B Schwyn and J B Neilands ldquoUniversal chemical assay forthe detection and determination of siderophoresrdquo AnalyticalBiochemistry vol 160 no 1 pp 47ndash56 1987
[27] A Baakza A K Vala B P Dave and H C Dube ldquoAcomparative study of siderophore production by fungi frommarine and terrestrial habitatsrdquo Journal of Experimental MarineBiology and Ecology vol 311 no 1 pp 1ndash9 2004
[28] J Felsenstein ldquoEvolutionary trees from DNA sequences amaximum likelihood approachrdquo Journal ofMolecular Evolutionvol 17 no 6 pp 368ndash376 1981
[29] A W Eastman D E Heinrichs and Z-C Yuan ldquoCompara-tive and genetic analysis of the four sequenced Paenibacilluspolymyxa genomes reveals a diverse metabolism and con-servation of genes relevant to plant-growth promotion andcompetitivenessrdquo BMC genomics vol 15 article 851 2014
[30] D Lu J Liu and Z Mao ldquoEngineering of Corynebacteriumglutamicum to enhance L-ornithine production by gene knock-out and comparative proteomic analysisrdquo Chinese Journal ofChemical Engineering vol 20 no 4 pp 731ndash739 2012
[31] F Xia L Zhang S Liang et al ldquoStudy on root colonizationof flowering Chinese cabbage by LuxAB gene-marked Pseu-domonas flurosecensrdquo Biotechnology vol 20 no 1 pp 25ndash272010
8 BioMed Research International
[32] M A Wyatt C W Johnston and N A MagarveyldquoGold nanoparticle formation via microbial metallophorechemistriesrdquo Journal of Nanoparticle Research vol 16 no 3 pp1ndash7 2014
[33] C W Johnston M A Wyatt X Li et al ldquoGold biomineraliza-tion by a metallophore from a gold-associated microberdquoNatureChemical Biology vol 9 no 4 pp 241ndash243 2013
CP002735_c2 Delftia sp Cs1-4 complete genome (71 of genes show similarity)
CP000884_c3 Delftia acidovorans SPH-1 complete genome (65 of genes show similarity)
(a)
Query sequence
CP000884_c2 Delftia acidovorans SPH-1 complete genome (24 genes show similarity)
CP002735_c3 Delftia spCs1-4 complete genome (24 of genes show similarity)
AGYY01000003_c1 Delftia acidovorans CCUG 15835 acHMM-supercont12C3 whol (21 of genes show similarity)
JOUB01000003_c1 Delftia acidovorans strain 2167 DR66 Contig240 whole geno (24 of genes show similarity)
AGYX01000005_c1 Delftia acidovorans CCUG 274B acHMQ-supercont14C5 whole (24 of genes show similarity)
(b)
Figure 4 Nonribosomal peptide and polyketide synthesis clusters (a) NRPS gene cluster (b) Bacitracin synthesis clusterThe query sequencerefers to the sequence of MTQ3 (httpantismashsecondarymetabolitesorghelphtml)
performed The amplified target fragments of three NRPSswere ligated into the pGEM-T easy vector between sites Spe Iand Xho I which were then religated to the suicide plasmidpJQ200SK using the same restriction endonucleases for cut-ting The resulting suicide plasmids were then linearized byPst I Km fragments were cloned from the plasmid pUC4k byPst I digestion and then ligated into the above linearized sui-cide plasmids Finally the resulting three plasmids pk-1941pk-1945 and pk-1946 were transformed into E coli DH5120572[30] With the help of plasmid pRK2013 triparental mating[31] was used to generate the recombinant strains MTQ3-Δ1941 MTQ3-Δ1945 andMTQ3-Δ1946 (Figure 5)The threemutants were selected by 5 sucrose plus LB plates withkanamycin and rifampicin and further confirmed by PCRusing primers for Km and sequencing
34 Qualitative and Quantitative Analyses of SiderophoresOn the CAS-agar plates we observed an orange halo aroundthe colony of MTQ3 after 2-3 days of incubation but noorange ring around the mutants (Figure 6) The presence ofthe orange ring suggested that MTQ3 can produce sidero-phores to chelate iron in themedium thus resulting in a colorchange of the medium surrounding the colony The mutantslost the ability to produce siderophores
