Role of HGF/cMet Role of HGF/cMet Signaling Pathway in Signaling Pathway in
NSCLCNSCLC
MM..GGümüştekinümüştekin11,3,4,3,4, B, B.. S Sisis22, G, G..BBulutulut11, , AA..KKargıargı22, İ, İ.. Ö Öztopztop44, N, N.. O Olgunlgun44, , NN..AAtabeytabey11
Dokuz Eylul University, School of Medicine, Dokuz Eylul University, School of Medicine, 11Departments of Medical Biology and Genetics, Departments of Medical Biology and Genetics,
22Pathology, Pathology, 3 3 Pharmacology, Pharmacology, 44 Institute of Oncology, Institute of Oncology, IzmirIzmir
Receptor Tyrosine KinasesReceptor Tyrosine Kinases HGF-c-Met signaling pathwayHGF-c-Met signaling pathway Importance and role in Importance and role in
carcinogenesiscarcinogenesis Role in development of lung cancerRole in development of lung cancer Probable role in NSCLC ?Probable role in NSCLC ? IHC data of of c-Met, HGF ve some IHC data of of c-Met, HGF ve some
of target genesof target genes Mutation analysis of Exon 14Mutation analysis of Exon 14
Protein Tyrosine KinasesProtein Tyrosine Kinases Enzymes that catalyse transfer of a Enzymes that catalyse transfer of a --
phosphoryl group from ATP to serine, phosphoryl group from ATP to serine, treonine or tyrosine residues of other treonine or tyrosine residues of other proteins proteins
Normal cell and tissue developmentNormal cell and tissue development
Increased RTK activityIncreased RTK activity Proliferative diseasesProliferative diseases *Solid Tumors*Solid Tumors *Leukemia and Lymphomas*Leukemia and Lymphomas **PseurosiasisPseurosiasis, etc, etc
Protein Tyrosine KinasesProtein Tyrosine Kinases
20 subfamilies according to catalytic 20 subfamilies according to catalytic tyrosine kinase domain homology tyrosine kinase domain homology
Extracellular ligand binding regionExtracellular ligand binding region Single transmembranal regionSingle transmembranal region Intracellular tyrosine kinase regionIntracellular tyrosine kinase region Conserved Ig-like and EGF-like Conserved Ig-like and EGF-like
regions rich in sisteinregions rich in sistein
Intracellular RegionIntracellular Region
Extracellular DomainExtracellular Domain Upon ligand binding, receptor Upon ligand binding, receptor
dimerisation and changes in confirmation, dimerisation and changes in confirmation, leading to increase in kinase activity and leading to increase in kinase activity and autophosphorylationautophosphorylation
Catalytic Domain: Catalytic Domain: HighlyHighly conserved conserved ATP binding region that catalyses ATP binding region that catalyses
receptor autophosphorylation and receptor autophosphorylation and tyrosine phosphorylation of RTK tyrosine phosphorylation of RTK substratessubstrates
Activation of Receptor Activation of Receptor Tyrosine KinasesTyrosine Kinases
Autophosphorylation has dual effect:Autophosphorylation has dual effect:
1- Activation following Tyr 1- Activation following Tyr phosphorylation leads to phosphorylation leads to phosphorylation of Tyr away from phosphorylation of Tyr away from the active sitethe active site
2- These phosphorylated residues 2- These phosphorylated residues creates binding regions for the creates binding regions for the effector molecules (effector molecules (those those containing SH2 ve PTB domainscontaining SH2 ve PTB domains))
Effectors of Receptor Effectors of Receptor Tyrosine KinasesTyrosine Kinases
PI3K p85 subunitPI3K p85 subunit Non-receptor PLCgamaNon-receptor PLCgama Src family tyrosine kinasesSrc family tyrosine kinases p120GAP p120GAP (a GTPase activating enzyme in Ras (a GTPase activating enzyme in Ras
