Retrospective Theses and Dissertations Iowa State University Capstones, Theses andDissertations
2001
Response of plant growth and development todifferent light conditions in three model plantsystemsHanhong BaeIowa State University
Follow this and additional works at: https://lib.dr.iastate.edu/rtd
Part of the Molecular Biology Commons
This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State UniversityDigital Repository. It has been accepted for inclusion in Retrospective Theses and Dissertations by an authorized administrator of Iowa State UniversityDigital Repository. For more information, please contact [email protected].
Recommended CitationBae, Hanhong, "Response of plant growth and development to different light conditions in three model plant systems " (2001).Retrospective Theses and Dissertations. 911.https://lib.dr.iastate.edu/rtd/911
INFORMATION TO USERS
This manuscript has been reproduced from the microfilm master. UMI films
the text directly from the original or copy submitted. Thus, some thesis and
dissertation copies are in typewriter face, while others may be from any type of
computer printer.
The quality of this reproduction is dependent upon the quality of the
copy submitted. Broken or indistinct print, colored or poor quality illustrations
and photographs, print bleedthrough, substandard margins, and improper
alignment can adversely affect reproduction.
in the unlikely event that the author did not send UMI a complete manuscript
and there are missing pages, these will be noted. Also, if unauthorized
copyright material had to be removed, a note will indicate the deletion.
Oversize materials (e.g., maps, drawings, charts) are reproduced by
sectioning the original, beginning at the upper left-hand comer and continuing
from left to right in equal sections with small overlaps.
Photographs included in the original manuscript have been reproduced
xerographically in this copy. Higher quality 6" x 9" black and white
photographic prints are available for any photographs or illustrations appearing
in this copy for an additional charge. Contact UMI directly to order.
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, Ml 48106-1346 USA
800-521-0600
Response of plant growth and development to different light conditions
in three model plant systems
By
Hanhong Bae
A dissertation submitted to the graduate faculty
in partial fulfillment of the requirement for the degree of
DOCTOR OF PHILOSOPHY
Major: Genetics
Major Professors: Richard B. Hall and Steven R. Rodermel
Iowa State University
Ames. Iowa
2001
Copyright © Hanhong Bae, 2001. All rights reserved.
UMI Number: 3003224
UMT UMI Microform 3003224
Copyright 2001 by Bell & Howell Information and Learning Company. All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
Bell & Howell Information and Learning Company 300 North Zeeb Road
P.O. Box 1346 Ann Arbor, Ml 48106-1346
ii
Graduate College Iowa State University
This is to certify that the Doctoral dissertation of
Hanhong Bae
has met the dissertation requirements of Iowa State University
Co-major Professor
Co-major Professor
For the Major Program
For'the Gr^dtfafe College
Signature was redacted for privacy.
Signature was redacted for privacy.
Signature was redacted for privacy.
Signature was redacted for privacy.
iii
TABLE OF CONTENTS
ABSTRACT
CHAPTER 1. INTRODUCTION 1 Dissertation Organization 1 Literature Review 1 Literature Cited 23
CHAPTER 2. COMPETITION RESPONSES OF WHITE ASPEN TO 37 RED:FAR-RED LIGHT
Abstract 37 Introduction 38 Materials and Methods 41 Results 44 Discussion 45 Literature Cited 48
CHAPTER 3. IMMUTANS AND GHOST ARE PLASTID QUINOL OXIDASES: EVIDENCE FOR A NEW STRUCTURAL MODEL OF THE MITOCHONDRIAL ALTERNATIVE OXIDASE 60
Abstract 60 Introduction 61 Materials and Methods 63 Results 65 Discussion 70 References 75
CHAPTER 4. PLASTID-TO-NUCLEUS SIGNALING: THE IMMUTANS GENE OF ARABIDOPSIS CONTROLS PLASTID DIFFERENTIATION AND LEAF MORPHOGENESIS 88
Abstract 88 Introduction 89 Results 92 Discussion 97 Materials and Methods 103 Literature Cited 107
CHAPTER 5. GENERAL SUMMARY 128 General Conclusions 128 Literature Cited 130
ACKNOWLEDGEMENTS 132
iv
ABSTRACT
Shade avoidance response to the reduced ratio of red:far-red (R:FR) light was studied
in a white aspen Populus alba clone 'Bolleana' using two filter systems: a clear plastic filter
system that allows a R:FR ratio less than 1.0 to pass from adjacent border plant reflection;
and a special commercial plastic that blocks FR light and creates a R:FR ratio above 3.0.
The response to low R:FR The reduced R:FR signals enhanced the stem elongation in
response to competition at the expense of relative stem diameter growth. Trees grown inside
clear chambers were 27% taller and 22% heavier in stem dry weight than trees grown inside
the FR-blocking filter chambers. Stem taper of clear chamber trees was 16% less than the
FR-blocking filter trees. Low R:FR also induced 13% greater petiole length per leaf
compared to the FR-blocking filter trees.
The immutans (im) variegation mutant of Arabidopsis has green and white leaf
sectors due to the action of a nuclear recessive gene. IM is a chloroplast homolog of the
mitochondrial alternative oxidase. The ghost (gh) variegation mutant of tomato bears
phenotypic similarities to im. We show that the im and gh phenotypes arise from mutations
in orthologous genes. Structural analyses reveal that AOX, IM and GH are RNR R2 di-iron
carboxylate proteins with perfectly conserved Fe-coordinating ligands that define a quinol-
binding catalytic site. IM has a global impact on plant growth and development and that it is
V
required for the differentiation of multiple plastid types. IM transcript levels do not
necessarily correlate with carotenoid pool sizes, raising the possibility that IM function is not
limited to carcinogenesis. Leaf anatomy is radically altered in the green and white sectors
of im. The green im sectors have significantly higher than normal rates of O? evolution and
significantly elevated chlorophyl a/b ratios, typical of those found in "sun" leaves. We
conclude that IM and GH are plastid quinol oxidases that act downstream from a quinone
pool to dissipate electrons in plastids. In addition, im interrupts plastid-to-nucleus signaling
pathways that control Arabidopsis leaf developmental programming.
1
CHAPTER 1. GENERAL INTRODUCTION
Dissertation Organization
Due to funding circumstances and a desire to explore different areas, I worked on
three different plant systems. I used a tree system to study the growth changes in response to
altered light condition. Herbaceous plants (tomato and Arabidopsis) were used to learn
molecular techniques, interpretations, and knowledge. This dissertation consists of five
chapters, three of which are formatted for submission to specific journals. Chapter 1 is a
general introduction that reviews the literature pertinent to the research performed. This
chapter includes the nature of the plant responses to the changed red:far-red photon flux
ratio, tomato ghost and Arabidopsis immutans variegation mutants, carotenoid biosynthesis,
and the proposed mechanisms of variegation in ghost and immutans. Chapter 2 includes the
changes in growth traits in the shade avoidance response of Populus alba clone 'Bolleana'.
Chapter 3 focuses on the cloning, characterization and a structural model of GHOST. In
chapter 4, the biological function of IMMUTANS is examined by studying its expression
pattern and anatomical features. Chapter 5 is an overall summary of the findings.
Literature Review
Light environment
Light has properties of both waves and particles (Taiz and Zeiger, 1998).
Wavelength is the distance between successive wave crests. The frequency is the number of
2
wave crests that pass in a given time. Light particles, photons, of different wavelengths are
characterized by their quantum level. There are three important parameters to understand
with respect to light: 1) quantity, 2) quality and 3) spectral distribution (Hopkins, 1998).
Light quantity is a fluence and is expressed as photon numbers or quanta (in moles). The
total number of photons incident on surfaces is called photon fluence (mol m"2). Photon
fluence rate (mol m"2 s"1) is commonly used in plant research. Sunlight contains a spectrum
of photons with different frequencies. While the range of sunlight wavelengths is between
290 to 3000 nanometer (nm), plants use radiation energy only from 380 to 730 nm. The
range between 400-700 nm is known as photosynthetically active radiation (PAR) (Larcher,
1995; Hopkins, 1998; Taiz and Zeiger, 1998).
Phytochrome system as a sensor of R:FR
Plants use light as a source of energy for photosynthesis, a time-keeping mechanism,
and as information to detect the proximity of neighbors. There are at least three
photoreceptors in plants to perceive information about their light environment, each
specifically absorb different spectral ranges: red:far-red (R:FR)-sensing phytochromes,
blue/UV-A photoreceptors, and UV-B photoreceptors (Kendrick and Kronenberg, 1994).
Phytochromes can detect R:FR (665-670 / 730-735 nm) fluctuations and provide important
information to a plant: 1) the length of the diurnal dark period, 2) potential and actual
shading by other vegetation, 3) depth of immersion in water. According to many
experiments, the phytochrome system is responsible for monitoring the changes in R:FR and
initiating the shade avoidance response (reviewed in Kendrick and Kronenberg, 1994; Casal
and Smith, 1989; Smith and Whitelam, 1990). In addition, phytochromes absorb red and far-
3
red light most strongly and have important roles in light-regulated vegetative and
reproductive development.
Phytochromes are blue protein pigments with molecular mass around 125 kD.
Pytochromes are encoded by a multigene family and each phytochrome acts independently of
the others, sometimes redundantly, and sometimes antagonistically. Whereas only three
genes (PHYA, B1 and B2) have been discovered in Populus trichocarpa and Populus
balsamifera, five genes {PHYA, B, C, D and E) have been reported in Arabidopsis (Sharrock
and Quail, 1989; Howe et al., 1998). There are two types of phytochromes (Taiz and Zeiger,
1998). Phytochrome A belongs to type I that is transcriptionally active in the dark, but the
expression is strongly inhibited in the light. In dark-grown plants, phytochrome A is the
most abundant phytochrome. Expression of phytochrome A is negatively regulated in the
light and phytochrome A protein is degraded in the light. The rest of the phytochromes (B-
E) belong to type II that are detected both in the green and etiolated plants. The expression
of type II phytochrome is not significantly changed by light. The Pfr form of type II
phytochromes is more stable than the Pfr form of phytochrome A.
Phytochrome is produced in the red light-absorbing form called Pr in dark-grown
plants. The Pr form is converted to a far-red light-absorbing form called Pfr by red light. Pfr
is the physiologically active form of phytochrome. Photoreversibility is the most distinctive
characteristic of the photoreceptor (Kendrick and Kronenberg, 1994; Taiz and Zeiger, 1998).
Significant amount of absorbance spectra of the two forms overlap each other in the red
region, while the Pr form absorbs a small amount of light in the far-red region. When Pr
forms are exposed to red light, most of them are converted to Pfr form. However, some of
the converted Pfr form absorbs red light and is converted back to Pr form, because both
4
forms absorb red light. Similarly, it is impossible to convert Pfr entirely to Pr by far-red
light. A phytochrome response is not quantitatively related to the absolute amount of Pfr. It
has been suggested that the ratio between Pfr and the total amount of phytochrome
(Pfr/Ptotal) determines the magnitude of the response. Lower ratios of R:FR convert greater
portions of Pfr into the Pr form generating reduced ratios of Pfr/Ptotal. This kind of
reduction was also reported in field experiments with tree species. Higher density canopies
produced lower ratios of Pfr/Ptotal in Populus trichocarpa x deltoides 'Beaupré' and
Douglas-fir seedlings (Gilbert et al., 1995; Ritchie, 1997). Negative linear relationships were
found between stem growth rate and plant spacing or Pfr/Ptotal. Therefore, the red and far-
red wavelengths of light function as a signal for plants to adjust to the environment through
modification in growth.
Shade avoidance syndrome is controlled by multiple phytochrome species
Multiple phytochromes are involved in the shade avoidance response. This has been
established through studies of phytochrome deficient mutants, especially in Arabidopsis.
Arabidopsis is a typical shade avoidance plant that shows reduced cotyledon and leaf
expansion and elongated hypocotyl and petiole growth under low R:FR (Morelli and Ruberti,
2000). A phytochrome A deficient mutant grown in the light showed a similar phenotype to
wild type and this mutant did not respond to FR-rich light (Johnson et al., 1994). This
indicates that phytochrome A is not normally important in the shade avoidance response.
This may be due to the light instability property of phytochrome A. Phytochrome B deficient
mutants of Arabidopsis showed elongated growth and early flowering, which are
characteristics of the shade avoidance syndrome of wild type seedlings grown under a low
5
R:FR light environment (Nagatani et al., 1991; Reed et al., 1993). This indicates that the
phytochrome B signal is responsible for the inhibition of hypocotyl elongation and has a
major role in the shade avoidance response. In addition, the phytochrome B null mutants
showed more elongation growth and early flowering under FR-rich light than phytochrome B
null mutants grown in normal light environment. This indicates that other phytochromes are
also involved in the shade avoidance response (Smith and Whitelam, 1997). The function of
phytochrome C is still unknown in shade avoidance response due to the lack of phytochrome
C null mutants (Morelli and Ruberti, 2000). However, a reduced level of phytochrome C
was detected in the Arabidopsis phytochrome B mutant, which indicates that the phenotype
of the mutant may result in part from the reduced phytochrome C (Hirschfeld et al., 1998).
Phytochrome D mutants showed increased hypocotyl elongation and decreased cotyledon
expansion under continuous high R:FR (Aukerman et al., 1997). Phytochrome B and D
double mutants displayed enhanced elongation of petioles and early flowering than did
phytochrome B mutants, indicating that phytochrome D also has a role in shade avoidance.
Double mutants of phytochrome B and E had longer petioles and flowered earlier than did
phytochrome B mutants (Devlin et al., 1998). This also indicates the involvement of
phytochorme E in the regulation of shade avoidance.
Competition changes growth traits
Competition occurs between individual plants as they expand in size to capture more
resources from limited amounts of light, water, and nutrients to colonize a location (Lemaire
and Millard, 1999). As a result of competition, plants change their growth characteristics,
such as leaf structure and angle, stem growth and form, branching, branching angle, root
6
growth, and biomass allocation (Larcher, 1995; Ritchie, 1997). Tree leaves are able to
change their position with respect to light in order to capture maximum light energy for
photosynthesis (Larcher, 1995). The number of branches and branching angle are also
influenced by competition (Heilman et al., 1993; Ceulemans, 1990).
Competition response varies according to the species and genetic background. Most
studies have been done in herbaceous plants. The most common response of shade
avoidance is extra elongation growth in intemodes. The elongation growth is also observed
in the hypocotyl and petioles. Most herbaceous plants show elongation growth at the
expense of leaf development and branching. However, different shade avoidance responses
have been reported in tree species. In coastal Douglas-fir (Pseudotsuga menziesii) seedlings,
crown biomass and branch number increased with decreasing growing space (Ritchie, 1997).
Although leaf numbers were reduced in more dense canopies in Populus trichocarpa x
deltoides 'Beaupré' trees, more leaf area and dry weight were reported (Gilbert et al., 1995).
In accordance with the above results, other studies reported that young trees in high density
plantations usually show rapid height growth that occurs long before actual shading
(Cameron et al., 1991; DeBell and Giordano, 1994; Knowe and Hibbs, 1996; Scott et al.,
1992).
The altered R:FR affects hormone levels
The shade avoidance response that causes organs to expand or elongate, is dependent
on the action of phytohormones (Morelli and Ruberti, 2000). Gibberellin biosynthesis
appears to be controlled by the phytochromes during seed germination, seedling growth, and
photoperiodic induction of flowering (Kamiya and Garcia-Martinez, 1999). Gibberellin is
7
produced in higher levels in low R:FR, which leads to the intemode elongation, cell
extension and cell division, and leaf development (Weller et al, 1994; Beall et al., 1996).
Stem elongation and cell expansion are strongly correlated with gibberellin, but dry weight
deposition is not related to gibberellin concentration (Potter et al., 1999). Overexpression of
oat phytochrome A in aspen (Populus tremula x tremuloides) led to the reduction of
gibberellin and IAA levels in apical leaf and stem tissues, indicating that phytochrome A and
Pfr/Ptotal can control gibberellin and IAA metabolism (Olsen et al., 1997).
Auxin is also an important phytohormone that regulates cell division, cell elongation,
and cell differentiation (e.g., vascular tissue) (Taiz and Zeiger, 1998). Auxin synthesis
occurs in apical meristems and young leaves and is transported to the root tips through the
vascular system. Auxin is also an important component of the elongation process that is
induced by shade. Stem elongation that is regulated by phytochrome is partly the result of
changes in IAA levels; an auxin response deficient mutant did not elongate significantly in
response to FR-rich light (Behringer and Davies, 1992). In addition, treatments with an
auxin transport inhibitor reduced hypocotyl elongation in FR-rich light (Steindler et al.,
1999). It has been hypothesized that higher lateral transport of auxin to epidermal and
cortical cells occurs in the hypocotyl of shaded seedlings at the expense of auxin transport
through the developing vascular system. This leads to elongation of these tissues and
reduces the vascular differentiation and root auxin concentration, which causes the reduction
in lateral root formation and eventually primary root growth (Morelli and Ruberti, 2000).
8
Variegation mutants
Plant pigments are essential for the capturing of light energy for photosynthesis. The
main pigments in this regard are the green chlorophylls and carotenoids, which exist inside of
plastids. In addition to light harvest, carotenoids are also important in preventing
photooxidation. Plants turn into albinos and they can not survive. Because albino plants are
not suitable for developmental investigations, variegated plants have been used for such
studies. Plastid development could be affected by three genomes: nuclear, mitochondrial and
plastid genomes. Therefore, variegation phenotypes could be generated by mutations within
any one of the genomes. Nuclear-encoded proteins are essential for plastid development and
function, indeed, most plastid proteins are encoded by the nuclear genome. Defective
mitochondria might have problems in generating energy and precursors for plastid
development resulting in a variegated phenotype (Raghavendra et al., 1994). Thus,
variegated mutants are an excellent system to study nuclear-organellar communication.
Variegation due to genetic damage in the organelle genome
There are two types of mutants in this category: defective in 1) plastid genome and 2)
mitochondrial genome. In both cases, the causal effect of the defective organelle can be a
recessive nuclear gene, but these can also be caused by organelle mutation.
The maize iojap (ij) mutant produces striped plants with normal chloroplasts in green
tissues and poorly developed chloroplasts in the white tissues (Walbot et al., 1979; Coe et al.,
1988; Han et al., 1992; Byrne and Taylor, 1996). IJ gene encodes a 24.8-kD protein that is
associated with the 50S subunit of chloroplast ribosome (Han et al., 1995). The albostrians
mutant of barley is another example of a nuclear recessive gene that causes plastid genome
9
mutation. The plastids of this mutant lack ribosomes and photosynthetic activity. Plastids
have impaired membrane structures in white sectors (Hedtke et al., 1999; Hess et al., 1994).
The plastome mutator (pm) of Oenothera hookeri causes deletions and duplications in the
plastid genome (Stubbe et al., 1982; Johnson et al., 1991; Stoike and Sears, 1998). The
mutant is chlorotic and the plastid internal membrane is impaired. Stoike and Sears (1998)
proposed that PM might encode a protein that affects the helicity or rigidity of the plastome.
Another type of mutation is due to a mutation in a recessive nuclear gene that
generates abnormal nonfunctional mitochondria. Chloroplast mutator (chm) of Arabidopsis
shows rearrangements in two mitochondrial DNA fragments associated with RPS3-RP115
genes that encode ribosomal proteins S3 and L16, respectively (Martinez-Zapater et al.,
1992; Sakamoto et al., 1996). Nonchromosomal stripe mutants of maize (NCS) show yellow
stripes on leaves due to mitochondrial DNA mutations (Newton et al., 1986). MCS2 has a
mutation in NAD4-NAD7 mitochondrial genes that encode subunits of complex I (NADH
dehydrogenase) of the mitochondrial electron transfer chain, resulting in the reduced
complex I function (Marienfeld and Newton, 1994). Mitochondrial cytochrome oxidase
subunit 2 (COX2) gene is partially deleted in NCS5 and NCS6 (Newton et al., 1990; Lauer et
al., 1990, respectively). It is not clear how mutated mitochondrial genome affects the
chloroplast development. The explanation might be that mitochondria provide energy and
biosynthetic precursors for chloroplast development (Raghavendra et al., 1994).
Variegated mutants that have normal organelle DNA
Arabidopsis var2 is one of the examples of this type of mutation, which displays
green and yellow sectors in leaves (Chen et al., 1999). The white sectors contain non-
10
pigmented plastids with unorganized lamellar structures. VAR2 has similarity to the FtsH
family of AAA proteins (ATPases associated with diverse cellular activities). It is an ATP-
dependent metalloprotease and functions in membrane associated events. Chen et al. (1999)
suggested that VAR2 may mediate thylakoid membrane biogenesis in early stages through
vesicle fusion.
Arabidopsis immutans (im) and tomato ghost (gh) are other examples of this type of
mutants. Both mutants share common characteristics: I) caused by nuclear recessive gene;
2) light sensitivity in white sector formation; 3) phytoene accumulation and impaired internal
membrane of chloroplasts in white tissues (Rick et al., 1959; Rédei et al., 1963; Rédei et al.,
1967; Scolnik et al., 1987; Wetzel et al., 1994; Wu et al., 1999). IM shows similarity to the
alternative oxidase (AOX) of the mitochondrial respiratory pathway (Wu et al., 1999). I
found that the gh mutant phenotype is caused by an IM homolog (Chapter 3). Both mutant
phenotypes occur due to a block in carotenoid biosynthesis and/or plastid development.
Carotenoids
Carotenoids, C40 terpenoid compounds, are synthesized in all photosynthetic and
some of non-photosynthetic organisms. There are over 600 different, naturally-synthesized
carotenoids (Pogson et al, 1998). In plants, carotenoids are yellow, orange, and red pigments
that are synthesized in the plastids (reviewed in Cunningham and Gantt, 1998). In
chloroplsts, carotenoids are located in the photosynthetic membranes in the form of
chlorophyll-carotenoid-protein complexes, which serve in light harvesting, in
photoprotecting, and as stabilizers of the three-dimensional integrity of the light-harvesting
complexes (LHCs) and photosystem II (Green and Dumford, 1996; Havaux, 1998;
11
Vishnevetsky et al., 1999). Carotenoids are accumulated in membranes, oil bodies, or other
structures within the stroma of chromoplats of ripening fruits and flower petals and the
chloroplasts of senescing leaves. They also serve as precursors for the plant growth regulator
abscisic acid, and as coloring agents to attract pollinators and as seed dispersal agents in
flowers and fruits (Demmig-Adams et al., 1996; Walton and Li, 1995). Carotenoids are also
precursors of vitamin A in humans and animals (Krinsky et al., 1994).
In the absence of colored carotenoids, plants have an albino phenotype due to the
destruction of chlorophyll by photooxidation. Carotenoids have many important roles in the
prevention of photooxidation. In general, harmful oxidizing molecules are produced from
three sites of the photosynthetic apparatus: the light-harvesting complex (LHC) of
photosystem II, the photosystem II reaction center, and the acceptor side of photosystem I.
Xanthophylls bind to the LHC proteins of photosystem II and efficiently quench excited
triplet chlorophylls (3Chl) and 'Oi (Kiihlbrandt et al., 1994). (3-carotene in the photosystem
II reaction center also can quench lOi that is generated through interactions between 3P680
(3Chl dimer) and Oi (Telfer et al., 1994). De-epoxidized xanthophyll pigments can carry out
thermal dissipation and quench lChl in the photosystem II antenna (Gilmore, 1997). On the
acceptor side of photosystem I, superoxide anion radical (O2") can be generated by reduction
of O2, and O2' can be metabolized to toxic reactive oxygen species (H2O2 and hydroxyl
radical (OH )) (Asada, 1994; Mehler, 1951).
The extent of photooxidation is increased when the absorbed light energy exceeds the
maximum utilization capacity of photosynthesis. Photosystem II is a main target for
photooxidation. In this process, lipids, proteins, and pigments are oxidized by 'Ot (Anderson
et al., 1998; Andersson and Barber, 1996; Barber and Andersson, 1992; Knox and Dodge,
12
1985). Due to the unsaturated fatty acid side chains, the thylakoid membrane is vulnerable to
lC>2 attack resulting in reducing hydroperoxides that initiate peroxyl radical chain reactions.
