Research ArticleOptimization of the Medium for the Production ofExtracellular Amylase by the Pseudomonas stutzeri ISL B5Isolated from Municipal Solid Waste
Prajesh Dutta Akash Deb and Sukanta Majumdar
Microbiology and Microbial Biotechnology Laboratory Department of Botany University of Gour Banga MaldaWest Bengal 732103 India
Correspondence should be addressed to Sukanta Majumdar smajumdarwbesgmailcom
Received 29 July 2016 Revised 21 November 2016 Accepted 28 November 2016
Academic Editor Todd R Callaway
Copyright copy 2016 Prajesh Dutta et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited
The management of municipal solid waste is one of the major problems of the present world The use of microbial enzymes forsustainable management of the solid waste is the need of the time In the present study we have isolated a potent amylase producingstrain (ISL B5) from municipal solid waste The strain was identified as Pseudomonas stutzeri (P stutzeri) both biochemically andby 16S rDNA sequencing The optimization studies revealed that the strain ISL B5 exhibited maximum activity in the liquid mediacontaining 2 starch (277Uml) 08 peptone (277Uml) and 0001 Ca2+ ion (249Uml) under the pH 75 (259Uml)temperature 40∘C (263Uml) and 25 h of incubation period (249Uml) The highest activity of crude enzyme has also beenoptimized at the pH 8 (249Uml)
1 Introduction
Microorganisms are most important sources of enzyme pro-duction which can be used for various purposes of humansMicrobial enzymes have several advantages which compriselower production costs possibility of large-scale productionin industrial fermenters wide range of physical and chemicalcharacteristics scope of genetic manipulation and rapidculture development [1] The enzymes produced by microor-ganisms are alsomore active and stable than plant and animalcounterparts [2] The above characteristics make microbialenzymes suitable for various industrial applications [3] Inaddition as the microorganisms can be cultured in largequantities in a short time by fermentation they represent analternative source of enzymes Presently microbial enzymesare considered to be increasingly important for sustainabletechnology and green chemistry [2 4]
Amylase is one of the important enzymes used in thefield of biotechnology It performs the hydrolysis of starch toyield glucose [5] In recent years the microbial productionhas made its superiority due to its wide spread use in food
baking and detergent and textile industries [6] There are somany advantages of using microorganisms for their abilityin mass production of amylase and also for their very easymanipulation for desired products [7] 120572 -Amylase has beenderived frommany fungi yeasts bacteria and actinomyceteshowever enzymes from fungal and bacterial sources havebeen considered most suitable for applications in industrialsectors [8] Several microorganisms are able to make amy-lases including Bacillus spp Lactobacillus Pseudomonas spProteus Escherichia and Streptomyces sp [9]
Municipal solid waste management is tremendous prob-lem in front of current world One of the sustainable man-agement of solid wastes is to digest it to produce an endproduct which can be used as a resource Several productsincluding biofertilizers have been reported to be producedfrom municipal solid waste Several reports suggested thatmunicipal solid waste can be transformed into biofertilizerwith multifunctional efficiency Biofertilizer generated frommunicipal solid waste are rich in microorganisms withvarious capabilities as these products are generated frommicrobial action where microbes use various substrates like
Hindawi Publishing CorporationInternational Journal of MicrobiologyVolume 2016 Article ID 4950743 7 pageshttpdxdoiorg10115520164950743
2 International Journal of Microbiology
starch cellulose and proteins Composting is one of themethods of converting organic wastes into biofertilizersreducing the inorganic compound usage that may lead tothe environmental contamination This conversion is theconsequence of the action of microorganism transformingcomplex carbon sources into resultant energy Production ofenzymes by microbes to its environment leads this process[10]
The present study focuses on the search of the starchymaterial transforming capacity of amylolytic bacteria presentin the municipal waste For the fulfilment of this objectiveisolation characterization and identification of amylolyticbacteria and partial characterization of amylase enzyme withregard to the effect of substrate temperature and pH weredone
2 Materials and Methods
21 Sample Collection In this study for the purpose ofisolation of amylase producers soil samples were collectedfrom the municipal solid waste deposition area of Maldatown West Bengal India The soil samples were collected insterilized polyethylene bags and brought in ice pack to thelaboratory
22 Isolation of Amylase Producing Bacteria One gram (1 g)of the soil sample was weighed and added to 9ml of steriledistilled water Serial dilutions were prepared up to the 10minus4dilution and then 01ml of each dilution was added using thespread plate method to nutrient agar that had been fortifiedwith 1 starch The agar plates were incubated at 37∘C for24ndash48 h and then flooded with Lugolrsquos iodine The coloniesproduced halo zones were designated as amylase producerspicked and maintained in NA slants supplemented with 1starch
23 Characterization and Identification Thebacterial isolateswere characterized based on the followingmorphological andbiochemical tests such as Gram staining scanning electronmicroscopy (SEM) using Hitachi Scanning Electron Micro-scopes (model S-530) catalase test production of acid andgas from carbohydrate nitrate reduction protein hydrolysisgelatin liquefaction and Voges-Proskauer (VP) test [11 12]
The strain was identified by both biochemical andmolec-ular approaches Biochemically the stain was identified byusing the BiomerieusVitek 2 system
For molecular identification genomic DNA wasextracted from 24-hour-old culture following the methodof Stafford et al [13] DNA was precipitated from theaqueous phase with chilled ethanol (100) and pelleted bycentrifuging at 12000 rpm for 15min followed by washing in70 ethanol and centrifugation The pellets were air-driedand suspended in TE buffer pH 8
For PCR amplification DNA was amplified by mixingthe template DNA (50 ng) with the polymerase reactionbuffer dNTP mix primers and Taq polymerase Poly-merase chain reaction was performed in a total volumeof 100120583l containing 78120583l deionized water 10 120583l 10x Taqpolymerase buffer 1 120583l of 1U Taq polymerase 6 120583l 2mM
dNTPs 15 120583l of 100mM reverse and forward primers and35 120583l of 50 ng template DNAThe amplification of 16S rRNAgene was carried out by PCR using the forward (704F51015840GTAGCGGTGAAATGCGTAGA 31015840) and reverse (907R51015840CCGTCAATTCMTTTGAGTTTAG 31015840) primer The PCRwas programmed with an initial denaturing at 94∘C for5min followed by 30 cycles of denaturation at 94∘C for30 sec annealing at 61∘C for 30 sec and extension at 70∘Cfor 2min and with a final extension at 72∘C for 7minin a thermocycler (Applied Biosystems 2720) Amplifiedproducts were resolved by electrophoresis in 08 agarosegel and PCR amplicons were purified The purified DNAwas sequenced from Xcelris laboratories Ahmadabad Indiaand the 16S rDNA sequence obtained from PCR productswas subjected to BLAST analyses The DNA sequences weredeposited to NCBI GenBank through BankIt procedure andapproved as the sequence after complete annotation andgiven accession numbers Evolutionary history was inferredby neighbor-joiningmethod [14] Phylogenetic analyses wereconducted in MEGA 40 software [15]
24 Assay of Amylase For assay previously inoculated nutri-ent starch broth was centrifuged at 8000119892 for 12minutes andthe supernatant was used as crude enzyme source The assayof amylase was conducted following the method of Jamiesonet al [16] In brief oneml of diluted enzyme solution wasadded to 1ml of substrate and then incubated for threeminutes at 37∘C twoml of color reagent was added to stopthe enzyme reaction tubes were heated in a boiling waterbath for five minutes to effect the color change and thencooled with running tap water and absorbance was read ina spectrophotometer at 470 nm of spectrophotometer [17]Units of amylase activity were expressed as micromoles ofmaltose liberated per minute
25 Optimization of Amylase Production The effect of dif-ferent parameters on the amylase production by the iso-late was standardized in respect of incubation time tem-perature pH carbon source nitrogen source and metalions
26 Effect of Incubation Period After inoculation the flaskswere incubated at 35∘C for different time periods rangingfrom 5 hours to 30 hours
27 Effect of Temperature Effect of temperature on amylaseproduction was studied in the nutrient starch broth atdifferent temperature (28∘C to 48∘C)
28 Effect of pH The amylase production in relation to in-itial medium pH was studied by inoculating the bacteria innutrient starch broth by adjusting the pH ranging from 50to 80
Effect of pH of reaction mixture on amylase productionwas tested by using buffer (01M) of different pH By usingsodium phosphate (pH 6) potassium phosphate (pH 7) tris-HCl (pH 8) and glycinendashNaOH (pH 10) buffers different pHof the reaction mixture was maintained during the enzymeassay [18 19]
Figure 1 Phylogenetic analysis of 16S rDNA sequences of P Stutzeri ISL B5 (KT748761) with other ex-type strains by neighbor-joiningmethod
29 Effect of Carbon Source The effect of various carbonsources such as starch sucrose glucose and mannitol at theconcentration of 2 was examined for amylase productionThe effect of starch concentration on amylase productionwas determined by supplementing the nutrient broth withdifferent concentration of starch ranging from 02 to 4
210 Effect of Nitrogen Source The effects of nitrogen sourceson amylase production were determined by using differentorganic and inorganic nitrogen sources (06) such as beefextract ammonium chloride peptone and tryptone Theeffect of peptone at varied concentration on amylase produc-tion was checked by supplementing the nutrient starch brothwith different concentration of peptone ranging from 03 to20
211 Effect of Metal Ions Effects of metal ions on amylaseproduction were checked by substituting different metalions ferrous ions zinc manganese and calcium at 0001concentration with the nutrient starch broth [20]
212 Statistical Analysis All the optimization studies wereconducted in triplicate and the data were analyzed usingone-way analysis of variance (ANOVA) All the data aregraphically presented as mean plusmn SD of triplicates (119899 = 3)ANOVA was performed using SPSS software P values lt 005were considered significant with a confidence limit of 95
3 Results
A total of twenty-five strains were isolated with amylaseactivity Among them the isolate ISL B5 showed the highestzone of clearance around the colony when flooded withLugolrsquos iodine solution The isolate ISL B5 was characterizedboth morphologically and biochemically Light microscopicobservation revealed that the isolate was a rod shaped Gramnegative bacteria The morphology of the isolate was alsoconfirmed by scanning electron microscopy
The identity of the isolate was confirmed by bothbiochemical and molecular techniques Biochemically the
strain was identified by using the BiomerieusVitek 2 systemas Pseudomonas stutzeri with 99 probability Molecularanalysis based on 16S rDNA gene homology identified theISL B5 as Pseudomonas stutzeri with 99 similarity with therespective strains in NCBI GenBank database with querycoverage of 95The obtained sequence was aligned with ex-type isolate sequences fromNCBIGenBank for identificationas well as studying phylogenetic relationship with otherex-type sequences (Figure 1) The evolutionary distanceswere computed using the Maximum Composite Likelihoodmethod [21 22] The nucleotide sequences were deposited inNCBIGenBank database under accession number KT748761
The amylase production by P stutzeri ISL B5 was opti-mized in terms of incubation period temperature pH car-bon and nitrogen source and metal irons After inoculationthe flasks were incubated at 30∘C and enzyme activity wasmeasured at different time intervals (Figure 2) The isolateshowed highest production of amylase after 25 hours ofincubation (249Uml) The yield of enzyme decreased after25 hours maybe due to the decrease in growth of the isolate
The effect of temperature on enzyme production wasassessed by maintaining the flasks at different temperatureranging from 28∘C to 48∘C for 25 h (Figure 3)Themaximumenzyme production was detected at 40∘C (263Uml) Theenzyme production was declined below and above 40∘Ctemperature
The media pH was adjusted from 50 to 80 for theassessment of amylase production (Figure 4(a)) After 25 hof incubation it was observed that in pH 75 enzyme wasproduced maximally (259Uml) by ISL B5 strain Effect ofpHof reactionmixture on amylase productionwas also testedby using sodium phosphate (pH 6) potassium phosphate(pH 7) tris-HCl (pH 8) and glycinendashNaOH (pH 10) buffersduring the enzyme assay (Figure 4(b)) [18 19] It was observedthat after 25 hours of incubation the reaction mixturecontaining tris-HCl buffer (pH 8) showedmaximum amylaseproduction (249Uml)
The bacterial isolate ISL B5 was inoculated in nutrientbroth containing starch sucrose glucose and mannitol to
4 International Journal of Microbiology
000
050
100
150
200
250
300
10 15 20 25 30
Enzy
me a
ctiv
ity (U
ml)
Incubation period (h)
Figure 2 Effect of incubation period on amylase production by Pstutzeri ISL B5 Data represent mean plusmn SD (119899 = 3)
28 32 36 40 44 48000
050
100
150
200
250
300
Enzy
me a
ctiv
ity (U
ml)
Temperature (∘C)
Figure 3 Effect of temperature on amylase production by P stutzeriISL B5 Data represent mean plusmn SD (119899 = 3) 119875 lt 005
show the effect of carbon sources in amylase production (Fig-ure 5(a)) The starch showed the highest enzyme productionat 2 concentration (277Uml) (Figure 5(b))