signalingsignaling Grb2 Adaptor proteinGrb2 Adaptor protein SH-PTP2 (Shp2) Tyr specific protein SH-PTP2 (Shp2) Tyr specific protein
phosphotasephosphotase
Plazma Zarı
c-Met c-Met Reseptor Reseptor Tyrosine Tyrosine KinaseKinase
S: “Sema” domain C: sistein-rich domainIg: immunoglobulin domains K: kinase domain
HOS, 7q21-q31, 12 kb, 150 kDa
Substrate binding regions of c-Met and Substrate binding regions of c-Met and Tpr-MetTpr-Met
Ekstraselüler Domain
Transmembran DomainJuxtamembran Domain
KinazDomaini
Karboksi terminal “docking” bölgesi
c-Met
Tpr-Met
Hepatocyte Growth Factor / Hepatocyte Growth Factor / Scatter Factor (HGF/SF)Scatter Factor (HGF/SF)
MitogenMitogen MMororphogenphogen MMotootoggenen
HepatoHepatocytescytes EEpithelialpithelial cells cells EEndotndothhelial elial cellscells NeuronsNeurons MelanoMelanocytescytes LLymphocytesymphocytes Bone marrow derived Bone marrow derived
cellscells
HGF/SFHGF/SF
NoNormal developmentrmal development
and adult homeostasisand adult homeostasis Development og kidney, Development og kidney,
liver, spleen and placentaliver, spleen and placenta NeuronalNeuronal developmen developmentt BBranching morphogenesis ranching morphogenesis Kidney and lung Kidney and lung
regenerationregeneration Normal functions of liverNormal functions of liver Wound healingWound healing
CarsinogenesisCarsinogenesis Carcinomas (kCarcinomas (kolon, olon,
mammary, head-neck, mammary, head-neck, gastric, lunggastric, lung, thyroid and , thyroid and renal carcinomas)renal carcinomas)
MMelanomelanomasas SSararcomascomas
Lung??Lung??
N: N terminal Domain, K1-K4 Kringle Domains, SPH:Serin Proteinase Homology Domain
Hepatocyte Growth Hepatocyte Growth Factor / Scatter Factor Factor / Scatter Factor
(HGF/SF)(HGF/SF)
HGF (Aktive) 69kDa+32 kDA
Target Cells
c-Met (HGF receptor)HGFA (latent)
Nonparanchimal cells
Pro-HGF (latent) 92 kDa
HGFA (active)Trombin
HAI
Hepatocyte Growth Hepatocyte Growth Factor / Scatter Factor Factor / Scatter Factor
(HGF/SF)(HGF/SF)
Effect of HGF Effect of HGF stimulationstimulation
Plasma Membrane
Unstimulated
Substrates
Stimulated
HGF-HGF-c-Met c-Met
SignaliSignaling ng
PathwPathwayay
*Cell polarity*Actin cytoskeleton*Motility
*Proliferation*Cell Cycle regulation
*C/C contacts
*Migration*Invasion
*Survival
Branching morphogenesis
Plasma Membrane
HGF/c-MetHGF/c-MetInvasion MetastsisInvasion Metastsis
*HGF is the unique extracellular signaling molecule that can trigger increase in extracellular matrix proteolysis, cell dissociation, cellular motility
*Inhibitors that block this pathway blocks cell motility, invasion and angiogenesis as well.•Atabey N, et al. J of Biol Chem 276 (17) : 14308-14, 2001,
•Maulik G et al, Cytokine Growth Factor Rev 13(1): 41-59, 2002,
•Soriano JS, et al Mol Cancer Ther, 2004
Relationship between c-Met-HGF Relationship between c-Met-HGF Signaling and Solid Tumor Signaling and Solid Tumor
MetastasisMetastasis
Normal Epithelial Cells
VEGF, bFGF HGF, uPA,MMPs
ECMOrgan spesific
Metastasis
BrainLiverBoneBone Marrow
Transformed cellsMotility
ScatteringMigrationInvasion
Metastasis
C-Met in NSCLCC-Met in NSCLC Increase in c-Met expression and autonomous Met Increase in c-Met expression and autonomous Met
kinase activitykinase activity In patients exhibiting recurrence, HGF level is high, In patients exhibiting recurrence, HGF level is high,
related with poor prognosis related with poor prognosis Siegfried JM et al, Cancer Res 57(3):433-9, 1997. Siegfried JM et al, Cancer Res 57(3):433-9, 1997.