On the acceptor (stromal) side of photosystem I, the key enzymes of photosynthetic carbon
metabolism can be damaged by O2", H2O2, and OH (Asada, 1994; Kaiser, 1979).
Carotenoid biosynthesis pathway
The lipid-soluble carotenoid pigments are synthesized by the isoprenoid biosynthetic
pathway (McGarvey and Croteau, 1995; Cunningham and Gantt, 1998). The 5-carbon
isopentenyl pyrophosphate (IPP) is the building block of all isoprenoid compounds. IPP
isomerase (IPS) catalyzes the formation of dimethylallyl pyrophosphate (DMAPP) from IPP.
Geranylgeranyl pyrophosphate (GGPP) synthase (GGPS) catalyzes the addition of three IPP
molecules to one DMAPP to form the C20 compound, GGPP. From immunogold
cytochemistry, GGPS was found to be concentrated in the developing stroma globli of pepper
fruit, where carotenoid accumulation occurs during fruit ripening (Cheniclet et al., 1992).
Pepper GGPS mRNA reaches a maximum at the early ripening stage and decreases in very
ripe fruit, however, enzyme activity increases throughout fruit ripening (Kuntz et al., 1992).
This indicates GGPS gene expression is under post-transcriptional control. The first
colorless C40 carotenoid, phytoene, is formed from two molecules of GGPP by phytoene
synthase (PSY). PSY from pepper chromoplasts was purified as a soluble, monomelic
polypeptide (Dogbo et al., 1988). PSY is thought to be loosely associated with chloroplast or
chromoplast membranes and phytoene is delivered to the plastid membranes for production
of further step products of the pathway (Bartley et al., 1991; Schledz et al., 1996).
13
Phytoene turns into the red pigment, lycopene, by four consecutive desaturation
reactions forming carbon-carbon double bonds. The desaturation reactions are catalyzed by
two enzymes in plants: two membrane-associated enzymes, phytoene desaturase (PDS) and Ç
-carotene desaturase (ZDS) (Beyer et al., 1989). Phytofluene and Ç-carotene are the products
of the phytoene desaturation reaction, and neurosporene and lycopene are the products of the
ZDS reaction. PSY and PDS transcript levels are highest in flower petals and ripening fruits
(Giuliano et al., 1993). During flower development, PSY and PDS increase more than 10-
fold immediately before anthesis. During fruit ripening, PSY increases more than 20-fold,
but PDS increases only 3-fold. Both transcripts are also detected in the root; this organ
contains the lowest carotenoid amounts. There is no light effect on the expression of either
PSY or PDS. Two forms of PDS have been reported: one soluble and inactive, the other
membrane-bound and active (Al-Baili et al., 1996). For PDS to be active, FAD binding is
required. Electrons liberated during double-bond formation are transferred to membrane-
bound quinones from the PDS-FAD/FADHi complex (Mayer et la., 1990; Nievelstein et al.,
1995; Noms et al., 1995). The requirement of quinones for PDS activity was recognized in a
study of a quinone biosynthesis mutant in Arabidopsis; phytoene accumulates in this mutant
(Norris et al., 1995). PDS also requires NADPH and oxygen for its activity. Based on all of
these data, it has been suggested that phytoene desaturation is carried out by a redox chain
between phytoene and oxygen.
Cyclization of lycopene synthesizes either a-carotene or ^-carotene through lycopene
^-cyclase (LCYB) and lycopene E-cyclase (LCYE). LCYB catalyzes the formation of
bicyclic ^-carotene from the linear, symmetrical lycopene (Hugueney et al., 1995;
14
Cunningham et al., 1996; Pecker et al., 1996). (3-carotene has two P-rings that are generated
by LCYB. (3-carotene is the precursor for the carotenoids that are commonly found in the
photosynthetic apparatus of plants, a-carotene has one P and one a-ring, which are
generated by LCYB and LCYE, respectively, a-carotene is the immediate precursor of lutein
that is the predominant carotenoid in the photosynthetic membranes of green plants. The
only difference between the (3 and a rings is the position of the double bond within the
cyclohexene ring. Further hydroxylation of each ring of the hydrocarbons of a-carotene and
P-carotene by CHYE and CHYB produces the xanthophyll pigments lutein and zeaxanthin,
respectively. The relative amounts of the P, P-carotenoids (e.g. P-carotene, zeaxanthin,
antheraxanthin, and violaxnthin) versus P, a-carotenoids (e.g. lutein) is determined by the
relative amounts and/or activities of LCYB and LCYE. In the lutein deficient mutants (lutl
and lut2), which have mutations in CHYE and LCYE, respectively, P, P-carotenoids are
significantly higher than P, a-carotenoids, and this results in the functional compensation of
lutein by other xanthophylls, in particular violxanthin and antheraxanthin (Pogson et al.,
1996; Pogson et al., 1998).
The epoxidation of zeaxanthin forms violaxanthin via antheraxanthin, and the de-
epoxidation of violaxanthin regenerates zeaxanthin. These conversions are referred to as the
xanthophyll cycle (Yamamoto and Bassi, 1996). The main function of the xanthophyll cycle
is to protect the photosynthetic apparatus from excessive light and oxidative stress (Demmig-
Adams and Adams, 1990; Owens, 1994; Havaux and Niyogi, 1999). Xanthophylls are the
most abundant carotenoids in the photosynthetic thylakoid membranes of plants. Neoxanthin
is generated by an additional rearrangement of violaxanthin. The violaxanthin and
15
neoxanthin are the precursors for biosynthesis of the plant growth regulator, abscisic acid
(ABA) (Zeevaart and Creelman, 1988).
Cummingham and Gantt (1998) suggested that carotenogenic complexes are
organized into supercomplexes. The first one is the soluble enzyme complex that consists of
one IPS, two copies of GGPS, and one PSY; the final product of this complex is phytoene.
The other complex is a plastid membrane-associated enzyme complex that consists of two
copies of each desaturase (PDS and ZDS) and two copies of the cyclase subunits (LCYB and
LCYE). The soluble complex is actually proposed to be loosely associated with membranes
so that PSY can easily transfer phytoene to the membrane-associated enzyme complex to
perform further desaturation and hydroxylation reaction.
Respiration and alternative oxidase
During respiration, the six-carbon sugar, glucose, is oxidized generating H?0, CO]
and ATP (reviewed in Taiz and Zeiger, 1998). In the inner mitochondrial membrane, there is
an electron transport chain that transfers electrons from NADH (and FADHi), produced
during glycolysis and the tricarboxylic acid (TCA) cycle, to oxygen. During electron
transfer, a large amount of free energy, ATP, is produced. There are four multiprotein
complexes that are localized in the inner mitochondrial membrane. Electrons from NADH
are oxidized by complex I (NADH dehydrogenase) and electrons are transferred to
ubiquinone. Ubiquinone is similar chemically and functionally to plastoquinone in the
photosynthetic electron transport chain. Electrons derived from the oxidation of succinate by
Complex II (succinate dehydrogenase) are transferred to ubiquinone. Complex III
(ubiquinol:cytochrome c oxidoreductase) oxidizes the reduced ubiquinone (ubiquinol) and
transfers the electrons to complex IV (cytochrome c oxidase) via cytochrome c. Complex IV
transfers the electrons to O2 and generates H2O.
There are two electron transport pathways that transfer electrons from ubiquinone to
O2 in the respiration pathway (reviewed in Vanlerberghe and Mcintosh, 1997). The first
pathway is the cytochrome pathway, and it is inhibited by cyanide and uses cytochrome c
oxidase (complex IV) as a terminal oxidase. The second pathway is the alternative pathway,
and it is inhibited by salicylhydroxamic acid and uses alternative oxidase (AOX) as a
terminal oxidase. Electron transport through the alternative pathway generates heat instead
of ATP. Heat volatilizes aromatic chemicals to attract pollinators during voodoo lily floral
development (Meeuse, 1975; Meeuse and Buggeln, 1969). The physiological function of the
alternative pathway is unclear, but stresses such as chilling, drought, and osmotic stress
activate the alternative pathway (Wagner and Krab, 1995). Since over-reduction of the
ubiquinone pool occurs in the presence of these stresses, and because over-reduction is able
to generate harmful reactive oxygens, a possible function of the alternative pathway is that it
prevents ubiquinone from over-reduction by removing electrons and transferring then to O2
(Mcintosh, 1994; Vanlerberghe and Mcintosh, 1996).
Tomato ghost mutant
The gh mutant arose spontaneously and has two independent origins. The first one
arose from a hybrid between a line of 'San Marzano' and another line with Verticillium-wilt
resistance in cultures in 1953 at the Agricultural Experiment Station, Davis, California (Rick
et al., 1959). Selfed hétérozygotes segregated in a Mendelian fashion generating about 3
normal to 1 gh, and reciprocal crosses between gh and normal generate only normal
17
progenies. This indicates that the gh phenotype is controlled by a single nuclear recessive
gene. The second allele of gh was reported in 1953 from the variety 'Stokesdale' at the
Illinois Agricultural Experiment Station, Urbana, Illinois (Rick et al., 1959). Allelism tests
confirmed that both mutants are in the same gene (ghost or gh).
The phenotype of gh was examined by Rick et al. (1959) and the following
description of gh is according to their findings unless mentioned separately. The cotyledons
and hypocotyls are variegated or totally white. The degree of variegation is enhanced by
elevated light intensity. In general, gh cotyledons are smaller than wild type. While the
cellular organization of green sectors of gh cotyledon is normal, palisade pigmentation in the
paler sectors is less intense and there are less chloroplasts. The chloroplasts in the white
sectors do not have organized internal membranes and have large vacuoles.
All vegetative tissues of gh seedlings are variegated. Longitudinal streaks are formed
on the stem, petioles, and peduncles of gh plants. These streaks are mostly limited to a single
subepidermal layer of cells, which suggests that the green streaks are derived from one or
several primordial cells that contains normal chloroplasts. Green islands on leaves have
irregular swollen masses of large undifferentiated cells. Epidermal cells of white sectors are
irregularly-shaped and much larger than normal. The internal parenchymas of white sectors
are not differentiated into palisade and spongy layers. While cells in the palisade are
elongated and larger than normal, cells in the vascular bundles are smaller than normal.
Other organs of gh mutants (roots, stems, and petioles) are relatively unaffected in terms of
morphology (Scolnik, et al., 1986). gh green cotyledons and leaves contain colored
carotenoids and chlorophylls, while the colorless carotenoid (phytoene) accumulates in the
white leaves. While the ultrastructure of plastids from white leaves contain no internal
18
membrane structures, normal chloroplasts are found in green leaves of gh (Scolnik et al.,
1986).
The yellow color of petals of tomato flowers is due to carotenoid accumulation, but
gh petals are variegated, with strong yellow stripes along the midrib, and a loss of
pigmentation at the margins of petals (Scolnik, et al., 1986). The flowers from the white
branches usually fail to open, but the pollen from these flowers are viable. The size of gh
fruits is proportional to the degree of greening in the corresponding branch, which is
probably due to the availability of nutrient from the branch. Fruits are usually white before
reaching the ripe stage and turn yellow and finally orange with normal softening. Fruits
arising from green branches reach almost wild type size.
Impaired plastid structures are also found in the white fruits of gh, similar in
structures of those in white leaves. That is, thylakoid membrane structures are not developed
in white fruit, but osmiophilic globules are detected, which might be the site of phytoene
accumulation.
Arabidopsis immutans mutant
Cells in the white tissues of im are heteroplastic, that is, they contain predominantly
abnormal plastids but also a few normal-appearing plastids (Wetzel et al., 1994). The
heteroplastidic condition has not been detected in gh white tissues. White reproductive bolts
of im can produce progenies that are green, white, or variegated, depending on growth
conditions of light and temperature. Due to this reversibility, Rédei (1975) called the mutant
immutans for "immutable" in Latin. The defective plastids are not maternally-inherited
indicating that the mutation is not in the organelle genome (Wetzel et al., 1994).
19
Wu et al. (1999) cloned the IM gene, and found that it codes for a protein with a high
similarity to AOX. However, IM does not have the two conserved cystein residues that are
responsible for dimerization and regulation of enzyme activity. In addition, the IM protein is
imported into the chloroplast and inserted into the thylakoid membrane, while AOX is an
inner mitochondrial protein (Carol et al., 1999). Also, phylogenetic analyses show that IM is
distantly related to AOX, indicating that IM is a novel type of chloroplast AOX. IM shares
conserved domains, such as membrane domains and iron-binding domains. However, recent
analysis with many AOX sequences shows that AOXs are interfacial proteins rather than
proteins having transmembrane domains (Andersson and Nordlund, 1999).
IM affects phytoene desaturase activity
White sector formation is due to the lack of phytoene desaturase (PDS) activity in
Arabidopsis im (Wu et al., 1999). In im white tissues, phytoene is accumulated, but the PDS
protein is detected at wild type levels, which indicates that phytoene desaturase is inactive in
the white tissues (Wetzel and Rodermel, 1998). Chemical treatments that block carotenoid
biosynthesis at later step of carotenogenesis also leads to albino phenotype, but do not cause
phytoene accumulation (Sandmann and Boger, 1989). This result indicates that phytoene
accumulation due to PDS inactivation is not the direct result of photooxidation. According to
precursor-feeding experiments, chlorophyll synthesis is not blocked in im (Wetzel and
Rodermel, unpublished data). Thus, a lack of carotenoid accumulation causes either
inhibition of chlorophyll accumulation and/or photodestruction of chlorophyll.
20
Variegation model of immutans
Based on the sequence analyses of three im alleles, a functional IM protein is not
made in im mutants (Wu et al., 1999). Yet, even without a functional IM protein, im has
normal looking plastids in green sectors. This indicates that there is a redundant function that
can compensate for the IM deficiency in some cells and plastids. Wu et al. (1999)
hypothesized two working models for im variegation. The models were based on the
assumption that IM is one of the electron transport components in phytoene desaturation,
which is required for carotenoid biosynthesis during early chloroplast biogenesis. In the first
model, IM serves as a cofactor for PDS, which transfers electrons from PDS to plastoquinone
or generates water by accepting electrons directly from PDS. In the second model, IM acts
as a terminal oxidase of the plastoquinone pool and the redundant function is photosystem I.
During an early stage of thylakoid membrane development, PDS activity would be limited in
the absence of IM leading to the accumulation of phytoene because the redundant function is
inefficient in the first model or is not yet fully functional in the second model. In either case,
carotenoid biosynthesis is limited and an absence of carotenoids causes photooxidation under
high light conditions.
According to Wu et al. (1999), several factors control tissue-level sectoring in im.
First of all, the level of light illumination is important. Plant tissues, cells and plastids
receive different levels of illumination due to differences in the angle of incident light,
presence of shading structures, and thickness of tissue layers (reviewed in Smith et al., 1997).
The amount of existing thylakoid material that is from progenitors is another important
factor. The daughter plastids that are from white plastids are more vulnerable to
photooxidation due to the lack of electron transport capacity for PDS function. The
21
abundance and activities of components of carotenoid biosynthesis, such as electron transport
and radical scavenging are also different in cell levels. Overall, sector formation is due to an
interplay of the above factors. Even in the green plastids, electron transport capacity is less
than wild type plastids. Thus, lower illumination, more thylakoid material and carotenoid
biosynthesis components would increase the possibility of generating normal plastids and
green tissues.
Expression of PDS and PSY in ghost and immutans
Giuliano et al. (1993) compared the expression levels of PDS and PSY between gh
and wild type tomato leaves using reverse transcriptase-polymerase chain reaction (RT-PCR)
amplification assays. This was done because PSY and PDS mRNAs are not detectable by
northern blot analysis. The expression levels were the same in the green leaf sector of gh and
wild type leaves. They also compared the transcript levels of the white leaves of gh and
norflurazon-treated wild type seedlings. Norflurazon is an inhibitor of PDS activity that
results in the accumulation of phytoene and generation of white leaves. The expression of
PSY in white leaves was induced two- and three-fold in gh and norflurazon-treated wild type,
respectively. PDS was induced even more, both in gh white leaves and norflurazon-treated
white leaves (5 and 10 times, respectively). This induction might be for two reasons: 1)
photooxidation or 2) end-product regulation of carotenogenesis. In general, the transcription
of photosynthesis-related genes is depressed in photooxidative conditions (Giuliano and
Scolnik, 1988; Taylor, 1989). It is thought that a "plastid factor" is required for nuclear-
encoded plastid proteins and that the plastid factor is no longer produced in photooxidative
conditions (Taylor, 1989). While photooxidative stress acts as a negative regulator of genes
22
that encode chlorophyll binding proteins, other genes involved in the biosynthesis and
accumulation of carotenoids are induced (Sagar and Briggs, 1990; Tonkyn et al., 1992;
Guiliano et al., 1993). Another example of induction of PDS gene transcription by
norflurazon treatment was performed by Corona et al. (1996). In their experiment, a GUS
reporter gene was fused to 1.5 kb tomato PDS promoter and 0.5 kb 5' untranslated region and
expressed in tobacco seedlings. Treatment of the transgenic plants with norflurazon induced
PDS/GUS transgene expressing three-fold in the light, and two-fold in the dark in the
transgenic tobacco seedlings. The induction of PDS in the absence of light and chlorophyll
indicates that the PDS promoter is controlled by end-product regulation.
As mentioned above, in the previous studies, PDS mRNA levels are controlled by
end-product regulation (Giuliano et al., 1993; Corona et al., 1996). However, Wetzel et al.
(1998) found that PDS expression is independent of leaf pigment content in Arabidopsis.
PDS mRNA levels were not significantly different between wild type and im in any light or
pigment condition during the early stage of seedling development (6-day old). In mature
leaves of 4-week old seedlings, im accumulated more PDS mRNA than wild type in every
treatment by a factor of 2.2 (norflurazon > high light > low light). Interestingly, there was no
difference in PDS mRNA levels between im white and im green leaves grown under high
light conditions. Wetzel et al. (1998) explained the differences between im and gh in the two
experiments as difference in the normalization methods used to quantify RNA amounts.
Giuliano et al. (1993) normalized the RNA amount by total RNA per sample, while Wetzel et
al. (1998) used cytoplasmic 18S rRNA. Because photobleaching degrades chloroplast
ribosomes but not cytoplasmic ribosomes (Blume and McClure, 1980; Reiss et al., 1983),
23
normalization by total RNA would give an over-estimation of the PDS mRNA in white
compared to green tissue.
Literature Cited
Anderson JM, Park Y-I, Chow WS (1998) Unifying model for the photoinactivation of
Photosystem II in vivo under steady-state photosynthesis. Photosynth. Res 56: 1-13
Andersson B, Barber J (1996) Mechanisms of photodamage and protein degradation during
photoinhibition of photosystem II. Baker NR, ed. Photosynthesis and the
Environment. Dordrecht: Kluwer pp. 101-21
Al-Babili S, Lintig JV, Haubruck H, Beyer P (1996) A novel, soluble form of phytoene
desaturase from Narcissus pseudonarcissus chromoplasts is Hsp70-complexed and
competent for flavinylation, membrane association and enzymatic activation. Plant J
9: 601-612
Asada K (1994) Production and action of active oxygen species in photosynthetic tissues. In
Causes of Photooxidative Stress and Amelioration of Defense Systems in Plants, ed.
CH Foyer, PM Mullineaux,pp. 77-104. Boca Raton: CRC Press
Aukerman MJ, Hirschfeld M, Wester L, Weaver M, Clack T, Amasino RM, Sharrock RA
(1997) A deletion in the PHYD gene of the Arabidopsis Wassilewskija ecotype
defines a role for phytochrome 0 in red/far-red light sensing. Plant Cell 9: 1317-1326
Barber J, Andersson B (1992) Too much of a good thing: Light can be bad for
photosynthesis. Trends Biochem Sci 17: 61-66
24
Hartley GE, Viitanen PV, Pecker I, Chamovitz D, Hirschberg J, Scolnik PA (1991)
Molecular cloning and expression in photosynthetic bacteria of a soybean cDNA
coding for phytoene desaturase, an enzyme of the carotenoid biosynthesis pathway.
Proc Natl Acad Sci USA 88: 6532-6536
Beall FD, Yeung EC, Pharis RP (1996) Far-red light stimulates intemode elongation, cell
division, cell elongation, and gibberellin levels in bean. Can J Bot 74: 743-752
Behringer JF, Davies PJ (1992) Indole-3-acetic acid levels after phytochrome-mediated
changes in the stem elongation rate of dark- and light-grown Pisum seedlings. Planta
188:85-92
Beyer P, Mayer M, Kleinig H (1989) Molecular oxygen and the state of geometric
isomerism of intermediates are essential in the carotene desaturation and cyclization
reactions in daffodil chromoplasts. Eur J Biochem 184: 141-50
Blume DE, McClure JW (1980) Developmental effects of Sandoz 6706 on activities of
enzymes of phenolic and general metabolism in barley shoots grown in the dark or
under low or high intensity light. Plant Physiol 65: 238-244
Byrne M, Taylor WC (1996) Analysis of Mt/totor-induced mutations in the lojap gene of
maize. Mol Gen Genet 252: 216-20
Cameron DM, Ranee SJ, Jones RM, Charles-Edwards DA (1991) Trees and pasture: a study
on the effects of spacing. Agrofor Today 3: 8-9
Carol P, Stevenson D, Bisanz C, Breitenbach J, Sandmann G, Mache R. Coupland G,
Kuntz M (1999) Mutations in the Arabidopsis gene IMMUTANS cause a variegated
phenotype by inactivating a chloroplast terminal oxidase associated with phytoene
desaturation. Plant Cell 11: 57-68
25
Casai JJ, Smith H (1989) The function, action and adaptive significance of phytochrome in
light-grown plant. Plant Cell Environ 12: 855-862
Ceulemans R (1990) Genetic variation in functional and structural productivity determinants
in Poplar. Eds. Thesis publisher, Amsterdam, pp 25-46
Chen M, Jensen M, Rodermel S (1999). The yellow variegated mutant of Arabidopsis is
plastid autonomous and delayed in chloroplast biogenesis. J Heredity 90: 207-214
Cheniclet C, Rafia F, Saint-Guily A, Verna A, Carde J-P (1992) Localization of the enzyme
geranylgeranylpyrophosphate synthase in Capsicum fruits by cytochemistry after
conventional chemical fixation or quick-freezing followed by freeze-substitution:
labelling evolution during fruit ripening. Biol Cell 75: 145-154
Coe EH, Thompson D, Walbot V (1988) Phenotypes mediated by the iojap genotype in
maize. Am J Bot 75: 634-644
Corona V, Aracri B, Kosturkova G, Bartley GE, Pitto L, Giorgetti L, Scolnik PA,
Giuliano G (1996) Regulation of a carotenoid biosynthesis gene promoter during
plant development. Plant J 9(4): 505-512
Cunningham FX, Gantt E (1998) Genes and enzymes of carotenoid biosynthesis in plants.
Annu Rev Plant Physiol Plant Mol Biol 49: 557-583
DeBell DS, Giordano PA (1994) Growth patterns of red alder. In The Biology and
Management of Red Alder. Eds. D.E. Hibbs, O.S. DeBell and R.F. Tarrant. Oregon
State University Press, pp 116-130
26
Demmig-Adams, B (1990) Carotenoids and photoprotection in plants: A role for the
xanthophyll zeaxanthin. Biochim Biophys Acta 1020: 1-24
Demmig-Adams B, Gilmore AM, Adams WW III (1996) In vivo functions of carotenoids in
higher plants. FASEB J 10: 403-412
Devlin PF, Patel SR, Whitelam GC (1998) Phytochrome E influences intemode elongation
and flowering time in Arabidopsis. Plant Cell 10: 1479-1488
Dogbo O, Laferrière A, D'Harlingue A, Camara B (1988) Carotenoid biosynthesis: isolation
and characterization of a Afunctional enzyme catalyzing the synthesis of phytoene.
