RNA localization
and translation
J. Dictenberg, Ph.DJ. Dictenberg, Ph.D
Biological Sciences, 833NBiological Sciences, 833N
I. Introduction to messenger RNA (mRNA) localization
II. Motor dependent localization of mRNA in yeast:The paradigm for molecular motor dependenttransport of mRNAs
III. Progress & parallels in other cells where molecularmotors are involved in mRNA transport and
localizationFibroblastsNeurons
Dogma of genetic flow in cells
3'
5'
5'
DNADNA
mRNAmRNA
proteinprotein
mRNAmRNA
NucleusNucleus
CytoplasmCytoplasm
mRNA is a messenger of genetic information inthat it encodes for proteins
mRNA localization: regulation of gene expression in the cytoplasmmRNA localization: regulation of gene expression in the cytoplasm
AA D
E
Drosophila Drosophila oocyteoocyte XenopusXenopus embryo embryo
FF GG H IE
Budding YeastBudding Yeast
FibroblastFibroblast
NanosNanos mRNA mRNA fatVgfatVg mRNA mRNA XpatXpat mRNA mRNA ASH1ASH1 mRNA mRNA
Panels A –D, F,G modified from Kloc M , Zearfoss, R., and Etkin, L. Cell 108:535 (2002).Panel E provided by Amber Wells. Panels H,I from Huettelmaier, et al., Nature 438:512-515 (2005).
NeuronsNeurons-actin-actin mRNA mRNA -actin-actin mRNA mRNA -actin-actin
ZBP1ZBP1
Why Localize mRNA?Why Localize mRNA?
1.1. ItIt’’s an efficient means of sortings an efficient means of sortingproteinsproteins
2.2. Spatial-temporal regulation of geneSpatial-temporal regulation of geneexpressionexpression
3.3. Determination of asymmetry inDetermination of asymmetry indevelopmentdevelopment
4.4. Promote assembly of proteinPromote assembly of proteincomplexescomplexes
5.5. Prevent inappropriate interactionsPrevent inappropriate interactions
AAAAAA5’- -3’
ProteinProteinCoding sequenceCoding sequence
33’’ untranslated region (UTR) untranslated region (UTR)
ZipcodeZipcode Cis Cis acting factors are found inacting factors are found inthe mRNA sequencethe mRNA sequence
TransTrans acting factors interact with acting factors interact withthe mRNA sequence (e.g. proteins)the mRNA sequence (e.g. proteins)
How do mRNAs localize in cells?
AAAAAA AAAAAA
AAAAAA
AAAAAA
AA
AA
AA
mRNAmRNAlocalizationlocalization
PerinuclearPerinuclear
DistancesDistancestraveled:traveled:4 to >2004 to >200μμmm
nucleusnucleus cytoplasmcytoplasm
In a cell, mRNAs are localizedIn a cell, mRNAs are localizedseveral microns from the nucleusseveral microns from the nucleus
Trans acting factors bind to Trans acting factors bind to ciscis acting elements found in the mRNA acting elements found in the mRNAsequence to facilitate transport, localization and protein expressionsequence to facilitate transport, localization and protein expression
Untranslated regions are important!
Red - +3’UTRGreen - -3’UTRBlue - Nucleii
Ash1Ash1mRNA inmRNA inyeastyeast
Hunchback &Hunchback &caudalcaudal mRNA in mRNA inDrosophilaDrosophilaembryosembryos
nanosnanos mRNA inmRNA inDrosophilaDrosophilaoocytesoocytes
examplesexamples
MyosinMyosin
Type VType V
nonenonenonenoneMotorMotorproteinprotein
ActinActinActinActinCytoskeletalCytoskeletalsystemsystem
yesyesNoNoYes Yes –– anchoring anchoringCytoskeletonCytoskeletondependent ?dependent ?