The quantitative measurements of siderophores (Table 4)indicated that the siderophore units of the wild-type strain
MTQ3 were 478 However production levels by MTQ3-Δ1941 MTQ3-Δ1945 and MTQ3-Δ1946 were just less than5 which were regarded as negative results In addition weobserved a color change from blue to orange when mixingthe MTQ3 culture with the CAS assay solution but this phe-nomenon was not observed for MTQ3-Δ1941 MTQ3-Δ1945and MTQ3-Δ1946 This further demonstrated that NRPSmutants MTQ3-Δ1941 MTQ3-Δ1945 and MTQ3-Δ1946failed to produce siderophores
4 Discussion
In this study D tsuruhatensis MTQ3 was examined as aPGPR The phylogenetic analyses showed that MTQ3 hashigh homology with D tsuruhatensis General features anda comparative genomic analysis with Delftia Cs1-4 SPH-1and strain 391 suggested that D tsuruhatensis MTQ3 shows
6 BioMed Research International
Genomic DNA of MTQ3
Target gene (TE)
TEKm
Genomic DNA of MTQ3-Km
pk-194119451946
KmRTE
mob
oriT
sacB
GmR sim7000 bp
Figure 5 Knockout target genes with the Km cassette The target genes orf-1941 orf-1945 and orf-1946 were amplified from the genomicDNA ofMTQ3 after a series of enzyme digestions and ligation to form the recombinant plasmids pK-1941 pK-1945 and pK-1946 Triparentalmating was used to generate homologous recombinant strains
1 2
3 4
Figure 6 Qualitative analysis of siderophores on the CAS-agarplate The bacterial lawn was inoculated on the CAS-agar plate forcultivation at 37∘C for 2-3 days followed by monitoring for a colorring (1) MTQ
3-Δ1941 (2) MTQ3 (3) MTQ
3-Δ1945 and (4) MTQ
3-
Δ1946
some similarities with respect to COG categories but theproportions are somehow different MTQ3 contains a largerproportion of genes involved in carbohydrate transport andmetabolism which indicates its better potential for carbohy-drate utilization For secondary metabolite prediction usinganti-SMASH the gene clusters of NRPS and bacteriocinsynthesis genes are not identical in the Delftia genomes Thedifferent features of the four genomes may be explained byadaptations of strains to their specific environments
As PGPR MTQ3 exhibits the potential to producesiderophores To determine the genes involved in siderophoreproduction three NRPS genes orf-1941 orf-1945 and orf-1946 of MTQ3 were figured out to test the functionThey belong to one gene cluster the genes of which show85 similarity to the nonribosomal peptide metallophoredelftibactin [32 33] Compared with the wild-type strainMTQ3 three obtained mutants lost their ability to producesiderophoresThese results indicated that siderophores couldbe biosynthesized by the NRPS modular multienzymes inMTQ3 Siderophores could improve the absorption of ironby plants therefore promoting growth [4] The ability ofsiderophores produced by bacteria to repress phytopathogenscould be of significant importance in agriculture This mayexplain why D tsuruhatensis MTQ3 could stimulate plantgrowth To the best of our knowledge this is the first studyto verify the gene cluster for siderophore production in Dtsuruhatensis Meanwhile the PGPR of MTQ3 may haveimportant applications in agriculture
Competing Interests
All authors declare that they have no competing interests
Authorsrsquo Contributions
HaimengGuo andYananYangwere equal contributors to thiswork
Acknowledgments
This work was supported by the National Science and Tech-nology Pillar ProgramofChina (2014BAD16B02) the Science
BioMed Research International 7
and Technology Major Projects of Shandong Province(2015ZDXX0502B02) and the National Natural ScienceFoundation of China (31100005)
References