The effect of different nitrogen sources on amylaseproduction was assessed by using beef extract ammoniumchloride peptone and tryptone The maximum enzymeproduction was exhibited in 08 peptone concentration(277Uml) whereas ammonium chloride had the lowestenzyme production ability (Figures 6(a) and 6(b))
Ferrous zinc manganese and calcium ions in very lowconcentration were used to determine the effect of metalions on amylase production (Figure 7) After 25 hours brothcontaining calcium ion showed the highest ability of enzymeproduction (249Uml) whereas ferrous ion had the lowestability of enzyme production
4 Discussion
Twenty-five bacterial strains were isolated from munici-pal dumping waste from these the isolate ISL B5 whichwas identified as Pseudomonas stutzeri showed the highestamylase activity Several reports have suggested that manybacteria isolated from solid waste show amylase activity withsignificant efficiency [23] Among bacterial isolates Bacillussp [24] and Pseudomonas sp [25] are frequent amylaseproducers
P stutzeri ISL B5 showed the highest amylase productionat 25 hours of incubation Above this incubation periodthe amylase enzyme activity started to decrease This maybe due to the decrease in growth of the isolate Most ofthe studies reported the highest enzyme production between35 hours and 48 hours [26 27] on the contrary ISL B5showed optimum production after 25 hours thus provingearly harvesting time for industrial use
The strain of P stutzeri has low starch degrading activitybelow and above 40∘CThis may be due to decreased growthrate and inactivation of genes which are responsible for thestarch degrading enzyme [28]Most of the amylase producingbacterial strain exhibited a pH range between 60 and 75for normal growth and enzyme production [29] The presentbacterial strain revealed maximal enzyme production at pH75 The highest enzyme activity in reaction mixture has beenachieved at pH 8 Samanta et al [30] also reported the highestamylase activity of Cronobacter sakazakii Jor52 at pH 8
The supplement of carbon sources in either monosac-charide or polysaccharide form may induce the amylaseproduction In our present study the influence of starch wasmore than the other carbon sources tested Mannitol wasthe second best supplementary carbon source Glucose hasthe lowest amylase activity It is reported that the differentcarbon sources variedly influence the amylase production[31] Similar findings suggested that glucose represses theamylase production in the case of hyperthermophilic archaeaSulfolobus solfataricus [32] They also reported that glucoseinhibits the expression of amylase gene
Thenitrogen sources are secondary energy sources for theorganisms and those play an important role in the growthand in the production of valuable enzymes of organismsThenature of the compound and the concentration that we usedmight influence or downregulate enzyme production [27] Inthis experiment the effect of nitrogen sources on amylaseproduction showed that peptone was found to be a betternitrogen source for P stutzeri ISL B5
The effects ofmetal ions have been well studied on severalamylases from bacteria and fungi It has been known thatmost of amylases are metal ion-dependent enzymes andthese ions are divalent cations such as Mn2+ Zn2+ Mg2+Ca2+ and Fe2+ [17] Enhancement of amylase activity in thepresence of ions could be based on its ability to interact withnegatively charged amino acid residues such as aspartic andglutamic acid [33] The study showed the highest enzymeactivity in the presence of calcium ion According to Burhanet al [34] in case of Bacillus sp calcium ion increasedthe production of amylase Ramesh and Lonsane [35] alsoreported that different concentrations of calcium affect the
International Journal of Microbiology 5
000
050
100
150
200
250
300En
zym
e act
ivity
(Um
l)
55 6 65 7 755 8Media pH
(a)
6 7 8 10pH of reaction mixture
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
(b)
Figure 4 Effect of pH on amylase production by P stutzeri ISL B5 and on enzyme activity in reactionmixture (a) Amylase production underdifferent media pH (b) Enzyme activity under different pH of reaction mixture Data represent mean plusmn SD (119899 = 3) 119875 lt 005
Starch Sucrose Glucose MannitolCarbon source
000
050
100
150
200
250
300
350
Enzy
me a
ctiv
ity (U
ml)
(a)
02 05 08 1 2 4Starch concentration ()
000
050
100
150
200
250
300
350
Enzy
me a
ctiv
ity (U
ml)
(b)
Figure 5 Effect different carbon sources and different starch concentrations on amylase production by P stutzeri ISL B5 (a) Amylaseproduction under the influence of different carbon sources (b) Amylase production under the influence of different starch concentrations inpercentage Data represent mean plusmn SD (119899 = 3) 119875 lt 005
amylase production and its activity The crystal structure ofamylase showed that calcium ions play a detrimental role inionic interactionwithAsn 100 andHis 201 residues of domainA and also with Asp 159 and Asp 167 residues of domain Bin amylase enzyme It has also been reported that the activesite of amylase is located between domain A and domain Band calcium promotes stability and catalytic activity of theenzyme by interconnecting these two domains [36 37]
In the present study we have isolated and identifiedamylase producing bacteria from the municipal solid wasteOur study showed that the municipal solid wastes can beused as productive sources of beneficial microbes thosecan be successfully used in large scale for management ofmunicipal starchywastematerials present inmunicipal waste
The isolate Pseudomonas stutzeri ISL B5 showed the abilityto tolerate adverse conditions like wide range of pH andtemperature and has significant toxic metal ion tolerancewhich makes it a promising inoculant for enzyme industryas well as in solid waste management
Competing Interests
The authors declare no conflict of interests
Authorsrsquo Contributions
Prajesh Dutta and AkashDeb performed the laboratory worklike isolation identification and optimization and wrote the
6 International Journal of Microbiology
Beef extract Ammoniumsulfate
Peptone Tryptone
Nitrogen source
0
05
1
15
2
25
3En
zym
e act
ivity
(Um
l)
(a)
03 06 08 1 2Peptone concentration ()
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
(b)
Figure 6 Effect different nitrogen sources and different peptone concentrations on amylase production by P stutzeri ISL B5 (a) Amylaseproduction under the influence of different nitrogen sources (b) Amylase production under the influence of different peptone concentrationsin percentage Data represent mean plusmn SD (119899 = 3) 119875 lt 005
Ferrous Zinc Manganese CalciumMetal ions
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
Figure 7 Effect different metal ions on amylase production by Pstutzeri ISL B5 Data represent mean plusmn SD (119899 = 3) 119875 lt 005
manuscript Sukanta Majumdar participated in the statisticalanalysis and supervised the whole work
Acknowledgments
The authors are thankful to the Xcelris laboratories Ahmad-abad India for their help in sequencing of 16S rDNA
References
[1] B Duza and S A Mastan ldquoMicrobial enzymes and theirapplications-a reviewrdquo IndoAmerican Journal of PharmaceuticalResearch vol 3 no 8 pp 6208ndash6219 2013
[2] P Anbu S C B Gopinath A C Cihan and B P ChaulagainldquoMicrobial enzymes and their applications in industries andmedicinerdquo BioMed Research International vol 2013 Article ID204014 2 pages 2013
[3] F Hasan A A Shah and A Hameed ldquoIndustrial applicationsof microbial lipasesrdquo Enzyme and Microbial Technology vol 39no 2 pp 235ndash251 2006
[4] M Kiro ldquoMicrobial 120572-amylases and their industrial applica-tions a reviewrdquo International Journals of Management IT andEngineering vol 2 no 10 pp 583ndash609 2012
[5] A M Omemu I Akpan M O Bankole and O D TeniolaldquoHydrolysis of raw tuber starches by amylase of Aspergillusniger AM07 isolated from the soilrdquo African Journal of Biotech-nology vol 4 no 1 pp 19ndash25 2005
[6] V Verma M S Avasthi A R Gupta M Singh and AKushwaha ldquoAmylase production and purification from bacteriaisolated from a waste potato dumpsite in district FarrukhabadUP state Indiardquo European Journal of Experimental Biology vol1 no 3 pp 107ndash113 2012
[7] B K Lonsane and M V Ramesh ldquoProduction of bacterialthermostable 120572-amylase by solid-state fermentation a potentialtool for achieving economy in enzyme production and starchhydrolysisrdquo Advances in Applied Microbiology vol 35 pp 1ndash561990
[8] H K Manonmani and A A M Kunhi ldquoInterference of thiol-compounds with dextrinizing activity assay of 120572-amylase bystarch-iodine colour reaction modification of the method toeliminate this interferencerdquo World Journal of Microbiology andBiotechnology vol 15 no 4 pp 485ndash487 1999
[9] D Parmar andA Pandya ldquoCharacterization of amylase produc-ing bacterial isolatesrdquo Bulletin of Environment Pharmacologyand Life Sciences vol 1 no 6 pp 42ndash47 2012
[10] R C Pascon R F Bergamo R X Spinelli et al ldquoAmylolyticmicroorganism from Sao Paulo zoo composting isolationidentification and amylase productionrdquo Enzyme Research vol2011 Article ID 679624 8 pages 2011
[11] R Rohban M A Amoozegar and A Ventosa ldquoScreeningand isolation of halophilic bacteria producing extracellularhydrolyses from Howz Soltan Lake Iranrdquo Journal of IndustrialMicrobiology and Biotechnology vol 36 no 3 pp 333ndash3402009
[12] D Gangadharan K Madhavan Nampoothiri S Sivaramakr-ishnan and A Pandey ldquoImmobilized bacterial 120572-amylase for
International Journal of Microbiology 7
effective hydrolysis of raw and soluble starchrdquo Food ResearchInternational vol 42 no 4 pp 436ndash442 2009
[13] W H L Stafford G C Baker S A Brown S G Burton and DA Cowan ldquoBacterial diversity in the rhizosphere of Proteaceaespeciesrdquo Environmental Microbiology vol 7 no 11 pp 1755ndash1768 2005
[14] N Saitou and M Nei ldquoThe neighbor-joining method a newmethod for reconstructing phylogenetic treesrdquo Molecular Biol-ogy and Evolution vol 4 no 4 pp 406ndash425 1987
[15] K Tamura J Dudley M Nei and S Kumar ldquoMEGA4 Molec-ular Evolutionary Genetics Analysis (MEGA) software version40rdquo Molecular Biology and Evolution vol 24 no 8 pp 1596ndash1599 2007
[16] A D Jamieson K M Pruitt and R C Caldwell ldquoAn improvedamylase assayrdquo Journal of Dental Research vol 48 no 3 p 4831969
[17] R Gupta P Gigras H Mohapatra V K Goswami and BChauhan ldquoMicrobial 120572-amylases a biotechnological perspec-tiverdquo Process Biochemistry vol 38 no 11 pp 1599ndash1616 2003
[18] K Kathiresan and S Manivannan ldquo120572-amylase production byPenicillium fellutanum isolated from mangrove rhizospheresoilrdquoAfrican Journal of Biotechnology vol 5 no 10 pp 829ndash8322006
[19] HK ZavedMMRahmanA Rahman SM YArafat andMS Rahman ldquoIsolation and characterization of effective bacteriafor solid waste degradation for organic manurerdquo KMITL ScienceandTechnology Journal vol 2 2008 httpswwwacademiaedu2718658
[20] K R Aneja Experiments in Microbiology Plant Pathology andBiotechnology New Age International New Delhi India 4thedition 2003
[21] J Felsenstein ldquoConfidence limits on phylogenies an approachusing the bootstraprdquo Evolution vol 39 no 4 pp 783ndash791 1985
[22] K Tamura M Nei and S Kumar ldquoProspects for inferringvery large phylogenies by using the neighbor-joining methodrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 101 no 30 pp 11030ndash11035 2004
[23] M A Naidub and P Saranraj ldquoBacterial amylase a reviewrdquoInternational Journal of Pharmaceutical and Biological Archivevol 4 no 2 pp 274ndash287 2013
[24] S B Oyeleke and A A Oduwole ldquoProduction of amylase bybacteria isolated from a cassavawaste dumpsite inMinna NigerState Nigeriardquo African Journal of Microbiology Research vol 3no 4 pp 143ndash146 2009
[25] L Khannous M Jrad M Dammak et al ldquoIsolation of a novelamylase and lipase-producing Pseudomonas luteola strainstudy of amylase production conditionsrdquo Lipids in Health andDisease vol 13 article 9 2014
[26] P Singh P Gupta R Singh and R Sharma ldquoFactors affectingalfa amylase production on submerged fermentation byBacillussprdquo International Journal of Pharmacy and Life Sciences vol 3no 12 pp 2243ndash2246 2012
[27] E V N Raju and G Divakar ldquoProduction of amylase by usingPseudomonas aeruginosa isolated from garden soilrdquo Interna-tional Journal of Advances in Pharmacy Biology and Chemistryvol 2 no 1 pp 50ndash56 2013
[28] S Aiba K Kitai and T Imanaka ldquoCloning and expression ofthermostable 120572-amylase gene from Bacillus stearothermophilusin Bacillus stearothermophilus and Bacillus subtilisrdquoApplied andEnvironmental Microbiology vol 46 no 5 pp 1059ndash1065 1983
[29] G D Haki and S K Rakshit ldquoDevelopments in industriallyimportant thermostable enzymes a reviewrdquo Bioresource Tech-nology vol 89 no 1 pp 17ndash34 2003
[30] A Samanta DMitra S N Roy C Sinha and P Pal ldquoCharacter-ization and optimization of amylase producing bacteria isolatedfrom solid wasterdquo Journal of Environmental Protection vol 04no 06 pp 647ndash652 2013
[31] T Sivakumar V Ramasubramanian T Shankar P Vijayabaskarand K T K Anandapandian ldquoScreening of keratinolytic bacte-ria Bacillus cereus from the feather dumping soil of sivakasirdquoJournal of Basic and Applied Biology vol 5 no 1-2 pp 305ndash3142001
[32] C Haseltine M Rolfsmeier and P Blum ldquoThe glucose effectand regulation of alpha-amylase synthesis in the hyperther-mophilic archaeon Sulfolobus solfataricusrdquo Journal of Bacteri-ology vol 178 no 4 pp 945ndash950 1996
[33] A Linden O Mayans W Meyer-Klaucke G Antranikian andM Wilmanns ldquoDifferential regulation of a hyperthermophilic120572-amylase with a novel (CaZn) two-metal center by zincrdquoTheJournal of Biological Chemistry vol 278 no 11 pp 9875ndash98842003
[34] A Burhan U Nisa C Gokhan C Omer A Ashabil and GOsman ldquoEnzymatic properties of a novel thermostable ther-mophilic alkaline and chelator resistant amylase from analkaliphilic Bacillus sp isolate ANT-6rdquo Process Biochemistryvol 38 no 10 pp 1397ndash1403 2003