Proc Natl Acad Sci USA 85: 7054—58
Gilbert IR, Seavers GP, Jarvis PG, Smith H (1995) Photomorphogenesis and canopy
dynamics, phytochrome-mediated proximity perception accounts for the growth
dynamics of canopies of Populus trichocarpa x deltoides "Beaupre". Plant Cell
Environ 18: 475-497
Gilmore AM (1997) Mechanistic aspects of xanthophyll cycle-dependent photoprotection in
higher plant chloroplasts and leaves. Physiol Plant 99: 197-209
Giuliano G, Bartley GE, Scolnik PA (1993) Regulation of carotenoid biosynthesis during
tomato development. Plant Cell 5(4): 379-387
Green BR, Dumford DG (1996) The chlorophyll-carotenid proteins of oxygenic
photosynthesis. Annu Rev Plant Physiol Plant Mol Biol 47: 685-714
Han CD, Coe EH and Martienssen RA (1992)Molecular cloning and characterization of iojap
(ij), pattern striping gene of maize. EMBO J 11: 4037-4046.
Han CD and Martienssen RA (1995) The iojap protein (IJ) is associated with 50S chloroplast
ribosomal subunits. Maize Coop. Newsletter 69: 32
27
Havaux, M (1998) Carotenoids as membrane stabilizers in chloroplasts. Trends Plant Sci
3(4): 147-151
Havaux M, Niyogi KK (1999) The violaxanthin cycle protects plants from photooxidative
damage by more than one mechanism. Proc Natl Acad Sci USA 96: 8762-8767
Hedtke B, Bagner 1, Borner T and Hess WR (1999) Inter-organellar crosstalk in higher
plants: impaired chloroplast development affects mitochondrial gene and transcript
levels. Plant J 19: 635-43
Heilman PE, Fu-Guang X (1993) Effect of nitrogen fertilization on leaf area, light
interaction, and productivity of short-rotation P. trichocarpa x P.deltoides hybrids.
Can J For Res 24: 166-173
Hess WR, Hoch B, Zeltz P, Hiibschmann T, Kôssel H, Bôrner T (1994) Inefficient rpll
slicing in barley mutants with ribosome-deficient plastids. Plant Cell 6: 1455-1465
Hirschfeld M, Tepperman JM, Clack T, Quail PH, Sharrock RA (1998) Coordination of
phytochrome levels in phyB mutants of Arabidopsis as revealed by apoprotein-
specific monoclonal antibodies. Genetics 149: 523-535
Hopkins WC (1998) Introduction to plant physiology. 2nd ed. John Willey and Son, Inc.
Howe GT, Bucciaglia PA, Hackett WP, Fumier GR, Cordonnier-Pratt MM, Gardner G
(1998) Evidence that the phytochrome gene family in black cottonwood has one
PHY A locus and two PHYB loci but lacks members of the PHYC/F and PHYE
subfamilies. Mol Biol Evol 15(2): 160-75
Hugueney P, Romer S, Kuntz M, Camara B (1992) Characterization and molecular cloning
of a flavoprotein catalyzing the synthesis of phytofluene and Ç-carotene in Capsicum
chromoplasts. Eur J Biochem 209: 399-407
Hugueney P, Badillo A, Chen HC, Klein A, Hirschberg J (1995) Metabolism of cyclic
carotenoids: a model for the alteration of this biosynthetic pathway in Capsicum
annuum chromoplasts. Plant J 8: 417-24
Johnson EM, Schnaberlrauch LS, Sears BB (1991) A plastome mutation affects processing of
both chloroplast and nuclear DNA-encoded plastid proteins. Mol Gen Genet 225(1):
106-12
Johnson E, Bradley M, Harberd NP, Whitelam GC (1994) Photoresponses of light-grown
phyA mutants of Arabidopsis. Phytochrome A is required for the perception of
daylength extensions. Plant Physiol 105: 141-149
Kaiser WM (1979) Reversible inhibition of the Calvin cycle and activation of oxidative
pentose phosphate cycle in isolated intact chloroplasts by hydrogen peroxide. Planta
145: 377-82
Kamiya Y, Garcia-Martinez JL (1999) Regulation of gibberellin biosynthesis by light. CUIT
Opin Plant Biol 2: 398-403
Kendrick RE, Kronenberg GHM (1994) Photomorphogenesis in plants, 2nd ed. Kluwer
Academic Publishers, Dordrecht, The Netherlands
Knowe SA, Hibbs DE (1996) Stand structure and dynamics of young red alder as affected by
planting density. For Ecol Manage 82: 69-85
Knox JP, Dodge AD (1985) Singlet oxygen and plants. Phytochem 24: 889-896
Krinsky NI, Wang X-D, Tang T, Russell RM (1994) Cleavage of 6-carotene to retinoids. In
Retinoids: Basic Science and Clinical Applications, ed. MA Livrea, G Vidali, pp. 21-
28. Basel: Birkhaeuser
29
Kiihlbrandt W, Wang DN, Fujiyoshi Y (1994) Atomic model of plant light-harvesting
complex by electron crystallography. Nature 367: 614-621
Kuntz M, Chen HC, Simkin AJ, Rômer S, Shipton CA, Drake R, Schuch W, Bramley PM
(1998) Upregulation of two ripening-related enes from a non-climacteric plant
(pepper) in a transgenic climacteric plant (tomato). Plant J 13: 351-361
Larcher, W (1995) Physiological Plant Ecology. Ecophysiology and Stress Physiology of
Functional Group. 3rd ed. Springer-Verlag, Berlin Heidelberg
Lauer M, Knudsen C, Newton KJ, Gabay-Laughnan S, Laughnan JR (1990) A partially
deleted mitochondrial cytochrome oxidase gene in the NCS6 abnormal growth mutant
of maize. New Biol 2(2): 179-86
Lemair G, Millard P (1999) An ecophysiological approach to modeling resource fluxes in
competing plants. J Exp Bot 50: 15-28
Marienfeld JR, Newton KJ (1994) The maize NCS2 abnormal growth mutant has a chimeric
nad4-nad7 mitochondrial gene and is associated with reduced complex I function.
Genetics 138(3): 855-63
Martfnez-Zapater JM, Gil P, Cape I J, Somerville CR (1992) Mutations at the Arabidopsis
CHM locus promote rearrangements of the mitochondrial genome. Plant Cell 4: 889-
899
Mayer MP, Beyer P, Kleinig H (1990) Quinone compounds are able to replace molecular
oxygen as terminal electron acceptor in phytoene desaturation in chromoplasts of
Narcissus pseudonarcissus L. Eur J Biochem 191: 359-363
30
McGarvey DJ, Croteau R (1995) Terpenoid metabolism. Plant Cell 7(7): 1015-1026
Mcintosh L (1994) Molecular biology of the alternative oxidase. Plant Physiol 105: 781
786
Meeuse BJD, Buggeln RG (1969) Time, space, light and darkness in the metabolic flare-up
of the Sauromatum appendix. Acta Bot Neerl 18: 159-72
Meeuse BJD (1975) Thermogenic respiration in aroids. Annu Rev Plant Physiol 26: 117-
126
Mehler AH (1951) Studies on reactions of illuminated chloroplasts. I. Mechanism of the
reduction of oxygen and other Hill reagents. Arch Biochem Biophys 33: 65-77
Morelli G, Ruberti I (2000) Shade avoidance responses, driving auxin along lateral routes.
Plant Physiol 122: 621-626
Nagatini A, Reed JW, Chory J (1993) Isolation and initial characterization of Arabidopsis
mutants that are deficient in phytochrome A. Plant Physiol 102: 269-277
Nievelstein V, Vandekerkchove J, Tadros MH, Lintig JV, Nitschke W, Beyer P (1995)
Carotene desaturation is linked to a respiratory redox pathway in Narcissus
pseudonarcissus chromoplast membranes. Involvement of a 23-kDa oxygen-
evolving-complex-like protein. Eur J Biochem 233: 864-872
Newton KJ, Knudsen C, Gabay-Laughnan S and Laughnan JR (1990) An abnormal growth
mutant in maize has a defective mitochondrial cytochrome oxidase gene. Plant Cell
2: 107-113
Newton KJ and Coe EH (1986) Mitochondrial DNA changes in abnormal growth mutants of
maize. Proc Natl Acad Sci USA 83: 7363-7366
31
Noms SR, Barrette TR, DellaPenna D (1995) Genetic dissection of carotenoid synthesis in
Arabidopsis defines plastoquinone as an essential component of phytoene
desaturation. Plant Cell 7: 2139-2149
Olsen EJ, Junttila O, Nilsen J, Eriksson ME, Martinussen I, Olsson O, Sandberg G, Moritz T
(1997) Ectopic expression of oat phytochrome A in hybrid aspen changes critical
day length for growth and prevents cold acclimatization. Plant J 12: 1339-1350
Owens TG (1994) Excitation energy transfer between chlorophylls and carotenoids: a
proposed molecular mechanism for non-photochemical quenching. In NR Baker, JR
Bowyered, eds, Photoinhibition of Photosynthesis. Bios Scientific, Oxford, pp 95-
107Potter TI, Rood SB, Zanewich KP (1999) Light intensity, gibberellin contents and
the resolution of shoot growth in Brassica. Planta 207: 505-511
Pogson, BJ., McDonald, K.A., Truong, M., Britton, G., and DellaPenna, D (1996)
Arabidopsis carotenoid mutants demonstrate that lutein is not essential for
photosynthesis in higher plants. Plant Cell 8: 1627-1639
Pogson BJ, Niyogi KK, Bjorkman O, DellaPenna D (1998) Altered xanthophyll
compositions adversely affect chlorophyll accumulation and nonphotochemical
quenching in Arabidopsis mutants. Proc Natl Acad Sci USA 95: 13324-29
Pecker I, Chamovitz D, Linden H, Sandmann G, Hirschberg J (1992) A single polypeptide
catalyzing the conversion of phytoene to zeta-carotene is transcriptionally regulated
during tomato fruit ripening. Proc Natl Acad Sci USA 89: 4962-4966
Pecker I, Gabbay R, Cunningham FX Jr,Hirschberg J (1996) Cloning and characterization of
the cDNA for lycopene B-cyclase from tomato reveals decrease in its expression
during fruit ripening. Plant Mol Biol 30: 807-19
32
Raghavendra AS, Padmasree K and Saradadevi K (1994) Interdependence of photosynthesis
and respiration in plant cells: interactions between chloroplasts and mitochondria.
Plant Science 97: 1-14
Rédei GP (1963) Somatic instability caused by a cysteine-sensitive gene in Arabidopsis.
Science 139: 767-769
Rédei GP (1967) Biochemical aspects of a genetically determined variegation in
Arabidopsis. Genetics 56: 431-443
Rédei GP (1975) Arabidopsis as a genetic tool. Annu Rev Genet 9: 111-127
Reed JW, Nagpal P, Poole SD, Furuya M, Chory J (1993) Mutations in gene for the red:far-
red light receptor phytochrome B alter cell elongation and physiological responses
throughout arabidopsis development. Plant Cell 5: 147-157
Reiss, T., R. Bergfeld, G. Link, W. Thien and H. Mohr (1983) Photooxidative destruction of
chloroplasts and its consequences for cytosolic enzyme levels and plant development.
Planta 159: 518-528
Rick CM, Thomson AE, Brauer O (1959) Genetics and development of an unstable
chlorophyll deficiency in Lycopersicon esculentum. Amer J Bot 46: 1-11
Ritchie GA (1997) Evidence for red:far-red signaling and photomorphogenic growth
response in Douglas-fir (Pseudotsuga menziesii) seedlings. Tree Physiol 17: 161-168
Sandmann G, Bôger P (1989) Inhibition of carotenoid biosynthesis by herbicides. In Target
Sites of Herbicide Action, ed. P Bôger, G Sandmann,pp. 25-44. Boca Raton, FL:
CRC
Sagar, AD and WR Briggs (1990) Effects of high light stress on carotenoid-deficient
chloroplasts in Pisum sativum. Plant Physiol 94: 1663-1670.
33
Sakamoto W, Kondo H, Murata M, Motoyoshi F (1996) Altered mitochondrial gene
expression in a maternal distorted leaf mutant of Arabidopsis induced by chloroplast
mutator. Plant Cell 8: 1377-1390
Schledz M, al-Babili S, von Lintig J, Haubruck H, Rabbani S (1996) Phytoene synthase
from Narcissus pseudonarcissus: functional expression, galactolipid requirement,
topological distribution in chromoplasts and induction during flowering. Plant J 10:
781-92
Scolnik P, Giuliano G, Pollock D, Hinton P (1986) Molecular genetics of carotenoid
biosynthesis: the tomato ghost mutant and mutants of the photosynthetic bacterium
Rhodopseudomonas capsulata. Curr-Top-Plant-Biochem-Physiol-Proc-Plant-
Biochem-Physiol-Symp-Univ-Mo-Columbia. Columbia, MO: The Interdisciplinary
Plant Biochemistry and Physiology Program 5: 142-152
Scolnik PA, Hinton P, Greenblatt IM, Giuliano G (1987) Somatic instability of carotenoid
biosynthesis in the tomato ghost mutant and its effect on plastid development. Planta
171: 11-18
Scott W, Meade R, Leon R (1992) Observations from 7- to 9-year old Douglas-fir variable
density plantation test beds. Weyerhaeuser Forestry Research Filed Notes 92-2,
Centralia, WA, 2 p
Sharrock RA, Quail PG (1989) Novel phytochrome sequences in Arabidopsis thaliana:
Structure, evolution, and differential expression of a plant regulatory photoreceptor
family. Gene & Dev 3: 1745-1757
Smith H, Whitelam GC (1997) The shade avoidance syndrome: Multiple responses mediated
by multiple phytochromes. Plant Cell Environ 20: 840-844
34
Steindler C, Matteucci A, Sessa G, Weimar T, Ohgishi M, Aoyama T, Morelli G, Ruberti I.
(1999) Shade avoidance responses are mediated by the ATHB-2 HD-Zip protein, a
negative regulator of gene expression. Development 126: 4235-4245
Siedow JN, Umbach AL (1995) Plant mitochondrial electron transfer and molecular biology.
Plant Cell 7: 821-831
Smith WK, Vogelmann TC, DeLucia EH, Bell DT, Shepherd KA (1997) Leaf form and
photosynthesis. Bioscience 47: 785-793
Stoike LL, Sears BB (1998) Plastome mutator-induced alterations arise in Oenothera
chloroplast DNA through template slippage. Genetics 149(1): 347-53
Stubbe W, Herrmann RG (1982) Selection and maintenance of plastome mutants and
interspecific genome/plastome hybrids from Oenothera. In Methods in Chloroplast
Molecular Biology, Edelman M, Hallick RB and Chua NH, eds. (Elsevier Biomedical
Press, New York) pp. 149-165
Taylor,W.C (1989) Regulatory interactions between nuclear and plastid genomes. Annu
Rev Plant Physiol Plant Mol Biol 40: 211-233
Telfer A, Dhami S, Bishop SM, Phillips D, Barber J (1994) B-carotene quenches singlet
oxygen formed by isolated photosystem II reaction centers. Biochemistry 33: 14469-
74
Taiz L, Zeiger E (1998) Plant physiology, 2nd Eds. Sinauer Associates, Inc.
Tonkyn, JC, Deng X-W, Gruissem W (1992) Regulation of plastid gene expression
during photooxidative stress. Plant Physiol 99: 1406-1415
Vanlerberghe GC, Mcintosh L (1997) Alternative oxidase: From gene to function. Annu
Rev Plant Physiol Plant Mol Biol 48: 703-734
35
Vanlerberghe GC, Vanlerberghe AE, Mcintosh L (1997) Molecular genetic evidence of
the ability of alternative oxidase to support respiratory carbon metabolism. Plant
Physiol 113:657-661
Vishnevetsky M, Ivadus M, Vainstein A (1999) Carotenoid sequestration in plants: the
role of carotenoid-associated proteins. Trends in Plant Science 4(6): 232-235
Wagner AM. Krab K (1995) The alternative respiration pathway in plants: role and
regulation. Physiol Plant 95: 318-325
Walbot V, Coe EH (1979) Nuclear gene iojap conditions a programmed change to ribosome-
less plastids in Zea mays. Proc Natl Acad Sci USA 76: 2760-2764
Walden R, Frtize K, Hayashi H, Miklashevichs E, Harling H, Schell J (1994) Activation
tagging: means of isolating genes implicated as playing a role in plant growth and
development. Plant Mol Biol 26: 1521-1528
Weller JL, Ross JJ, Reid JB (1994) Gibberellins and phytochrome regulation of stem
elongation in pea. Planta 192: 489-496
Wetzel CM, Jiang CZ, Meehan LJ, Voytas DF, Rodermel SR (1994) Nuclear-organelle
interactions: the immutans variegation mutation of Arabidopsis is plastid autonomous
and impaired in carotenoid biosynthesis. Plant J 6: 161-175
Wetzel CM, Rodermel SR (1998) Regulation of phytoene desaturase expression is
independent of leaf pigment content in Arabidopsis thaliana. Plant Mol Biol 37:
1045-1053
Wu D, Wright DA, Wetzel C, Voytas DF, Rodermel S (1999) The IMMUTANS
variegation locus of Arabidopsis defines a mitochondrial alternative oxidase homolog
that functions during early chloroplast biogenesis. Plant Cell 11: 43-55
36
Yamamoto HY, Bassi R (1996) Carotenoids: loclization and function. IN oxygenic
Photosynthesis: The Light Resactions, ed. DR Ort, CF Yocum, pp. 539-563 The
Netherlands: Kluwer
Zeevaart, JAD,Creelman RA (1988) Metabolism and physiology of abscisic-acid. Annu.
Rev. Plant Physiol. Plant Mol Biol 39: 439-473
37
CHAPTER 2. COMPETION RESPONSES OF WHITE ASPEN
TO RED:FAR-RED LIGHT
A paper to be submitted to the journal of Tree Physiology
Hanhong Bae and Richard B. Hall
Abstract
The reduced ratio of red:far-red (R:FR) light acts as a measure of the proximity of
competitors and plants can detect the potentially competing neighbor plants by perceiving
reflected R:FR signals and initiate the response of "shade avoidance" before actual shading
occurs. The phytochrome system is responsible for monitoring the changes in the R:FR and
initiating the shade avoidance response. The response to low R:FR ratio was studied in a
white aspen Populus alba clone 'Bolleana' using two filter systems: a clear plastic filter
system that allows a R:FR ratio less than 1.0 to pass from adjacent border plant reflection;
and a special commercial plastic that blocks FR light and creates a R:FR ratio above 3.0.
The reduced R:FR signals enhanced the stem elongation in response to competition at the
expense of relative stem diameter growth. Trees grown inside clear chambers were 27%
taller than trees grown inside the FR-blocking filter chambers. Stem taper of clear chamber
trees was 16% less than the FR-blocking filter trees. Low R:FR also induced 22% more stem
dry weight and 13% greater petiole length per leaf compared to the FR-blocking filter trees.
There were no statistically significant differences in leaf area, leaf number increment, and
total dry weight between the two light filter treatments.
38
Introduction
Plants use light as energy, information to detect neighbors, and to keep track of time
throughout the seasonal growth cycle. Plants can detect their neighbors by sensing the
spectral properties of light reflected from the foliage of nearby plants and initiate the
response of "shade avoidance" before actual shading occurs (Ballaré et al., 1987, 1990, 1994;
Smith et al., 1990). Ambient light has a ratio of red to far-red light (R:FR at -660 nm to
-730 nm) of about 1.2 (Kendrick and Kronenberg, 1994). The photosynthetic pigments
absorb R light preferentially, but reflect or transmit FR light, which reduces the R:FR photon
ratio below 1.0 and acts as a signal for detection of neighbors (Ballaré et al., 1987, 1990,
1994; Ritchie, 1997; Smith et al., 1990; Smith and Whitelam, 1997). The changes in the
R:FR ratio function as a measure of the proximity of competitors and acts as an "early
warning signal" (Ballaré et al., 1987). The shade avoidance includes enhanced stem
elongation and other morphological changes to increase the chance of receiving direct
sunlight. The shade avoidance reaction varies according to the species and genetic
background. Most studies have been done with herbaceous plants (reviewed in Kendrick and
Kronenberg, 1994). The most common response of shade avoidance is extra elongation
growth in intemodes. The elongation growth is also observed in the hypocotyl and petioles.
Most herbaceous plants show the elongation growth at the expense of leaf development and
branching. However, different shade avoidance responses have been reported in some tree
species. In coastal Douglas-fir (Pseudotsuga menziesii) seedlings, crown biomass and
branch number increased with decreasing growing space (Ritchie, 1997). Although leaf
numbers were reduced in more dense canopies in Populus trichocarpa x deltoides clone
'Beaupré' trees, increased leaf area and dry weight were reported (Gilbert et al., 1995). In
39
accordance with the above results, other studies reported that young trees in high density
plantations usually show rapid height growth that occurs long before actual shading
(Cameron et al., 1991; DeBell and Giordano, 1994; Knowe and Hibbs, 1996; Scott et al.,
1992).
Many experiments have shown that the phytochrome pigment system is responsible
for monitoring the changes in the R:FR and initiating the shade avoidance response
(reviewed in Kendrick and Kronenberg, 1994). Phytochromes are blue protein photo-
reversible pigments that absorb R and FR light most strongly. They have important roles in
light-regulated vegetative and reproductive development. Phytochromes are encoded by a
multigene family and each phytochrome controls a different process with overlapping
functions. While five genes (PHYA, B, C, D and E) have been reported in Arabidopsis, only
three genes (PHYA, Bl and B2) have been reported in Populus trichocarpa and Populus
balsamifera (Sharrock and Quail, 1989; Howe et al., 1998). There are two types of
phytochromes: type I is light labile (phytochrome A) and type II (phytochrome B-E) is light
stable. In dark-grown plants, phytochrome A is the most abundant phytochrome. Expression
of phytochrome A is negatively regulated in the light and the protein is degraded in the light
(Kendrick and Kronenberg, 1994).
The involvement of multiple phytochromes in response to shade avoidance has been
reported through the studies of phytochrome deficient mutants. For example, light-grown
phytochrome B deficient mutants of Arabidopsis showed elongated growth and early
flowering that are characteristics of the shade avoidance syndrome of wild type seedlings
grown under a low R:FR light environment (Nagatani et al., 1991; Reed et al., 1993). This
indicates that the phytochrome B signal is responsible for the inhibition of hypocotyl
40
elongation and has a major role in the shade avoidance response. Under FR-rich light,
Arabidopsis phytochrome B null mutants showed additional elongation growth and even
earlier flowering than phytochrome B null mutants grown in a normal light environment.
This indicates that other phytochromes are also involved in the shade avoidance response
(Smith and Whitelam, 1997). According to the analyses of other phytochrome null mutants,
phytochrome B, D and E regulate the shade avoidance response (Aukerman et al., 1997;
Devlin et al., 1998, 1999). Normally, phytochrome A has little effect on shade avoidance,
probably due to the property of light instability of phytochrome A. The function of
phytochrome C is still unknown in the shade avoidance response due to the lack of
phytochrome C null mutants (Morelli and Ruberti, 2000). However, a reduced level of
phytochrome C was detected in the Arabidopsis phytochrome B mutant, which indicates that
the mutant phenotype may result in part from the reduced phytochrome C (Hirschfeld et al.,
1998).
Phytochrome is produced in the R light-absorbing form called Pr in dark-grown
plants. Pr is converted by R light to the FR light-absorbing form called Pfr, which is the
physiologically active form of phytochrome and the two forms are photoreversible (reviewed
in Kendrick and Kronenberg, 1994). It has been suggested that the ratio between Pfr and the
total amount of phytochrome (Pfr/Ptotal) determines the magnitude of the response. Lower
ratios of R:FR convert greater portions of Pfr into the Pr form generating reduced ratios of
Pfr/Ptotal. The changes were also reported in tree experiments: lower Pfr/Ptotal was detected
with higher canopy density of Populus trichocarpa x deltoides clone 'Beaupré' and Douglas-
fir seedlings (Gilbert et al., 1995; Ritchie, 1997). They found negative linear relationships
between stem height growth rate and plant spacing or Pfr/Ptotal. Therefore, the R and FR
41
wavelengths of light function as a signal for plants to adjust to the competition environment
through modification in growth.