Models of how mRNA localize
Biology of the Cell (2002) Alberts et al. 4th edition
DiffusionDiffusion& Trapping& Trapping
LocalizedLocalizedDegradation/Degradation/ProtectionProtection
ActiveActiveTransportTransport
Requirements for the Active Transport of mRNA
1. Molecular Motor Proteins2. Polarized Cytoskeleton3. A way in which to bind to
mRNA molecules (directlyor indirectly)
++
++
++++
++
++
--
--
Shav-Tal Shav-Tal & Singer (2005) J. Cell Science 118:4077-81& Singer (2005) J. Cell Science 118:4077-81
HirokawaHirokawa & &TakemuraTakemura (2005) (2005)Nature Rev. NeuroscienceNature Rev. Neuroscience 6:201 6:201
The cytoskeleton is highly dynamic
Thermodynamics governs cytoskeletal activities
Tubulin and actin structures
Subunit concentration is a critical determinant of activity
Dynamic instability due to structural differences at ends
Part II
Motor Protein Dependent Localization of mRNA in Yeast:
The only model system in which a molecular motor protein is known todirectly move mRNAs
++++
++
--
--
--Shav-Tal Shav-Tal & Singer (2005) J. Cell Science 118:4077-81& Singer (2005) J. Cell Science 118:4077-81
Life Cycle of Budding Yeast
MotherMothercellcell
BudBud
DaughterDaughtercellcell
ActinActincablescables
ActinActinpatchespatches
Saccharomyces cerevisiae Saccharomyces cerevisiae (Brewer(Brewer’’s yeast)s yeast)
++
++++
++++
++++
ASH1ASH1 mRNA localizes Ash1 protein mRNA localizes Ash1 protein
2 m
mother celldiploid
cell
daughter cell
mother cell
Ash1p
Ash1 Protein Represses Mating-Type Switching in the Daughter CellAsh1 Protein Represses Mating-Type Switching in the Daughter Cell
Amon A. Cell 84:651 (1996)
Haploid cells
aa
/a/amating
ASH1 mRNA Ash1p-myc DAPI Nomarski
Long RM, et al. Science 277:383 (1997)
Daughter cellDaughter cell
Mother cellMother cell
budding
Ash1p : Asymmetric Synthesis of HO endonucleasetranscriptional repressor protein
The ASH1The ASH1 mRNA Zipcodes mRNA Zipcodes
ASH1ASH155’’UTRUTR 33’’UTRUTR
E1E1 E2AE2A E2BE2B E3E3
Chartrand Chartrand P, et al. P, et al. Curr BiolCurr Biol 9:285 (1999)9:285 (1999)
ASH1ASH1 mRNA Zipcodes are essential for its localization mRNA Zipcodes are essential for its localization
Pascal Pascal ChartrandChartrand: in : in KlocKloc M, et al. M, et al. CellCell 108:535 (2002) 108:535 (2002)
Stem-loop structure is essential
SHESHE mutants delocalize mutants delocalize ASH1ASH1 mRNA mRNAShe : Swi5p-dependent HO expression
She 1p is a type V myosin (Myo4p)She 1p is a type V myosin (Myo4p)
Long RM, et al. Long RM, et al. ScienceScience 277:383 (1997) 277:383 (1997)
18 myosin18 myosinfamilyfamily
membersmembers
NOWNOW……....
There are There are 2424 ! !Foth Foth et al. (2006)et al. (2006) PNAS PNAS 103:3681-6103:3681-6
Myosin Family Tree
Tyska & Mooseker (2003) TICB 13:447
Class V myosins
Biology of the Cell (2002) Alberts et al. 4th ed
HEADHEADNECKNECK
TAILTAIL
• convert energy from ATP hydrolysis into mechanical energy• bind to and move along actin filaments
Myosin Motors
• Processive• Moves toward the barbed end of actin
Real Time Visualization of RNA MovementReal Time Visualization of RNA Movement
Needed to order the temporal and spatial events inNeeded to order the temporal and spatial events inRNA localizationRNA localization
Requirements:Requirements:in vivo fluorescent labeling of RNAsin vivo fluorescent labeling of RNAs
High numerical aperture, wide-field opticsHigh numerical aperture, wide-field optics
Rapid image acquisition to satisfy Nyquist sampling rateRapid image acquisition to satisfy Nyquist sampling rate
Highly sensitive image sensorHighly sensitive image sensor
Biology of the Cell (2002) Alberts et al. 4th edition
Does the myosin motor activelytransport ASH1 mRNA along actin
filaments ?OR
Could the motor protein capture andanchor ASH1 mRNA in the bud tip?
A Dual-Reporter System for Labeling RNA inA Dual-Reporter System for Labeling RNA inLiving CellsLiving Cells
Bertrand E, et al. Mol Cell 2:437 (1998)
MS2
ASH13’UTR
6 MS2 Binding site repeatsmRNA
MS2-GFPCoat proteindimerizes
Real-Time Localization of Real-Time Localization of ASH1ASH1 mRNA mRNA
Bertrand E, et al. Mol Cell 2:437 (1998)
Net Distance: 4.4 umTotal Distance: 23 umAvg. Velocity: 200 – 400 nm/secMax. Velocity: ~600nm/sec
Movie available at http://www.singerlab.org/supplements/
2 mmin
wild type She1 (deleted)
Total time: 4 min
Locasome Tracking
Wild typeWild type Myo4p deletedMyo4p deleted
ASH1ASH1 mRNA Particle Assembly mRNA Particle Assembly
Long RM, et al. Long RM, et al. ScienceScience 277:383 (1997) 277:383 (1997)
Trans acting factors that bind toTrans acting factors that bind tothe the ASH1ASH1 mRNA particle mRNA particle
Model of Model of ASH1ASH1Particle AssemblyParticle Assembly
Modified from Long et al., 2000, EMBO J.19:6592-601
RNA movement is stochasticRNA movement is stochastic
The movement of RNAs is a probabilisticThe movement of RNAs is a probabilisticphenomenon and follows rules of diffusion.phenomenon and follows rules of diffusion.