[35] M V Ramesh and B K Lonsane ldquoSolid state fermentationfor production of higher titres of thermostable alpha-amylasewith two peaks for pH optima by Bacillus licheniformis M27rdquoBiotechnology Letters vol 11 no 1 pp 49ndash52 1989
[36] R Lifshitz and A Levitzki ldquoIdentity and properties of thechloride effector binding site in hog pancreatic 120572-amylaserdquo Bio-chemistry vol 15 no 9 pp 1987ndash1993 1976
[37] K Saha S Maity S Roy et al ldquoOptimization of amylaseproduction from B amyloliquefaciens(MTCC 1270) using solidstate fermentationrdquo International Journal of Microbiology vol2014 Article ID 764046 7 pages 2014
starch cellulose and proteins Composting is one of themethods of converting organic wastes into biofertilizersreducing the inorganic compound usage that may lead tothe environmental contamination This conversion is theconsequence of the action of microorganism transformingcomplex carbon sources into resultant energy Production ofenzymes by microbes to its environment leads this process[10]
The present study focuses on the search of the starchymaterial transforming capacity of amylolytic bacteria presentin the municipal waste For the fulfilment of this objectiveisolation characterization and identification of amylolyticbacteria and partial characterization of amylase enzyme withregard to the effect of substrate temperature and pH weredone
2 Materials and Methods
21 Sample Collection In this study for the purpose ofisolation of amylase producers soil samples were collectedfrom the municipal solid waste deposition area of Maldatown West Bengal India The soil samples were collected insterilized polyethylene bags and brought in ice pack to thelaboratory
22 Isolation of Amylase Producing Bacteria One gram (1 g)of the soil sample was weighed and added to 9ml of steriledistilled water Serial dilutions were prepared up to the 10minus4dilution and then 01ml of each dilution was added using thespread plate method to nutrient agar that had been fortifiedwith 1 starch The agar plates were incubated at 37∘C for24ndash48 h and then flooded with Lugolrsquos iodine The coloniesproduced halo zones were designated as amylase producerspicked and maintained in NA slants supplemented with 1starch
23 Characterization and Identification Thebacterial isolateswere characterized based on the followingmorphological andbiochemical tests such as Gram staining scanning electronmicroscopy (SEM) using Hitachi Scanning Electron Micro-scopes (model S-530) catalase test production of acid andgas from carbohydrate nitrate reduction protein hydrolysisgelatin liquefaction and Voges-Proskauer (VP) test [11 12]
The strain was identified by both biochemical andmolec-ular approaches Biochemically the stain was identified byusing the BiomerieusVitek 2 system
For molecular identification genomic DNA wasextracted from 24-hour-old culture following the methodof Stafford et al [13] DNA was precipitated from theaqueous phase with chilled ethanol (100) and pelleted bycentrifuging at 12000 rpm for 15min followed by washing in70 ethanol and centrifugation The pellets were air-driedand suspended in TE buffer pH 8
For PCR amplification DNA was amplified by mixingthe template DNA (50 ng) with the polymerase reactionbuffer dNTP mix primers and Taq polymerase Poly-merase chain reaction was performed in a total volumeof 100120583l containing 78120583l deionized water 10 120583l 10x Taqpolymerase buffer 1 120583l of 1U Taq polymerase 6 120583l 2mM
dNTPs 15 120583l of 100mM reverse and forward primers and35 120583l of 50 ng template DNAThe amplification of 16S rRNAgene was carried out by PCR using the forward (704F51015840GTAGCGGTGAAATGCGTAGA 31015840) and reverse (907R51015840CCGTCAATTCMTTTGAGTTTAG 31015840) primer The PCRwas programmed with an initial denaturing at 94∘C for5min followed by 30 cycles of denaturation at 94∘C for30 sec annealing at 61∘C for 30 sec and extension at 70∘Cfor 2min and with a final extension at 72∘C for 7minin a thermocycler (Applied Biosystems 2720) Amplifiedproducts were resolved by electrophoresis in 08 agarosegel and PCR amplicons were purified The purified DNAwas sequenced from Xcelris laboratories Ahmadabad Indiaand the 16S rDNA sequence obtained from PCR productswas subjected to BLAST analyses The DNA sequences weredeposited to NCBI GenBank through BankIt procedure andapproved as the sequence after complete annotation andgiven accession numbers Evolutionary history was inferredby neighbor-joiningmethod [14] Phylogenetic analyses wereconducted in MEGA 40 software [15]
24 Assay of Amylase For assay previously inoculated nutri-ent starch broth was centrifuged at 8000119892 for 12minutes andthe supernatant was used as crude enzyme source The assayof amylase was conducted following the method of Jamiesonet al [16] In brief oneml of diluted enzyme solution wasadded to 1ml of substrate and then incubated for threeminutes at 37∘C twoml of color reagent was added to stopthe enzyme reaction tubes were heated in a boiling waterbath for five minutes to effect the color change and thencooled with running tap water and absorbance was read ina spectrophotometer at 470 nm of spectrophotometer [17]Units of amylase activity were expressed as micromoles ofmaltose liberated per minute
25 Optimization of Amylase Production The effect of dif-ferent parameters on the amylase production by the iso-late was standardized in respect of incubation time tem-perature pH carbon source nitrogen source and metalions
26 Effect of Incubation Period After inoculation the flaskswere incubated at 35∘C for different time periods rangingfrom 5 hours to 30 hours
27 Effect of Temperature Effect of temperature on amylaseproduction was studied in the nutrient starch broth atdifferent temperature (28∘C to 48∘C)
28 Effect of pH The amylase production in relation to in-itial medium pH was studied by inoculating the bacteria innutrient starch broth by adjusting the pH ranging from 50to 80
Effect of pH of reaction mixture on amylase productionwas tested by using buffer (01M) of different pH By usingsodium phosphate (pH 6) potassium phosphate (pH 7) tris-HCl (pH 8) and glycinendashNaOH (pH 10) buffers different pHof the reaction mixture was maintained during the enzymeassay [18 19]
Figure 1 Phylogenetic analysis of 16S rDNA sequences of P Stutzeri ISL B5 (KT748761) with other ex-type strains by neighbor-joiningmethod
29 Effect of Carbon Source The effect of various carbonsources such as starch sucrose glucose and mannitol at theconcentration of 2 was examined for amylase productionThe effect of starch concentration on amylase productionwas determined by supplementing the nutrient broth withdifferent concentration of starch ranging from 02 to 4
210 Effect of Nitrogen Source The effects of nitrogen sourceson amylase production were determined by using differentorganic and inorganic nitrogen sources (06) such as beefextract ammonium chloride peptone and tryptone Theeffect of peptone at varied concentration on amylase produc-tion was checked by supplementing the nutrient starch brothwith different concentration of peptone ranging from 03 to20
211 Effect of Metal Ions Effects of metal ions on amylaseproduction were checked by substituting different metalions ferrous ions zinc manganese and calcium at 0001concentration with the nutrient starch broth [20]
212 Statistical Analysis All the optimization studies wereconducted in triplicate and the data were analyzed usingone-way analysis of variance (ANOVA) All the data aregraphically presented as mean plusmn SD of triplicates (119899 = 3)ANOVA was performed using SPSS software P values lt 005were considered significant with a confidence limit of 95
3 Results
A total of twenty-five strains were isolated with amylaseactivity Among them the isolate ISL B5 showed the highestzone of clearance around the colony when flooded withLugolrsquos iodine solution The isolate ISL B5 was characterizedboth morphologically and biochemically Light microscopicobservation revealed that the isolate was a rod shaped Gramnegative bacteria The morphology of the isolate was alsoconfirmed by scanning electron microscopy
The identity of the isolate was confirmed by bothbiochemical and molecular techniques Biochemically the
strain was identified by using the BiomerieusVitek 2 systemas Pseudomonas stutzeri with 99 probability Molecularanalysis based on 16S rDNA gene homology identified theISL B5 as Pseudomonas stutzeri with 99 similarity with therespective strains in NCBI GenBank database with querycoverage of 95The obtained sequence was aligned with ex-type isolate sequences fromNCBIGenBank for identificationas well as studying phylogenetic relationship with otherex-type sequences (Figure 1) The evolutionary distanceswere computed using the Maximum Composite Likelihoodmethod [21 22] The nucleotide sequences were deposited inNCBIGenBank database under accession number KT748761
The amylase production by P stutzeri ISL B5 was opti-mized in terms of incubation period temperature pH car-bon and nitrogen source and metal irons After inoculationthe flasks were incubated at 30∘C and enzyme activity wasmeasured at different time intervals (Figure 2) The isolateshowed highest production of amylase after 25 hours ofincubation (249Uml) The yield of enzyme decreased after25 hours maybe due to the decrease in growth of the isolate
The effect of temperature on enzyme production wasassessed by maintaining the flasks at different temperatureranging from 28∘C to 48∘C for 25 h (Figure 3)Themaximumenzyme production was detected at 40∘C (263Uml) Theenzyme production was declined below and above 40∘Ctemperature
The media pH was adjusted from 50 to 80 for theassessment of amylase production (Figure 4(a)) After 25 hof incubation it was observed that in pH 75 enzyme wasproduced maximally (259Uml) by ISL B5 strain Effect ofpHof reactionmixture on amylase productionwas also testedby using sodium phosphate (pH 6) potassium phosphate(pH 7) tris-HCl (pH 8) and glycinendashNaOH (pH 10) buffersduring the enzyme assay (Figure 4(b)) [18 19] It was observedthat after 25 hours of incubation the reaction mixturecontaining tris-HCl buffer (pH 8) showedmaximum amylaseproduction (249Uml)
The bacterial isolate ISL B5 was inoculated in nutrientbroth containing starch sucrose glucose and mannitol to
4 International Journal of Microbiology
000
050
100
150
200
250
300
10 15 20 25 30
Enzy
me a
ctiv
ity (U
ml)
Incubation period (h)
Figure 2 Effect of incubation period on amylase production by Pstutzeri ISL B5 Data represent mean plusmn SD (119899 = 3)
28 32 36 40 44 48000
050
100
150
200
250
300
Enzy
me a
ctiv
ity (U
ml)
Temperature (∘C)
Figure 3 Effect of temperature on amylase production by P stutzeriISL B5 Data represent mean plusmn SD (119899 = 3) 119875 lt 005
show the effect of carbon sources in amylase production (Fig-ure 5(a)) The starch showed the highest enzyme productionat 2 concentration (277Uml) (Figure 5(b))
The effect of different nitrogen sources on amylaseproduction was assessed by using beef extract ammoniumchloride peptone and tryptone The maximum enzymeproduction was exhibited in 08 peptone concentration(277Uml) whereas ammonium chloride had the lowestenzyme production ability (Figures 6(a) and 6(b))
Ferrous zinc manganese and calcium ions in very lowconcentration were used to determine the effect of metalions on amylase production (Figure 7) After 25 hours brothcontaining calcium ion showed the highest ability of enzymeproduction (249Uml) whereas ferrous ion had the lowestability of enzyme production
4 Discussion
Twenty-five bacterial strains were isolated from munici-pal dumping waste from these the isolate ISL B5 whichwas identified as Pseudomonas stutzeri showed the highestamylase activity Several reports have suggested that manybacteria isolated from solid waste show amylase activity withsignificant efficiency [23] Among bacterial isolates Bacillussp [24] and Pseudomonas sp [25] are frequent amylaseproducers
P stutzeri ISL B5 showed the highest amylase productionat 25 hours of incubation Above this incubation periodthe amylase enzyme activity started to decrease This maybe due to the decrease in growth of the isolate Most ofthe studies reported the highest enzyme production between35 hours and 48 hours [26 27] on the contrary ISL B5showed optimum production after 25 hours thus provingearly harvesting time for industrial use
The strain of P stutzeri has low starch degrading activitybelow and above 40∘CThis may be due to decreased growthrate and inactivation of genes which are responsible for thestarch degrading enzyme [28]Most of the amylase producingbacterial strain exhibited a pH range between 60 and 75for normal growth and enzyme production [29] The presentbacterial strain revealed maximal enzyme production at pH75 The highest enzyme activity in reaction mixture has beenachieved at pH 8 Samanta et al [30] also reported the highestamylase activity of Cronobacter sakazakii Jor52 at pH 8
The supplement of carbon sources in either monosac-charide or polysaccharide form may induce the amylaseproduction In our present study the influence of starch wasmore than the other carbon sources tested Mannitol wasthe second best supplementary carbon source Glucose hasthe lowest amylase activity It is reported that the differentcarbon sources variedly influence the amylase production[31] Similar findings suggested that glucose represses theamylase production in the case of hyperthermophilic archaeaSulfolobus solfataricus [32] They also reported that glucoseinhibits the expression of amylase gene
Thenitrogen sources are secondary energy sources for theorganisms and those play an important role in the growthand in the production of valuable enzymes of organismsThenature of the compound and the concentration that we usedmight influence or downregulate enzyme production [27] Inthis experiment the effect of nitrogen sources on amylaseproduction showed that peptone was found to be a betternitrogen source for P stutzeri ISL B5