[1] A Beneduzi A Ambrosini and L M P Passaglia ldquoPlantgrowth-promoting rhizobacteria (PGPR) their potential asantagonists and biocontrol agentsrdquo Genetics and MolecularBiology vol 35 no 4 pp 1044ndash1051 2012
[2] G H Zheng J CWang and XHWang ldquoMechanisms of plantgrowth promoting rhizobacteriardquo JIANGXI Science vol 30 no4 pp 454ndash458 2012
[3] M Ahemad and M Kibret ldquoMechanisms and applications ofplant growth promoting rhizobacteria current perspectiverdquoJournal of King Saud UniversitymdashScience vol 26 no 1 pp 1ndash20 2014
[4] M Miethke and M A Marahiel ldquoSiderophore-based ironacquisition and pathogen controlrdquoMicrobiology and MolecularBiology Reviews vol 71 no 3 pp 413ndash451 2007
[5] Y Zhang W Zhang X Chen and F Zhang ldquoThe structurefunction and progress of siderophores produced by bacteriardquoChinese Journal of Health Laboratory Technology vol 22 no 9pp 2249ndash2251 2012
[6] S M Barry and G L Challis ldquoRecent advances in siderophorebiosynthesisrdquo Current Opinion in Chemical Biology vol 13 no2 pp 205ndash215 2009
[7] H Yan X Yang J Chen C Yin C Xiao and H ChenldquoSynergistic removal of aniline by carbon nanotubes and theenzymes ofDelftia sp XYJ6rdquo Journal of Environmental Sciencesvol 23 no 7 pp 1165ndash1170 2011
[8] B J Jimenez P Reboleiro Rivas J G Lopez C Pesciaroli PBarghini andM Fenice ldquoImmobilization ofDelftia tsuruhaten-sis in macro-porous cellulose and biodegradation of phenoliccompounds in repeated batch processrdquo Journal of Biotechnologyvol 157 no 1 pp 148ndash153 2012
[9] H Yoon S Leibeling C Zhang R H Muller C J Werth andJ L Zilles ldquoAdaptation ofDelftia acidovorans for degradation of24-dichlorophenoxyacetate in a microfluidic porous mediumrdquoBiodegradation vol 25 no 4 pp 595ndash604 2014
[10] J Han L Sun X Dong et al ldquoCharacterization of a novel plantgrowth-promoting bacteria strain Delftia tsuruhatensis HR4both as a diazotroph and a potential biocontrol agent againstvarious plant pathogensrdquo Systematic and Applied Microbiologyvol 28 no 1 pp 66ndash76 2005
[11] Q Hou C Wang H Guo et al ldquoDraft genome sequence ofDelftia tsuruhatensisMTQ3 a strain of plant growth-promotingrhizobacteriumwith antimicrobial activityrdquoGenomeAnnounce-ment vol 3 no 4 p e00822-15 2015
[12] J Quandt and M F Hynes ldquoVersatile suicide vectors whichallow direct selection for gene replacement in Gram-negativebacteriardquo Gene vol 127 no 1 pp 15ndash21 1993
[13] J Vieira and J Messing ldquoThe pUC plasmids an M13mp7-derived system for insertion mutagenesis and sequencing withsynthetic universal primersrdquo Gene vol 19 no 3 pp 259ndash2681982
[14] D H Figurski and D R Helinski ldquoReplication of an origin-containing derivative of plasmid RK2 dependent on a plas-mid function provided in transrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 76 no4 pp 1648ndash1652 1979
[15] B O Bachmann and J Ravel ldquoChapter 8 methods for in silicoprediction of microbial polyketide and nonribosomal peptidebiosynthetic pathways from DNA sequence datardquo Methods inEnzymology vol 458 pp 181ndash217 2009
[16] P Shen H Chao C Jiang Z Long C Wang and B WuldquoEnhancing production of l-serine by increasing the glyA geneexpression in Methylobacterium sp MB200rdquo Applied Biochem-istry and Biotechnology vol 160 no 3 pp 740ndash750 2010
[17] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[18] C Camacho G Coulouris V Avagyan et al ldquoBLAST+ archi-tecture and applicationsrdquo BMC Bioinformatics vol 10 article421 2009
[19] DA BensonMCavanaugh K Clark et al ldquoGenBankrdquoNucleicAcids Research vol 41 no 1 pp D36ndashD42 2013
[20] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011