Constitutive and paracrine activation of c-Met Constitutive and paracrine activation of c-Met activates signaling pathways that regulates cell activates signaling pathways that regulates cell survival and proliferation. This leads to tumor survival and proliferation. This leads to tumor progression. progression. Qiao H et al, J Cell Biochem 86(4): 665-77, 2002.Qiao H et al, J Cell Biochem 86(4): 665-77, 2002.
Adenokarsinomda %35, Büyük hücreli andiferansiye Adenokarsinomda %35, Büyük hücreli andiferansiye kanserinde %20, Skuamöz hücreli kanserde ise kanserinde %20, Skuamöz hücreli kanserde ise normal akciğer dokusundan normal akciğer dokusundan daha az veya yakındaha az veya yakın oranda, Adenokarsinomda c-met’in ekspresyon düzeyi oranda, Adenokarsinomda c-met’in ekspresyon düzeyi ile tümör diferansiasyonu arasında ile tümör diferansiasyonu arasında korelasyonkorelasyon var varTsao MS et al, Lung Cancer 20(1): 1-16,1998.Tsao MS et al, Lung Cancer 20(1): 1-16,1998.
HGF and c-met expression analysis HGF and c-met expression analysis in 63 NSCLC tissue samples in 63 NSCLC tissue samples obtained from Dokuz Eylul obtained from Dokuz Eylul University, School of Medicine, University, School of Medicine, Department of Pathology was Department of Pathology was established immunohistochemically. established immunohistochemically.
Due to IHC analysis, Due to IHC analysis, of these NSCLC of these NSCLC tissue samplestissue samples
c-Met expression c-Met expression was increased in was increased in 81%,81%,
HGF expression was HGF expression was increased in 48%. increased in 48%.
c-Met
HGF
In late stage cases, c-Met expression In late stage cases, c-Met expression was high in 72 %, HGF expression was high in 72 %, HGF expression was high in 58 % of the cases.was high in 58 % of the cases.
There was no corelation between There was no corelation between tumor size, lymphatic metastasis, tumor size, lymphatic metastasis, tumor stage and recurrency.tumor stage and recurrency.
In 3 cases with metastasis, c-met In 3 cases with metastasis, c-met expression was found to be high.expression was found to be high.
MethodMethodParaffin blocked tissue samples
DNA Isolation (Nucleospin)
Polymerase Chain Reaction (PCR)
Agarose Gel Electrophoresis
DNA sequence analysis (ABI Prism)
Blast analysis (Multalin)
with primers flanking exon 14 c-Met reseptörünün tirozin kinaz
bölgesini kodlayan 14.eksona özgü primerler
Forward primer: GCCCATGATAGCCGTCTTTA
Revers primer: CAACAATGTCACAACCCACTG
ResultsResults
256 bp
Exon 14 PCR AmplificationExon 14 PCR Amplification DNA Sequence AnalysisDNA Sequence Analysis
A deletion
Frameshift
Squamous cell Ca Ca T3N0M0
c-met overexpression
HGF/c-Met pathway may be HGF/c-Met pathway may be important in NSCLC development.important in NSCLC development.
1- Mutation analysis of exon 13 and 1- Mutation analysis of exon 13 and exons 15-20 exons 15-20 2- Increase sample group size2- Increase sample group size3- Identification of molecules in HGF/c-3- Identification of molecules in HGF/c-Met signaling that may participate in Met signaling that may participate in NSCLC developmentNSCLC development
Studies under progress