The effects ofmetal ions have been well studied on severalamylases from bacteria and fungi It has been known thatmost of amylases are metal ion-dependent enzymes andthese ions are divalent cations such as Mn2+ Zn2+ Mg2+Ca2+ and Fe2+ [17] Enhancement of amylase activity in thepresence of ions could be based on its ability to interact withnegatively charged amino acid residues such as aspartic andglutamic acid [33] The study showed the highest enzymeactivity in the presence of calcium ion According to Burhanet al [34] in case of Bacillus sp calcium ion increasedthe production of amylase Ramesh and Lonsane [35] alsoreported that different concentrations of calcium affect the
International Journal of Microbiology 5
000
050
100
150
200
250
300En
zym
e act
ivity
(Um
l)
55 6 65 7 755 8Media pH
(a)
6 7 8 10pH of reaction mixture
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
(b)
Figure 4 Effect of pH on amylase production by P stutzeri ISL B5 and on enzyme activity in reactionmixture (a) Amylase production underdifferent media pH (b) Enzyme activity under different pH of reaction mixture Data represent mean plusmn SD (119899 = 3) 119875 lt 005
Starch Sucrose Glucose MannitolCarbon source
000
050
100
150
200
250
300
350
Enzy
me a
ctiv
ity (U
ml)
(a)
02 05 08 1 2 4Starch concentration ()
000
050
100
150
200
250
300
350
Enzy
me a
ctiv
ity (U
ml)
(b)
Figure 5 Effect different carbon sources and different starch concentrations on amylase production by P stutzeri ISL B5 (a) Amylaseproduction under the influence of different carbon sources (b) Amylase production under the influence of different starch concentrations inpercentage Data represent mean plusmn SD (119899 = 3) 119875 lt 005
amylase production and its activity The crystal structure ofamylase showed that calcium ions play a detrimental role inionic interactionwithAsn 100 andHis 201 residues of domainA and also with Asp 159 and Asp 167 residues of domain Bin amylase enzyme It has also been reported that the activesite of amylase is located between domain A and domain Band calcium promotes stability and catalytic activity of theenzyme by interconnecting these two domains [36 37]
In the present study we have isolated and identifiedamylase producing bacteria from the municipal solid wasteOur study showed that the municipal solid wastes can beused as productive sources of beneficial microbes thosecan be successfully used in large scale for management ofmunicipal starchywastematerials present inmunicipal waste
The isolate Pseudomonas stutzeri ISL B5 showed the abilityto tolerate adverse conditions like wide range of pH andtemperature and has significant toxic metal ion tolerancewhich makes it a promising inoculant for enzyme industryas well as in solid waste management
Competing Interests
The authors declare no conflict of interests
Authorsrsquo Contributions
Prajesh Dutta and AkashDeb performed the laboratory worklike isolation identification and optimization and wrote the
6 International Journal of Microbiology
Beef extract Ammoniumsulfate
Peptone Tryptone
Nitrogen source
0
05
1
15
2
25
3En
zym
e act
ivity
(Um
l)
(a)
03 06 08 1 2Peptone concentration ()
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
(b)
Figure 6 Effect different nitrogen sources and different peptone concentrations on amylase production by P stutzeri ISL B5 (a) Amylaseproduction under the influence of different nitrogen sources (b) Amylase production under the influence of different peptone concentrationsin percentage Data represent mean plusmn SD (119899 = 3) 119875 lt 005
Ferrous Zinc Manganese CalciumMetal ions
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
Figure 7 Effect different metal ions on amylase production by Pstutzeri ISL B5 Data represent mean plusmn SD (119899 = 3) 119875 lt 005
manuscript Sukanta Majumdar participated in the statisticalanalysis and supervised the whole work
Acknowledgments
The authors are thankful to the Xcelris laboratories Ahmad-abad India for their help in sequencing of 16S rDNA
References
[1] B Duza and S A Mastan ldquoMicrobial enzymes and theirapplications-a reviewrdquo IndoAmerican Journal of PharmaceuticalResearch vol 3 no 8 pp 6208ndash6219 2013
[2] P Anbu S C B Gopinath A C Cihan and B P ChaulagainldquoMicrobial enzymes and their applications in industries andmedicinerdquo BioMed Research International vol 2013 Article ID204014 2 pages 2013
[3] F Hasan A A Shah and A Hameed ldquoIndustrial applicationsof microbial lipasesrdquo Enzyme and Microbial Technology vol 39no 2 pp 235ndash251 2006
[4] M Kiro ldquoMicrobial 120572-amylases and their industrial applica-tions a reviewrdquo International Journals of Management IT andEngineering vol 2 no 10 pp 583ndash609 2012
[5] A M Omemu I Akpan M O Bankole and O D TeniolaldquoHydrolysis of raw tuber starches by amylase of Aspergillusniger AM07 isolated from the soilrdquo African Journal of Biotech-nology vol 4 no 1 pp 19ndash25 2005
[6] V Verma M S Avasthi A R Gupta M Singh and AKushwaha ldquoAmylase production and purification from bacteriaisolated from a waste potato dumpsite in district FarrukhabadUP state Indiardquo European Journal of Experimental Biology vol1 no 3 pp 107ndash113 2012
[7] B K Lonsane and M V Ramesh ldquoProduction of bacterialthermostable 120572-amylase by solid-state fermentation a potentialtool for achieving economy in enzyme production and starchhydrolysisrdquo Advances in Applied Microbiology vol 35 pp 1ndash561990
[8] H K Manonmani and A A M Kunhi ldquoInterference of thiol-compounds with dextrinizing activity assay of 120572-amylase bystarch-iodine colour reaction modification of the method toeliminate this interferencerdquo World Journal of Microbiology andBiotechnology vol 15 no 4 pp 485ndash487 1999
[9] D Parmar andA Pandya ldquoCharacterization of amylase produc-ing bacterial isolatesrdquo Bulletin of Environment Pharmacologyand Life Sciences vol 1 no 6 pp 42ndash47 2012
[10] R C Pascon R F Bergamo R X Spinelli et al ldquoAmylolyticmicroorganism from Sao Paulo zoo composting isolationidentification and amylase productionrdquo Enzyme Research vol2011 Article ID 679624 8 pages 2011
[11] R Rohban M A Amoozegar and A Ventosa ldquoScreeningand isolation of halophilic bacteria producing extracellularhydrolyses from Howz Soltan Lake Iranrdquo Journal of IndustrialMicrobiology and Biotechnology vol 36 no 3 pp 333ndash3402009
[12] D Gangadharan K Madhavan Nampoothiri S Sivaramakr-ishnan and A Pandey ldquoImmobilized bacterial 120572-amylase for
International Journal of Microbiology 7
effective hydrolysis of raw and soluble starchrdquo Food ResearchInternational vol 42 no 4 pp 436ndash442 2009
[13] W H L Stafford G C Baker S A Brown S G Burton and DA Cowan ldquoBacterial diversity in the rhizosphere of Proteaceaespeciesrdquo Environmental Microbiology vol 7 no 11 pp 1755ndash1768 2005
[14] N Saitou and M Nei ldquoThe neighbor-joining method a newmethod for reconstructing phylogenetic treesrdquo Molecular Biol-ogy and Evolution vol 4 no 4 pp 406ndash425 1987
[15] K Tamura J Dudley M Nei and S Kumar ldquoMEGA4 Molec-ular Evolutionary Genetics Analysis (MEGA) software version40rdquo Molecular Biology and Evolution vol 24 no 8 pp 1596ndash1599 2007
[16] A D Jamieson K M Pruitt and R C Caldwell ldquoAn improvedamylase assayrdquo Journal of Dental Research vol 48 no 3 p 4831969
[17] R Gupta P Gigras H Mohapatra V K Goswami and BChauhan ldquoMicrobial 120572-amylases a biotechnological perspec-tiverdquo Process Biochemistry vol 38 no 11 pp 1599ndash1616 2003
[18] K Kathiresan and S Manivannan ldquo120572-amylase production byPenicillium fellutanum isolated from mangrove rhizospheresoilrdquoAfrican Journal of Biotechnology vol 5 no 10 pp 829ndash8322006
[19] HK ZavedMMRahmanA Rahman SM YArafat andMS Rahman ldquoIsolation and characterization of effective bacteriafor solid waste degradation for organic manurerdquo KMITL ScienceandTechnology Journal vol 2 2008 httpswwwacademiaedu2718658
[20] K R Aneja Experiments in Microbiology Plant Pathology andBiotechnology New Age International New Delhi India 4thedition 2003
[21] J Felsenstein ldquoConfidence limits on phylogenies an approachusing the bootstraprdquo Evolution vol 39 no 4 pp 783ndash791 1985
[22] K Tamura M Nei and S Kumar ldquoProspects for inferringvery large phylogenies by using the neighbor-joining methodrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 101 no 30 pp 11030ndash11035 2004
[23] M A Naidub and P Saranraj ldquoBacterial amylase a reviewrdquoInternational Journal of Pharmaceutical and Biological Archivevol 4 no 2 pp 274ndash287 2013
[24] S B Oyeleke and A A Oduwole ldquoProduction of amylase bybacteria isolated from a cassavawaste dumpsite inMinna NigerState Nigeriardquo African Journal of Microbiology Research vol 3no 4 pp 143ndash146 2009
[25] L Khannous M Jrad M Dammak et al ldquoIsolation of a novelamylase and lipase-producing Pseudomonas luteola strainstudy of amylase production conditionsrdquo Lipids in Health andDisease vol 13 article 9 2014
[26] P Singh P Gupta R Singh and R Sharma ldquoFactors affectingalfa amylase production on submerged fermentation byBacillussprdquo International Journal of Pharmacy and Life Sciences vol 3no 12 pp 2243ndash2246 2012
[27] E V N Raju and G Divakar ldquoProduction of amylase by usingPseudomonas aeruginosa isolated from garden soilrdquo Interna-tional Journal of Advances in Pharmacy Biology and Chemistryvol 2 no 1 pp 50ndash56 2013
[28] S Aiba K Kitai and T Imanaka ldquoCloning and expression ofthermostable 120572-amylase gene from Bacillus stearothermophilusin Bacillus stearothermophilus and Bacillus subtilisrdquoApplied andEnvironmental Microbiology vol 46 no 5 pp 1059ndash1065 1983
[29] G D Haki and S K Rakshit ldquoDevelopments in industriallyimportant thermostable enzymes a reviewrdquo Bioresource Tech-nology vol 89 no 1 pp 17ndash34 2003
[30] A Samanta DMitra S N Roy C Sinha and P Pal ldquoCharacter-ization and optimization of amylase producing bacteria isolatedfrom solid wasterdquo Journal of Environmental Protection vol 04no 06 pp 647ndash652 2013
[31] T Sivakumar V Ramasubramanian T Shankar P Vijayabaskarand K T K Anandapandian ldquoScreening of keratinolytic bacte-ria Bacillus cereus from the feather dumping soil of sivakasirdquoJournal of Basic and Applied Biology vol 5 no 1-2 pp 305ndash3142001
[32] C Haseltine M Rolfsmeier and P Blum ldquoThe glucose effectand regulation of alpha-amylase synthesis in the hyperther-mophilic archaeon Sulfolobus solfataricusrdquo Journal of Bacteri-ology vol 178 no 4 pp 945ndash950 1996
[33] A Linden O Mayans W Meyer-Klaucke G Antranikian andM Wilmanns ldquoDifferential regulation of a hyperthermophilic120572-amylase with a novel (CaZn) two-metal center by zincrdquoTheJournal of Biological Chemistry vol 278 no 11 pp 9875ndash98842003
[34] A Burhan U Nisa C Gokhan C Omer A Ashabil and GOsman ldquoEnzymatic properties of a novel thermostable ther-mophilic alkaline and chelator resistant amylase from analkaliphilic Bacillus sp isolate ANT-6rdquo Process Biochemistryvol 38 no 10 pp 1397ndash1403 2003
[35] M V Ramesh and B K Lonsane ldquoSolid state fermentationfor production of higher titres of thermostable alpha-amylasewith two peaks for pH optima by Bacillus licheniformis M27rdquoBiotechnology Letters vol 11 no 1 pp 49ndash52 1989
[36] R Lifshitz and A Levitzki ldquoIdentity and properties of thechloride effector binding site in hog pancreatic 120572-amylaserdquo Bio-chemistry vol 15 no 9 pp 1987ndash1993 1976
[37] K Saha S Maity S Roy et al ldquoOptimization of amylaseproduction from B amyloliquefaciens(MTCC 1270) using solidstate fermentationrdquo International Journal of Microbiology vol2014 Article ID 764046 7 pages 2014
Figure 1 Phylogenetic analysis of 16S rDNA sequences of P Stutzeri ISL B5 (KT748761) with other ex-type strains by neighbor-joiningmethod
29 Effect of Carbon Source The effect of various carbonsources such as starch sucrose glucose and mannitol at theconcentration of 2 was examined for amylase productionThe effect of starch concentration on amylase productionwas determined by supplementing the nutrient broth withdifferent concentration of starch ranging from 02 to 4
210 Effect of Nitrogen Source The effects of nitrogen sourceson amylase production were determined by using differentorganic and inorganic nitrogen sources (06) such as beefextract ammonium chloride peptone and tryptone Theeffect of peptone at varied concentration on amylase produc-tion was checked by supplementing the nutrient starch brothwith different concentration of peptone ranging from 03 to20
211 Effect of Metal Ions Effects of metal ions on amylaseproduction were checked by substituting different metalions ferrous ions zinc manganese and calcium at 0001concentration with the nutrient starch broth [20]
212 Statistical Analysis All the optimization studies wereconducted in triplicate and the data were analyzed usingone-way analysis of variance (ANOVA) All the data aregraphically presented as mean plusmn SD of triplicates (119899 = 3)ANOVA was performed using SPSS software P values lt 005were considered significant with a confidence limit of 95
3 Results
A total of twenty-five strains were isolated with amylaseactivity Among them the isolate ISL B5 showed the highestzone of clearance around the colony when flooded withLugolrsquos iodine solution The isolate ISL B5 was characterizedboth morphologically and biochemically Light microscopicobservation revealed that the isolate was a rod shaped Gramnegative bacteria The morphology of the isolate was alsoconfirmed by scanning electron microscopy
The identity of the isolate was confirmed by bothbiochemical and molecular techniques Biochemically the
strain was identified by using the BiomerieusVitek 2 systemas Pseudomonas stutzeri with 99 probability Molecularanalysis based on 16S rDNA gene homology identified theISL B5 as Pseudomonas stutzeri with 99 similarity with therespective strains in NCBI GenBank database with querycoverage of 95The obtained sequence was aligned with ex-type isolate sequences fromNCBIGenBank for identificationas well as studying phylogenetic relationship with otherex-type sequences (Figure 1) The evolutionary distanceswere computed using the Maximum Composite Likelihoodmethod [21 22] The nucleotide sequences were deposited inNCBIGenBank database under accession number KT748761