The objective of this study was to understand the growth changes in Populus alba
clone 'Bolleana' in its juvenile stage in response to the changes in R:FR. The long term
objective is to develop a controlled-environment assay to study genetic variation in the shade
avoidance response of Populus clones. A commercial plastic filter system that selectively
absorbs FR light was used to produce a high ratio of R:FR (van Haeringen et al., 1998).
Although many studies have been performed on the response to the different R:FR light
conditions, most of the data are from herbaceous plants. An understanding of the shade
avoidance response of poplar trees would be useful for the management of poplar stands in
the field to maximize production through genetic selection for the best growth response and
to choose optimal spacings.
Materials and Methods
Plant Material and Growth Conditions
The white aspen Populus alba clone 'Bolleana' was used to study the effect of R:FR
on growth as a competition signal. Ramets were propagated through a greenwood cutting
method (Faltonson et al., 1983). Stems were cut into small sizes that contained two
intemodes with two fully-expanded leaves. The lower leaf was removed and the base of the
stem was dipped into 1,000 mg/L of indole 3-butyric acid (IB A) to induce rooting. The IBA-
treated stem segments were inserted into Jiffy-7 Peat Pellets (Jiffy Products of America,
Batavia, IL) that were moisturized overnight before use. The stem cuttings were placed in a
42
mist chamber for rooting over a 20-day period. The rooted stem cuttings were potted in a
mixture of peat:perlite:vermiculite (1:1:1) and used for the R:FR light treatment when plant
height reached around 14 -19 cm. All plants were fertilized once a week with a mixture of
Miracle-GroExcel All Purpose® (21:5:20, Scotts, Columbus, OH) and watered daily. Plants
were grown in the Forestry Greenhouse at Iowa State University under 20 °C and 16-h light
period.
Light Treatment and Growth Measurements
Two plants of similar height were randomly assigned to one of two filter chambers.
Trees in the filter chambers were surrounded by four border trees arranged in a 40-cm square
to create the reflected light environment. Four more border trees were added at the 12lh day
of treatment to reduce the R:FR ratio inside the clear filter chamber below 1.0, which is the
threshold light condition that induces the shade avoidance response (Fig. 1). Open toped
chambers constructed from plastic films (30-cm diameter and 50-cm height) were used to
establish the two different R:FR ratios. A special FR-blocking plastic filter was used to
create a ratio of above 3.0 for a plant grown inside (Visqueen, Cleveland, UK; van Haeringen
et al., 1998). The FR filter selectively blocks FR light and thereby increases the R:FR ratio.
A transparent plastic filter was used as a control, transmitting a R:FR ratio of below 1.0
produced by the border trees. The filter chambers surrounded whole plants during the
treatment period that continued for 27 days. Photosynthetically active radiation (PAR, 400-
700 nm) inside the two filter chambers was measured using a LI-1000 spectroradiometer (LI-
COR, Lincoln, NE). According to preliminary measurements, the clear filter chambers
allowed -25% more PAR to pass through than the FR filter chambers. To maintain the same
43
level of PAR for the two filter chambers, six 3.7-cm width strips of duct tape were attached
vertically to the sides of the clear filter chambers at every 60° around the circumference of a
chamber to reduce light penetration. To homogenize the growing conditions in the
greenhouse, plants were rotated into different positions on different benches every six days.
The R:FR was measured horizontally at the mid-height of the filter chamber with an
integrating cylinder, on loan from Weyerhaeuser Company (Ballaré et al., 1987). This
integrating cylinder has a cylindrical bar of transparent acrylic with a 45° cone removed from
the upper end to focus light entering from the sides on to the filter optic cable of a LI-COR
remote sensing attachment on a LI-1800 spectroradiometer (LI-COR, Lincoln, NE). The
R:FR ratios were calculated as the ratio of photon irradiance between 655 and 665 nm (R)
over photon irradiance between 725 and 735 nm (FR) (Smith, 1994).
To study the effect of R:FR light on plant growth, the following traits were measured
on five replications. Plant height was measured during the treatment at 3-day intervals. At
the end of the treatment period, height, intemode length, stem diameter at every intemode,
leaf area, leaf number, and petiole length were measured from LPI 0 (Leaf Plastochron
Index, first leaf > 3.0 cm) to the base of each tree (Larson and Isebrands, 1971). Leaf area
was measured using a LI 3000 area meter (Li-Cor, Lincoln, NE). Stem tapers were
calculated as follows: stem taper = (D2-D1) / L, where D1 = diameter at the LPI 2 (mm), D2
= diameter at the LPI nearest to 25 cm basipetal from Dl (mm), and L = actual stem distance
between Dl and D2 (cm). The potted root mass was soaked in water in a cold room at 4 °C
overnight and then washed clean of potting debris. Dry weights were determined for leaf,
stem, petiole and root after drying in an oven at 70 °C for 72 h.
44
One-way analysis of variance (ANOVA) was used to compare treatment means with
a threshold of P = 0.05 used to classify statistical significance. The SAS statistical package
program version 6.12 was used to compute the analysis of variance (SAS institute, 1996).
Results
The R:FR ratio averaged 1.0 inside the clear filter chambers and 3.7 inside FR-
blocking filter chambers when the filter chambers were surrounded by four border trees. An
additional four border trees were added at the 12th day of treatment and the ratios were
decreased to 0.8 and 3.3, respectively. The temperatures inside the two types of filter
chambers were not significantly different (Sin, 2000). PAR levels were similar inside both
filter chambers during the period of treatment. The major response to low R:FR was the
enhanced stem growth. Trees inside clear filter chambers were taller than trees inside the
FR-blocking filter chambers (Table 1 and Fig. 2\P- 0.01). The difference in growth
increment between the two filter systems became significant after 15 days of treatment and
reached a maximum at the end of the treatment (Fig. 3). Average stem growth inside the
clear filter chamber was 6.9 cm (27%) taller than trees inside the FR-blocking filter chambers
through 27 days of treatment. Average intemode lengths were greater for trees in the clear
chambers at all positions except the lowest one that would have formed at the beginning of
the treatment. LPI 0-1 and LPI 5-6 of the clear filter trees showed the most significant length
advantage over trees inside the FR filter chambers (Fig. 4).
Stem taper showed a significant difference between the two filter treatments (P =
0.004). Average stem taper for the FR-blocking filter treatment was 16% greater than the
clear filter treatment. Stem dry weight showed a significant difference between the two filter
45
treatments in the reverse direction (P = 0.005). Average stem dry weight of the clear filter
trees was 22% heavier than the stem dry weight of the FR-blocking filter trees.
Average petiole length also showed a significant difference between the two filter
treatments (P = 0.01). Petioles of clear filter trees averaged 13% longer than petioles of FR-
blocking filter trees. However, the difference in total petiole dry weight did not show a
significant difference between the two filter treatments. Average petiole length of the clear
filter trees between LPI 0 and LPI 2 was significantly longer than the FR-blocking filter trees
and this trend was present in older leaves as well (Fig. 5). The pattern of petiole length
development at each LPI was similar between the two filter treatments.
There were no significant differences in leaf number increment, leaf area, leaf dry
weight, and root dry weight (Table 1). Total biomass was not significantly different between
the two filter chambers. In addition, the ratio of top dry weight (leaf, stem and petiole) to
root dry weight was not significantly different between the two filter chambers.
Discussion
Two different filter systems were used to analyze the effect of the R:FR ratio on the
stem elongation and other growth traits in a poplar clone. Not many studies have been done
with tree species and most work has been performed in the field. The field studies used
different plant spacings to analyze the effect of changed R:RF. However, different spacings
influence many other variables, such as light intensity, root competition, water use efficiency
and gas exchange. So, it is not usually clear from field studies what the direct effect of R:FR
is on growth traits. The filter system we used gives better conditions to study the effect of
R:FR on growth and morphological changes because the filters modify only the R:FR ratios.
46
The results of this study indicate that R:FR signals change stem elongation, stem
taper, stem dry weight, and petiole length in young Populus alba clone 'Bolleana' trees.
However, other traits, such as leaf number increment, leaf area, and dry weight (leaf, petiole
and root) showed no significant differences. The main effect of low R:FR is to induce the
competition response that enhances stem elongation. While the reduction in R:FR inside
filter chambers appears to be the cause of stem elongation, we have checked for other
possible conditions that might affect the changes, such as differences in temperature and
PAR. However, no differences were found in temperature and PAR in the two filter
chambers. The two filter chambers act the same in reducing air movement. Air movement
does affect the allocation of photosynthate to mechanically support stems, reducing stem
height and increasing stem taper (Cleugh et al., 1998).
The combined dry weight of leaf, stem and petiole (top dry weight) in each treatment
was not significantly different. This suggests that elongated stem growth was due to
enhanced allocation of resources to stem intemode elongation at the expense of other growth
centers, not the result of increased photosynthesis. This result is consistent with previous
studies in herbaceous species, in which reduced R:FR redirected dry mass towards stem and
petioles and away from leaves, although the difference in leaf dry weight was not
statistically significant in our experiment (Morgan and Smith, 1979; Keiller and Smith,
1989). However, the response to changed R:FR is dependent on genetic background, which
suggests that the allocation of biomass in different tissues is controlled through genetic
mechanisms.
At day 12, an additional four trees were added around the filter chambers to reduce
R:FR. Over the next three days, growth differences in the two filter chambers became
47
significantly different and stayed that way (days 15-27 of the combined treatment schedule in
Fig. 3). This is supportive evidence that the competition response occurs quickly in the low
R:FR condition. R:FR less than 1.0 is known as the starting point of inducing competition
response. From day 15, the growth increment difference between the two treatments kept
getting larger until the last day of treatment.
Gibberellin production is indcreased under low R:FR, which leads to the intemode
elongation, cell extension and cell division, and leaf development (Weller et al, 1994; Beall
et al., 1996). Stem elongation and cell expansion are strongly correlated with gibberellin
levels, but dry weight deposition is not related to gibberellin concentration (Potter et al.,
1999). Auxin is also an important component of the elongation process that is induced by
shade (Behringer and Davies, 1992; Steindler et al., 1999). It has been hypothesized that
higher lateral transport of auxin to epidermal and cortical cells occurs in the hypocotyl of
shaded seedlings at the expense of auxin transport through the developing vascular system.
This leads to elongation of these tissues and reduction of the vascular differentiation and root
auxin concentration, which causes a reduction in lateral root formation and eventually
primary root growth (Morelli and Ruberti, 2000). We did not find significant root dry weight
reduction in our low R:FR treatment, but the trend in the data was in that direction. The
control of hormonal effects is probably dependent on genetic background and/or
developmental stage, showing different competition responses.
The average leaf areas at LPI 0 and LPI 1 for clear filter trees were larger than FR-
blocking filter trees. This may be an adaptation of leaves in the fast growing region of the
stem to produce leaf area more rapidly at the top region of elongating stems in the
competition condition. Enhanced stem elongation and reduced stem taper in response to
48
reduced R:FR is consistent with the previous studies (Casai et al., 1990; Ritchie, 1997).
Stem taper is an important indicator of mechanical support of trees and also indicates the
relative allocation to height and diameter growth. This kind of plant response to reduced
R:FR is probably a physiological process for better light harvest, which increases the
possibility of survival during competition.
Through this study, we found that there was large variability in the response of trees
during the treatment for the same filter chamber. Even though the starting plants were
similar in terms of height and leaf number, the subsequent growth rate fluctuated tree by tree.
This indicates that the physiological condition of each tree was not the same although they
looked the same. To eliminate this problem, trees need to be grown for a longer period of
time under the same growth conditions and then monitored for their growth rate to be sure
they have similar potential once treatment starts. Finally, we should choose trees that show
similar growth rate and have the same height and leaf number.
This study provides clear evidence that competition conditions (low R:FR) alter tree
biomass allocation to stem elongation. However, this study was performed using the juvenile
trees, which might respond differently as they age. This phenomenon is common in other
physiological processes. Therefore, further experiments with plants of various ages are
needed.
LITERATURE CITED
Aukerman, M.J, Hirschfeld M, Wester L, Weaver M, Clack T, Amasino R.M. and Sharrock
R.A. 1997. A deletion in the PHYD gene of the Arabidopsis Wassilewskija ecotype
defines a role for phytochrome D in red/far-red light sensing. Plant Cell 9:1317-1326
49
Behringer J.F. and P.J. Davies. 1992. Indole-3-acetic acid levels after phytochrome-mediated
changes in the stem elongation rate of dark- and light-grown Pisum seedlings. Planta
188:85-92.
Ballaré, C L, A.L. Scopel, R.A. Sanchez, J.J. Casai and C.M. Gharsa. 1987. Early
detection of neighbor plants by phytochrome perception of spectral changes in
reflected sunlight. Plant Cell Environ 10:551-557.
Ballaré, C.L, A.L Scopel and R.A. Sanchez. 1994. Signaling among neighboring plants
and the development of size inequalities in plant populations.
Proc. Natl. Acad. Sci. USA. 1:10094-10098.
Ballaré, C.L, A.L. Scopel, and R.A. Sanchez. 1990. Far-red radiation reflected from
adjacent leaves: an early signal of competition in plant canopy. Science 247:329-332.
Beall, F.D., E.C. Yeung, and R.P. Pharis. 1996. Far-red light stimulates intemode
elongation, cell division, cell elongation, and gibberellin levels in bean. Can. J. Bot.
74:743-752.
Cameron, D.M., S.J. Ranee, R.M. Jones and D.A. Charles-Edwards. 1991. Trees and
pasture: a study on the effects of spacing. Agrofor. Today 3:8-9.
Casai J.J., and H. Smith. 1989. The function, action and adaptive significance of
phytochrome in light-grown plant. Plant Cell Environ. 12:855-862.
Casai J.J., R.A. Sanchez, and D. Gibson. 1990. The significance of changes in the red bar
red ratio, associated with either neighbor plants or twilight for tillering in Lilium
multifloriim Lam. New Phytol. 116:565-572.
Ceulemans, R. 1990. Genetic variation in functional and structural productivity determinants
in Poplar. Eds. Thesis publisher, Amsterdam, pp 25-46.
Cleugh, H.A., J.M. Miller, and M. Bohm. 1998. Direct mechanical effects of wind on crops.
Agroforestry Syst. 41:85-112.
DeBell, D.S. and P A. Giordano. 1994. Growth patterns of red alder. In The Biology and
Management of Red Alder. Eds. D.E. Hibbs, D.S. DeBell and R.F. Tarrant. Oregon
State University Press, pp 116-130.
Devlin, P.P., S.R. Patel, and G.C. Whitelam. 1998. Phytochrome E influences intemode
elongation and flowering time in Arabidopsis. Plant Cell 10: 1479-1488.
Devlin, P.P., P.R. Robson, S.R. Patel, L. Goosey, R.A. Sharrock, and G.C. Whitelam. 1999.
Phytochrome D acts in the shade-avoidance syndrome in Arabidopsis by controlling
elongation growth and flowering time. Plant Physiol. 119: 909-915.
Faltonson, R., D. Thompson, and J.C. Gordon. 1983. Propagation of poplar clones for
controlled-environment studies. USDA Forest service General Technical Report NC-
81.
Gilbert, I.R., G.P. Seavers, P.G. Jarvis, and H. Smith. 1995. Photomorphogenesis and canopy
dynamics, phytochrome-mediated proximity perception accounts for the growth
dynamics of canopies of Populus trichocarpa x deltoides "Beaupre". Plant Cell and
Environment 18:475-497.
Givnesh, J.T. 1995. Plant stems: Biomechanical adaptation for energy capture and influence
on species distributions. In Plant Stems. Physiology and Functional Morphology.
Eds. B.L. Gartner. Academic Press, Neew York, pp 10-58.
Hikosaka K., S. Sudoh and T. Hirose. 1999. Light acquisition and use by individuals
competing in a dense stand of an annual herb, Xanthium canadense. Oecologia
118:388-396.
51
Hirschfeld, M., J.M. Tepperman, T. Clack, P.H. Quail, and R.A. Sharrock. 1998.
Coordination of phytochrome levels in phyB mutants of Arabidopsis as revealed by
apoprotein-specific monoclonal antibodies. Genetics 149: 523-535.
Howe, G.T., P.A Bucciaglia, W.P. Hackett, G.R. Fumier, M.M. Cordonnier-Pratt, G.
Gardner. 1998. Evidence that the phytochrome gene family in black cottonwood has
one PHY A locus and two PHYB loci but lacks members of the PHYC/F and PHYE
subfamilies. Mol Biol Evol. 15(2): 160-75.
Keiller, D. and H. Smith. 1989. Control of carbon partitioning by light quality mediated by
phytochrome. Plant Science 63:25-29.
Kendrick, R.E. and G.H.M. Kronenberg. 1994. Photomorphogenesis in plants, 2nd ed.
Kluwer Academic Publishers, Dordrecht, The Netherlands.
Knowe, S.A. and D.E. Hibbs. 1996. Stand structure and dynamics of young red alder as
affected by planting density. For. Ecol. Manage. 82:69-85.
Larson, P.R. and J.G. Isebrands. 1971. The piastochron index as applied to developmental
studies of cottonwood. Can. J. For. Res. 1:1-11.
Morelli, G. and I. Ruberti. 2000. Shade avoidance responses, driving auxin along lateral
routes. Plant Physiol. 122:621-626.
Morgan, D. C. and H. Smith. 1976. Linear relationship between phytochrome
photoequilibrium and growth in plants under simulated natural radiation. Nature 262:
210-212.
Nagatini, A., J.W. Reed, and J. Chory. 1993. Isolation and initial characterization of
arabidopsis mutants that are deficient in phytochrome A. Plant Physiol. 102:269-277.
52
Panetso, C.K.P. 1980. Selection of new poplar clones under various spacings. Silvae Genet.
29:130-135.
Potter, T.I., S B. Rood and K.P. Zanewich. 1999. Light intensity, gibberellin content and the
resolution of shoot growth in Brassica. Planta 207: 505-511.
Reed, J.W., P. Nagpal, S.D. Poole, M. Furuya, and J. Chory. 1993. Mutations in gene for
the red:far-red light receptor phytochrome B alter cell elongation and physiological
responses throughout arabidopsis development. The Plant Cell 5:147-157.
Ritchie, G.A. 1997. Evidence for red:far-red signaling and photomorphogenic growth
response in Douglas-fir (Pseudotsuga menziesii) seedlings. Tree Physiol. 17:161-168.
SAS Institute Inc. 1996. S AS/STAT user's guide, release 6.12. Edn. SAS Inst., Cary, NC.
Scott, W., R. Meade and R. Leon. 1992. Observations from 7- to 9-year old Douglas-fir
variable density plantation test beds. Weyerhaeuser Forestry Research Filed Notes
92-2, Centralia, WA, 2 p.
Sharrock, R.A. and P H. Quail. 1989. Novel phytochrome sequences in Arabidopsis thaliana:
Structure, evolution, and differential expression of a plant regulatory photoreceptor
family. Gene Dev. 3:1745-1757.
Sin, S. 2000. Tree spacings and red:far-red light effects on juvenile Populus growth and
morphology. Ph.D. Thesis, Iowa State University, Ames, IA.
Smith, H., J.J. Casal, and G.M. Jackson. 1990. Reflection signals and the perception by
phytochrome of the proximity of neighboring vegetation. Plant Cell Environ. 13:73-
78.
53
Smith, H. 1994. Sensing the light environment: the functions of the phytochrome family. In
Photomorphogenesis in plants, 2nd ed. (ed. R E. Kendrick and G.H.M. Kronenberg),
pp. 377-416. Kluwer Academic Publishers, Dordrecht, The Netherlands.
Smith, H. 1995. Physiological and ecological function within the phytochrome family.
Annu. Rev. Plant Physiol. Plant Mol. Biol. 46:289-315.
Smith, H. and G.C. Whitelam. 1997. The shade avoidance syndrome: Multiple responses
mediated by multiple phytochromes. Plant Cell Environ. 20: 840-844.
Steindler, C„ A. Matteucci, G. Sessa, T. Weimar, M. Ohgishi, T. Aoyama, G. Morelli, and I.
Ruberti. 1999. Shade avoidance responses are mediated by the ATHB-2 HD-Zip
protein, a negative regulator of gene expression. Development 126: 4235-4245.
van Haeringen, C.J., J.S. West, F.J. Davis, A. Gilbert, P. Hadley, S. Pearson, A.E. Wheldon
and R.G.C. Henbest. 1998. The development of solid spectral filters for the
regulation of plant growth. Photochem photobiol. 67(4):407-413.
Weller, J.L., J.J. Ross, and J.B. Reid. 1994. Gibberellins and phytochrome regulation of
stem elongation in pea. Planta 192:489-496.
Table 1. Effect of different red:far-red light on tree morphological characteristics. All numbers are average of five replications
after 27 days of filter chamber treatment. The P values from the ANOVA are shown for each trait in the bottom row. Top dry
weight is the combined dry weight of leaf, stem and petiole. Total dry weight is the combined dry weight of top and root. NS, not
significant.
Filter Growth Stem Petiole Leaf No. Leaf Leaf dry Stem dry Petiole Top dry Root dry Top/root Total dry system increment taper length increment area weight weight dry weight weight weight dry weight
(cm) (cm) (cm2) (g) (g) (g) (g) (g) weight (g)
Clear 25.7 0.066 2.94 6.2 602 1.60 0.78 0.11 2.49 0.69 3.85 3.18
FR- 18.8 0.079 2.57 6.0 613 1.64 0.61 0.10 2.35 0.75 3.09 3.10 blocking
Increment 27% (+) 19%(-) 13%(+) NS NS NS 22% (+) NS NS NS NS NS for the
clear filler trees (%)
P value 0.011 0.004 0.014 0.749 0.885 0.749 0.005 0.675 0.430 0.307 0.112 0.884
Figure 1. Arrangement of two filter chambers in greenhouse experiment. Left chamber is
--iear filter and right chamber is FR-blocking filter. Trees in the filter chambers were
surrounded by eight border trees to create the reflected light environment. To maintain the
same level of photosynthetically active radiation for the two filter chambers, six 3.7-cm
width strips of duct tape were attached to the sides of the clear filter chambers to reduce light
penetration.
56
35
g 30
a
i 2 5
i 0 c £
1 O
20
15
10
Clear filter FR-blocking filter
Chamber treatment
Figure 2. Average growth increment after 27-day treatment of five replications exposed to
different red:far-red under two different filter chambers. Trees inside clear filter chambers
(R:FR = 0.8) were 27% taller than trees inside the FR-blocking filter chambers (R:FR = 3.2,
P = 0.01). The vertical bars represent standard error.
57
30
E 25 o
g 20
I O c
! o
15
10
Clear filter
FR-blocking filter
9 12 15 18 21
Days after treatment
24 27
Figure 3. Increase in cumulative stem growth in response to low red:far-red light (clear
filter, R:FR = 0.8) during 27 days of treatment. Growth increments are averages of five
replications for each treatment exposed to two different red:far-red light. The vertical bars
represent standard error.
58
6
Clear filter
FR-blocking filter ' 5 0-
4 O)
3
2
1
0-1 1-2 2-3 3-4 4-5 5-6 6-7 7-8 8-9 9-10
Intemode between each leaf plastochron index
Figure 4. Average intemode length after 27-day filter treatment of five replications exposed
to two different red:far-red light under two different filter chambers. Leaf plastochron index
(LPI) was used to compare the leaves between the two treatment in the same stage of
development and same age of leaves (LPI 0 > 3.0 cm). The vertical bars represent standard
error.
59
E o
4.5
4
3.5
3
O) 2.5
» 0) "3
I 2
1.5
1
0.5
0
Clear filter
FR-blocking filter
2 3 4 5 6 7 8 9
Leaf plastochron index
10
Figure 5. Average petiole length at each leaf plastochrom index (LPI 0 > 3.0 cm) after 27-
day treatment of five replications exposed to two different red:far-red light under two
different filter chambers. The vertical bars represent standard error.