[21] H Kang X Xu K Fu et al ldquoCharacterization and genomicanalysis of quinolone-resistant Delftia sp 670 isolated from apatient who died from severe pneumoniardquo Current Microbiol-ogy vol 71 no 1 pp 54ndash61 2015
[22] K BlinMHMedemaD Kazempour et al ldquoantiSMASH20mdasha versatile platform for genomemining of secondarymetaboliteproducersrdquo Nucleic Acids Research vol 41 pp W204ndashW2122013
[23] J Sambrook andDW RussellMolecular Cloning A LaboratoryManual Cold Spring Harbor Laboratory Press New York NYUSA 3rd edition 2001
[24] AMachuca andAM FMilagres ldquoUse of CAS-agar platemod-ified to study the effect of different variables on the siderophoreproduction by Aspergillusrdquo Letters in Applied Microbiology vol36 no 3 pp 177ndash181 2003
[25] M Manninen and T Mattila-Sandholm ldquoMethods for thedetection of Pseudomonas siderophoresrdquo Journal of Microbio-logical Methods vol 19 no 3 pp 223ndash234 1994
[26] B Schwyn and J B Neilands ldquoUniversal chemical assay forthe detection and determination of siderophoresrdquo AnalyticalBiochemistry vol 160 no 1 pp 47ndash56 1987
[27] A Baakza A K Vala B P Dave and H C Dube ldquoAcomparative study of siderophore production by fungi frommarine and terrestrial habitatsrdquo Journal of Experimental MarineBiology and Ecology vol 311 no 1 pp 1ndash9 2004
[28] J Felsenstein ldquoEvolutionary trees from DNA sequences amaximum likelihood approachrdquo Journal ofMolecular Evolutionvol 17 no 6 pp 368ndash376 1981
[29] A W Eastman D E Heinrichs and Z-C Yuan ldquoCompara-tive and genetic analysis of the four sequenced Paenibacilluspolymyxa genomes reveals a diverse metabolism and con-servation of genes relevant to plant-growth promotion andcompetitivenessrdquo BMC genomics vol 15 article 851 2014
[30] D Lu J Liu and Z Mao ldquoEngineering of Corynebacteriumglutamicum to enhance L-ornithine production by gene knock-out and comparative proteomic analysisrdquo Chinese Journal ofChemical Engineering vol 20 no 4 pp 731ndash739 2012
[31] F Xia L Zhang S Liang et al ldquoStudy on root colonizationof flowering Chinese cabbage by LuxAB gene-marked Pseu-domonas flurosecensrdquo Biotechnology vol 20 no 1 pp 25ndash272010
8 BioMed Research International
[32] M A Wyatt C W Johnston and N A MagarveyldquoGold nanoparticle formation via microbial metallophorechemistriesrdquo Journal of Nanoparticle Research vol 16 no 3 pp1ndash7 2014
[33] C W Johnston M A Wyatt X Li et al ldquoGold biomineraliza-tion by a metallophore from a gold-associated microberdquoNatureChemical Biology vol 9 no 4 pp 241ndash243 2013
Figure 5 Knockout target genes with the Km cassette The target genes orf-1941 orf-1945 and orf-1946 were amplified from the genomicDNA ofMTQ3 after a series of enzyme digestions and ligation to form the recombinant plasmids pK-1941 pK-1945 and pK-1946 Triparentalmating was used to generate homologous recombinant strains
1 2
3 4
Figure 6 Qualitative analysis of siderophores on the CAS-agarplate The bacterial lawn was inoculated on the CAS-agar plate forcultivation at 37∘C for 2-3 days followed by monitoring for a colorring (1) MTQ
3-Δ1941 (2) MTQ3 (3) MTQ
3-Δ1945 and (4) MTQ
3-
Δ1946
some similarities with respect to COG categories but theproportions are somehow different MTQ3 contains a largerproportion of genes involved in carbohydrate transport andmetabolism which indicates its better potential for carbohy-drate utilization For secondary metabolite prediction usinganti-SMASH the gene clusters of NRPS and bacteriocinsynthesis genes are not identical in the Delftia genomes Thedifferent features of the four genomes may be explained byadaptations of strains to their specific environments