Zipcodes increase the probability that the RNAs Zipcodes increase the probability that the RNAswill associate with motors.will associate with motors.
Motor-driven RNAs are more likely to localizeMotor-driven RNAs are more likely to localizeasymmetrically and do not localize by diffusion.asymmetrically and do not localize by diffusion. Localized RNAs ensure correct protein sorting by Localized RNAs ensure correct protein sorting bybeing translated at their final destination. being translated at their final destination.
Therefore, they must be translationally repressedTherefore, they must be translationally repressedduring transport.during transport. (To be discussed in part III) (To be discussed in part III)
Part III
Mechanisms for mRNA localization in fibroblastsand neurons
Shav-Tal Shav-Tal & Singer (2005) J. Cell Science 118:4077-81& Singer (2005) J. Cell Science 118:4077-81
Is motor driven mRNA transport seen in other biological systems?
cis acting-actin-actin CDSCDS
33’’UTRUTR““ZipcodeZipcode””
TAA TAA ACCACCGGACTGGACTGTTACCAGTTACCAACACCCACACCCACACCCCTGTGATGAAACAAAACCCATAAATGCACACCCCTGTGATGAAACAAAACCCATAAATGC(stop) 1222(stop) 1222 1278 1278
The 3The 3’’UTR ofUTR of -actin -actin mRNAmRNA contains a contains a ““zipcodezipcode”” that is required for that is required forits localizationits localization
-actin mRNA localizes to the leading edge of-actin mRNA localizes to the leading edge ofmigrating fibroblastsmigrating fibroblasts
-actin mRNA localization requires:-actin mRNA localization requires:
an intact actin cytoskeleton an intact actin cytoskeleton (Sundell(Sundell
and Singer, 1990; Hill and Gunning, 1993)and Singer, 1990; Hill and Gunning, 1993)
the 3the 3’’UTR of UTR of -actin = -actin = ““zipcodezipcode””
-actin mRNA-actin protein
DAPI
Detection of Single RNA Molecules in Living CellsDetection of Single RNA Molecules in Living Cells
Data from Fusco D, et al. Curr Biol 13:161 (2003)
Quantification of mRNAs per ParticleQuantification of mRNAs per Particle
Fusco D, et al. Curr Biol 13:161 (2003)
Dynamics of RNA MovementDynamics of RNA Movement
Fusco D, et al. Curr Biol 13:161 (2003)
Dynamics of RNA Movement:Dynamics of RNA Movement:4 types of particle motility4 types of particle motility
Fusco D, et al. Curr Biol 13:161 (2003)
10 μm
2 μm
Directed Movement of RNADirected Movement of RNA
Fusco D, et al. Curr Biol 13:161 (2003)
Diffusive Movement of RNADiffusive Movement of RNA
Fusco D, et al. Curr Biol 13:161 (2003)
Corralled Movement of RNACorralled Movement of RNA
Fusco D, et al. Curr Biol 13:161 (2003)
mRNA particles containing the mRNA particles containing the b-actin b-actin zipcode show morezipcode show more““directeddirected”” motility events motility events
Fusco D, et al. Curr
Biol 13:161 (2003)
Mean Squared Distance (MSD) Particle Analysis of mRNAsMean Squared Distance (MSD) Particle Analysis of mRNAs
Model for ß-actin mRNA Transport andModel for ß-actin mRNA Transport and
Localization in FibroblastsLocalization in Fibroblasts
Shav-Tal & Singer (2005) J. Cell Sci. 118:4077
cis acting
trans actingtrans actingZBP1ZBP1
-actin-actin CDSCDS
33’’UTRUTR““ZipcodeZipcode””
TAA TAA ACCACCGGACTGGACTGTTACCAGTTACCAACACCCACACCCACACCCCTGTGATGAAACAAAACCCATAAATGCACACCCCTGTGATGAAACAAAACCCATAAATGC(stop) 1222(stop) 1222 1278 1278
ZBP1 binds toZBP1 binds to the 3 the 3’’UTR of UTR of -actin-actin mRNA mRNA
• Zipcode binding protein (Zipcode binding protein (ZBP1ZBP1) is an essential trans-acting) is an essential trans-actinglocalization factor that binds to the localization factor that binds to the ““zipcodezipcode””
•• inhibiting the interaction of ZBP1 with the zipcode using anti- inhibiting the interaction of ZBP1 with the zipcode using anti-sense sense oligosoligos results in: results in:1.1. delocalization of delocalization of -actin mRNA (diffuse cytoplasmic-actin mRNA (diffuse cytoplasmic