60
CHAPTER 3. IMMUTANS AND GHOST ARE PLASTID QUINOL OXIDASES:
EVIDENCE FOR A NEW STRUCTURAL MODEL OF THE MITOCHONDRIAL
ALTERNATIVE OXIDASE
A paper submitted to Proceedings of the National Academy of Sciences
Hanhong Baea, Friedrich Behringer3, Carolyn Wetzel0 and Steve Rodermel3
Abstract
The immutans (im) variegation mutant of Arabidopsis has green- and white-sectored
leaves due to the action of a nuclear recessive gene. The white sectors of im accumulate
phytoene, a carotenoid biosynthetic intermediate. IMMUTANS codes for a plastid protein
that bears similarity to alternative oxidase (AOX), an inner mitochondrial membrane protein
that serves as a terminal oxidase in the alternative pathway of respiration. The function of
IM is unclear, but by analogy to AOX, it may function in a poorly understood redox pathway
in which electrons are transferred from phytoene to molecular oxygen. The ghost (gh)
variegation mutant of tomato bears phenotypic similarities to immutans. In this paper we
show that the im and gh phenotypes arise from mutations in orthologous genes, and we take
interdepartmental Genetics Major, Iowa State University, Ames, IA 50011
^Department of Botany and Plant Pathology, Oregon State University, Corvallis, OR 97331
^Department of Biological Sciences, East Tennessee State University, Johnson City, TN
37614
61
advantage of the tomato system to demonstrate that GH is expressed in plastid-types that
accumulate high levels of carotenoids, viz., chloroplasts in leaves and chromoplasts in
developing fruit and flowers. This suggests that GH (and IM) play a major role in
carotenogenesis. We also exploit the distant phylogenetic relatedness of GH (and IM) versus
AOX to test structural models of AOX. Our analyses reveal that AOX, IM and GH are RNR
R2 di-iron carboxylate proteins with perfectly conserved Fe-coordinating ligands that
define a quinol-binding catalytic site. This provides strong support for the hypothesis that
IM and GH are plastid quinol oxidases that act downstream from a quinone pool to dissipate
electrons in both chloroplast and chromoplast membranes. Importantly, our phylogenetic
analyses provide compelling evidence that AOX, IM and GH are interfacial membrane
proteins, indicating that structure/function studies based on currently accepted models of
AOX as a transmembrane protein will need to be re-evaluated.
Introduction
Carotenoids are C40 terpenoids that accumulate to high levels in the chloroplasts and
chromoplasts of photosynthetic eukaryotes (1,2). In chloroplasts, carotenoids function as
accessory pigments in photosynthesis, as structural determinants in the thylakoid membrane,
and as photoprotective agents, where they quench triplet excited state chlorophyll and singlet
oxygen that can occur as a byproduct of light absorption (3,4,5). In the absence of colored
carotenoids, chloroplasts are rendered nonfunctional in high light conditions due to
photooxidative damage. In chromoplasts, which are found in some nonphotosynthetic tissues
(e.g., some fruits and flowers), carotenoids are thought to serve primarily as visual attractants
62
for pollinators (5). Carotenoids with provitamin A activity are essential components of the
human diet and many have anti-cancer activity (6).
All the steps of carotenoid biosynthesis occur in plastids by nuclear DNA-encoded
enzymes that are imported into the organelle post-translationally (5). Whereas genes for
most of these enzymes have been cloned and characterized (2), the identification and
isolation of factors that regulate higher plant carotenogenesis are poorly understood. To gain
insight into these factors we have been studying the immutans (im) variegation mutant of
Arabidopsis (7,8). Cells in the green sectors of im contain morphologically normal
chloroplasts, whereas cells in the white sectors have abnormal plastids that lack organized
internal lamellar structures. All im alleles examined to date are nuclear recessive (8,9,
unpublished data) and white sector formation is promoted by growth in enhanced light
intensities (7,9).
The white plastids of im accumulate phytoene, a colorless C40 carotenoid
intermediate, suggesting that im is impaired in the activity of phytoene desaturase (PDS),
which converts phytoene to zeta-carotene (7). We have recently positionally cloned
IMMUTANS (8) and found that it codes for a plastid homolog of the mitochondrial
alternative oxidase (AOX), an inner membrane protein that acts as a terminal oxidase in the
alternative pathway of mitochondrial respiration (10,11). This pathway branches from the
cytochrome pathway at the ubiquinone pool; AOX transfers electrons from ubiquinone to
molecular oxygen, forming water. IM is only distantly related to AOX, but because of its
similarity to the AOX class of proteins we suggested that it may be a component of a poorly
understood redox pathway in which the desaturation of phytoene by PDS results in the
transfer of electrons to a quinone pool and thence to molecular oxygen (12,13,14,15). We
63
hypothesized that IM could act either as a cofactor of PDS, passing electrons to the quinone
pool, or as a redox component downstream from the quinone pool (8).
We and others (5,7) have noted that there are many phenotypic similarities between
im and the well-known ghost (gh) variegation mutant of tomato (16) (Fig. 1). Like im,
variegation arises in gh due to the action of a nuclear recessive gene (16); the white gh
sectors accumulate phytoene (16,17,18); and white sector formation in gh is promoted by
elevated light intensities (16,18). In this paper we show that im and gh arise from mutations
in orthologous genes and we use the tomato system as a tool to clarify the function of IM and
GH in carotenogenesis. We further exploit the phylogenetic distance between IM and GH
versus AOX to gain insight into the structure of these proteins. Our analyses provide
compelling evidence that the active sites of these proteins are highly conserved, indicating
that current structural models of AOX need to be revised.
Materials and Methods
Plant Material and Growth Conditions
Tomato (Lycopersicon esculentum Mill.) seeds heterozygous for the ghost (gh)
mutation were obtained from the Tomato Genetics Resource Center (University of
California, Davis). The plants were maintained in a greenhouse. The hétérozygotes were
sel fed and the F1 progeny were used for analysis; the genotypes of normal-appearing F1
plants (gh/+ or +/+) were determined by examining the phenotypes of F2 progeny from
selfed F1 plants. For some experiments, seeds were surface sterilized (50% Chlorox),
germinated on Gamborg medium supplemented with 3% sucrose, and maintained on a lab
64
bench under continuous light (100 |imol/m2sl). In some cases, the tissue culture medium was
supplemented with 5 x 10"5 M Norflurazon (Sandoz 9789).
Nucleic Acid Manipulations
A tomato (cv. VFNT cherry) green-fruit cDNA library (kindly provided by D.
Hannapel, Iowa State University) was screened for the presence of /M-like sequences using
established procedures (19); the filters were probed with a radiolabeled Arabidopsis IM
cDNA (8). Tomato genomic DNAs were isolated and genomic DNA gel blot analyses were
conducted, also by established methods (19). GH genomic sequences were determined by
primer walking using DNAs from +/+ and gh/gh F1 progeny plants; the PCR products were
sequenced directly. DNA and derived protein sequences were analyzed using DNASIS
(Hitachi Software Engineering America, San Francisco, CA); Biology WorkBench
(http//biology.ncsa.uiuc.edu) and ChloroP (http://www.cbs.dtu.dk/services/ChloroP/).
Total cell RNA was isolated using an RNA isolation kit (Quiagen, Valencia, CA).
RNA gel blot and RT-PCR analyses were performed as previously described (7,20).
Northern filters were probed with random-primed cDNAs specific for the tomato IM
homolog (GH) or for Lhcb (CAB40, for the tobacco light-harvesting chlorophyll a/b binding
proteins of photosystem II) (21).
65
Results
im and gh Arise from Mutations in Orthologous Genes
A tomato gene with homology to IM was isolated by screening a tomato fruit cDNA
library with IM sequences. Four cDNAs were identified, all of which were identical in
sequence but differed in their 3' lengths. The size of the longest cDNA (1,463 bp) was
similar to that of transcripts from this gene on RNA gel blots (see later, Fig. 6), suggesting
that it is a near full-length cDNA (Fig. 2). This cDNA contains an open reading frame of
366 amino acids with a predicted molecular mass of 42.1 kD, similar to IM (40.5 kD) (8).
The protein also bears 67% amino acid sequence identity to IM, with most of the variability
in the putative N-terminal plastid targeting sequences of the two proteins. We conclude that
we have isolated an IM homolog from tomato.
Genomic Southern blot analyses performed under low stringency hybridization
conditions revealed that the IM homolog is a single-copy gene in tomato (data not shown).
IM is also a single-copy gene in Arabidopsis (8). Sequencing of tomato genomic DNA
showed that the IM-homolog contains nine exons, identical to the number found in the IM
genomic sequence (Fig. 3A). As a first step to determine whether the gene for the IM
homolog is the same as the gene for GH, we used a collection of 45 F2 plants generated from
an interspecific cross between Lycopersicon esculentum (L.) Mill, and L pennellii (Correll)
D'Arcy to physically map the IM homolog on the tomato genome. We found that it mapped
6.4 cM (+/- 0.29 cM) from RFLP marker TG47 on chromosome 11 ; TG47 maps ~3 cM from
GH (23). This map location is consistent with the idea that the IM homolog maps to the GH
locus.
66
If IM and GH are homologs, then the IM homolog should bear a mutation in gh
plants. To test this hypothesis, we determined the genomic sequence of the I M homolog in
gh/gh and +/+ F1 progeny plants. Compared to the wild type, the IM homolog contains a T
nucleotide insertion near the 3'end of the seventh exon of the gene in the mutants (Fig. 3A).
This would be predicted to generate an mRNA species with a premature stop codon ~40 nt
downstream from the site of the insertion (Fig. 3B). However, mutations near splice sites of
plant genes sometimes result in the activation of cryptic splicing sites that generate mRNAs
in which the normal reading frame is reconstituted (A. Manuell and S. Rodermel,
unpublished data). To examine this question in gh, we isolated mRNAs from gh/gh plants
and performed reverse transcriptase-PCR (RT-PCR). Sequencing of the PCR products
revealed that the IM homolog transcripts bears the T insertion and contains the expected
premature stop codon (Fig. 3B). This suggests that a truncated protein would be generated
from the gh mRNA; if stable, this polypeptide would lack critical functions of the GH protein
(below, Fig. 4).
In summary, we have shown that the tomato genome contains a single copy gene for
an IM homolog, that this homolog maps to gh, and that its mRNAs bear a premature stop
codon in gh plants. These data support the notion that GH and IM are orthologous proteins.
Further support for this conclusion comes from the observation that im and gh have similar
phenotypes.
Structural Model of GH, IM and AOX
Phylogenetic analyses revealed that IM is a distantly related member of the AOX
class of inner mitochondrial membrane proteins (8). The substrates of AOX are ubiquinol
67
and dioxygen, and iron is essential for activity (10,11). The currently accepted structural
model of AOX, proposed by Siedow and colleagues (24,25) was based on that of the "RNR
R2" class of di-iron carboxylate proteins (named after the R2 subunit of ribonucleotide
reductase). The active sites of RNR R2-type proteins consist of a binuclear iron center
coordinated by two histidines and four carboxylate residues (26). In the Siedow model,
AOX contains two transmembrane domains, with the N and C termini exposed to the matrix
side of the membrane (Fig. 4A). Of three "EXXH" motifs in the C-terminal portion of the
protein (Bl, B2 and B3), B2 and B3 were proposed to form part of the di-iron center because
only these two would reside on the same side of the membrane. It has proven difficult to test
the Siedow model, and it enjoys little unequivocal experimental support (26).
Taking advantage of a larger number of AOX sequences than were available when
the Siedow model was proposed, Andersson and Nordlund (26) have recently proposed a
revised structural model of AOX. They hypothesized that the hydrophobic regions of AOX
are not transmembrane segments but rather, as with other RNR R2 proteins, they proposed
that AOX is an interfacial membrane protein with an active site contained within a four helix
bundle, with helices 1 and 3 (and helices 2 and 4) oriented anti-parallel to one another. In
this model, the active site consists of a di-iron center coordinated by the B1 and B3 "EXXH"
motifs on the paired second and fourth helices (Fig. 4A), while the other two carboxylates
are contributed by the paired first and third helices. El83 on helix 1 and E274 on helix 3
were proposed as these carboxylate residues, based on the spacing between helices 1 and 2
(usually 30 amino acids) and between helices 3 and 4 (also, usually 30 amino acids) found in
other RNR R2 type proteins.
68
Because we found that IM and GH are only distantly related to AOX (8), we reasoned
that phylogenetic comparisons of these sequences might offer an opportunity to test the
validity of the Andersson and Nordlund model, i.e., AOX sequences that are evolutionary
conserved in GH and IM are likely important for structure and function. In Fig. 4B, the
sequences of 20 AOX proteins were compared with those of IM and GH in the C-terminal
two-thirds of the protein. This is the most conserved region of the three proteins (Fig. 2).
Consistent with the Andersson and Nordlund model, GH (and IM) are predicted to contain
four helices. Importantly, the B1 and B3 "EXXH" sites are precisely conserved between
AOX, GH, and IM; the B2 site is not conserved. This suggests strongly that these sequences
provide four of the six expected Fe-ligands. The only conserved carboxylates in helices 1
and 3 are E147 and E238, respectively, suggesting that these residues serve as the other two
Fe ligands.
The strict conservation of the B1 and B3 sequences (on helices 2 and 4, respectively)
indicates that if these sequences provide four of the six Fe-ligands, they must reside on the
same side of the membrane to form a bi nuclear iron center. Considered together with the
precise conservation of the E147 and E238 sequences (on helices I and 3, respectively), our
data thus lend striking support to the Andersson and Nordlund hypothesis that the four
helices in AOX are oriented anti-parallel to one another, as in other RNR R2 proteins, and
that AOX is an interfacial membrane protein, also as in other RNR R2 proteins (26). We
propose that IM and GH have a similar structure to AOX (Fig. 5). As with AOX, we
hypothesize that the hydrophobic portions of GH and IM insert only partially through the
lipid bilayer, providing a surface for dimerization, which has been observed with AOX
(10,11), or other protein/protein interactions.
69
GH Expression
As a first approach to assess the physiological function of GH and the mechanism of
gh variegation, we examined the patterns of GH mRNA accumulation in various tomato
tissues, organs and developmental stages. CAB mRNA expression served as a control. GH
transcripts were detected in all organs tested. They were highest in expanding (young)
leaves, flowers, and fruits, and lowest in stems and roots (Fig. 6A). Similar levels
accumulated in the green leaf tissues of WT and gh, but much lower levels were found in the
white sectors of gh leaves (Fig. 6A). GH mRNAs increased markedly in abundance during
flower and fruit development (Fig. 6B), two processes that involve the biogenesis of
chromoplasts from either proplastids (during flower development) or chloroplasts (during
fruit development) (27). GH transcript amounts were also elevated by treatment with
Norflurazon (NF), a chemical inhibitor of PDS (Fig. 6C). Etiolated and greening seedlings
had similar GH mRNA levels (Fig. 6C), suggesting that GH transcription is not
photoregulated.
As anticipated, CAB transcripts were abundant in all normally green organs of the
plant (Fig. 6A). They also declined during flower and fruit development (Fig. 6B) and were
induced during de-etiolation (Fig. 6C), also as expected (27); expression in the flowers is
from the sepals. Fig. 6C further reveals that CAB mRNAs are detectable in the white leaf
tissues of gh, but not in white, NF-treated leaves. Moreover, CAB mRNA levels were
markedly higher in the green leaf sectors of gh than in the leaves of WT plants (Fig. 6A).
This is also the case in im (28), where we suggested that higher CAB mRNA levels in the
green sectors is part of a physiological strategy to maximize growth that involves an increase
70
in light-harvesting capacity and photosynthesis in the green sectors to compensate for a lack
of photosynthesis in the white sectors.
Discussion
Structure of AOX, GH and IM
The primary lesion in the gh variegation mutant has been a matter of intense
speculation since its discovery nearly 50 years ago (16). In support of the idea that GH is the
tomato ortholog of IM, we found that a tomato IM homolog is a single copy gene in tomato
(as is IM in Arabidopsis) (8); that the IM homolog maps to the gh locus; that its mRNA
contains an insertion mutation in the gh background; and that the phenotypes of gh and im
are very similar. Interestingly, this phenotype has not yet been described for any other
Arabidopsis or tomato mutant loci. It will be of interest to determine whether light-sensitive
variegations in other species, such as albescent in maize (29), are orthologous to IM and GH.
Our phylogenetic analyses have provided compelling evolutionary evidence for the
validity of the Andersson and Nordlund model (26) of the structure of the AOX. Not only
are the active site helices conserved between AOX, GH, IM, and other RNR R2 type di-iron
proteins, but our evolutionary filtering allowed us to identify precisely the six carboxylates
that likely act as coordinating Fe ligands; these will be the target of future mutagenesis
experiments. Also consistent with the Andersson and Nordlund model, we predict that AOX,
GH and IM are interfacial membrane proteins. One possibility is that the hydrophobic
helices (previously modeled as transmembrane domains) are involved in protein-protein
interactions. Regardless, the conservation of active site residues between GH, IM and AOX
argues convincingly that GH is a quinol oxidase, and suggests that these proteins have
71
similar reaction mechanisms. The active sites of RNR R2 type di-iron proteins examined to
date have a small hydrophobic crevice that reaches down to the Fe center and that serves as
the quinol-binding site. We suggest that this, too, is the case for the active sites of IM, GH
and AOX.
Whereas our analyses are in broad agreement with the idea that IM, GH and AOX
have structures like other RNR R2-type proteins, there are some differences. Most notably,
there is an insertion of 19 amino acids between helices 3 and 4 in the GH (and IM) versus
AOX sequences, which results in an abnormally long second helix pair. Yet, this may be a
trend in the AOX class of RNR R2 proteins inasmuch as the spacing between the two co
ordinating carboxylates within the pair of helices 3 and 4 in AOX is 50 residues (versus a
normal 30 residues); the significance of this spacing is not clear. It is also likely that there
are differences in the regulatory properties of IM and GH versus AOX. For instance, GH
(and IM) lack the conserved cysteines that are involved in dimerization and activation of
AOX (30,31). Any contribution to structure and function by sequences in the N termini of
the mature proteins might also be unique, since GH, IM and AOX are not conserved in this
region. Despite these apparent differences, the proposed structural model of AOX, IM and
GH offers testable hypotheses about residues and domains that are important for structure
and function. In this light, it would be worthwhile to re-evaluate results from previous
structure/function studies on AOX that were designed assuming AOX is a transmembrane
protein and that B2 and B3 are the active site Fe-ligands (e.g., 32,33,34).
72
Role of GH in Carotenogenesis and the Mechanism of Variegation
The accumulation of phytoene in gh indicates that GH affects (directly or indirectly)
the activity of PDS, suggesting that GH plays a central role in carotenoid biosynthesis. In
support of this notion, GH transcripts are abundant in tissues whose plastids accumulate high
levels of carotenoids- leaves, flowers and fruits. They are also abundantly expressed during
chromoplastogenesis. The expression profile of GH is similar to that of PDS and PSY, two
genes in the carotenogenic pathway (27,35-39). We conclude that carotenoid accumulation
and GH expression are coordinated, at least at the level of transcript abundance, arguing that
GH plays a role in carotenogenesis.
The enzymes of carotenoid biosynthesis starting with the PDS step appear to be part
of a membrane-localized metabolon (2), and thus one possibility is that GH (IM) is a
component of this complex in both chromoplast and chloroplast membranes. In our current
working model, we envision that electrons from the desaturation of phytoene are transferred
by PDS to a quinone pool and thence to GH, reducing molecular oxygen. GH may also be
involved in the other desaturation step of carotenoid biosythesis, viz., the conversion of zeta
carotene to lycopene by zeta carotene desaturase (ZDS) (2). However, because GH mRNAs
appear to be present in plastid types that accumulate only trace levels of carotenoids, such as
etioplasts in dark-grown seedlings and amyloplasts in roots (27,36), it is possible that GH
plays a more general role in plastid metabolism. For instance, we have suggested that IM
functions during chloroplast biogenesis to help optimize electron dissipation while the
photosynthetic apparatus is being assembled (8). According to this hypothesis, im leaves are
variegated because photoprotective (colored) carotenoids are not synthesized in the absence
of IM, making the contents of the developing chloroplast susceptible to photooxidation under
73
high light intensities. We further hypothesized that the formation of green versus white
plastids is conditioned by variations in IM activity and in the light intensity perceived by
individual plastids in the developing leaf primordium; once formed, white and green plastids
divide to form clones of plastids and cells (sectors) in the mature leaf (8).
We propose that variegated gh tissues that are normally green arise by a mechanism
similar to im (8). Yet, tomato tissues that contain chromoplasts, as well as chloroplasts, are
variegated in gh (flowers, fruits). The chromoplasts in these tissues are non-pigmented and
lack organized internal membrane structures (18, H. Bae and S. Rodermel, unpublished
observations). Because chromoplasts do not undergo photosynthesis and photooxidation, we
suggest that a lack of GH results in an inhibition of carotenogenesis and a consequent
blockage of chromoplast development at an early stage. Consistent with this idea, colored
carotenoid accumulation is necessary for the assembly and stability of chromoplast
membranes (4).
Regardless of the precise mechanisms of variegation in im and gh, perusal of the
cyanobacterial genome database reveals that IM, GH and AOX are not found in
cyanobacteria, the evolutionary progenitors of plastids. One possibility is that a nuclear gene
for the mitochondrial AOX duplicated and diverged, and once it acquired plastid targeting
signals, it became functional in multiple plastid types, serving primarily as a redox
component in carotenogenesis, but also as a more generalized electron sink. In agreement
with this hypothesis, recent evidence in Chlamydomonas suggests that IM may serve as a
terminal oxidase of chlororespiration (40).
74
Expression of gh: Feedback Regulation
In addition to enhanced GH expression in carotenoid-accumulating tissues, our
expression analyses revealed that GH transcripts are induced in NF-treated tomato leaf
tissues. This is consistent with the notion that GH, like PDS and PSY, is subject to feedback
regulation of transcription, with higher rates in non-pigmented tissues (27,39). Against this
suggestion, we did not find induction of GH mRNAs in the white tissues of gh, as reported
for PDS and PSY (27). We cannot explain this difference, but it points toward the possibility
that the plastid states in the two types of phytoene-accumulating white tissues (i.e., gh and
NF-treated) are not identical, even though both are presumably photooxidized due to a lack
of colored carotenoid production. In support of this idea, Fig. 6 showed that CAB mRNAs
are detectable in the white leaf tissues of gh but not in NF-treated tomato leaves; we
observed a similar phenomenon in im (28). The lack of CAB mRNA accumulation in the
NF-treated tissues of both im and gh is consistent with the "plastid signal" hypothesis that the
transcription of some nuclear genes for plastid proteins is dependent on a signal that requires
developing or mature chloroplasts for its generation and/or transmission (41). However, the
presence of CAB mRNAs in the white sectors of gh and im suggests that CAB transcription is
partially uncoupled from its normal dependence on chlorophyll accumulation and chloroplast
development in these mutants. CAB transcription appears to be sensitive to the redox state of
the plastid (42), and thus one way GH (and IM) could influence this process is via altering
the redox poise of the PQ pool. How a lack of GH activity affects photosynthetic electron
transport is currently under investigation.
75
References
1. McGarvey, D.J. & Croteau, R. (1995) Plant Cell 7, 1015-1026.
2. Cunningham, F.X. & Gantt, E. (1998) Annu. Rev. Plant. Physiol. Plant. Mol. Biol. 49,
557-583.
3. Demmig-Adams, B., Gilmore, A.M. & Adams, W.W. III. (1996) FASEB J. 10,403-412.
4. Havaux, M. (1998) Trends Plant Sci. 3, 147-151.
5. Bartley, G.E. & Scolnik, P.A. (1995) Plant Cell 7, 1027-1038.
6. Bendich, A. (1994) Pure Appl. Chem. 66, 1017-1024.
7. Wetzel, C M., Jiang, C.-Z., Meehan, L.J., Voytas, D.F. & Rodermel, S R. (1994) Plant J.
6, 161-175.
8. Wu, D., Wright, D.A., Wetzel, C„ Voytas, D.F. & Rodermel, S. (1999) Plant Cell 11, 43-
55.