The amylase production by P stutzeri ISL B5 was opti-mized in terms of incubation period temperature pH car-bon and nitrogen source and metal irons After inoculationthe flasks were incubated at 30∘C and enzyme activity wasmeasured at different time intervals (Figure 2) The isolateshowed highest production of amylase after 25 hours ofincubation (249Uml) The yield of enzyme decreased after25 hours maybe due to the decrease in growth of the isolate
The effect of temperature on enzyme production wasassessed by maintaining the flasks at different temperatureranging from 28∘C to 48∘C for 25 h (Figure 3)Themaximumenzyme production was detected at 40∘C (263Uml) Theenzyme production was declined below and above 40∘Ctemperature
The media pH was adjusted from 50 to 80 for theassessment of amylase production (Figure 4(a)) After 25 hof incubation it was observed that in pH 75 enzyme wasproduced maximally (259Uml) by ISL B5 strain Effect ofpHof reactionmixture on amylase productionwas also testedby using sodium phosphate (pH 6) potassium phosphate(pH 7) tris-HCl (pH 8) and glycinendashNaOH (pH 10) buffersduring the enzyme assay (Figure 4(b)) [18 19] It was observedthat after 25 hours of incubation the reaction mixturecontaining tris-HCl buffer (pH 8) showedmaximum amylaseproduction (249Uml)
The bacterial isolate ISL B5 was inoculated in nutrientbroth containing starch sucrose glucose and mannitol to
4 International Journal of Microbiology
000
050
100
150
200
250
300
10 15 20 25 30
Enzy
me a
ctiv
ity (U
ml)
Incubation period (h)
Figure 2 Effect of incubation period on amylase production by Pstutzeri ISL B5 Data represent mean plusmn SD (119899 = 3)
28 32 36 40 44 48000
050
100
150
200
250
300
Enzy
me a
ctiv
ity (U
ml)
Temperature (∘C)
Figure 3 Effect of temperature on amylase production by P stutzeriISL B5 Data represent mean plusmn SD (119899 = 3) 119875 lt 005
show the effect of carbon sources in amylase production (Fig-ure 5(a)) The starch showed the highest enzyme productionat 2 concentration (277Uml) (Figure 5(b))
The effect of different nitrogen sources on amylaseproduction was assessed by using beef extract ammoniumchloride peptone and tryptone The maximum enzymeproduction was exhibited in 08 peptone concentration(277Uml) whereas ammonium chloride had the lowestenzyme production ability (Figures 6(a) and 6(b))
Ferrous zinc manganese and calcium ions in very lowconcentration were used to determine the effect of metalions on amylase production (Figure 7) After 25 hours brothcontaining calcium ion showed the highest ability of enzymeproduction (249Uml) whereas ferrous ion had the lowestability of enzyme production
4 Discussion
Twenty-five bacterial strains were isolated from munici-pal dumping waste from these the isolate ISL B5 whichwas identified as Pseudomonas stutzeri showed the highestamylase activity Several reports have suggested that manybacteria isolated from solid waste show amylase activity withsignificant efficiency [23] Among bacterial isolates Bacillussp [24] and Pseudomonas sp [25] are frequent amylaseproducers
P stutzeri ISL B5 showed the highest amylase productionat 25 hours of incubation Above this incubation periodthe amylase enzyme activity started to decrease This maybe due to the decrease in growth of the isolate Most ofthe studies reported the highest enzyme production between35 hours and 48 hours [26 27] on the contrary ISL B5showed optimum production after 25 hours thus provingearly harvesting time for industrial use
The strain of P stutzeri has low starch degrading activitybelow and above 40∘CThis may be due to decreased growthrate and inactivation of genes which are responsible for thestarch degrading enzyme [28]Most of the amylase producingbacterial strain exhibited a pH range between 60 and 75for normal growth and enzyme production [29] The presentbacterial strain revealed maximal enzyme production at pH75 The highest enzyme activity in reaction mixture has beenachieved at pH 8 Samanta et al [30] also reported the highestamylase activity of Cronobacter sakazakii Jor52 at pH 8
The supplement of carbon sources in either monosac-charide or polysaccharide form may induce the amylaseproduction In our present study the influence of starch wasmore than the other carbon sources tested Mannitol wasthe second best supplementary carbon source Glucose hasthe lowest amylase activity It is reported that the differentcarbon sources variedly influence the amylase production[31] Similar findings suggested that glucose represses theamylase production in the case of hyperthermophilic archaeaSulfolobus solfataricus [32] They also reported that glucoseinhibits the expression of amylase gene
Thenitrogen sources are secondary energy sources for theorganisms and those play an important role in the growthand in the production of valuable enzymes of organismsThenature of the compound and the concentration that we usedmight influence or downregulate enzyme production [27] Inthis experiment the effect of nitrogen sources on amylaseproduction showed that peptone was found to be a betternitrogen source for P stutzeri ISL B5
The effects ofmetal ions have been well studied on severalamylases from bacteria and fungi It has been known thatmost of amylases are metal ion-dependent enzymes andthese ions are divalent cations such as Mn2+ Zn2+ Mg2+Ca2+ and Fe2+ [17] Enhancement of amylase activity in thepresence of ions could be based on its ability to interact withnegatively charged amino acid residues such as aspartic andglutamic acid [33] The study showed the highest enzymeactivity in the presence of calcium ion According to Burhanet al [34] in case of Bacillus sp calcium ion increasedthe production of amylase Ramesh and Lonsane [35] alsoreported that different concentrations of calcium affect the
International Journal of Microbiology 5
000
050
100
150
200
250
300En
zym
e act
ivity
(Um
l)
55 6 65 7 755 8Media pH
(a)
6 7 8 10pH of reaction mixture
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
(b)
Figure 4 Effect of pH on amylase production by P stutzeri ISL B5 and on enzyme activity in reactionmixture (a) Amylase production underdifferent media pH (b) Enzyme activity under different pH of reaction mixture Data represent mean plusmn SD (119899 = 3) 119875 lt 005
Starch Sucrose Glucose MannitolCarbon source
000
050
100
150
200
250
300
350
Enzy
me a
ctiv
ity (U
ml)
(a)
02 05 08 1 2 4Starch concentration ()
000
050
100
150
200
250
300
350
Enzy
me a
ctiv
ity (U
ml)
(b)
Figure 5 Effect different carbon sources and different starch concentrations on amylase production by P stutzeri ISL B5 (a) Amylaseproduction under the influence of different carbon sources (b) Amylase production under the influence of different starch concentrations inpercentage Data represent mean plusmn SD (119899 = 3) 119875 lt 005
amylase production and its activity The crystal structure ofamylase showed that calcium ions play a detrimental role inionic interactionwithAsn 100 andHis 201 residues of domainA and also with Asp 159 and Asp 167 residues of domain Bin amylase enzyme It has also been reported that the activesite of amylase is located between domain A and domain Band calcium promotes stability and catalytic activity of theenzyme by interconnecting these two domains [36 37]
In the present study we have isolated and identifiedamylase producing bacteria from the municipal solid wasteOur study showed that the municipal solid wastes can beused as productive sources of beneficial microbes thosecan be successfully used in large scale for management ofmunicipal starchywastematerials present inmunicipal waste
The isolate Pseudomonas stutzeri ISL B5 showed the abilityto tolerate adverse conditions like wide range of pH andtemperature and has significant toxic metal ion tolerancewhich makes it a promising inoculant for enzyme industryas well as in solid waste management
Competing Interests
The authors declare no conflict of interests
Authorsrsquo Contributions
Prajesh Dutta and AkashDeb performed the laboratory worklike isolation identification and optimization and wrote the
6 International Journal of Microbiology
Beef extract Ammoniumsulfate
Peptone Tryptone
Nitrogen source
0
05
1
15
2
25
3En
zym
e act
ivity
(Um
l)
(a)
03 06 08 1 2Peptone concentration ()
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
(b)
Figure 6 Effect different nitrogen sources and different peptone concentrations on amylase production by P stutzeri ISL B5 (a) Amylaseproduction under the influence of different nitrogen sources (b) Amylase production under the influence of different peptone concentrationsin percentage Data represent mean plusmn SD (119899 = 3) 119875 lt 005
Ferrous Zinc Manganese CalciumMetal ions
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
Figure 7 Effect different metal ions on amylase production by Pstutzeri ISL B5 Data represent mean plusmn SD (119899 = 3) 119875 lt 005
manuscript Sukanta Majumdar participated in the statisticalanalysis and supervised the whole work
Acknowledgments
The authors are thankful to the Xcelris laboratories Ahmad-abad India for their help in sequencing of 16S rDNA
References
[1] B Duza and S A Mastan ldquoMicrobial enzymes and theirapplications-a reviewrdquo IndoAmerican Journal of PharmaceuticalResearch vol 3 no 8 pp 6208ndash6219 2013
[2] P Anbu S C B Gopinath A C Cihan and B P ChaulagainldquoMicrobial enzymes and their applications in industries andmedicinerdquo BioMed Research International vol 2013 Article ID204014 2 pages 2013
[3] F Hasan A A Shah and A Hameed ldquoIndustrial applicationsof microbial lipasesrdquo Enzyme and Microbial Technology vol 39no 2 pp 235ndash251 2006
[4] M Kiro ldquoMicrobial 120572-amylases and their industrial applica-tions a reviewrdquo International Journals of Management IT andEngineering vol 2 no 10 pp 583ndash609 2012
[5] A M Omemu I Akpan M O Bankole and O D TeniolaldquoHydrolysis of raw tuber starches by amylase of Aspergillusniger AM07 isolated from the soilrdquo African Journal of Biotech-nology vol 4 no 1 pp 19ndash25 2005
[6] V Verma M S Avasthi A R Gupta M Singh and AKushwaha ldquoAmylase production and purification from bacteriaisolated from a waste potato dumpsite in district FarrukhabadUP state Indiardquo European Journal of Experimental Biology vol1 no 3 pp 107ndash113 2012
[7] B K Lonsane and M V Ramesh ldquoProduction of bacterialthermostable 120572-amylase by solid-state fermentation a potentialtool for achieving economy in enzyme production and starchhydrolysisrdquo Advances in Applied Microbiology vol 35 pp 1ndash561990
[8] H K Manonmani and A A M Kunhi ldquoInterference of thiol-compounds with dextrinizing activity assay of 120572-amylase bystarch-iodine colour reaction modification of the method toeliminate this interferencerdquo World Journal of Microbiology andBiotechnology vol 15 no 4 pp 485ndash487 1999
[9] D Parmar andA Pandya ldquoCharacterization of amylase produc-ing bacterial isolatesrdquo Bulletin of Environment Pharmacologyand Life Sciences vol 1 no 6 pp 42ndash47 2012
[10] R C Pascon R F Bergamo R X Spinelli et al ldquoAmylolyticmicroorganism from Sao Paulo zoo composting isolationidentification and amylase productionrdquo Enzyme Research vol2011 Article ID 679624 8 pages 2011
[11] R Rohban M A Amoozegar and A Ventosa ldquoScreeningand isolation of halophilic bacteria producing extracellularhydrolyses from Howz Soltan Lake Iranrdquo Journal of IndustrialMicrobiology and Biotechnology vol 36 no 3 pp 333ndash3402009
[12] D Gangadharan K Madhavan Nampoothiri S Sivaramakr-ishnan and A Pandey ldquoImmobilized bacterial 120572-amylase for
International Journal of Microbiology 7
effective hydrolysis of raw and soluble starchrdquo Food ResearchInternational vol 42 no 4 pp 436ndash442 2009
[13] W H L Stafford G C Baker S A Brown S G Burton and DA Cowan ldquoBacterial diversity in the rhizosphere of Proteaceaespeciesrdquo Environmental Microbiology vol 7 no 11 pp 1755ndash1768 2005
[14] N Saitou and M Nei ldquoThe neighbor-joining method a newmethod for reconstructing phylogenetic treesrdquo Molecular Biol-ogy and Evolution vol 4 no 4 pp 406ndash425 1987
[15] K Tamura J Dudley M Nei and S Kumar ldquoMEGA4 Molec-ular Evolutionary Genetics Analysis (MEGA) software version40rdquo Molecular Biology and Evolution vol 24 no 8 pp 1596ndash1599 2007
[16] A D Jamieson K M Pruitt and R C Caldwell ldquoAn improvedamylase assayrdquo Journal of Dental Research vol 48 no 3 p 4831969
[17] R Gupta P Gigras H Mohapatra V K Goswami and BChauhan ldquoMicrobial 120572-amylases a biotechnological perspec-tiverdquo Process Biochemistry vol 38 no 11 pp 1599ndash1616 2003
[18] K Kathiresan and S Manivannan ldquo120572-amylase production byPenicillium fellutanum isolated from mangrove rhizospheresoilrdquoAfrican Journal of Biotechnology vol 5 no 10 pp 829ndash8322006
[19] HK ZavedMMRahmanA Rahman SM YArafat andMS Rahman ldquoIsolation and characterization of effective bacteriafor solid waste degradation for organic manurerdquo KMITL ScienceandTechnology Journal vol 2 2008 httpswwwacademiaedu2718658
[20] K R Aneja Experiments in Microbiology Plant Pathology andBiotechnology New Age International New Delhi India 4thedition 2003
[21] J Felsenstein ldquoConfidence limits on phylogenies an approachusing the bootstraprdquo Evolution vol 39 no 4 pp 783ndash791 1985
[22] K Tamura M Nei and S Kumar ldquoProspects for inferringvery large phylogenies by using the neighbor-joining methodrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 101 no 30 pp 11030ndash11035 2004
[23] M A Naidub and P Saranraj ldquoBacterial amylase a reviewrdquoInternational Journal of Pharmaceutical and Biological Archivevol 4 no 2 pp 274ndash287 2013
[24] S B Oyeleke and A A Oduwole ldquoProduction of amylase bybacteria isolated from a cassavawaste dumpsite inMinna NigerState Nigeriardquo African Journal of Microbiology Research vol 3no 4 pp 143ndash146 2009
[25] L Khannous M Jrad M Dammak et al ldquoIsolation of a novelamylase and lipase-producing Pseudomonas luteola strainstudy of amylase production conditionsrdquo Lipids in Health andDisease vol 13 article 9 2014