As PGPR MTQ3 exhibits the potential to producesiderophores To determine the genes involved in siderophoreproduction three NRPS genes orf-1941 orf-1945 and orf-1946 of MTQ3 were figured out to test the functionThey belong to one gene cluster the genes of which show85 similarity to the nonribosomal peptide metallophoredelftibactin [32 33] Compared with the wild-type strainMTQ3 three obtained mutants lost their ability to producesiderophoresThese results indicated that siderophores couldbe biosynthesized by the NRPS modular multienzymes inMTQ3 Siderophores could improve the absorption of ironby plants therefore promoting growth [4] The ability ofsiderophores produced by bacteria to repress phytopathogenscould be of significant importance in agriculture This mayexplain why D tsuruhatensis MTQ3 could stimulate plantgrowth To the best of our knowledge this is the first studyto verify the gene cluster for siderophore production in Dtsuruhatensis Meanwhile the PGPR of MTQ3 may haveimportant applications in agriculture
Competing Interests
All authors declare that they have no competing interests
Authorsrsquo Contributions
HaimengGuo andYananYangwere equal contributors to thiswork
Acknowledgments
This work was supported by the National Science and Tech-nology Pillar ProgramofChina (2014BAD16B02) the Science
BioMed Research International 7
and Technology Major Projects of Shandong Province(2015ZDXX0502B02) and the National Natural ScienceFoundation of China (31100005)
References
[1] A Beneduzi A Ambrosini and L M P Passaglia ldquoPlantgrowth-promoting rhizobacteria (PGPR) their potential asantagonists and biocontrol agentsrdquo Genetics and MolecularBiology vol 35 no 4 pp 1044ndash1051 2012
[2] G H Zheng J CWang and XHWang ldquoMechanisms of plantgrowth promoting rhizobacteriardquo JIANGXI Science vol 30 no4 pp 454ndash458 2012
[3] M Ahemad and M Kibret ldquoMechanisms and applications ofplant growth promoting rhizobacteria current perspectiverdquoJournal of King Saud UniversitymdashScience vol 26 no 1 pp 1ndash20 2014
[4] M Miethke and M A Marahiel ldquoSiderophore-based ironacquisition and pathogen controlrdquoMicrobiology and MolecularBiology Reviews vol 71 no 3 pp 413ndash451 2007
[5] Y Zhang W Zhang X Chen and F Zhang ldquoThe structurefunction and progress of siderophores produced by bacteriardquoChinese Journal of Health Laboratory Technology vol 22 no 9pp 2249ndash2251 2012
[6] S M Barry and G L Challis ldquoRecent advances in siderophorebiosynthesisrdquo Current Opinion in Chemical Biology vol 13 no2 pp 205ndash215 2009
[7] H Yan X Yang J Chen C Yin C Xiao and H ChenldquoSynergistic removal of aniline by carbon nanotubes and theenzymes ofDelftia sp XYJ6rdquo Journal of Environmental Sciencesvol 23 no 7 pp 1165ndash1170 2011
[8] B J Jimenez P Reboleiro Rivas J G Lopez C Pesciaroli PBarghini andM Fenice ldquoImmobilization ofDelftia tsuruhaten-sis in macro-porous cellulose and biodegradation of phenoliccompounds in repeated batch processrdquo Journal of Biotechnologyvol 157 no 1 pp 148ndash153 2012
[9] H Yoon S Leibeling C Zhang R H Muller C J Werth andJ L Zilles ldquoAdaptation ofDelftia acidovorans for degradation of24-dichlorophenoxyacetate in a microfluidic porous mediumrdquoBiodegradation vol 25 no 4 pp 595ndash604 2014
[10] J Han L Sun X Dong et al ldquoCharacterization of a novel plantgrowth-promoting bacteria strain Delftia tsuruhatensis HR4both as a diazotroph and a potential biocontrol agent againstvarious plant pathogensrdquo Systematic and Applied Microbiologyvol 28 no 1 pp 66ndash76 2005
[11] Q Hou C Wang H Guo et al ldquoDraft genome sequence ofDelftia tsuruhatensisMTQ3 a strain of plant growth-promotingrhizobacteriumwith antimicrobial activityrdquoGenomeAnnounce-ment vol 3 no 4 p e00822-15 2015