9. Rédei, G.P. (1967) Genetics 56,431-443.
10. Siedow, J.N. & Umbach, A.L. (1995) Plant Cell 7, 821-831.
11. Vanlerberghe, G.C. & Mcintosh, L. (1997) Annu. Rev. Plant Physiol. Plant Mol. Biol. 48,
703-734.
12. Mayer, M P., Beyer, P. & Kleinig, H. (1990) Eur. J. Biochem. 191, 359-363.
13. Schulz, A., Ort, O., Beyer, P. & Kleinig, H. (1993) FEBS Lett. 318, 162-166.
14. Nievelstein. V., Vandekerkchove, J., Tadros, M.H., Lintig, J.V., Nitschke, W. & Beyer,
P. (1995) Eur. J. Biochem. 233, 864-872.
15. Morris, S R., Barrette, T.R. & DellaPenna, D. (1995) Plant Cell 7, 2139-2149.
16. Rick, C.M., Thompson, A.E. & Brauer, O. (1959) Am. J. Bot. 46, 1-11.
17. Mackinney, G., Rick, C.M. & Jenkins, J.A. (1956) Proc. Natl. Acad. Sci. USA 42,404-
408.
18. Scolnik, P.A., Hinton, P., Greenblatt, I.M., Giuliano, G., Delanoy, M.R., Spector, D.L. &
Pollock, D. (1987) Planta 171,11-18.
19. Ausubel, P.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. &
Struhl, K. (1998) Current Protocols in Molecular Biology. (Greene Publishing
Associates/Wiley Interscience, New York).
20. Wetzel, C.M. & Rodermel, S R. (1998) Plant Mol. Biol. 37, 1045-1053.
21. Rodermel, S R., Haley, J., Jiang, C.-Z., Tsai, C.-H. & Bogorad, L. (1996) Proc. Natl.
Acad. Sci. USA 93, 3881-3885.
22. Carol, P., Stevenson, D., Bisanz, C., Breitenbach, J„ Sandmann, G., Mache, R.,
Coupland, G. & Kuntz, M. (1999) Plant Cell 11, 57-68.
23. Tanksley, S.D. et al. (1992) Genetics 132, 1141-1160.
24. Siedow, J.N., Umbach, A.L. & Moore, A.L. (1995) FEBS Lett 362, 10-14.
25. Moore, A.L., Umbach, A.L. & Siedow, J.N. (1995) J. Bioenerg. Biomembr. 27, 367-377.
26. Andersson, M.E. & Nordlund, P. (1999) FEBS Lett. 449, 17-22.
27. Giuliano, G., Bartley, G.E. & Scolnik, P A. (1993) Plant Cell 5, 379-387.
28. Meehan, L„ Harkins, K„ Chory, J. & Rodermel, S. (1996) Plant Physiol. 112, 953-963
29. Troxler, R.F., Lester, R., Craft, P.O. & Albright, J.T. (1969) Plant Physiol. 44, 1609-
1618.
30. Umbach, A.L. & Siedow, J.N. (1993) Plant Physiol. 103, 845-854.
31. Vanlerberghe, G.C., Mcintosh, L. & Yip, J.Y.H. (1998) Plant Cell 10, 1551-1560.
77
32. Albury, M.S, Affurtit, C. & Moore, A.L. (1998) J. Biol. Chem. 273, 30301-30305.
33. Chadhuri, M., Ajayi, W. & Hill, G.C. (1998) Mol. Biochem. Parasit. 95, 53-68.
34. Berthold, D.A. (1998) Biochim. Biophys. Acta 1364, 73-83.
35. Maunders, M.J., Holdsworth, M.J., Slater, A., Knapp, J.E., Bird, C.R., Schuch, W. &
Grierson, D. (1987) Plant Cell Environ. 10, 177-184.
36. Fraser, P.O., Truesdale, M.R., Bird, C.R., Schuch, W. & Bramley, P.M. (1994) Plant
Physiol. 105,405-413.
37. Pecker, I., Chamovitz, D., Linden, H., Sandmann, G. & Hirschberg, J. (1992) Proc. Natl.
Acad. Sci. USA 89, 4962-4966.
38. Pecker, I., Gabbay, R., Cunningham, F.X. & Hirschberg, J. (1996) Plant Mol. Biol. 30,
807-819.
39. Corona, V., Aracri, B„ Kosturkova, G., Bartley, G.E., Pitto, L., Giorgetti, L„ Scolnik,
P.A. & Giuliano, G. (1996) Plant J. 9, 505-512.
40. Cournac, L., Redding, K., Ravenel, J., Rumeau, D„ Josse, E.-M., Kuntz, M. & Peltier, G.
(2000)7. Biol. Chem. 275, 17256-17262.
41. Leon, P., Arroyo, A. & Mackenzie, S. (1998) Annu. Rev. Plant Physiol. Plant Mol. Biol.
49, 453-480.
42. Escoubas, J.-M., Lomas, M., LaRoche, J. & Falkowski, P.G. (1995) Proc. Natl. Acad.
Sci. USA 92, 10237-10241.
78
FIGURE LEGENDS
Fig. 1. The gh variegation mutant of tomato.
Fig. 2. GH is homologous to IM. The translated GH cDNA sequence (deposited in Genbank
as Accession number AF302931) is compared to that of IM (8). Identical amino acid
residues are boxed. The arrow indicates a putative protease cleavage site for removal of an
N-terminal transit sequence (predicted by ChloroP software). The location of this site
correlates with the size of the IM transit sequence, as estimated by in vitro chloroplast import
experiments (8,22) *, site of the insertion mutation in gh (See Fig. 3).
Fig. 3. gh mRNA has an insertion mutation.
A) Schematic of the GH genomic sequence (deposited in Genbank as Accession number
AF302932). Exons are shown as filled boxes, introns as open boxes. The numbering below
the gene refers to bp in the genomic sequence (5.01 kbp), commencing with the first base of
the GH cDNA. The numbering above the gene diagram refers to the codon position in the
translated sequence. *, site of the insertion mutation in gh.
B) The translated sequence of the IM homolog has a T insertion in gh/gh plants, resulting in a
premature stop codon.
79
Fig. 4. Structural and functional domains of AOX, GH and IM.
A) The predicted structure of AOX according to the Siedow model (top) (24,25) and to the
Andersson-Nordlund model (middle) (26). The structure of GH is modeled after the
Andersson-Nordlund model. Shaded boxes (I-IV) are alpha helical regions: T1 and T2 are
putative transmembrane segments; "EXXH" (Bl, B2 and B3), "D" and "E" are putative Fe
binding carboxylate ligands; TP are putative transit peptides. Size of the protein is from
initiating ATG (codon 1) to the termination codon.
B) Comparison of AOX, GH and IM derived amino acid sequences. Non-identical residues
are shown. The sequences of GH and IM are compared downstream from codon 135 in the
GH sequence. The sequences were compared with 20 AOX sequences from GenBank
(.Arabidopsis thaliana AOX la, Arabidopsis thaliana AOX lb, Arabidopsis thaliana AOXlc,
Arabidopsis thaliana AOX2, Glycine max AOXl, Glycine max AOX2, Glycine max AOX3,
Nicotiana tabacum AOXl, Nicotiana tabacum AOX2, Oryza sativa AOX la, Oryza sativa
AOX lb, Sauromatum guttatum AOXl, Catharanthus roseus AOX, Mangifera indica AOXl,
Zea mays AOX, Chlamydomonas reinhardtii AOXl, Neurospora crassa AOX, Hansenula
anomala AOX, Trypanosoma brucei brucei AOX, Chlamydomonas sp AOX). Open and
shaded boxes, identical amino acids between all three sequences; the six perfectly conserved
Fe-ligands are indicated by the shaded boxes. Alpha helices are single-underlined;
hydrophobic regions are double-underlined. *, site of the insertion mutation in gh. —, gaps
in the alignment.
80
Fig. 5. Structural model of GH. GH is proposed to be an interfacial membrane protein with
a di-iron center coordinated by two EXXH motifs on helices 2 and 4 (oriented anti-parallel to
one another), and two carboxylates on helices 1 and 3 (also oriented anti-parallel to one
another).
Fig. 6. GH mRNA expression.
A) Total cell RNAs were isolated from stems, roots, young expanding leaves, flowers
(corresponding to stage 3, Fig. 6B), and fruit (Turning stage) from WT plants, and from
white and green sectors of young expanding leaves of ghost. The samples were from
greenhouse-grown plants. Seven ng of each sample was electrophoresed through
formaldehyde-agarose gels and the filters were probed with random-primed cDNAs specific
for GH and CAB. Gel loadings are shown by EtBr-staining of rRNA bands.
B) RNAs were isolated from five developmental stages of flowers: stage 1 (< 0.2 cm); stage
2 (< 0.5 cm); stage 3 (< 1 cm); stage 4 (open sepal stage); and stage 5 (open petal stage)
(stages defined in 27). For tomato fruits, RNAs were isolated from total pericarp from
mature green (MG), breaker (BR), turning (TU), and red-ripe (RR) fruits. The samples were
from greenhouse-grown plants. Two gg of each sample were electrophoresed through
formaldehyde-agarose gels then treated as in A).
C). Total cell RNAs were isolated from WT seedlings germinated for 7 days in the dark on
tissue culture medium (dark), then exposed to light for 4 h or 12 h (100 (imol/mY, 22 °C).
81
WT and gh seedlings were also germinated in the light on tissue culture medium for 7 days,
then transferred to new medium for 10 days; RNAs were isolated from expanding WT leaves
and from dissected white sectors of expanding ghost leaves (gh white). Some WT type
plants growing in the light were transferred to medium containing Norflurazon (5 X 10"5 M)
for the 10 days; total cell RNAs were isolated from bleached leaf tissue (NF).
Figure 1
83
n» 164
rTTACCTAACAACGGTATTAATTTCATTCrrGTGCGAA 3GAAJAALX3A7CAACAA7CZX:GATTrC£yVTTTCrGCTAT'2ACTrr?OGAACCTCAôTrrC «a : : m ? : : a: ?
S i 3 ? l A K
TAATTCTCTTTTT*;CTTC'V.AAAT :TnATCCCCCTTCAC:X7T': : R F N J V F e : s K j 2 A «551? : 4 m L :. H H L i L - - - - - J S£?1S R -TA^-JVUiTCATOTA^AirrrCGAGCAACCTrCTT/urAAJAÔAArGAACAAà'A : t £ ii iiSS ;iS3 '• SEES S
•AAr' -lAA.X:-' Aù - A- - --.ATCATTC AT •CTCTAACCGrrT/VJAtîAAAT V«CTTATAAA U - . * V ? - z ? . m m -• m l E K « v :. r. £ » N M .i :: *^53 ? A F W ? # : -r ie
^-TT:A—ACT -TCTAAATATrrTALrrCAC^CATTCACTCATAAACATTCTTCACACTTT s ses v r «aBaaBBmmmeM
TTAT A.V\A::UAAACTAT^T^A^;TTTT rT;TT-:TryiAAA :AATTr;CAA î t « s . s
ï M ï i 'Waaaa ? 'BmBgBBa
;« i r & z V.AAATV .TTt U7Î •
ïï 5 gB#mEamag*«gRB : $
TIAATITCTr^A^CCCATCCATA^A^CTTACCATAAATTtAT AUGATZAAk^A^A i : % 3 a
* V.AATT-JUCMXATrTCi.'C-^rrcrA/xAi ATTtkrAiTrfA^ACTACTACAC^r^AGr.-riACrT EEGSS S 5 HB# Ï
ATATTTATTT-.ATCAJT TTCAAACTTCAL"AJAJCCTAATAJT:_1AA^A: "TAAAAATAJA v i :
TAATTT^TATIA,—TATT "AT">AA "ATTAv".A^ATCACT.AA»>~AinAc^A7T'7rAAAA^rw\T
. ;:•) w%v. :TTTr:AAACT:Ajn,viA^"rrT':rrrr rT- TA:ACA':AGA-—-:AT V-T.ATSA % S 3RBM • i ï : ï ; 83S
% ' ï i V I t ; s ï ï l ë m m . ; •; TT::TATAAAL^w\JT:ACTCACC:;ATATr:AAL;TAACCAAAA(X7TALK;AAAACX:AAAAA«.':: 353 C : WWÎ?m •'• .1 D T ; v r K •* * 3*4 c :. i r* '* : * s . : K . ACAAA-rrATACrTGTATATACTAOTA-rA^Ai AAAAAAAAAAAAATAL-AAAÔATArA TTACAT'TrrerTATZTTTTTITrTGAGCTACAÛATG: .T : OC AAAJTTTT -" AA^GCAAAA T : : : : AHATAGTrTACCTrATTTAAJdrTCTTTACTA^ArTSTTTTTATATTTAGAATTTiTTA . r: -TC^AAACrzrrTATA^TC^ATJCATTrT^ACAArrTTT^GATATATCrJArrrJCATGAC . 4 -T7TTTACATA'"r,7AAAAAAAAAAAAAAA
J91 264
Figure 2
84
A
ATG(l) *(259) TAG (367)
1 4263 4762 5019
B
WT RNA aat ttg ccc get cca aag att gca gtg gac tac tac acg gga ggt gac tta tat protein N L P A P K I A V ' D Y Y T G G D L Y
ghost RNA aat ttl gcc cgc tcc aaa gat tgc agt gga eta eta cac ggg agg tga ctt ata protein NFARSKDCSGLLHGR stop
Figure 3
85
rz lxxh n kxxh
Figure 4
86
1 1 Btetid Këmbrape I I I ! 1 i I < i ( I l l >, I I < I ( ( ,1 I ( ( I I I '
Figure 5
9 3-m3ij
WT stem
WT root
gh white leaf
gh green leaf
WTlcaf
WT flower
WT fruit
light 4 fa
light 12 h
WT leal
NF-lref
wihlc leaf
Z.8
88
CHAPTER 4. PLASTID-TO-NUCLEUS SIGNALING: THE IMMUTANS GENE OF
ARABIDOPSIS CONTROLS PLASTID DIFFERENTIATION AND LEAF
MORPHOGENESIS
A paper submitted to The Plant Physiology
Maneesha Aluru, Hanhong Bae, Dongying Wu and Steven Rodermel
Department of Botany and Interdepartmental Genetics Program, Iowa State University,
Ames, Iowa 50011
Abstract
The immutans (im) variegation mutant of Arabidopsis has green and white leaf
sectors due to the action of a nuclear recessive gene. IM is a chloroplast homolog of the
mitochondrial alternative oxidase. Because the white sectors of im accumulate the
noncolored carotenoid, phytoene, IM likely serves as a redox component in phytoene
desaturation. In this paper we show that IM has a global impact on plant growth and
development and that it is required for the differentiation of multiple plastid types, including
chloroplasts, amyloplasts and etioplasts. Consistent with these observations, IM promoter
activity and IM mRNAs are expressed ubiquitously in Arabidopsis. IM transcript levels do
not necessarily correlate with carotenoid pool sizes, raising the possibility that IM function is
not limited to carotenogenesis. Leaf anatomy is radically altered in the green and white
sectors of im. In particular, mesophyll cell sizes are dramatically enlarged in the green
sectors and palisade cells fail to expand in the white sectors. These findings suggest that im
interrupts plastid-to-nucleus signaling pathways that control Arabidopsis leaf developmental
programming. The green im sectors have significantly higher than normal rates of O,
89
evolution and significantly elevated chlorophyl a/b ratios, typical of those found in "sun"
leaves. We conclude that the changes in structure and photosynthetic function of the green
leaf sectors are part of an adaptive mechanism that attempts to compensate for a lack of
photosynthesis in the white leaf sectors, while maximizing the ability of the plant to avoid
photodamage.
Introduction
Variegation mutants provide an excellent system to explore the nature of
communication between the nucleus-cytoplasm, chloroplast and mitochondrial genetic
compartments (reviewed by Leôn et al., 1998; Rodermel, 2001). The leaves of these mutants
have green and white (or yellow) sectors that arise as a consequence of mutations in nuclear
or organellar genes (Tilney-Bassett, 1975). Whereas the green sectors contain cells with
morphologically normal chloroplasts, cells in the white sectors contain plastids that lack
pigments and normal lamellar structures. One common mechanism of variegation involves
the induction of defective mitochondria or chloroplasts by mutations in nuclear genes. This
is sometimes due to transposable element activity, in which case the green and white cells
have different genotypes. In other cases the two types of cells have the same (mutant)
genotype, indicating that the gene defined by the mutation codes for a product that is required
for organelle biogenesis in some, but not all, cells of the mutant.
Despite the large number of mutant screens that have been conducted in Arabidopsis,
surprisingly few nuclear "variegation" loci have been reported. These include cab
underexpressed (cue 1), chloroplast mutator (chm), differential development of vascular-
associated cells (dov), immutans (im),pale cress (pac), varl and varl (e.g., Rédei, 1963;
90
1967; 1973; Rôbbelen, 1968; Martinez-Zapater et al., 1992; Reiter et al., 1994; Li et al.,
1995; Grevelding et al., 1996; Sakamoto et al., 1996; Lôpez-Juez et al., 1998; Meurer et al.,
1998; Tirlapur et al., 1999; Streatfield et al., 1999). Of these, we have focused on immuians
(Wetzel et al., 1994; Meehan et al., 1996; Wetzel and Rodermel, 1998; Wu et al., 1999) and
varl (Chen et al., 1999; Chen et al., 2000); im is the topic of the present investigation, im
was first isolated and partially characterized nearly 40 years ago by Rédei (1963; 1967) and
Rôbbelen (1968). Sectoring in im is due to the action of a nuclear recessive gene, and white-
sector formation is promoted by growth in elevated light or temperature (Rédei, 1963;
Rôbbelen, 1968; Wetzel et al., 1994). Visually white reproductive structures of im give rise
to variegated progeny that are predominantly green or white, again depending on growth
illumination and temperature. Because of this apparent phenotypic reversibility and an
inability of the mutant to convert permanently from an all-green ("wild-type-like") to an
albino phenotype, Rédei (1975) called the mutant immutans (for "immutable"). Consistent
with this reversibility, abnormal plastids are not maternally-inherited in im, suggesting that
the plastid defect can be cured (Wetzel et al., 1994).
Biochemical analyses revealed that im white sectors accumulate phytoene, a colorless
Cw carotenoid intermediate (Wetzel et al., 1994). This suggests that the mutant is impaired in
the activity of phytoene desaturase (PDS), the plastid enzyme that converts phytoene to (3-
carotene (Bartley et al., 1991). We cloned IM by map-based methods and found that it codes
for a plastid homolog of the mitochondrial alternative oxidase (AOX) (Wu et al., 1999); a
transposon-tagged im allele has also been reported (Carol et al., 1999). AOX is an inner
mitochondrial membrane protein that functions as a terminal oxidase in the alternative
(cyanide-resistant) pathway of mitochondrial respiration where it generates water from
91
ubiquinol (reviewed by Siedow and Umbach, 1995; Vanlerberghe and Mcintosh, 1997).
This similarity to AOX suggested that IM may be a component of a redox pathway that
functions in the desaturation of phytoene (Beyer et al., 1989; Mayer et al., 1990; 1992;
Schulz et al., 1993; Nievelstein et al., 1995; Morris et al., 1995). Consistent with this
interpretation, IM has quinokoxygen oxidoreductase activity when expressed in E. coli (Josse
et al., 2000).
We are interested in determining the physiological function of IM and the mechanism
of im variegation. A powerful way to gain insight into IM function is to examine the
phenotype of im plants. Because previous studies of im have focused on leaf variegation, we
were interested in determining whether im has other phenotypes. In this report, we show that
the mutant is impaired in its growth and development, and that this impairment is due, in
part, to a blockage of plastid differentiation in diverse cell types. IM expression appears to
be ubiquitous, but expression levels are not always correlated with carotenoid accumulation,
opening the possibility that IM serves as a general electron sink in thylakoid membranes.
Mesophyll cell morphogenesis is affected in both the green and white sectors of im,
indicating that IM is required for the transmission of a plastid signal(s) to regulate leaf
developmental programming. Finally, we report that the green im sectors have higher than
normal photosynthetic rates, perhaps to compensate for a lack of photosynthesis in the white
sectors.
92
Results
Phenotype of immutans
We have sequenced three im alleles and all are predicted to be null (Wu et al., 1999).
For the present studies we used the spotty allele. We have previously reported that im seeds
germinate normally under all light conditions (Wetzel et al., 1994), and that depending on the
illumination conditions, germinated seedlings have green, variegated or white cotyledons and
true leaves (Redei, 1967; Rôbbelen, 1968; Wetzel et al., 1994). Other normally-green
organs, including stems and sepals, are also variegated. Whereas im flowers are
morphologically normal, siliques are smaller than wild-type and are either variegated or all-
white. White siliques lack seeds and variegated siliques have significantly fewer seeds than
normal.
Under low light conditions that promote the formation of nearly all-green plants, im
grows more slowly than wild-type (Fig. 1); im ultimately attains the stature of wild-type
plants. Shoot growth is similarly retarded in mutant plants maintained under normal light
conditions. However, in this case it is difficult to ascribe the growth impairment to a lack of
IM per se since it can be argued that these plants have white sectors and, consequently, that
there is less green tissue than normal to support growth. Figure 2 shows that wild-type and
im roots increase in length as a function of growth illumination. Whereas both types of roots
have a similar size distribution in darkness and under low light conditions, there is a tendency
for the wild-type to have longer roots than im under normal light conditions. Considered
together, Figures 1 and 2 indicate that a lack of IM impacts root and shoot development.
93
Expression of IM
The phenotype of im suggests that IM is expressed not only in leaves, but also in
other Arabidopsis tissues and organs. To determine the developmental- and tissue-specificity
of IM expression, we investigated the patterns of IM promoter activity in transgenic plants
that bear an IM promoter: GUS reporter gene fusion (Fig. 3). Seeds from each line were
germinated on MS medium or in soil and GUS activity assays were carried out at different
stages of development. The expression patterns were identical for each of five
independently-transformed lines; the results in Figure 4 are from one of the lines.
GUS activity is first observed in one day-old light-grown seedlings immediately after
seed coat breakage (Fig. 4A). All of the tissues (roots, hypocotyls and cotyledons) are
heavily stained. This pattern is maintained throughout vegetative development, as illustrated
by the presence of GUS staining in roots, cotyledons, hypocotyls and developing first leaves
of 7-day-old light-grown seedlings (Fig. 4B). High levels of GUS activity are also found in
the cotyledons of dark-grown seedlings; however, the hypocotyls are barely stained (Fig.
4C). This is in contrast to control experiments performed with transgenic 35S promoter:
GUS seedlings, in which the hypocoyls and cotyledons are uniformly stained (Fig. 4D).
GUS activity appears to increase during early leaf development. It is low in the shoot
apical meristem (Fig. 4E) and in very young expanding leaves (leaf number 1 in Fig. 4E). As
the leaves continue to expand, GUS activity increases (leaf number 2 in Fig. 4E). Mesophyll
cells, guard cells and trichomes are stained in young leaves, while epidermal cells lack
significant staining (Figs. 4F and 4G). GUS activity is present in old leaves of six-week-old
mature rosettes (Fig. 4H). Stems also have appreciable GUS activity (Fig. 41). A cross
section of a hypocotyl reveals that staining is very high in the vascular tissues, but lower in
94
the ground tissues (Fig. 4J). GUS activity is also present throughout the root (Fig. 4K).
Staining is observed in all flower parts, including the sepals, petals, and anthers (Fig. 4L),
and also in green silique coats (Fig. 41). In young seeds, GUS is expressed specifically in the
funiculus (Fig. 4M). All tissues except seed coats are stained with GUS in the control 35S
promoter: GUS fusion plants (as Fig. 4D).
To obtain a quantitative estimate of IM mRNA levels, we performed northern blot
analyses on total cell RNAs isolated from various Arabidopsis tissues and organs. Fig. 5A
shows that IM mRNAs are present in all of the RNA samples analyzed. IM transcripts are
most abundant in leaves, cotyledons, flowers and stems, and least abundant in etiolated
seedlings and siliques. IM mRNAs increase in amount during leaf development. These
experiments validate the results of the IM promoter: GUS assays and indicate that IM is
expressed ubiquitously in Arabidopsis tissues and organs throughout development.