and and perinuclearperinuclear pools remain) pools remain)2.2. loss of cell polarity loss of cell polarity3.3. loss of directed cell motility loss of directed cell motility
Homology Domains Predicted by Sequence Analysis ofHomology Domains Predicted by Sequence Analysis ofZIPCODE BINDING PROTEIN-1 (ZBP1)ZIPCODE BINDING PROTEIN-1 (ZBP1)
RRM 1 RRM2 KH1 KH3 KH4KH2
Flexible Region(loop)
Flexible Region(loop)
NES NLS
• 3 nM affinity• KH3&KH4 responsible for RNA binding• SELEX regenerates the zipcode• Protein footprints on the zipcode• co-localizes with b-actin mRNA in nucleus and cytoplasm• requires RNA binding for localization and granule formation• will redirect b-actin mRNA when fused to membrane targeting sequence
Ross AF, et al. Mol. Cell. Biol. 17:2158 (1997) & Farina KL, et al. J. Cell Biol. 160:77 (2003), Oleynikov&Singer, Curr. Biol.13: 199 (2003)
A founding member of a large family of developmentally expressed proteinsA founding member of a large family of developmentally expressed proteinsimportant in RNA localization and regulation.important in RNA localization and regulation.
Delocalizing Delocalizing -actin -actin mRNA using anti-sense mRNA using anti-sense oligosoligosdestroys cell polarity and directed cell movementdestroys cell polarity and directed cell movement
Shestakova E, et al. PNAS 98:7045 (2001)
10 m
sense anti-sense
RhodamineactinFITC
phalloidin
centroidperimeterperimeter
Yeast and mammalian fibroblasts share an Yeast and mammalian fibroblasts share an actoacto--myosin based localization of mRNAsmyosin based localization of mRNAs
Modified from Long et al., 2000,EMBO J. 19:6592-601
Modified from Long et al., 2000,EMBO J. 19:6592-601
ShavShav-Tal & Singer (2005) J. Cell Science 118:4077-81-Tal & Singer (2005) J. Cell Science 118:4077-81 ShavShav-Tal & Singer (2005) J. Cell Science 118:4077-81-Tal & Singer (2005) J. Cell Science 118:4077-81
Myosin IIB??
Comparison of mRNA MovementsComparison of mRNA Movements
-actin -actin mRNA localization in neurites is dependent on amRNA localization in neurites is dependent on afunctional zipcode and on growth factor stimulationfunctional zipcode and on growth factor stimulation
Starved+ AntisenseStarved+ Antisense
NT-3 + AntisenseNT-3 + Antisense
Starved+ Reverse ASStarved+ Reverse AS
NT-3 + Reverse ASNT-3 + Reverse AS
Bassell et al. (1998) J. Neurosci. 18:251-65Zhang et al. (2001) Neuron 31:261-75
Anti-sense oligonucleotides directed againstthe zipcode delocalizes b-actin mRNA andimpairs association with zipcode bindingproteins (e.g. ZBP1)
Anti-senseReverse AS
The localization of The localization of -actin mRNA in -actin mRNA in neuritesneurites is is zipcodezipcodedependentdependent
Starved+ AntisenseStarved+ Antisense
NT-3 + AntisenseNT-3 + Antisense
Starved+ Reverse ASStarved+ Reverse AS
NT-3 + Reverse ASNT-3 + Reverse AS
Bassell et al. (1998) J. Neurosci. 18:251-65Zhang et al. (2001) Neuron 31:261-75
-actin mRNA and ZBP1 co-localize in neurites as-actin mRNA and ZBP1 co-localize in neurites asparticles and appear to align along microtubulesparticles and appear to align along microtubules
Zhang et al. (2001) Neuron 31:261-75
-actin & endogenous ZBP1
-actin-actin && EGFP-ZBP1EGFP-ZBP1
Kinesin: an ATPase that is a microtubule-based motorKinesin: an ATPase that is a microtubule-based motor
kinesin: a plus-end directed motor involved in fastaxonal transport of vesicles
T. Hays et al. (2001)
Previous reports show that kinesin is required for neurite outgrowth formation
Kinesin-I binds through its light chains to theKinesin-I binds through its light chains to the
vesicular cargo receptor vesicular cargo receptor SydSyd