[12] J Quandt and M F Hynes ldquoVersatile suicide vectors whichallow direct selection for gene replacement in Gram-negativebacteriardquo Gene vol 127 no 1 pp 15ndash21 1993
[13] J Vieira and J Messing ldquoThe pUC plasmids an M13mp7-derived system for insertion mutagenesis and sequencing withsynthetic universal primersrdquo Gene vol 19 no 3 pp 259ndash2681982
[14] D H Figurski and D R Helinski ldquoReplication of an origin-containing derivative of plasmid RK2 dependent on a plas-mid function provided in transrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 76 no4 pp 1648ndash1652 1979
[15] B O Bachmann and J Ravel ldquoChapter 8 methods for in silicoprediction of microbial polyketide and nonribosomal peptidebiosynthetic pathways from DNA sequence datardquo Methods inEnzymology vol 458 pp 181ndash217 2009
[16] P Shen H Chao C Jiang Z Long C Wang and B WuldquoEnhancing production of l-serine by increasing the glyA geneexpression in Methylobacterium sp MB200rdquo Applied Biochem-istry and Biotechnology vol 160 no 3 pp 740ndash750 2010
[17] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[18] C Camacho G Coulouris V Avagyan et al ldquoBLAST+ archi-tecture and applicationsrdquo BMC Bioinformatics vol 10 article421 2009
[19] DA BensonMCavanaugh K Clark et al ldquoGenBankrdquoNucleicAcids Research vol 41 no 1 pp D36ndashD42 2013
[20] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011
[21] H Kang X Xu K Fu et al ldquoCharacterization and genomicanalysis of quinolone-resistant Delftia sp 670 isolated from apatient who died from severe pneumoniardquo Current Microbiol-ogy vol 71 no 1 pp 54ndash61 2015
[22] K BlinMHMedemaD Kazempour et al ldquoantiSMASH20mdasha versatile platform for genomemining of secondarymetaboliteproducersrdquo Nucleic Acids Research vol 41 pp W204ndashW2122013
[23] J Sambrook andDW RussellMolecular Cloning A LaboratoryManual Cold Spring Harbor Laboratory Press New York NYUSA 3rd edition 2001
[24] AMachuca andAM FMilagres ldquoUse of CAS-agar platemod-ified to study the effect of different variables on the siderophoreproduction by Aspergillusrdquo Letters in Applied Microbiology vol36 no 3 pp 177ndash181 2003
[25] M Manninen and T Mattila-Sandholm ldquoMethods for thedetection of Pseudomonas siderophoresrdquo Journal of Microbio-logical Methods vol 19 no 3 pp 223ndash234 1994
[26] B Schwyn and J B Neilands ldquoUniversal chemical assay forthe detection and determination of siderophoresrdquo AnalyticalBiochemistry vol 160 no 1 pp 47ndash56 1987
[27] A Baakza A K Vala B P Dave and H C Dube ldquoAcomparative study of siderophore production by fungi frommarine and terrestrial habitatsrdquo Journal of Experimental MarineBiology and Ecology vol 311 no 1 pp 1ndash9 2004
[28] J Felsenstein ldquoEvolutionary trees from DNA sequences amaximum likelihood approachrdquo Journal ofMolecular Evolutionvol 17 no 6 pp 368ndash376 1981
[29] A W Eastman D E Heinrichs and Z-C Yuan ldquoCompara-tive and genetic analysis of the four sequenced Paenibacilluspolymyxa genomes reveals a diverse metabolism and con-servation of genes relevant to plant-growth promotion andcompetitivenessrdquo BMC genomics vol 15 article 851 2014
[30] D Lu J Liu and Z Mao ldquoEngineering of Corynebacteriumglutamicum to enhance L-ornithine production by gene knock-out and comparative proteomic analysisrdquo Chinese Journal ofChemical Engineering vol 20 no 4 pp 731ndash739 2012
[31] F Xia L Zhang S Liang et al ldquoStudy on root colonizationof flowering Chinese cabbage by LuxAB gene-marked Pseu-domonas flurosecensrdquo Biotechnology vol 20 no 1 pp 25ndash272010
8 BioMed Research International
[32] M A Wyatt C W Johnston and N A MagarveyldquoGold nanoparticle formation via microbial metallophorechemistriesrdquo Journal of Nanoparticle Research vol 16 no 3 pp1ndash7 2014