[26] P Singh P Gupta R Singh and R Sharma ldquoFactors affectingalfa amylase production on submerged fermentation byBacillussprdquo International Journal of Pharmacy and Life Sciences vol 3no 12 pp 2243ndash2246 2012
[27] E V N Raju and G Divakar ldquoProduction of amylase by usingPseudomonas aeruginosa isolated from garden soilrdquo Interna-tional Journal of Advances in Pharmacy Biology and Chemistryvol 2 no 1 pp 50ndash56 2013
[28] S Aiba K Kitai and T Imanaka ldquoCloning and expression ofthermostable 120572-amylase gene from Bacillus stearothermophilusin Bacillus stearothermophilus and Bacillus subtilisrdquoApplied andEnvironmental Microbiology vol 46 no 5 pp 1059ndash1065 1983
[29] G D Haki and S K Rakshit ldquoDevelopments in industriallyimportant thermostable enzymes a reviewrdquo Bioresource Tech-nology vol 89 no 1 pp 17ndash34 2003
[30] A Samanta DMitra S N Roy C Sinha and P Pal ldquoCharacter-ization and optimization of amylase producing bacteria isolatedfrom solid wasterdquo Journal of Environmental Protection vol 04no 06 pp 647ndash652 2013
[31] T Sivakumar V Ramasubramanian T Shankar P Vijayabaskarand K T K Anandapandian ldquoScreening of keratinolytic bacte-ria Bacillus cereus from the feather dumping soil of sivakasirdquoJournal of Basic and Applied Biology vol 5 no 1-2 pp 305ndash3142001
[32] C Haseltine M Rolfsmeier and P Blum ldquoThe glucose effectand regulation of alpha-amylase synthesis in the hyperther-mophilic archaeon Sulfolobus solfataricusrdquo Journal of Bacteri-ology vol 178 no 4 pp 945ndash950 1996
[33] A Linden O Mayans W Meyer-Klaucke G Antranikian andM Wilmanns ldquoDifferential regulation of a hyperthermophilic120572-amylase with a novel (CaZn) two-metal center by zincrdquoTheJournal of Biological Chemistry vol 278 no 11 pp 9875ndash98842003
[34] A Burhan U Nisa C Gokhan C Omer A Ashabil and GOsman ldquoEnzymatic properties of a novel thermostable ther-mophilic alkaline and chelator resistant amylase from analkaliphilic Bacillus sp isolate ANT-6rdquo Process Biochemistryvol 38 no 10 pp 1397ndash1403 2003
[35] M V Ramesh and B K Lonsane ldquoSolid state fermentationfor production of higher titres of thermostable alpha-amylasewith two peaks for pH optima by Bacillus licheniformis M27rdquoBiotechnology Letters vol 11 no 1 pp 49ndash52 1989
[36] R Lifshitz and A Levitzki ldquoIdentity and properties of thechloride effector binding site in hog pancreatic 120572-amylaserdquo Bio-chemistry vol 15 no 9 pp 1987ndash1993 1976
[37] K Saha S Maity S Roy et al ldquoOptimization of amylaseproduction from B amyloliquefaciens(MTCC 1270) using solidstate fermentationrdquo International Journal of Microbiology vol2014 Article ID 764046 7 pages 2014
Figure 2 Effect of incubation period on amylase production by Pstutzeri ISL B5 Data represent mean plusmn SD (119899 = 3)
28 32 36 40 44 48000
050
100
150
200
250
300
Enzy
me a
ctiv
ity (U
ml)
Temperature (∘C)
Figure 3 Effect of temperature on amylase production by P stutzeriISL B5 Data represent mean plusmn SD (119899 = 3) 119875 lt 005
show the effect of carbon sources in amylase production (Fig-ure 5(a)) The starch showed the highest enzyme productionat 2 concentration (277Uml) (Figure 5(b))
The effect of different nitrogen sources on amylaseproduction was assessed by using beef extract ammoniumchloride peptone and tryptone The maximum enzymeproduction was exhibited in 08 peptone concentration(277Uml) whereas ammonium chloride had the lowestenzyme production ability (Figures 6(a) and 6(b))
Ferrous zinc manganese and calcium ions in very lowconcentration were used to determine the effect of metalions on amylase production (Figure 7) After 25 hours brothcontaining calcium ion showed the highest ability of enzymeproduction (249Uml) whereas ferrous ion had the lowestability of enzyme production
4 Discussion
Twenty-five bacterial strains were isolated from munici-pal dumping waste from these the isolate ISL B5 whichwas identified as Pseudomonas stutzeri showed the highestamylase activity Several reports have suggested that manybacteria isolated from solid waste show amylase activity withsignificant efficiency [23] Among bacterial isolates Bacillussp [24] and Pseudomonas sp [25] are frequent amylaseproducers
P stutzeri ISL B5 showed the highest amylase productionat 25 hours of incubation Above this incubation periodthe amylase enzyme activity started to decrease This maybe due to the decrease in growth of the isolate Most ofthe studies reported the highest enzyme production between35 hours and 48 hours [26 27] on the contrary ISL B5showed optimum production after 25 hours thus provingearly harvesting time for industrial use
The strain of P stutzeri has low starch degrading activitybelow and above 40∘CThis may be due to decreased growthrate and inactivation of genes which are responsible for thestarch degrading enzyme [28]Most of the amylase producingbacterial strain exhibited a pH range between 60 and 75for normal growth and enzyme production [29] The presentbacterial strain revealed maximal enzyme production at pH75 The highest enzyme activity in reaction mixture has beenachieved at pH 8 Samanta et al [30] also reported the highestamylase activity of Cronobacter sakazakii Jor52 at pH 8
The supplement of carbon sources in either monosac-charide or polysaccharide form may induce the amylaseproduction In our present study the influence of starch wasmore than the other carbon sources tested Mannitol wasthe second best supplementary carbon source Glucose hasthe lowest amylase activity It is reported that the differentcarbon sources variedly influence the amylase production[31] Similar findings suggested that glucose represses theamylase production in the case of hyperthermophilic archaeaSulfolobus solfataricus [32] They also reported that glucoseinhibits the expression of amylase gene
Thenitrogen sources are secondary energy sources for theorganisms and those play an important role in the growthand in the production of valuable enzymes of organismsThenature of the compound and the concentration that we usedmight influence or downregulate enzyme production [27] Inthis experiment the effect of nitrogen sources on amylaseproduction showed that peptone was found to be a betternitrogen source for P stutzeri ISL B5
The effects ofmetal ions have been well studied on severalamylases from bacteria and fungi It has been known thatmost of amylases are metal ion-dependent enzymes andthese ions are divalent cations such as Mn2+ Zn2+ Mg2+Ca2+ and Fe2+ [17] Enhancement of amylase activity in thepresence of ions could be based on its ability to interact withnegatively charged amino acid residues such as aspartic andglutamic acid [33] The study showed the highest enzymeactivity in the presence of calcium ion According to Burhanet al [34] in case of Bacillus sp calcium ion increasedthe production of amylase Ramesh and Lonsane [35] alsoreported that different concentrations of calcium affect the
International Journal of Microbiology 5
000
050
100
150
200
250
300En
zym
e act
ivity
(Um
l)
55 6 65 7 755 8Media pH
(a)
6 7 8 10pH of reaction mixture
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
(b)
Figure 4 Effect of pH on amylase production by P stutzeri ISL B5 and on enzyme activity in reactionmixture (a) Amylase production underdifferent media pH (b) Enzyme activity under different pH of reaction mixture Data represent mean plusmn SD (119899 = 3) 119875 lt 005
Starch Sucrose Glucose MannitolCarbon source
000
050
100
150
200
250
300
350
Enzy
me a
ctiv
ity (U
ml)
(a)
02 05 08 1 2 4Starch concentration ()
000
050
100
150
200
250
300
350
Enzy
me a
ctiv
ity (U
ml)
(b)
Figure 5 Effect different carbon sources and different starch concentrations on amylase production by P stutzeri ISL B5 (a) Amylaseproduction under the influence of different carbon sources (b) Amylase production under the influence of different starch concentrations inpercentage Data represent mean plusmn SD (119899 = 3) 119875 lt 005
amylase production and its activity The crystal structure ofamylase showed that calcium ions play a detrimental role inionic interactionwithAsn 100 andHis 201 residues of domainA and also with Asp 159 and Asp 167 residues of domain Bin amylase enzyme It has also been reported that the activesite of amylase is located between domain A and domain Band calcium promotes stability and catalytic activity of theenzyme by interconnecting these two domains [36 37]
In the present study we have isolated and identifiedamylase producing bacteria from the municipal solid wasteOur study showed that the municipal solid wastes can beused as productive sources of beneficial microbes thosecan be successfully used in large scale for management ofmunicipal starchywastematerials present inmunicipal waste
The isolate Pseudomonas stutzeri ISL B5 showed the abilityto tolerate adverse conditions like wide range of pH andtemperature and has significant toxic metal ion tolerancewhich makes it a promising inoculant for enzyme industryas well as in solid waste management
Competing Interests
The authors declare no conflict of interests
Authorsrsquo Contributions
Prajesh Dutta and AkashDeb performed the laboratory worklike isolation identification and optimization and wrote the
6 International Journal of Microbiology
Beef extract Ammoniumsulfate
Peptone Tryptone
Nitrogen source
0
05
1
15
2
25
3En
zym
e act
ivity
(Um
l)
(a)
03 06 08 1 2Peptone concentration ()
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
(b)
Figure 6 Effect different nitrogen sources and different peptone concentrations on amylase production by P stutzeri ISL B5 (a) Amylaseproduction under the influence of different nitrogen sources (b) Amylase production under the influence of different peptone concentrationsin percentage Data represent mean plusmn SD (119899 = 3) 119875 lt 005
Ferrous Zinc Manganese CalciumMetal ions
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
Figure 7 Effect different metal ions on amylase production by Pstutzeri ISL B5 Data represent mean plusmn SD (119899 = 3) 119875 lt 005
manuscript Sukanta Majumdar participated in the statisticalanalysis and supervised the whole work
Acknowledgments
The authors are thankful to the Xcelris laboratories Ahmad-abad India for their help in sequencing of 16S rDNA
References
[1] B Duza and S A Mastan ldquoMicrobial enzymes and theirapplications-a reviewrdquo IndoAmerican Journal of PharmaceuticalResearch vol 3 no 8 pp 6208ndash6219 2013
[2] P Anbu S C B Gopinath A C Cihan and B P ChaulagainldquoMicrobial enzymes and their applications in industries andmedicinerdquo BioMed Research International vol 2013 Article ID204014 2 pages 2013
[3] F Hasan A A Shah and A Hameed ldquoIndustrial applicationsof microbial lipasesrdquo Enzyme and Microbial Technology vol 39no 2 pp 235ndash251 2006
[4] M Kiro ldquoMicrobial 120572-amylases and their industrial applica-tions a reviewrdquo International Journals of Management IT andEngineering vol 2 no 10 pp 583ndash609 2012
[5] A M Omemu I Akpan M O Bankole and O D TeniolaldquoHydrolysis of raw tuber starches by amylase of Aspergillusniger AM07 isolated from the soilrdquo African Journal of Biotech-nology vol 4 no 1 pp 19ndash25 2005
[6] V Verma M S Avasthi A R Gupta M Singh and AKushwaha ldquoAmylase production and purification from bacteriaisolated from a waste potato dumpsite in district FarrukhabadUP state Indiardquo European Journal of Experimental Biology vol1 no 3 pp 107ndash113 2012
[7] B K Lonsane and M V Ramesh ldquoProduction of bacterialthermostable 120572-amylase by solid-state fermentation a potentialtool for achieving economy in enzyme production and starchhydrolysisrdquo Advances in Applied Microbiology vol 35 pp 1ndash561990
[8] H K Manonmani and A A M Kunhi ldquoInterference of thiol-compounds with dextrinizing activity assay of 120572-amylase bystarch-iodine colour reaction modification of the method toeliminate this interferencerdquo World Journal of Microbiology andBiotechnology vol 15 no 4 pp 485ndash487 1999
[9] D Parmar andA Pandya ldquoCharacterization of amylase produc-ing bacterial isolatesrdquo Bulletin of Environment Pharmacologyand Life Sciences vol 1 no 6 pp 42ndash47 2012
[10] R C Pascon R F Bergamo R X Spinelli et al ldquoAmylolyticmicroorganism from Sao Paulo zoo composting isolationidentification and amylase productionrdquo Enzyme Research vol2011 Article ID 679624 8 pages 2011
[11] R Rohban M A Amoozegar and A Ventosa ldquoScreeningand isolation of halophilic bacteria producing extracellularhydrolyses from Howz Soltan Lake Iranrdquo Journal of IndustrialMicrobiology and Biotechnology vol 36 no 3 pp 333ndash3402009
[12] D Gangadharan K Madhavan Nampoothiri S Sivaramakr-ishnan and A Pandey ldquoImmobilized bacterial 120572-amylase for
International Journal of Microbiology 7
effective hydrolysis of raw and soluble starchrdquo Food ResearchInternational vol 42 no 4 pp 436ndash442 2009
[13] W H L Stafford G C Baker S A Brown S G Burton and DA Cowan ldquoBacterial diversity in the rhizosphere of Proteaceaespeciesrdquo Environmental Microbiology vol 7 no 11 pp 1755ndash1768 2005
[14] N Saitou and M Nei ldquoThe neighbor-joining method a newmethod for reconstructing phylogenetic treesrdquo Molecular Biol-ogy and Evolution vol 4 no 4 pp 406ndash425 1987
[15] K Tamura J Dudley M Nei and S Kumar ldquoMEGA4 Molec-ular Evolutionary Genetics Analysis (MEGA) software version40rdquo Molecular Biology and Evolution vol 24 no 8 pp 1596ndash1599 2007
[16] A D Jamieson K M Pruitt and R C Caldwell ldquoAn improvedamylase assayrdquo Journal of Dental Research vol 48 no 3 p 4831969
[17] R Gupta P Gigras H Mohapatra V K Goswami and BChauhan ldquoMicrobial 120572-amylases a biotechnological perspec-tiverdquo Process Biochemistry vol 38 no 11 pp 1599ndash1616 2003
[18] K Kathiresan and S Manivannan ldquo120572-amylase production byPenicillium fellutanum isolated from mangrove rhizospheresoilrdquoAfrican Journal of Biotechnology vol 5 no 10 pp 829ndash8322006
[19] HK ZavedMMRahmanA Rahman SM YArafat andMS Rahman ldquoIsolation and characterization of effective bacteriafor solid waste degradation for organic manurerdquo KMITL ScienceandTechnology Journal vol 2 2008 httpswwwacademiaedu2718658