Pigment Analyses
Carotenoid and chlorophyll levels were examined in the same organs and tissues as
the RNA gel blot analyses to determine whether there is a correlation between IM mRNA
accumulation and pigment content (Fig. 5B). In general, tissues in which IM mRNAs are
abundant have high pigment levels. Yet, there is not a one-to-one correspondence. For
instance, IM mRNAs are nearly as abundant in roots as in cotyledons and stems, but roots
contain only trace pigment amounts. IM mRNAs also increase progressively during leaf
development, while carotenoid and chlorophyll levels decline. On the other hand, a lack of
GUS staining of etiolated hypocotyls (Fig. 4C) correlates well with a lack of detectable
95
pigment in this tissue. We conclude that the patterns of IM mRNA expression and pigment
accumulation do not necessarily correspond.
Plastid Ultrastructure
We have previously examined the ultrastructure of plastids in the green and white leaf
sectors of im (Wetzel et al., 1994). Because of the ubiquity of IM expression, we wanted to
determine whether IM is required for the biogenesis of plastids in organs other than leaves.
As shown in Figure 6, normal chloroplasts are present in wild-type cotyledons and in the
green sectors of im cotyledons (Fig. 6A), while the white sectors of im cotyledons contain
vacuolated plastids that lack organized lamellar structures (Fig 6B). The latter plastids are
the size of normal chloroplasts, i.e., much larger (~6 gm) than undifferentiated proplastids in
meristem cells (0.5-1 gm) (Bowman, 1994). These findings are similar to TEM analyses of
plastids in wild-type and im leaves (Wetzel et al., 1994).
Amyloplasts are small (approximately the size of proplastids), irregularly-shaped
plastids in roots (Bowman, 1994). They usually contain starch granules and a few extended
lamellar structures. Figure 6C shows that roots from wild-type Arabidopsis contain typical
amyloplasts. Examination of a large number of plastids in sections of im roots reveals that
some resemble wild type amyloplasts, but that most are devoid of extended lamellae and
starch granules (Fig. 6D). This heterogeneity in structure suggests that root tissues have a
heteroplastic amyloplast population. Cells in the white leaf sectors of im are also
heteroplastidic (Wetzel et al., 1994).
Etioplasts are achlorophyllous plastids found in dark-grown seedlings (reviewed by
von Wettsein et al., 1995). They contain a distinctive paracrystalline lattice of interconnected
96
membrane tubules (the prolamellar body, or PLB). Figure 6E shows a representative
etioplast from a dark-grown wild-type cotyledon; it has a single large PLB. In contrast,
etioplasts from dark-grown im seedlings do not contain PLBs, but rather have a large,
organized molecular array (Fig. 6F). A large number of sections of im etioplasts have been
examined, and PLB-like structures have not been observed, i.e., the molecular array structure
is not an artifact of sectioning. Taken together, the data in Figure 6 indicate that IM is
required for the normal development of several plastid-types in Arabidopsis.
Anatomy of im Leaves
Although a lack of IM results in variegated green organs and retards plant growth,
light microscopy of tissue sections reveals that the morphology of non-green im organs (e.g.,
roots, hypocotyls and cotyledons of etiolated seedlings) is not detectably perturbed (data not
shown). This is in contrast to green organs such as leaves. We have previously shown that
chloroplast development is impaired in the white sectors of im leaves, but that the green leaf
sectors contain morphologically normal chloroplasts (Wetzel et al., 1994). Figure 7 shows
representative tissue sections of wild-type leaves, green im sectors, white im sectors and a
transition zone between green and white sectors. The wild-type leaves have typical
epidermal, columnar palisade mesophyll and spongy mesophyll cell layers; the latter two
layers have densely staining chloroplasts (Fig. 7A). In contrast, the tissue organization of the
green and white sectors of im leaves is perturbed. In particular, the green sectors are thicker
than normal due to a marked enlargement in the sizes of the mesophyll cells, epidermal cells
and air spaces (Fig. 7B). The white leaf sectors have a normal thickness, but the palisade
cells fail to expand normally (Fig. 7C). The distinctive characteristics of the white and green
97
sectors are apparent in regions where the two tissue-types abut and overlay one another (Fig.
7D). This suggests that the factors that cause the abnormalities in cell structure are cell
autonomous.
The significant anatomical differences between the wild-type and im green sectors
raise the question whether the two types of green tissue have similar photosynthetic rates. As
a first approach to address this question, we measured the amount of oxygen evolved from im
versus wild-type plants on a per chlorophyll basis. We analyzed the response of plants
germinated and maintained under both low light and normal light conditions. We found that
the im green sectors evolve approximately twice as much oxygen as the wild type under both
illumination conditions (Fig 8A). In normal light conditions, the enhancement in oxygen
evolution is accompanied by a significantly enhanced chlorophyll a/b ratio (Fig. 8B).
Discussion
IMMUTANS Plays an Important Role in Plant Development
Previous morphological, biochemical and molecular analyses of immutans have
focused on leaves (Rédei, 1963; 1967; Rôbbelen, 1968; Wetzel et al., 1994). These studies
showed that IM is required for normal chloroplast biogenesis in some, but not all, plastids
and cells of the expanding leaf. In the present study, we observed phenotypic alterations in
other major organ systems of the mutant. This was true for both green organs (e.g.,
cotyledons, stems, siliques) and non-green organs (e.g., roots, etiolated hypocotyls and
cotyledons). These data suggest that IM has a global impact on plant physiology and
development. Support for this conclusion is provided by our IM promoter: GUS fusion and
98
northern blot analyses showing that the IM promoter is active and that IM mRNAs are
expressed ubiquitously in Arabidopsis tissues and organs throughout development.
Role of IMMUTANS in Plastid Metabolism
The accumulation of phytoene in im white sectors suggests that PDS activity is
impaired in im and that IM plays an important role in carotenoid biosynthesis (Wetzel et al.,
1994). Cloning and sequencing of IM revealed that the gene product is a chloroplast
membrane protein with homology to the AOX class of inner mitochondrial membrane
terminal oxidases (Wu et. al., 1999; Carol et al., 1999). IM also has quinol oxidase activity
when expressed in E. coli (Josse et. al., 2000). Considered together, these data suggest that
IM is a redox component of a phytoene desaturation pathway involving PDS, plastoquinol
and oxygen as a terminal acceptor (Beyer et al., 1989; Mayer et al., 1990; 1992; Schulz et al.,
1993: Nievelstein et al., 1995; Norris et al., 1995).
In support of the central role of IM in carotenogenesis, our data show that the IM
promoter is active and that IM transcripts are abundant in Arabidopsis tissues that accumulate
high levels of carotenoids, including cotyledons, leaves, stems, siliques and flowers. In like
manner, some tissues that do not accumulate carotenoids, e.g., hypocotyls of dark-grown
seedlings, have low levels of IM expression. In further support of the idea that IM expression
and carotenoid accumulation are normally coupled is the finding that transcripts from an IM
ortholog in tomato are abundantly expressed during tomato fruit ripening (Josse et. al., 2000;
H. Bae and S. Rodermel, in preparation). During ripening, chloroplasts are converted into
carotenoid-accumulating chromoplasts; Arabidopsis, versus tomato, does not have an
abundant chromoplast population.
99
By contrast, we found that IM is expressed at appreciable levels in tissues whose
plastids accumulate only small carotenoid amounts. These include amyloplasts in roots and
etioplasts in dark-grown seedlings. Yet, IM appears to be required for the proper functioning
of these organelles. Particularly striking is the blockage in development of im etioplasts,
where ordered structures, but not PLBs, accumulate in the stroma. We speculate that these
represent unassembled intermediates of the PLB, and that IM may be a redox component of
the PLB membrane required for PLB assembly (directly or indirectly). One possibility is that
IM is a subunit of the recently-described PLB supercomplex that mediates the light-
dependent reduction of Chlide a (Reinbothe et al., 1999).
Further support for the idea that IM function is not limited to carotenogenesis is the
finding that IM is up-regulated during leaf development. In Arabidopsis and other dicots,
photosynthetic rates reach a maximum early in leaf development (usually coincident with
leaf expansion), then progressively fall during a prolonged senescent phase in the fully-
expanded leaf (Miller et al., 1997; 2000; Gan and Amasino, 1997; A. Miller, D. Stessman,
M. Spalding and S. Rodermel, unpublished findings). During senescence, chloroplasts are
converted into gerontoplasts and resources are mobilized to growing parts of the plant. Both
anabolic and catabolic processes are responsible for reductions that occur in many plastid
components during the senescence process (Matile, 1992). The up-regulation of IM
expression in the face of declining carotenoid production suggests that IM participates in
oxidative activities that occur during this phase of development.
Because all plastid types synthesize carotenoids (e.g. as precursors of ABA), the
possibility cannot be ruled out that IM is an electron transfer component involved solely in
carotenogenesis. Nevertheless, our data point the way toward a more global role of this
100
protein in plastid metabolism. In agreement with this hypothesis, recent evidence in
Chlamydomonas suggests that IM serves as a terminal oxidase in chlororespiration (Coumac
et. al., 2000). In the context of its importance in plastid metabolism and its ubiquitous
expression in all plastid types, it is interesting that IM does not seem to be required in
cyanobacteria, since BLAST searches show that IM (and AOX) are not present in this
evolutionary precursor of chloroplasts. Our working hypothesis is that a plant nuclear gene
for mitochondrial AOX duplicated, and once it acquired plastid targeting signals, it became
functional in many plastid-types as a redox component mediating electron transfer in
multiple pathways.
Plastid Signals Regulate Leaf Development
A considerable body of evidence supports the notion that the transcription of nuclear
genes for many photosynthetic proteins is controlled by the developmental state of the plastid
(the "plastid signal" hypothesis) (reviewed by Taylor, 1989; Susek and Chory, 1992; Leôn et
al., 1998; Rodermel, 2001). As an example, Lhcb transcription is markedly reduced in
carotenoid-deficient seedlings produced either by mutation or by treatment with herbicides
that block the carotenoid biosynthetic pathway, such as norflurazon, which inhibits PDS
activity (e.g., Mayfield and Taylor, 1984; Oelmiiller, 1989). Consistent with these
observations, we have previously reported that the white sectors of im, which are also
blocked at the PDS step of carotenogenesis, have reduced rates of Lhcb transcription and
decreased Lhcb mRNA levels (Meehan et al., 1996). A number of plastid signals have been
identified, and they have in common that they are involved (directly or indirectly) in
photosynthesis (reviewed by Rodermel, 2001). These signals include chlorophyll
101
biosynthetic intermediates (Johanningmeier, 1988; Oster et al., 1996; Kropat et al., 1997),
carotenoids (Corona et al., 1996), reactive oxygen intermediates (Gupta et al., 1993), and the
redox state of the thylakoid membrane, e.g., the redox poise of plastoquinone (Maxwell et al.,
1995; Escoubas et al., 1995; Karpinski et al., 1997). The pathways by which these signals
are transduced from the plastid to the nucleus are not understood, but Escoubas et al. (1995)
have presented evidence that plastoquinone signaling occurs via a phosphorylation cascade.
In addition to plastid signals that regulate the transcription of nuclear photosynthetic
genes, plastid signals appear to control tissue and organ developmental programming.
Identification of this type of plastid-to-nucleus signaling has come from an examination of a
handful of pigment mutants that have alterations in leaf anatomy. These include dag of
Antirrhinum (Chatterjee et al., 1996), del of tomato (Keddie et al., 1996), and several
Arabidopsis mutants, including clal (Mandel et al., 1996; Estévez et al., 2000), cue 1 (Li et
al., 1995; Streatfield et al., 1999) and pac (Reiter et al., 1994; Meurer et al., 1998). The
white leaf tissues of these mutants have abnormal plastids that resemble undifferentiated
proplastids, suggesting that they are blocked in early chloroplast biogenesis. These tissues
also have altered palisade and/or spongy mesophyll cell layer organizations. The genes
defined by these mutations have been cloned and all code for plastid proteins. While the
functions of most of these proteins are unclear, CUE 1 codes for the plastid
phosphoenolpyruvate/ phosphate trans locator (Streatfield et al., 1999) and CL41 codes for
DXP synthase, an enzyme in isoprenoid biosynthesis (Mandel et al., 1996; Estévez et al.,
2000).
In this report we found that im is similar to the other pigment mutants in that the
white im sectors have an abnormal palisade cell layer and plastids that lack organized
102
lamellar structures. In contrast to the other mutants, the white plastids do not resemble
proplastids, inasmuch as they are vacuolated and significantly larger (Figure 6 and Wetzel et
al., 1994) and likely arise by photooxidation (Wu et al., 1999). Although these observations
suggest that im is blocked later in plastid biogenesis than the other mutants, there are other
explanations (e.g., an impairment in plastid division early in development). It is possible that
the products of genes like IM are required independently for chloroplast biogenesis and for
mesophyll cell development. Yet, because they are localized in the plastid, it is more likely
that they are required for chloroplast biogenesis, and that the effects on mesophyll cell
differentiation are a consequence of incomplete chloroplast differentiation. We conclude that
IM is required for the functioning of a plastid-to-nucleus signaling pathway in which plastids
transmit one or more signals (plastid developmental signals) to the nucleus to regulate leaf
developmental programming.
Are plastid developmental signals the same as the plastid signals that regulate
photosynthetic gene expression? Most of the mutants with altered leaf anatomies, including
im, do not express Lhcb mRNAs (e.g., cla 1, cue 1, dag, im). The one exception is pac, which
has normal Lhcb mRNA levels (Reiter et al., 1994; Meurer et al., 1998). This suggests that
the plastid signal(s) that participates in mesophyll cell differentiation is separable from the
plastid factors involved in regulating the expression of nuclear genes for plastid proteins.
Consistent with this notion, Lhcb transcription can be uncoupled from leaf morphology in
mutants such as gun 1 (Susek et al., 1993; Mochizuki et al., 1996). In this case, norflurazon-
treated (white) leaf tissues of wild type or gunl have a normal anatomy, but the wild-type
and gunl differ in their patterns of Lhcb expression—i.e., wild-type cells lack Lhcb mRNAs,
while gunl cells express them.
103
Adaptations in the Green IM Sectors
Our anatomical studies showed that the green leaf sectors of im are thicker than
normal due to an enhancement in mesophyll cell size and intercellular air space volume
(Figure 7). Analyses of fluorescence-activated cell-sorter (FACS)-purified cells previously
demonstrated that cells from green im leaf sectors have more chlorophyll than similarly-sized
cells from wild-type plants (Meehan et al., 1996). As illustrated in Figure 8, the im green
sectors also have significantly elevated rates of photosynthesis on a chlorophyll basis. We do
not yet know why this is the case, but our observations point toward a complex mechanism
whereby the photosynthetic potential of the im green sectors is enhanced to compensate for a
lack of photosynthesis in the white sectors. We also found that the green im cells have
significantly higher chlorophyll a/b ratios than wild-type cells under normal light conditions.
High chlorophyll a/b ratios are typically found in "sun" versus "shade" plants and are
indicative of smaller light harvesting complexes and/or an altered stoichiometry of PSI and
PSII (reviewed by Stitt, 1991). These are typically adaptations to avoid light stress. Our
working hypothesis is that a lack of IM gives rise to morphological and biochemical
adaptations in the green sectors that make the leaf more "sun'Mike, perhaps as a way to avoid
photooxidative damage.
Materials and Methods
Plant Material and Growth Conditions
Seeds from wild-type Arabidopsis thaliana (Columbia ecotype) and the spotty allele
of immutans (im) (Wetzel et al., 1994) were germinated and grown at 25°C under continuous
illumination, either at 100 |imol-m'V (normal light; NL) or at 15 nmol-m'V (low light;
104
LL). Samples were collected from various tissues and organs from 4-5 wk old plants. To
measure root lengths, wild-type and im seeds were plated on MS medium (pH 5.7)
supplemented with 1 % sucrose. Before plating, the seeds were surface sterilized for 1 min in
70% ethanol, 10 min in 5% NaCl, and washed 5X for 1 min each with sterile distilled water.
The plates were incubated in a vertical position under normal or low light conditions or in
continuous darkness.
RNA and Pigment Analyses
Total RNA isolation and RNA gel blot analyses were performed according to
procedures described previously (Wetzel et al., 1994). The formaldehyde gels contained
equal amounts of RNA per gel lane. The blots were probed with an IM cDNA (Wu et al.,
1999). The analyses were repeated twice to confirm the reproducibility of the results.
Pigment extractions and calculations of pigment concentrations were performed essentially
as described by Lichtenthaler (1987). Leaf tissues were extracted with several changes of
95% ethanol in the dark at 4*C, and absorbance measurements were made at 664nm, 649nm
and 470nm.
IM Promoter: GUS Fusion Constructs
Transgenic Arabidopsis were generated that contained either an IM promoter: GUS
fusion or a cauliflower mosaic virus (CaMV) 35S promoter: GUS fusion. The IM promoter:
GUS fusion was derived from the binary plasmid, pPZPZIMGUS. To generate
pPZP/IMGUS, an -2.1 kb Smal/EcoRI fragment of pBI121 (Clontech, Palo Alto, CA),
which contains the GUS gene (Jefferson et al., 1987) fused to the nos terminator, was
105
subcloned into pPZP211 (Hajdukeiwicz et al., 1994), a binary vector that contains the NPTII
gene driven by the 35S promoter. This gave rise to pPZP/GUS. The IM promoter is a
Bcll/Xbal fragment that includes a portion of the N-terminal transit sequence of IM (25
amino acids) and ~3 kb of upstream sequence (Fig. 3). It was subcloned from a Ler lambda
genomic library (Voytas et al., 1990) and inserted as a Pstl/Xbal fragment into pPZPGUS.
The resulting construct (pPZP/IMGUS) is a translational fusion between the -25 amino acids
of the transit sequence and the GUS protein. The 35S promoter-GUS fusion sequence was
derived from the binary plasmid, pPZP/35SGUS. In this construct, the Xbal/SacI GUS-
containing sub-fragment of pPZPGUS was replaced by the 2.7 kb Pstl/SacI sub-fragment of
pBI121, which contains the GUS gene fused to the 35S promoter.
pPZP/IMGUS and pPZP/35SGUS were introduced into the Agrobacterium strain
C58CI by electroporation, and flowering Arabidopsis plants (Columbia ecotype) were
transformed by the floral dip method (Clough et al., 1998). After flowering, the T1 seeds
were collected and germinated on selective MS medium (50 ng/ml kanamycin). Forty-two
T1 lines of the IM promoter: GUS fusion were screened for the presence of the foreign DNA
by Southern hybridization (procedures described in Wetzel et al., 1994), and 5 lines were
identified with single-copy T-DNA insertions at different sites in the genome. Each of these
contained an intact reporter gene fusion. Similar procedures were carried out with the 35S
promoter: GUS lines. Two T1 lines were identified that had single intact inserts.
GUS activity assays were conducted on transgenic plants with a single IM promoter:
GUS insertion. For these assays, T2 seeds were sown on MS plates in the dark for two days
at 4°C. To obtain etiolated seedlings, the plates were maintained in darkness for another 4
days, but at 22°C. To obtain light-grown seedlings, the plates were transferred from the cold
106
to a growth chamber (100 gmol m " s ' continuous illumination, 22°C). To obtain mature
plants, the seedlings were transplanted to soil then maintained in a growth chamber. Plants
of different developmental stages were collected and analyzed for GUS activity as described
by Horvath et al. (1993). In some experiments, the stained plant tissues were embedded in 4
% agarose, and sections (-50 |im) were examined by light microscopy.
Light and Electron Microscopy
For TEM, cotyledon and root samples were obtained from 7-day-old seedlings grown
on MS medium under either normal light conditions or darkness. The samples were fixed,
stained, and examined as in Homer and Wagner (1980). Samples for light microscopy were
obtained from fully-expanded leaves or roots from wild-type and im plants grown under
normal light conditions in the growth chamber. They were cut into 1 mm pieces, vacuum
infiltrated with fixative (1% paraformaldehyde and 2% glutaraldehyde), then incubated
overnight at 4°C. After washing in 0.1 M cacodylate buffer, the samples were dehydrated
through an ethanol series and embedded in Spurr's resin. Sections (1.5 gm) were attached to
glass slides, stained with 1% toluidine blue and observed in bright field with a light
microscope (Leitz Orthoplan).
Measurements of Oxygen Evolution
Leaves from 4-5 wk old wild-type and im plants grown under normal and low light
conditions were used for oxygen evolution experiments as described by (Van and Spalding,
1999). The leaves were cut into 1-2 mm size pieces and half of the sample was immersed
into 1 ml of 10 mM NaHCOr After vacuum infiltration for 15 min, the sample was placed
107
in a Clark 02 electrode chamber and 02evolution was measured under 500 gmol m" s 'of
incident light at 25°C. The other half of the leaf sample was used for chlorophyll
determinations.
Literature Cited
Hartley GE, Viitanen PV, Pecker I, Chamovitz D, Hirschberg J, Scolnik PA (1991)
Molecular cloning and expression in photosynthetic bacteria of a soybean cDNA
coding for phytoene desaturase, an enzyme of the carotenoid biosynthesis pathway.
Proc Natl Acad Sci USA 88: 6532-6536
Beyer P, Mayer M, Kleinig H (1989) Molecular oxygen and the state of geometric
isomerism of intermediates are essential in the carotene desaturation and cyclization
reactions in daffodil chromoplasts. Eur J Biochem 184:141-50
Bowman J (1994) Arabidopsis: An Atlas of Morphology and Development. Springer-
Verlag, New York
Carol P, Stevenson D, Bisanz C, Breitenbach J, Sandmann G, Mache R, Coupland G,
Kuntz M (1999) Mutations in the Arabidopsis gene IMMUTANS cause a variegated
phenotype by inactivating a chloroplast terminal oxidase associated with phytoene
desaturation. Plant Cell 11: 57-68
Chatterjee M, Sparvoli S, Edmunds C, Garosi P, Findlay K, Martin C (1996) DAG, a
gene required for chloroplast differentiation and palisade development in Antirrhinum
majus. EMBO J 15: 4194-4207
108
Chen M, Jensen M, Rodermel S (1999). The yellow variegated mutant of Arabidopsis is
plastid autonomous and delayed in chloroplast biogenesis. J. Heredity 90: 207-214
Chen M, Choi YD, Voytas D, Rodermel S (2000) Mutations in the Arabidopsis VAR2
locus cause leaf variegation due to the loss of a chloroplast FtsH protease. Plant J 22:
303-313
Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediaied
transformation of Arabidopsis thaliana. Plant J 16: 735-43
Corona V, Aracri B, Kosturkova G, Bartley GE, Pitto L, Giorgetti L, Scolnik PA,
Giuliano G (1996) Regulation of a carotenoid biosynthesis gene promoter during plant
development. Plant J 9: 505-512
Coumac L, Redding K, Ravenel J, Rumeau D, Josse E-M, Kuntz M, Peltier G. (2000)
Electron flow between photosystem II and oxygen in chloroplasts of photosystem-
deficient algae is mediated by a quinol oxidase involved in chlororespiration. J Biol
Chem 275: 17256-17262
Escoubas J-M, Lomas M, LaRoche J, Falkowski PG ( 1995) Light intensity regulation of
cab gene transcription is signaled by the redox state of the plastoquinone pool. Proc
Natl Acad Sci USA 92: 10237-10241
Estévez JM, Cantero A, Romero C, Kawaide H, Jimenez LF, Kuzuyama T, Seto H,
Kamiya Y, Leon P (2000) Analysis of the expression of CLA1, a gene that encodes
the 1-deoxyxylulose 5-phosphate synthase of the 2-C-methyI-D-erythritol-4-phosphate
pathway in Arabidopsis. Plant Physiol. 124: 95-103
Gan S, Amasino RM (1997) Making sense of senescence. Plant Physiol 113: 313-319
Grevelding C, Suter-Crazzolara C, von Menges A, Kemper E, Masterson R, Schell J,
Reiss B (1996) Characterization of a new allele of pale cress and its role in greening in
Arabidopsis thaliana. Mol Gen Genet 251: 532-541
Gupta AS, Webb RP, Holaday SA, Allen RD (1993) Overexpression of superoxide
dismutase protects plants from oxidative stress. Induction of ascorbate peroxidsae in
superoxide dismutase-overexpressing plants. Plant Physiol 103: 1067-1073
Hajdukiewicz P, Svab Z, Maliga P (1994) The small, versatile pPZP family of
Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25: 989-994
Horner HT, Wagner BL (1980) The association of druse crystals with the developing
stomium of Capsicum annum (Solanaceae) anthers. Am J Bot 67:1347-1360
Horvath DP, McLarney BK, Thomashow MF (1993) Regulation of Arabidopsis thaliana
L. (Heyn) corl% in response to low temperature. Plant Physiol 103: 1047-1053
Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: ^-glucuronidase as a
sensitive and versatile gene fusion marker in higher plants. EMBO J 6: 3901-3907
Johanningmeier U (1988) Possible control of transcript levels by chlorophyll precursors in
Chlamydomonas. Eur J Biochem 177: 417-424
Josse E-M, Simkin AJ, Gaffé J, Labouré A-M, Kuntz M, Carol P (2000) A plastid
terminal oxidase associated with carotenoid desaturation during chromoplast
differentiation. Plant Physiol 123: 1427-1436
Karpinski S, Escobar C, Karpinska B, Creissen G, Mullineaux P (1997) Photosynthetic
electron transport regulates the expression of cytosolic ascorbate peroxidase genes in
Arabidopsis during excess light stress. Plant Cell 9: 627-640
Keddie JS, Carroll B, Jones JDG, Gruissem W (1996) The DCL gene of tomato is
required for chloroplast development and palisade cell morphogenesis in leaves.