[33] C W Johnston M A Wyatt X Li et al ldquoGold biomineraliza-tion by a metallophore from a gold-associated microberdquoNatureChemical Biology vol 9 no 4 pp 241ndash243 2013
and Technology Major Projects of Shandong Province(2015ZDXX0502B02) and the National Natural ScienceFoundation of China (31100005)
References
[1] A Beneduzi A Ambrosini and L M P Passaglia ldquoPlantgrowth-promoting rhizobacteria (PGPR) their potential asantagonists and biocontrol agentsrdquo Genetics and MolecularBiology vol 35 no 4 pp 1044ndash1051 2012
[2] G H Zheng J CWang and XHWang ldquoMechanisms of plantgrowth promoting rhizobacteriardquo JIANGXI Science vol 30 no4 pp 454ndash458 2012
[3] M Ahemad and M Kibret ldquoMechanisms and applications ofplant growth promoting rhizobacteria current perspectiverdquoJournal of King Saud UniversitymdashScience vol 26 no 1 pp 1ndash20 2014
[4] M Miethke and M A Marahiel ldquoSiderophore-based ironacquisition and pathogen controlrdquoMicrobiology and MolecularBiology Reviews vol 71 no 3 pp 413ndash451 2007
[5] Y Zhang W Zhang X Chen and F Zhang ldquoThe structurefunction and progress of siderophores produced by bacteriardquoChinese Journal of Health Laboratory Technology vol 22 no 9pp 2249ndash2251 2012
[6] S M Barry and G L Challis ldquoRecent advances in siderophorebiosynthesisrdquo Current Opinion in Chemical Biology vol 13 no2 pp 205ndash215 2009
[7] H Yan X Yang J Chen C Yin C Xiao and H ChenldquoSynergistic removal of aniline by carbon nanotubes and theenzymes ofDelftia sp XYJ6rdquo Journal of Environmental Sciencesvol 23 no 7 pp 1165ndash1170 2011
[8] B J Jimenez P Reboleiro Rivas J G Lopez C Pesciaroli PBarghini andM Fenice ldquoImmobilization ofDelftia tsuruhaten-sis in macro-porous cellulose and biodegradation of phenoliccompounds in repeated batch processrdquo Journal of Biotechnologyvol 157 no 1 pp 148ndash153 2012
[9] H Yoon S Leibeling C Zhang R H Muller C J Werth andJ L Zilles ldquoAdaptation ofDelftia acidovorans for degradation of24-dichlorophenoxyacetate in a microfluidic porous mediumrdquoBiodegradation vol 25 no 4 pp 595ndash604 2014
[10] J Han L Sun X Dong et al ldquoCharacterization of a novel plantgrowth-promoting bacteria strain Delftia tsuruhatensis HR4both as a diazotroph and a potential biocontrol agent againstvarious plant pathogensrdquo Systematic and Applied Microbiologyvol 28 no 1 pp 66ndash76 2005
[11] Q Hou C Wang H Guo et al ldquoDraft genome sequence ofDelftia tsuruhatensisMTQ3 a strain of plant growth-promotingrhizobacteriumwith antimicrobial activityrdquoGenomeAnnounce-ment vol 3 no 4 p e00822-15 2015
[12] J Quandt and M F Hynes ldquoVersatile suicide vectors whichallow direct selection for gene replacement in Gram-negativebacteriardquo Gene vol 127 no 1 pp 15ndash21 1993
[13] J Vieira and J Messing ldquoThe pUC plasmids an M13mp7-derived system for insertion mutagenesis and sequencing withsynthetic universal primersrdquo Gene vol 19 no 3 pp 259ndash2681982
[14] D H Figurski and D R Helinski ldquoReplication of an origin-containing derivative of plasmid RK2 dependent on a plas-mid function provided in transrdquo Proceedings of the NationalAcademy of Sciences of the United States of America vol 76 no4 pp 1648ndash1652 1979
[15] B O Bachmann and J Ravel ldquoChapter 8 methods for in silicoprediction of microbial polyketide and nonribosomal peptidebiosynthetic pathways from DNA sequence datardquo Methods inEnzymology vol 458 pp 181ndash217 2009
[16] P Shen H Chao C Jiang Z Long C Wang and B WuldquoEnhancing production of l-serine by increasing the glyA geneexpression in Methylobacterium sp MB200rdquo Applied Biochem-istry and Biotechnology vol 160 no 3 pp 740ndash750 2010