[20] K R Aneja Experiments in Microbiology Plant Pathology andBiotechnology New Age International New Delhi India 4thedition 2003
[21] J Felsenstein ldquoConfidence limits on phylogenies an approachusing the bootstraprdquo Evolution vol 39 no 4 pp 783ndash791 1985
[22] K Tamura M Nei and S Kumar ldquoProspects for inferringvery large phylogenies by using the neighbor-joining methodrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 101 no 30 pp 11030ndash11035 2004
[23] M A Naidub and P Saranraj ldquoBacterial amylase a reviewrdquoInternational Journal of Pharmaceutical and Biological Archivevol 4 no 2 pp 274ndash287 2013
[24] S B Oyeleke and A A Oduwole ldquoProduction of amylase bybacteria isolated from a cassavawaste dumpsite inMinna NigerState Nigeriardquo African Journal of Microbiology Research vol 3no 4 pp 143ndash146 2009
[25] L Khannous M Jrad M Dammak et al ldquoIsolation of a novelamylase and lipase-producing Pseudomonas luteola strainstudy of amylase production conditionsrdquo Lipids in Health andDisease vol 13 article 9 2014
[26] P Singh P Gupta R Singh and R Sharma ldquoFactors affectingalfa amylase production on submerged fermentation byBacillussprdquo International Journal of Pharmacy and Life Sciences vol 3no 12 pp 2243ndash2246 2012
[27] E V N Raju and G Divakar ldquoProduction of amylase by usingPseudomonas aeruginosa isolated from garden soilrdquo Interna-tional Journal of Advances in Pharmacy Biology and Chemistryvol 2 no 1 pp 50ndash56 2013
[28] S Aiba K Kitai and T Imanaka ldquoCloning and expression ofthermostable 120572-amylase gene from Bacillus stearothermophilusin Bacillus stearothermophilus and Bacillus subtilisrdquoApplied andEnvironmental Microbiology vol 46 no 5 pp 1059ndash1065 1983
[29] G D Haki and S K Rakshit ldquoDevelopments in industriallyimportant thermostable enzymes a reviewrdquo Bioresource Tech-nology vol 89 no 1 pp 17ndash34 2003
[30] A Samanta DMitra S N Roy C Sinha and P Pal ldquoCharacter-ization and optimization of amylase producing bacteria isolatedfrom solid wasterdquo Journal of Environmental Protection vol 04no 06 pp 647ndash652 2013
[31] T Sivakumar V Ramasubramanian T Shankar P Vijayabaskarand K T K Anandapandian ldquoScreening of keratinolytic bacte-ria Bacillus cereus from the feather dumping soil of sivakasirdquoJournal of Basic and Applied Biology vol 5 no 1-2 pp 305ndash3142001
[32] C Haseltine M Rolfsmeier and P Blum ldquoThe glucose effectand regulation of alpha-amylase synthesis in the hyperther-mophilic archaeon Sulfolobus solfataricusrdquo Journal of Bacteri-ology vol 178 no 4 pp 945ndash950 1996
[33] A Linden O Mayans W Meyer-Klaucke G Antranikian andM Wilmanns ldquoDifferential regulation of a hyperthermophilic120572-amylase with a novel (CaZn) two-metal center by zincrdquoTheJournal of Biological Chemistry vol 278 no 11 pp 9875ndash98842003
[34] A Burhan U Nisa C Gokhan C Omer A Ashabil and GOsman ldquoEnzymatic properties of a novel thermostable ther-mophilic alkaline and chelator resistant amylase from analkaliphilic Bacillus sp isolate ANT-6rdquo Process Biochemistryvol 38 no 10 pp 1397ndash1403 2003
[35] M V Ramesh and B K Lonsane ldquoSolid state fermentationfor production of higher titres of thermostable alpha-amylasewith two peaks for pH optima by Bacillus licheniformis M27rdquoBiotechnology Letters vol 11 no 1 pp 49ndash52 1989
[36] R Lifshitz and A Levitzki ldquoIdentity and properties of thechloride effector binding site in hog pancreatic 120572-amylaserdquo Bio-chemistry vol 15 no 9 pp 1987ndash1993 1976
[37] K Saha S Maity S Roy et al ldquoOptimization of amylaseproduction from B amyloliquefaciens(MTCC 1270) using solidstate fermentationrdquo International Journal of Microbiology vol2014 Article ID 764046 7 pages 2014
Figure 4 Effect of pH on amylase production by P stutzeri ISL B5 and on enzyme activity in reactionmixture (a) Amylase production underdifferent media pH (b) Enzyme activity under different pH of reaction mixture Data represent mean plusmn SD (119899 = 3) 119875 lt 005
Starch Sucrose Glucose MannitolCarbon source
000
050
100
150
200
250
300
350
Enzy
me a
ctiv
ity (U
ml)
(a)
02 05 08 1 2 4Starch concentration ()
000
050
100
150
200
250
300
350
Enzy
me a
ctiv
ity (U
ml)
(b)
Figure 5 Effect different carbon sources and different starch concentrations on amylase production by P stutzeri ISL B5 (a) Amylaseproduction under the influence of different carbon sources (b) Amylase production under the influence of different starch concentrations inpercentage Data represent mean plusmn SD (119899 = 3) 119875 lt 005
amylase production and its activity The crystal structure ofamylase showed that calcium ions play a detrimental role inionic interactionwithAsn 100 andHis 201 residues of domainA and also with Asp 159 and Asp 167 residues of domain Bin amylase enzyme It has also been reported that the activesite of amylase is located between domain A and domain Band calcium promotes stability and catalytic activity of theenzyme by interconnecting these two domains [36 37]
In the present study we have isolated and identifiedamylase producing bacteria from the municipal solid wasteOur study showed that the municipal solid wastes can beused as productive sources of beneficial microbes thosecan be successfully used in large scale for management ofmunicipal starchywastematerials present inmunicipal waste
The isolate Pseudomonas stutzeri ISL B5 showed the abilityto tolerate adverse conditions like wide range of pH andtemperature and has significant toxic metal ion tolerancewhich makes it a promising inoculant for enzyme industryas well as in solid waste management
Competing Interests
The authors declare no conflict of interests
Authorsrsquo Contributions
Prajesh Dutta and AkashDeb performed the laboratory worklike isolation identification and optimization and wrote the
6 International Journal of Microbiology
Beef extract Ammoniumsulfate
Peptone Tryptone
Nitrogen source
0
05
1
15
2
25
3En
zym
e act
ivity
(Um
l)
(a)
03 06 08 1 2Peptone concentration ()
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
(b)
Figure 6 Effect different nitrogen sources and different peptone concentrations on amylase production by P stutzeri ISL B5 (a) Amylaseproduction under the influence of different nitrogen sources (b) Amylase production under the influence of different peptone concentrationsin percentage Data represent mean plusmn SD (119899 = 3) 119875 lt 005
Ferrous Zinc Manganese CalciumMetal ions
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
Figure 7 Effect different metal ions on amylase production by Pstutzeri ISL B5 Data represent mean plusmn SD (119899 = 3) 119875 lt 005
manuscript Sukanta Majumdar participated in the statisticalanalysis and supervised the whole work
Acknowledgments
The authors are thankful to the Xcelris laboratories Ahmad-abad India for their help in sequencing of 16S rDNA
References
[1] B Duza and S A Mastan ldquoMicrobial enzymes and theirapplications-a reviewrdquo IndoAmerican Journal of PharmaceuticalResearch vol 3 no 8 pp 6208ndash6219 2013
[2] P Anbu S C B Gopinath A C Cihan and B P ChaulagainldquoMicrobial enzymes and their applications in industries andmedicinerdquo BioMed Research International vol 2013 Article ID204014 2 pages 2013
[3] F Hasan A A Shah and A Hameed ldquoIndustrial applicationsof microbial lipasesrdquo Enzyme and Microbial Technology vol 39no 2 pp 235ndash251 2006
[4] M Kiro ldquoMicrobial 120572-amylases and their industrial applica-tions a reviewrdquo International Journals of Management IT andEngineering vol 2 no 10 pp 583ndash609 2012
[5] A M Omemu I Akpan M O Bankole and O D TeniolaldquoHydrolysis of raw tuber starches by amylase of Aspergillusniger AM07 isolated from the soilrdquo African Journal of Biotech-nology vol 4 no 1 pp 19ndash25 2005
[6] V Verma M S Avasthi A R Gupta M Singh and AKushwaha ldquoAmylase production and purification from bacteriaisolated from a waste potato dumpsite in district FarrukhabadUP state Indiardquo European Journal of Experimental Biology vol1 no 3 pp 107ndash113 2012
[7] B K Lonsane and M V Ramesh ldquoProduction of bacterialthermostable 120572-amylase by solid-state fermentation a potentialtool for achieving economy in enzyme production and starchhydrolysisrdquo Advances in Applied Microbiology vol 35 pp 1ndash561990
[8] H K Manonmani and A A M Kunhi ldquoInterference of thiol-compounds with dextrinizing activity assay of 120572-amylase bystarch-iodine colour reaction modification of the method toeliminate this interferencerdquo World Journal of Microbiology andBiotechnology vol 15 no 4 pp 485ndash487 1999
[9] D Parmar andA Pandya ldquoCharacterization of amylase produc-ing bacterial isolatesrdquo Bulletin of Environment Pharmacologyand Life Sciences vol 1 no 6 pp 42ndash47 2012
[10] R C Pascon R F Bergamo R X Spinelli et al ldquoAmylolyticmicroorganism from Sao Paulo zoo composting isolationidentification and amylase productionrdquo Enzyme Research vol2011 Article ID 679624 8 pages 2011
[11] R Rohban M A Amoozegar and A Ventosa ldquoScreeningand isolation of halophilic bacteria producing extracellularhydrolyses from Howz Soltan Lake Iranrdquo Journal of IndustrialMicrobiology and Biotechnology vol 36 no 3 pp 333ndash3402009
[12] D Gangadharan K Madhavan Nampoothiri S Sivaramakr-ishnan and A Pandey ldquoImmobilized bacterial 120572-amylase for
International Journal of Microbiology 7
effective hydrolysis of raw and soluble starchrdquo Food ResearchInternational vol 42 no 4 pp 436ndash442 2009
[13] W H L Stafford G C Baker S A Brown S G Burton and DA Cowan ldquoBacterial diversity in the rhizosphere of Proteaceaespeciesrdquo Environmental Microbiology vol 7 no 11 pp 1755ndash1768 2005
[14] N Saitou and M Nei ldquoThe neighbor-joining method a newmethod for reconstructing phylogenetic treesrdquo Molecular Biol-ogy and Evolution vol 4 no 4 pp 406ndash425 1987
[15] K Tamura J Dudley M Nei and S Kumar ldquoMEGA4 Molec-ular Evolutionary Genetics Analysis (MEGA) software version40rdquo Molecular Biology and Evolution vol 24 no 8 pp 1596ndash1599 2007
[16] A D Jamieson K M Pruitt and R C Caldwell ldquoAn improvedamylase assayrdquo Journal of Dental Research vol 48 no 3 p 4831969
[17] R Gupta P Gigras H Mohapatra V K Goswami and BChauhan ldquoMicrobial 120572-amylases a biotechnological perspec-tiverdquo Process Biochemistry vol 38 no 11 pp 1599ndash1616 2003
[18] K Kathiresan and S Manivannan ldquo120572-amylase production byPenicillium fellutanum isolated from mangrove rhizospheresoilrdquoAfrican Journal of Biotechnology vol 5 no 10 pp 829ndash8322006
[19] HK ZavedMMRahmanA Rahman SM YArafat andMS Rahman ldquoIsolation and characterization of effective bacteriafor solid waste degradation for organic manurerdquo KMITL ScienceandTechnology Journal vol 2 2008 httpswwwacademiaedu2718658
[20] K R Aneja Experiments in Microbiology Plant Pathology andBiotechnology New Age International New Delhi India 4thedition 2003
[21] J Felsenstein ldquoConfidence limits on phylogenies an approachusing the bootstraprdquo Evolution vol 39 no 4 pp 783ndash791 1985
[22] K Tamura M Nei and S Kumar ldquoProspects for inferringvery large phylogenies by using the neighbor-joining methodrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 101 no 30 pp 11030ndash11035 2004
[23] M A Naidub and P Saranraj ldquoBacterial amylase a reviewrdquoInternational Journal of Pharmaceutical and Biological Archivevol 4 no 2 pp 274ndash287 2013
[24] S B Oyeleke and A A Oduwole ldquoProduction of amylase bybacteria isolated from a cassavawaste dumpsite inMinna NigerState Nigeriardquo African Journal of Microbiology Research vol 3no 4 pp 143ndash146 2009
[25] L Khannous M Jrad M Dammak et al ldquoIsolation of a novelamylase and lipase-producing Pseudomonas luteola strainstudy of amylase production conditionsrdquo Lipids in Health andDisease vol 13 article 9 2014
[26] P Singh P Gupta R Singh and R Sharma ldquoFactors affectingalfa amylase production on submerged fermentation byBacillussprdquo International Journal of Pharmacy and Life Sciences vol 3no 12 pp 2243ndash2246 2012
[27] E V N Raju and G Divakar ldquoProduction of amylase by usingPseudomonas aeruginosa isolated from garden soilrdquo Interna-tional Journal of Advances in Pharmacy Biology and Chemistryvol 2 no 1 pp 50ndash56 2013
[28] S Aiba K Kitai and T Imanaka ldquoCloning and expression ofthermostable 120572-amylase gene from Bacillus stearothermophilusin Bacillus stearothermophilus and Bacillus subtilisrdquoApplied andEnvironmental Microbiology vol 46 no 5 pp 1059ndash1065 1983
[29] G D Haki and S K Rakshit ldquoDevelopments in industriallyimportant thermostable enzymes a reviewrdquo Bioresource Tech-nology vol 89 no 1 pp 17ndash34 2003
[30] A Samanta DMitra S N Roy C Sinha and P Pal ldquoCharacter-ization and optimization of amylase producing bacteria isolatedfrom solid wasterdquo Journal of Environmental Protection vol 04no 06 pp 647ndash652 2013
[31] T Sivakumar V Ramasubramanian T Shankar P Vijayabaskarand K T K Anandapandian ldquoScreening of keratinolytic bacte-ria Bacillus cereus from the feather dumping soil of sivakasirdquoJournal of Basic and Applied Biology vol 5 no 1-2 pp 305ndash3142001
[32] C Haseltine M Rolfsmeier and P Blum ldquoThe glucose effectand regulation of alpha-amylase synthesis in the hyperther-mophilic archaeon Sulfolobus solfataricusrdquo Journal of Bacteri-ology vol 178 no 4 pp 945ndash950 1996
[33] A Linden O Mayans W Meyer-Klaucke G Antranikian andM Wilmanns ldquoDifferential regulation of a hyperthermophilic120572-amylase with a novel (CaZn) two-metal center by zincrdquoTheJournal of Biological Chemistry vol 278 no 11 pp 9875ndash98842003
[34] A Burhan U Nisa C Gokhan C Omer A Ashabil and GOsman ldquoEnzymatic properties of a novel thermostable ther-mophilic alkaline and chelator resistant amylase from analkaliphilic Bacillus sp isolate ANT-6rdquo Process Biochemistryvol 38 no 10 pp 1397ndash1403 2003
[35] M V Ramesh and B K Lonsane ldquoSolid state fermentationfor production of higher titres of thermostable alpha-amylasewith two peaks for pH optima by Bacillus licheniformis M27rdquoBiotechnology Letters vol 11 no 1 pp 49ndash52 1989