EMBOJ 15: 4208-4217
Kinsman EA, Pyke KA (1998) Bundle sheath cells and cell-specific plastid development in
Arabidopsis leaves. Development 125: 1815-1822
Kropat J, Oster U, Riidiger W, Beck CF (1997) Chlorophyll precursors are signals of
chloroplast origin involved in light induction of nuclear heat-shock genes. Proc Natl
Acad Sci USA 94: 14168-14172
Leon P, Arroyo A, Mackenzie S (1998) Nuclear control of plastid and mitochondrial
development in higher plants. Annu Rev Plant Physiol Plant Mol Biol 49: 453-480
Li H, Culligan K, Dixon RA, Chory J (1995) CUEl: a mesophyll cell-specific positive
regulator of light-controlled gene expression in Arabidopsis. Plant Cell 7: 1599-1610
Lichtenthaler HK (1987) Chlorophylls and carotenoids: Pigments of photosynthetic
biomembranes. In L Packer and R Douce, eds, Methods in Enzymology. Academic
Press, San Diego, pp 350-382
Lopez-Juez E, Jarvis RP, Takeuchi A, Page AM, Chory J (1998) New Arabidopsis cue
mutants suggest a close connection between plastid- and phytochrome regulation of
nuclear gene expression. Plant Physiol 118: 803-815
I l l
Mandel MA, Feldmann KA, Herrera-Estrella L, Rocha-Sosa M, Leôn P (1996) CLAl, a
novel gene required for chloroplast development, is highly conserved in evolution.
Plant J 9: 649-658
Martmez-Zapater JM, Gil P, Capel J, Somerville CR (1992) Mutations at the
Arabidopsis CHM locus promote rearrangements of the mitochondrial genome. Plant
Cell 4: 889-899
Matile P (1992) Chloroplast senescence. In NR Baker and H Thomas, eds, Crop
Photosynthesis: Spatial and Temporal Determinants. Elsevier Science Publishers B.V.,
New York, pp 413-441
Mayer MP, Beyer P, Kleinig H (1990) Quinone compounds are able to replace molecular
oxygen as terminal electron acceptor in phytoene desaturation in chromoplasts of
Narcissus pseudonarcissus L. Eur J Biochem 191: 359-363
Mayer MP, Nievelstein V, Beyer P (1992) Purification and characterization of a NADPH
dependent oxidoreductase from chromoplasts of Narcissus pseudonarcissus: a redox-
mediator possibly involved in carotene desaturation. Plant Physiol Biochem 30: 389-
398
Mayfield SP and Taylor WC (1984) Carotenoid-deficient maize seedlings fail to
accumulate light-harvesting chlorophyll a/b binding protein (LHCP) mRNA. Eur J
Biochem 144: 79-84
Maxwell DP, Laudenbach DE, Huner NPA (1995) Redox regulation of light harvesting
complex II and cab mRNA abundance in Dunaliella salina. Plant Physiol 109: 787-795
112
Meehan L, Harkins K, Chory J, Rodermel S (1996) Lhcb transcription is coordinated
with cell size and chlorophyll accumulation. Plant Physiol 112: 953-963
Meurer J, Grevelding C, Westhoff P, Reiss B (1998) The PAC protein affects the
maturation of specific chloroplast mRNAs in Arabidopsis thaliana. Mol Gen Genet
258: 342-351
Miller A, Tsai C-H, Hemphill D, Endres M, Rodermel S, Spalding M (1997) Elevated
CO, effects during leaf ontogeny: A new perspective on acclimation. Plant Physiol
115: 1195-1200
Miller A, Schlagnhaufer C, Spalding M, Rodermel S (2000) Carbohydrate regulation of
leaf development: prolongation of leaf senescence in Rubisco antisense mutants of
tobacco. Photosyn Res 63: 1-8
Mochizuki N, Susek R, Chory J (1996) An intracellular signal transduction pathway
between the chloroplast and nucleus is involved in de-etiolation. Plant Physiol 112:
1465-1469
Nievelstein V, Vandekerkchove J, Tadros MH, Lintig JV, Nitschke W, Beyer P (1995)
Carotene desaturation is linked to a respiratory redox pathway in Narcissus
pseudonarcissus chromoplast membranes. Involvement of a 23-kDa oxygen-evolving-
complex-like protein. Eur J Biochem 233: 864-872
Norris SR, Barrette TR, DellaPenna D (1995) Genetic dissection of carotenoid synthesis
in Arabidopsis defines plastoquinone as an essential component of phytoene
desaturation. Plant Cell 7: 2139-2149
113
Oelmuller R (1989) Photooxidative destruction of chloroplasts and its effects on nuclear
gene expression and extraplastidic enzyme levels. Photochem Photobiol 49: 229-239
Oster U, Brunner H, Rudiger W (1996) The greening process in cress seedlings. V.
Possible interference of chlorophyll precursors, accumulated after thujaplicin treatment,
with light-regulated expression of Uic genes. J Photochem Photobiol 36: 255-261
Rédei GP (1963) Somatic instability caused by a cysteine-sensitive gene in Arabidopsis.
Science 139: 767-769
Rédei GP ( 1967) Biochemical aspects of a genetically determined variegation in
Arabidopsis. Genetics 56: 431-443
Rédei GP (1973) Extra-chromosomal mutability determined by a nuclear gene locus in
Arabidopsis. Mutation Research 18: 149-162
Rédei GP (1975) Arabidopsis as a genetic tool. Annu Rev Genet 9: 111-127
Reinbothe C, Lebedev N, Reinbothe S (1999) A protochlorophyllide light-harvesting
complex involved in de-etiolation of higher plants. Nature 397: 80-84
Reiter RS, Coomber SA, Bourett TM, Bartley GE, Scolnik PA (1994) Control of leaf and
chloroplast development by the Arabidopsis gene pale cress. Plant Cell 6: 1253-1264
Rôbbelen G (1968) Genbedingte Rotlicht-Empfindlichkeit der Chloroplastendifferenzierung
bei Arabidopsis. Planta 80: 237-254
Rodermel SR (2001) Regulatory interactions between the nucleus and the plastid: plastid-
to-nucleus signaling. Trends Plant Sci (in press)
114
Sakamoto W, Kondo H, Murata M, Motoyoshi F (1996) Altered mitochondrial gene
expression in a maternal distorted leaf mutant of Arabidopsis induced by chloroplast
mutator. Plant Cell 8: 1377-1390
Schulz A, Ort O, Beyer P, Kleinig H (1993) SC-0051, a 2-benzoy 1-cyclohexane-1,3-dione
bleaching herbicide, is a potent inhibitor of the enzyme p-hydroxyphenylpyruvate
dioxygenase. FEES Lett 318: 162-166
Siedow JN, Umbach AL (1995) Plant mitochondrial electron transfer and molecular
biology. Plant Cell 7: 821-831
Stitt M (1991) Rising CO, levels and their potential significance for carbon flow in
photosynthetic cells. Plant Cell Environ 14: 741-762
Streatfield SJ, Weber A, Kinsman EA, Hausler RE, Li J, Post-Beittenmiller D, Kaiser
WM, Pyke KA, Fliigge U-I, Chory J (1999) The phosphoenolpyruvate/ phosphate
translocator is required for phenolic metabolism, palisade cell development, and
plastid-dependent nuclear gene expression. Plant Cell 11: 1609-1621
Susek RE, Ausubel FM, Chory J (1993) Signal transduction mutants of Arabidopsis
uncouple nuclear CAB and RBCS gene expression from chloroplast development. Cell
74: 787-799
Susek RE, Chory J (1992) A tale of two genomes: role of a chloroplast signal in
coordinating nuclear and plastid genome expression. Aust J Plant Physiol 19: 387-399
Taylor CB (1997) Promoter fusion analysis: an insufficient measure of gene expression.
Plant Cell 9: 273-275
115
Taylor WE (1989) Regulatory interactions between nuclear and plastid genomes. Annu
Rev Plant Physiol Plant Mol Biol 40: 211-233
Tilney-Bassett RAE (1975). Genetics of variegated plants. In CW Birky, PS Perlman, TJ
Byers, eds, Genetics and Biogenesis of Mitochondria and Chloroplasts. Ohio State
University Press, Columbus, pp 268-308
Tirlapur UK, Dahse I, Reiss B, Meurer J, Oelmuller R (1999) Characterization of the
activity of a plastid-targeted green fluorescent protein in Arabidopsis. Eur J Cell Biol
78: 233-240
Van K, Spalding M (1999) Periplasmic carbonic anhydrase structural gene (cah 1) mutant in
Chlamydomonas reinhardtii. Plant Physiol 120: 767-764
Vanlerberghe GC, Mcintosh L (1997) Alternative oxidase: from gene to function. Annu
Rev Plant Physiol Plant Mol Biol 48: 703-734
von Wettsetin D, Gough S, Kannangara CG (1995) Chlorophyll biosynthesis. Plant Cell
7: 1039-1057
Voytas DF, Konieczny A, Cummings MP, Ausubel FM (1990) The structure, distribution
and evolution of the Tal retrotransposable element family of Arabidopsis thaliana.
Genetics 126: 713-721
Wetzel CM, Jiang CZ, Meehan LJ, Voytas DF, Rodermel SR (1994) Nuclear-organelle
interactions: the immutans variegation mutant of Arabidopsis is plastid autonomous and
impaired in carotenoid biosynthesis. Plant J 6: 161-175
116
Wetzel CM, Rodermel SR (1998) Regulation of phytoene desaturase expression is
independent of leaf pigment content in Arabidopsis thaliana. Plant Mol Biol 37: 1045-
1053
Wu D, Wright DA, Wetzel C, Voytas DF, Rodermel S (1999) The 1MMUTANS
variegation locus of Arabidopsis defines a mitochondrial alternative oxidase homolog
that functions during early chloroplast biogenesis. Plant Cell 11: 43-55
FIGURES
Figure 1. Growth of wild-type and im. Plants were maintained under low light conditions
(15 p.mol m " s ') and photographed 8 wks after germination. The wild-type has an average of
four true leaves and im an average of two true leaves. The seeds germinated at the same time.
Figure 2. Root growth in wild-type and im. Root lengths were measured after four days of
growth on MS medium supplemented with 1% sucrose. The plants were grown under
normal light (100 gmolm" s '); low light (15 gmol-m'-s '); and in darkness. Each data point
represents an individual plant.
Figure 3. pPZP/IMGUS, the IM promoter: GUS fusion construct. pPZP/IMGUS contains
an -3 kb upstream region of IM fused to the GUS glucuronidase) gene and nos
terminator. The selectable marker is an NPTII gene fused to 35S promoter/noj terminator
elements. Twenty-five amino acids in the fusion protein are from the IM protein (Wu et al.,
1999). RB, right border; LB, left border.
117
Figure 4. Expression patterns of the IM promoter: GUS transgene during development.
A.. 1 day-old light-grown seedlings.
B. 7 day-old light-grown seedling.
C. Dark field microscopy of a 4 day-old etiolated seedling (5X objective).
D. 4 day-old etiolated seedling (35S promoter: GUS fusion) (5X objective).
E. Cross-section of a shoot meristem of a 10 day-old light-grown seedling (25X objective).
F and G. Cross-sections of first true leaves of 10 day-old light-grown seedlings (10X and
25X objectives, respectively).
H 6 week-old rosette.
I. Bolt from a flowering plant.
J. Cross-section of a hypocotyl of a 10 day-old light-grown seedling (25X objective).
K. Root tip of a 10 day-old light-grown seedling.
L. Dark field microscopy of a flower (5X objective).
M. Young seeds.
AM: Apical meristem; AT: Anther; COT: Cotyledon; EP: Epidermis; GC: Guard cell; GT:
Ground tissues; HC: Hypocotyl; MC: Mesophyll cell; VT: Vascular tissues; TR: Trichome.
Figure 5. Expression analysis of IM mRNA and pigment levels in Arabidopsis.
A. RNA gel blot analyses were performed as described in Materials and Methods. The
RNA gel is stained with ethidium bromide to show rRNA's (loading control). The blot was
probed with a radiolabeled IM cDNA (Wu et al., 1999).
118
B. Total carotenoids and chlorophylls were extracted from Arabidopsis as described in
Materials and Methods. Values are an average of three separate experiments ± SD. The
samples in A & B are from 4-5 wk old plants grown under normal light conditions (100
Hmol-m'V), with the exception of the samples from dark-grown seedlings (ET). RT, Root;
ST, Stem; SL, Green silique; FR, Flowers (petals + green sepals); ET, 7-day-old etiolated
seedling (cotyledon + hypocotyl); ET(H), Hypocotyls from 7-day old etiolated seedlings;
CO, 7-day-old cotyledon; YL, young leaf (5 mm length); FL, just fully-expanded leaf (40
mm length); OL, senescing, late-fully expanded leaf.
Figure 6. Plastid ultrastructure. Wild-type and im seedlings were grown on MS plates for 7
days under normal light conditions (A, B, C, D) or in darkness (E, F).
A. Chloroplast from a wild type cotyledon (Bar = 500nm)
B. Chloroplast from an im cotyledon (Bar = 500nm)
C. Amyloplast from a wild-type root (Bar = 200nm)
D. Amyloplast from an im root (Bar = 200nm)
E. Etioplast from a wild-type cotyledon (Bar = 200nm)
F. Etioplast from an im cotyledon (Bar = 200nm)
Figure 7. Light microscopy of fully-expanded leaves from wild-type and im plants grown
under normal light conditions. A magnification of 25X applies to all panels. The white
sectors stain less intensely than green sectors because their plastids are deficient in internal
structures.
119
A. Wild-type.
B. Green leaf sector of im.
C. White leaf sector of im.
D. Adjacent green and white sectors of im.
Figure 8. Photosynthetic oxygen evolution and chlorophyll a/b ratios in wild-type leaves
and im green leaf sectors. Plants were grown under normal light (100 ^mol-m'-s ') or low
light (15 (imol-m'V). Oxygen evolution (A) and chlorophyll a/b ratios (B) were determined
as described in Materials and Methods. Each graph represents an average +/- SD of three
different leaf samples for each illumination condition.
120
Figure 1
121
• WT o immutans
3i> MMIMCO
#»03W •<aœox> •40
ooo
(BOO •*•00000
•«03333000 •
00
• •woo
wo «•
MMM 00
#0033330 ###ooo
00X0 00 00
Dark Low light Normal light
Growth illumination
122
RB
U 25 aa
IM promoter IM GUS Tnos
4 ~ 3 kb »
- 35S NPTII Tnos
LB
U
Figure 3.
123
/ ROOT
COT
B LEAF
COT 5,C
ROOT
-—TR >d NIC
STEM
ROOT
SILIQUE
STEM
K
AM ».
ROOT CAP
PETAL
\ \
SEPAL
G PPEB B .MC
FUNICULUS
Figure 4.
124
B
RT ST SL FR ET CO YL FL OL
carotenoid chlorophyll
RT ST SL FR ET(H) CO YL FL OL
Figure 5
125
Figure 6.
126
Figure 7.
127
u .c
140
>> 120
e £ 100
1 80 -
60 -
40
20
SE "S "5 l 6
I e
3.5
3
2.5
J o
v 1
f
0.5
0
*
l B
WT im WT un
Normal Light Low Light
Growth Illumination
Figure 8.
128
CHAPTER 5. GENERAL SUMMARY
General Conclusion
Growth response to low R:FR in Populus alba
The photosynthetic pigments absorb red (R) light preferentially, but reflect or
transmit far-red (FR) light, which reduces the R:FR photon ratio below 1.0 and acts as a
signal for detection of neighbors (Ballaré et al., 1987, 1990, 1994; Ritchie, 1997; Smith et al.,
1990; Smith and Whitelam, 1997). Although many studies have been performed on the
response to the different R:FR light conditions, most of the data are from herbaceous plants.
In this study, we used two different filter systems to analyze the effect of R:FR ratio on the
stem elongation and other growth traits in young white aspen Populus alba clone 'Bolleana'.
Trees grown inside clear chambers (R:FR < 1.0) were 27% taller than trees grown inside the
FR filter chambers (R:FR > 3.0). Stem taper of clear chamber trees was 16% less than the
FR filter trees. Low R:FR also induced 22% more stem dry weight and 13% greater petiole
length per leaf compared to the FR filter trees. However, other traits, such as leaf number
increment, leaf area, and each dry weight (leaf, petiole and root) showed no significant
differences. The combined dry weight of leaf, stem and petiole was not significantly
different between treatment. This suggests that elongated stem growth was due to enhanced
allocation of resources to stem intemode elongation at the expense of other growth centers,
not the result of increased photosynthesis. This study provides clear evidence that
competition condition (low R:FR) alters tree biomass allocation to stem elongation.
However, this study was performed using the trees in juvenile stage, which might respond
129
differently at older ages. This phenomenon is common in other physiological processes.
Therefore, further experiments with plants of various ages need to be conducted.
ghost and immutans
The ghost (gh) and immutans (im) variegation mutants of tomato and Arabidopsis
have green- and white-sectored leaves due to the action of a nuclear recessive gene. Sector
formation is sensitive to light and temperature. The white sectors of both mutants
accumulate phytoene, a colorless carotenoid intermediate. IM codes for a chloroplast
homolog of the mitochondrial alternative oxidase (AOX), an inner mitochondrial membrane
protein that serves as a terminal oxidase in the alternative pathway of respiration (Wu et al.,
1999). It has been hypothesized that IM functions as a component of a redox chain
responsible for phytoene desaturase (Wu et al., 1999). Consistent with this hypothesis, IM
was shown to have quinol oxidase activity when expressed in E.coli (Josse et al., 2000). The
primary lesion in the gh variegation mutant has been a matter of intense speculation since its
discovery nearly 50 years ago (Rick et al., 1969). We show that the im and gh phenotypes
arise from mutations in orthologous genes. GH is highly expressed in plastid-types that
accumulate high levels of carotenoids, such as chloroplasts in leaves and chromoplasts in
developing fruit and flowers. This suggests that GH plays an important role in
carotenogenesis. Structural analysis shows that AOX, IM and GH are RNR2 di-iron
carboxylate proteins with perfectly conserved Fe-coordinating ligands that define a quinol-
binding catalytic site. This structural similarity with AOX is also supportive for the
hypothesis that IM and GH are plastid quinol oxidases that act downstream from a quinone
pool to dissipate electrons in both chloroplast and chromoplast membranes. In addition,
130
phylogenetic analyses provide evidence that AOX, IM and GH are interfacial membrane
proteins.
According to expression and anatomical studies in Arabidopsis, IM has a broad effect
on plant growth and development and is required for the differentiation of multiple plastid
types. Support for this conclusion is provided by IM promoter:GUS fusion and RNA blot
analyses showing that the IM promoter is active and that mRNAs are expressed ubiquitously
in Arabidopsis tissues and organs throughout development. However, IM expression levels
do not necessarily correlate with carotenoid levels, suggesting that IM function may be not
limited to carotenogenesis. Anatomical studies show that the green leaf sectors of im are
thicker than normal due to enlarged mesophyll cells and that palisade cells fail to expand in
the white sectors. These findings raise the possibility that IM is required for the functioning
of a plastid-to-nucleus signaling pathways in which plastids transmit one or more signals to
the nucleus to regulate leaf developmental programming. The green sectors of im have
significantly elevated rates of photosynthesis. These changes may be a part of an adaptive
mechanism to compensate for a lack of photosynthesis in the white leaf sectors. We
conclude that a lack of IM causes morphological and biochemical adaptations in the green
sectors to feed white leaf sectors and to avoid photooxidative damage.
Literature Cited
Ballaré, C.L, A.L. Scopel, R.A. Sanchez, J.J. Casai and C.M. Gharsa. 1987. Early detection
of neighbor plants by phytochrome perception of spectral changes in reflected
sunlight. Plant Cell Environ. 10:551-557.
131
Ballaré, C L, A.L. Scopel and R.A. Sanchez. 1994. Signaling among neighboring plants
and the development of size inequalities in plant populations. Proc. Natl. Acad. Sci.
USA. 1:10094-10098.
Ballaré, C.L, A.L. Scopel and R.A. Sanchez. 1990. Far-red radiation reflected from adjacent
leaves: an early signal of competition in plant canopy. Science 247:329-332.
Josse, E.M, A.J. Simkin, J. Gaffé, A.M. Labouré, M. Kuntz and P. Carol. 2000. A plastid
terminal oxidase associated with carotenoid desaturation during chromoplast
differentiation. Plant Physiol. 123:1427-1436.
Rick, C M., A.E. Thomson and O. Brauer. 1959. Genetics and development of an unstable
chlorophyll deficiency in Lycopersicon esculentum. Amer J Bot 46: 1-11.
Ritchie, G.A. 1997. Evidence for red:far-red signaling and photomorphogenic growth
response in Douglas-fir (Pseudotsuga menziesii) seedlings. Tree Physiol. 17:161-168.
Smith, H., J.J. Casal and G.M. Jackson. 1990. Reflection signals and the perception by
phytochrome of the proximity of neighboring vegetation. Plant Cell Environ. 13:73-
78.
Smith, H. and G.C. Whitelam. 1997. The shade avoidance syndrome: Multiple responses
mediated by multiple phytochromes. Plant Cell Environ. 20: 840-844.
Wu, D., D.A. Wright, C. Wetzel, D.F. Voytas and S. Rodermel. 1999. The IMMUTANS
variegation locus of Arabidopsis defines a mitochondrial alternative oxidase homolog
that functions during early chloroplast biogenesis. Plant Cell 11: 43-55.
132
ACKNOWLEDGEMENTS
Many people have contributed to me during my graduate studies at Iowa State
University, and I owe my thanks to all of them. In particular, I would like to thank my major
professors, Drs. Richard B. Hall and Steven R. Rodermel, for their support, patience and
guidance through good times and bad.
My sincere appreciation goes to the members of my committee: Drs. James T.
Colbert, J. Michael Kelly and Loren Stephens for their guidance and critical review of my
thesis.
I also thank Dr. Hall's lab members (Bonnie Green, Assibi Mahama, Sovith Sin,
Ronald Zalesny and Thomas Easley) and Dr. Rodermel's lab members (Carolyn Wetzel,
Meng Chen, Chris Wu, Adam Miller, Dan Stessman, Andrea Mannuell, Aigen Fu, Janson
Barr, Maneesha Aluru, Cody Sandersson and Dan Haake) for their help and encouragement.
Finally, I would like to thank my parents, brothers and sisters for their love and
support during my study.