[17] S F AltschulW GishWMiller EWMyers and D J LipmanldquoBasic local alignment search toolrdquo Journal ofMolecular Biologyvol 215 no 3 pp 403ndash410 1990
[18] C Camacho G Coulouris V Avagyan et al ldquoBLAST+ archi-tecture and applicationsrdquo BMC Bioinformatics vol 10 article421 2009
[19] DA BensonMCavanaugh K Clark et al ldquoGenBankrdquoNucleicAcids Research vol 41 no 1 pp D36ndashD42 2013
[20] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011
[21] H Kang X Xu K Fu et al ldquoCharacterization and genomicanalysis of quinolone-resistant Delftia sp 670 isolated from apatient who died from severe pneumoniardquo Current Microbiol-ogy vol 71 no 1 pp 54ndash61 2015
[22] K BlinMHMedemaD Kazempour et al ldquoantiSMASH20mdasha versatile platform for genomemining of secondarymetaboliteproducersrdquo Nucleic Acids Research vol 41 pp W204ndashW2122013
[23] J Sambrook andDW RussellMolecular Cloning A LaboratoryManual Cold Spring Harbor Laboratory Press New York NYUSA 3rd edition 2001
[24] AMachuca andAM FMilagres ldquoUse of CAS-agar platemod-ified to study the effect of different variables on the siderophoreproduction by Aspergillusrdquo Letters in Applied Microbiology vol36 no 3 pp 177ndash181 2003
[25] M Manninen and T Mattila-Sandholm ldquoMethods for thedetection of Pseudomonas siderophoresrdquo Journal of Microbio-logical Methods vol 19 no 3 pp 223ndash234 1994
[26] B Schwyn and J B Neilands ldquoUniversal chemical assay forthe detection and determination of siderophoresrdquo AnalyticalBiochemistry vol 160 no 1 pp 47ndash56 1987
[27] A Baakza A K Vala B P Dave and H C Dube ldquoAcomparative study of siderophore production by fungi frommarine and terrestrial habitatsrdquo Journal of Experimental MarineBiology and Ecology vol 311 no 1 pp 1ndash9 2004
[28] J Felsenstein ldquoEvolutionary trees from DNA sequences amaximum likelihood approachrdquo Journal ofMolecular Evolutionvol 17 no 6 pp 368ndash376 1981
[29] A W Eastman D E Heinrichs and Z-C Yuan ldquoCompara-tive and genetic analysis of the four sequenced Paenibacilluspolymyxa genomes reveals a diverse metabolism and con-servation of genes relevant to plant-growth promotion andcompetitivenessrdquo BMC genomics vol 15 article 851 2014
[30] D Lu J Liu and Z Mao ldquoEngineering of Corynebacteriumglutamicum to enhance L-ornithine production by gene knock-out and comparative proteomic analysisrdquo Chinese Journal ofChemical Engineering vol 20 no 4 pp 731ndash739 2012
[31] F Xia L Zhang S Liang et al ldquoStudy on root colonizationof flowering Chinese cabbage by LuxAB gene-marked Pseu-domonas flurosecensrdquo Biotechnology vol 20 no 1 pp 25ndash272010
8 BioMed Research International
[32] M A Wyatt C W Johnston and N A MagarveyldquoGold nanoparticle formation via microbial metallophorechemistriesrdquo Journal of Nanoparticle Research vol 16 no 3 pp1ndash7 2014
[33] C W Johnston M A Wyatt X Li et al ldquoGold biomineraliza-tion by a metallophore from a gold-associated microberdquoNatureChemical Biology vol 9 no 4 pp 241ndash243 2013
[32] M A Wyatt C W Johnston and N A MagarveyldquoGold nanoparticle formation via microbial metallophorechemistriesrdquo Journal of Nanoparticle Research vol 16 no 3 pp1ndash7 2014
[33] C W Johnston M A Wyatt X Li et al ldquoGold biomineraliza-tion by a metallophore from a gold-associated microberdquoNatureChemical Biology vol 9 no 4 pp 241ndash243 2013
![Comparative Functional Genomic Analysis of …Comparative Functional Genomic Analysis ofSolanum Glandular Trichome Types1[W][OA] Eric T. McDowell, Jeremy Kapteyn2,AdamSchmidt2,ChaoLi2,](https://static.documents.pub/doc/80x56/5e96bd08ce4cf53f0c168a28/comparative-functional-genomic-analysis-of-comparative-functional-genomic-analysis.jpg)