[36] R Lifshitz and A Levitzki ldquoIdentity and properties of thechloride effector binding site in hog pancreatic 120572-amylaserdquo Bio-chemistry vol 15 no 9 pp 1987ndash1993 1976
[37] K Saha S Maity S Roy et al ldquoOptimization of amylaseproduction from B amyloliquefaciens(MTCC 1270) using solidstate fermentationrdquo International Journal of Microbiology vol2014 Article ID 764046 7 pages 2014
Figure 6 Effect different nitrogen sources and different peptone concentrations on amylase production by P stutzeri ISL B5 (a) Amylaseproduction under the influence of different nitrogen sources (b) Amylase production under the influence of different peptone concentrationsin percentage Data represent mean plusmn SD (119899 = 3) 119875 lt 005
Ferrous Zinc Manganese CalciumMetal ions
0
05
1
15
2
25
3
Enzy
me a
ctiv
ity (U
ml)
Figure 7 Effect different metal ions on amylase production by Pstutzeri ISL B5 Data represent mean plusmn SD (119899 = 3) 119875 lt 005
manuscript Sukanta Majumdar participated in the statisticalanalysis and supervised the whole work
Acknowledgments
The authors are thankful to the Xcelris laboratories Ahmad-abad India for their help in sequencing of 16S rDNA
References
[1] B Duza and S A Mastan ldquoMicrobial enzymes and theirapplications-a reviewrdquo IndoAmerican Journal of PharmaceuticalResearch vol 3 no 8 pp 6208ndash6219 2013
[2] P Anbu S C B Gopinath A C Cihan and B P ChaulagainldquoMicrobial enzymes and their applications in industries andmedicinerdquo BioMed Research International vol 2013 Article ID204014 2 pages 2013
[3] F Hasan A A Shah and A Hameed ldquoIndustrial applicationsof microbial lipasesrdquo Enzyme and Microbial Technology vol 39no 2 pp 235ndash251 2006
[4] M Kiro ldquoMicrobial 120572-amylases and their industrial applica-tions a reviewrdquo International Journals of Management IT andEngineering vol 2 no 10 pp 583ndash609 2012
[5] A M Omemu I Akpan M O Bankole and O D TeniolaldquoHydrolysis of raw tuber starches by amylase of Aspergillusniger AM07 isolated from the soilrdquo African Journal of Biotech-nology vol 4 no 1 pp 19ndash25 2005
[6] V Verma M S Avasthi A R Gupta M Singh and AKushwaha ldquoAmylase production and purification from bacteriaisolated from a waste potato dumpsite in district FarrukhabadUP state Indiardquo European Journal of Experimental Biology vol1 no 3 pp 107ndash113 2012
[7] B K Lonsane and M V Ramesh ldquoProduction of bacterialthermostable 120572-amylase by solid-state fermentation a potentialtool for achieving economy in enzyme production and starchhydrolysisrdquo Advances in Applied Microbiology vol 35 pp 1ndash561990
[8] H K Manonmani and A A M Kunhi ldquoInterference of thiol-compounds with dextrinizing activity assay of 120572-amylase bystarch-iodine colour reaction modification of the method toeliminate this interferencerdquo World Journal of Microbiology andBiotechnology vol 15 no 4 pp 485ndash487 1999
[9] D Parmar andA Pandya ldquoCharacterization of amylase produc-ing bacterial isolatesrdquo Bulletin of Environment Pharmacologyand Life Sciences vol 1 no 6 pp 42ndash47 2012
[10] R C Pascon R F Bergamo R X Spinelli et al ldquoAmylolyticmicroorganism from Sao Paulo zoo composting isolationidentification and amylase productionrdquo Enzyme Research vol2011 Article ID 679624 8 pages 2011
[11] R Rohban M A Amoozegar and A Ventosa ldquoScreeningand isolation of halophilic bacteria producing extracellularhydrolyses from Howz Soltan Lake Iranrdquo Journal of IndustrialMicrobiology and Biotechnology vol 36 no 3 pp 333ndash3402009
[12] D Gangadharan K Madhavan Nampoothiri S Sivaramakr-ishnan and A Pandey ldquoImmobilized bacterial 120572-amylase for
International Journal of Microbiology 7
effective hydrolysis of raw and soluble starchrdquo Food ResearchInternational vol 42 no 4 pp 436ndash442 2009
[13] W H L Stafford G C Baker S A Brown S G Burton and DA Cowan ldquoBacterial diversity in the rhizosphere of Proteaceaespeciesrdquo Environmental Microbiology vol 7 no 11 pp 1755ndash1768 2005
[14] N Saitou and M Nei ldquoThe neighbor-joining method a newmethod for reconstructing phylogenetic treesrdquo Molecular Biol-ogy and Evolution vol 4 no 4 pp 406ndash425 1987
[15] K Tamura J Dudley M Nei and S Kumar ldquoMEGA4 Molec-ular Evolutionary Genetics Analysis (MEGA) software version40rdquo Molecular Biology and Evolution vol 24 no 8 pp 1596ndash1599 2007
[16] A D Jamieson K M Pruitt and R C Caldwell ldquoAn improvedamylase assayrdquo Journal of Dental Research vol 48 no 3 p 4831969
[17] R Gupta P Gigras H Mohapatra V K Goswami and BChauhan ldquoMicrobial 120572-amylases a biotechnological perspec-tiverdquo Process Biochemistry vol 38 no 11 pp 1599ndash1616 2003
[18] K Kathiresan and S Manivannan ldquo120572-amylase production byPenicillium fellutanum isolated from mangrove rhizospheresoilrdquoAfrican Journal of Biotechnology vol 5 no 10 pp 829ndash8322006
[19] HK ZavedMMRahmanA Rahman SM YArafat andMS Rahman ldquoIsolation and characterization of effective bacteriafor solid waste degradation for organic manurerdquo KMITL ScienceandTechnology Journal vol 2 2008 httpswwwacademiaedu2718658
[20] K R Aneja Experiments in Microbiology Plant Pathology andBiotechnology New Age International New Delhi India 4thedition 2003
[21] J Felsenstein ldquoConfidence limits on phylogenies an approachusing the bootstraprdquo Evolution vol 39 no 4 pp 783ndash791 1985
[22] K Tamura M Nei and S Kumar ldquoProspects for inferringvery large phylogenies by using the neighbor-joining methodrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 101 no 30 pp 11030ndash11035 2004
[23] M A Naidub and P Saranraj ldquoBacterial amylase a reviewrdquoInternational Journal of Pharmaceutical and Biological Archivevol 4 no 2 pp 274ndash287 2013
[24] S B Oyeleke and A A Oduwole ldquoProduction of amylase bybacteria isolated from a cassavawaste dumpsite inMinna NigerState Nigeriardquo African Journal of Microbiology Research vol 3no 4 pp 143ndash146 2009
[25] L Khannous M Jrad M Dammak et al ldquoIsolation of a novelamylase and lipase-producing Pseudomonas luteola strainstudy of amylase production conditionsrdquo Lipids in Health andDisease vol 13 article 9 2014
[26] P Singh P Gupta R Singh and R Sharma ldquoFactors affectingalfa amylase production on submerged fermentation byBacillussprdquo International Journal of Pharmacy and Life Sciences vol 3no 12 pp 2243ndash2246 2012
[27] E V N Raju and G Divakar ldquoProduction of amylase by usingPseudomonas aeruginosa isolated from garden soilrdquo Interna-tional Journal of Advances in Pharmacy Biology and Chemistryvol 2 no 1 pp 50ndash56 2013
[28] S Aiba K Kitai and T Imanaka ldquoCloning and expression ofthermostable 120572-amylase gene from Bacillus stearothermophilusin Bacillus stearothermophilus and Bacillus subtilisrdquoApplied andEnvironmental Microbiology vol 46 no 5 pp 1059ndash1065 1983
[29] G D Haki and S K Rakshit ldquoDevelopments in industriallyimportant thermostable enzymes a reviewrdquo Bioresource Tech-nology vol 89 no 1 pp 17ndash34 2003
[30] A Samanta DMitra S N Roy C Sinha and P Pal ldquoCharacter-ization and optimization of amylase producing bacteria isolatedfrom solid wasterdquo Journal of Environmental Protection vol 04no 06 pp 647ndash652 2013
[31] T Sivakumar V Ramasubramanian T Shankar P Vijayabaskarand K T K Anandapandian ldquoScreening of keratinolytic bacte-ria Bacillus cereus from the feather dumping soil of sivakasirdquoJournal of Basic and Applied Biology vol 5 no 1-2 pp 305ndash3142001
[32] C Haseltine M Rolfsmeier and P Blum ldquoThe glucose effectand regulation of alpha-amylase synthesis in the hyperther-mophilic archaeon Sulfolobus solfataricusrdquo Journal of Bacteri-ology vol 178 no 4 pp 945ndash950 1996
[33] A Linden O Mayans W Meyer-Klaucke G Antranikian andM Wilmanns ldquoDifferential regulation of a hyperthermophilic120572-amylase with a novel (CaZn) two-metal center by zincrdquoTheJournal of Biological Chemistry vol 278 no 11 pp 9875ndash98842003
[34] A Burhan U Nisa C Gokhan C Omer A Ashabil and GOsman ldquoEnzymatic properties of a novel thermostable ther-mophilic alkaline and chelator resistant amylase from analkaliphilic Bacillus sp isolate ANT-6rdquo Process Biochemistryvol 38 no 10 pp 1397ndash1403 2003
[35] M V Ramesh and B K Lonsane ldquoSolid state fermentationfor production of higher titres of thermostable alpha-amylasewith two peaks for pH optima by Bacillus licheniformis M27rdquoBiotechnology Letters vol 11 no 1 pp 49ndash52 1989
[36] R Lifshitz and A Levitzki ldquoIdentity and properties of thechloride effector binding site in hog pancreatic 120572-amylaserdquo Bio-chemistry vol 15 no 9 pp 1987ndash1993 1976
[37] K Saha S Maity S Roy et al ldquoOptimization of amylaseproduction from B amyloliquefaciens(MTCC 1270) using solidstate fermentationrdquo International Journal of Microbiology vol2014 Article ID 764046 7 pages 2014
effective hydrolysis of raw and soluble starchrdquo Food ResearchInternational vol 42 no 4 pp 436ndash442 2009
[13] W H L Stafford G C Baker S A Brown S G Burton and DA Cowan ldquoBacterial diversity in the rhizosphere of Proteaceaespeciesrdquo Environmental Microbiology vol 7 no 11 pp 1755ndash1768 2005
[14] N Saitou and M Nei ldquoThe neighbor-joining method a newmethod for reconstructing phylogenetic treesrdquo Molecular Biol-ogy and Evolution vol 4 no 4 pp 406ndash425 1987
[15] K Tamura J Dudley M Nei and S Kumar ldquoMEGA4 Molec-ular Evolutionary Genetics Analysis (MEGA) software version40rdquo Molecular Biology and Evolution vol 24 no 8 pp 1596ndash1599 2007
[16] A D Jamieson K M Pruitt and R C Caldwell ldquoAn improvedamylase assayrdquo Journal of Dental Research vol 48 no 3 p 4831969
[17] R Gupta P Gigras H Mohapatra V K Goswami and BChauhan ldquoMicrobial 120572-amylases a biotechnological perspec-tiverdquo Process Biochemistry vol 38 no 11 pp 1599ndash1616 2003
[18] K Kathiresan and S Manivannan ldquo120572-amylase production byPenicillium fellutanum isolated from mangrove rhizospheresoilrdquoAfrican Journal of Biotechnology vol 5 no 10 pp 829ndash8322006
[19] HK ZavedMMRahmanA Rahman SM YArafat andMS Rahman ldquoIsolation and characterization of effective bacteriafor solid waste degradation for organic manurerdquo KMITL ScienceandTechnology Journal vol 2 2008 httpswwwacademiaedu2718658
[20] K R Aneja Experiments in Microbiology Plant Pathology andBiotechnology New Age International New Delhi India 4thedition 2003
[21] J Felsenstein ldquoConfidence limits on phylogenies an approachusing the bootstraprdquo Evolution vol 39 no 4 pp 783ndash791 1985
[22] K Tamura M Nei and S Kumar ldquoProspects for inferringvery large phylogenies by using the neighbor-joining methodrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 101 no 30 pp 11030ndash11035 2004
[23] M A Naidub and P Saranraj ldquoBacterial amylase a reviewrdquoInternational Journal of Pharmaceutical and Biological Archivevol 4 no 2 pp 274ndash287 2013
[24] S B Oyeleke and A A Oduwole ldquoProduction of amylase bybacteria isolated from a cassavawaste dumpsite inMinna NigerState Nigeriardquo African Journal of Microbiology Research vol 3no 4 pp 143ndash146 2009
[25] L Khannous M Jrad M Dammak et al ldquoIsolation of a novelamylase and lipase-producing Pseudomonas luteola strainstudy of amylase production conditionsrdquo Lipids in Health andDisease vol 13 article 9 2014
[26] P Singh P Gupta R Singh and R Sharma ldquoFactors affectingalfa amylase production on submerged fermentation byBacillussprdquo International Journal of Pharmacy and Life Sciences vol 3no 12 pp 2243ndash2246 2012
[27] E V N Raju and G Divakar ldquoProduction of amylase by usingPseudomonas aeruginosa isolated from garden soilrdquo Interna-tional Journal of Advances in Pharmacy Biology and Chemistryvol 2 no 1 pp 50ndash56 2013
[28] S Aiba K Kitai and T Imanaka ldquoCloning and expression ofthermostable 120572-amylase gene from Bacillus stearothermophilusin Bacillus stearothermophilus and Bacillus subtilisrdquoApplied andEnvironmental Microbiology vol 46 no 5 pp 1059ndash1065 1983
[29] G D Haki and S K Rakshit ldquoDevelopments in industriallyimportant thermostable enzymes a reviewrdquo Bioresource Tech-nology vol 89 no 1 pp 17ndash34 2003
[30] A Samanta DMitra S N Roy C Sinha and P Pal ldquoCharacter-ization and optimization of amylase producing bacteria isolatedfrom solid wasterdquo Journal of Environmental Protection vol 04no 06 pp 647ndash652 2013
[31] T Sivakumar V Ramasubramanian T Shankar P Vijayabaskarand K T K Anandapandian ldquoScreening of keratinolytic bacte-ria Bacillus cereus from the feather dumping soil of sivakasirdquoJournal of Basic and Applied Biology vol 5 no 1-2 pp 305ndash3142001
[32] C Haseltine M Rolfsmeier and P Blum ldquoThe glucose effectand regulation of alpha-amylase synthesis in the hyperther-mophilic archaeon Sulfolobus solfataricusrdquo Journal of Bacteri-ology vol 178 no 4 pp 945ndash950 1996
[33] A Linden O Mayans W Meyer-Klaucke G Antranikian andM Wilmanns ldquoDifferential regulation of a hyperthermophilic120572-amylase with a novel (CaZn) two-metal center by zincrdquoTheJournal of Biological Chemistry vol 278 no 11 pp 9875ndash98842003
[34] A Burhan U Nisa C Gokhan C Omer A Ashabil and GOsman ldquoEnzymatic properties of a novel thermostable ther-mophilic alkaline and chelator resistant amylase from analkaliphilic Bacillus sp isolate ANT-6rdquo Process Biochemistryvol 38 no 10 pp 1397ndash1403 2003
[35] M V Ramesh and B K Lonsane ldquoSolid state fermentationfor production of higher titres of thermostable alpha-amylasewith two peaks for pH optima by Bacillus licheniformis M27rdquoBiotechnology Letters vol 11 no 1 pp 49ndash52 1989
[36] R Lifshitz and A Levitzki ldquoIdentity and properties of thechloride effector binding site in hog pancreatic 120572-amylaserdquo Bio-chemistry vol 15 no 9 pp 1987ndash1993 1976
[37] K Saha S Maity S Roy et al ldquoOptimization of amylaseproduction from B amyloliquefaciens(MTCC 1270) using solidstate fermentationrdquo International Journal of Microbiology vol2014 Article ID 764046 7 pages 2014
