Human feacal isolates were ascertain as genus Lactobacillus using specific primer LbLMA1/R16-1 and fur-ther identified as Lactobacillus plantarum with species specific primers Lpl-3/Lpl-2. 25 L. plantarum strainswere further assessed for hydrophobicity following the microbial adhesion to hydrocarbons (MATH)method and colonization potentials based on their adherence to immobilized human collagen type-1.Surface proteins were isolated from selected L. plantarum 91(Lp91) strain. The purified collagen bindingprotein (Cbp) protein was assessed for its anti-adhesion activity against enteric Escherichia coli 0157:H7pathogen on immobilized collagen. Four L. plantarum strains displayed high degree of hydrophobicityand significant adhesion to collagen. A 72 kDa protein was purified which reduced 59.71% adhesion of
ndigenousollagen binding protein
E. coli 0157:H7 on immobilized collagen as compared to control well during adhesion assay. Cbp proteinis the major influencing factor in inhibition of E. coli 0157:H7 adhesion with extracellular matrix (ECM)components. Hydrophobicity and adhesion potential are closely linked attributes precipitating in bettercolonization potential of the lactobacillus strains. Cbp is substantiated as a crucial surface protein con-tributing in adhesion of lactobacillus strains. The study can very well be the platform for commercializationof indigenous probiotic strain once their functional attributes are clinically explored.
. Introduction
Probiotic lactic acid bacteria (LAB) particularly genera lacto-acilli and bifidobacteria confer several beneficial effect to humanost. The mechanisms include maintaining the balance of the
ntestinal microflora, modulating the intestinal immune systemIvory et al. 2009; Duary et al. 2012a), detoxifying colonic toxins,owering serum cholesterol levels (Kumar et al. 2011), promot-ng lactose tolerance, and producing metabolites essential to theunction of intestinal epithelial cells (Szilagyi et al. 2010).
Bacterial colonization on the mucosal surface is a prerequi-ite for stable and successive exertion of these beneficial effects.dhesion has been a classical criterion and is considered as an
deal parameter to adjudge colonization capability of a poten-ial probiotic strain. Adhesion capability of a lactobacillus strain
Please cite this article in press as: Yadav AK, et al. Role of surface layer coladhesion and its anti-adhesion potential against gut pathogen. Microbiol R
as been found to be the determining probiotic attribute in sev-ral studies (Sillanpaa et al. 2000; Vesterlund et al. 2005; Munoznd Monedero 2011; Duary et al. 2011). Probiotic lactobacillus
strains adhere to ECM components viz. mucin, fibronectin, colla-gen, laminin, or fibrinogen protein. Surface proteins with a rangeof molecular masses have been identified with strong binding abil-ity to type-V collagen, the most abundant protein in gut mucosa(Harty et al. 1993; McGrady et al. 1995; Mukai et al. 1996,). Lac-tobacillus strains express surface layer proteins during cultivation(Duary et al. 2012b). The ability to bind to collagens is expressed by70% of Lactobacillus isolates, and it appears that Lactobacilli expressmultiple adhesin types interacting with these abundant tissue pro-teins. A collagen binding protein (Cbp) from different Lactobacillispecies binds to human collagen proteins. The specific binding abil-ity of these surface layer proteins, specifically Cbp, is suggested toplay a vital role in effective colonization and also competitive dis-placement of gut pathogens (Sillanpaa et al. 2000; Styriak et al.2003; Munoz and Monedero 2011). This can be achieved throughdirect competition for attachment sites on human intestinal cells,ECM and mucus proteins, or by the blockage of pathogen surfaceadhesins. Surface layer proteins from Lactobacillus crispatus JCM
lagen binding protein from indigenous Lactobacillus plantarum 91 ines (2013), http://dx.doi.org/10.1016/j.micres.2013.05.003
5810 have been reported to inhibit the adhesion of Escherichia colito laminin and to the basement membrane preparation, matrigel,probably due to the competition for the binding sites (Horie et al.2002). Surface layer protein from Lactobacillus helveticus R0052
nhibit the adhesion of E. coli 0157:H7 on pretreated Humanntestinal epitelium cells (HEp-2) lines (Johnson-Henry et al. 2007),oincubation of Salmonella typhimurium with S-layer proteins from. crispatus ZJ001 also prevented adhesion of the pathogens toeLa cells through a competitive exclusion mechanism (Chen et al.007). These studies suggest that the binding of lactobacilli toxtracellular matrix proteins of gut mucosa are crucial not only indhesion but also to protect the host against invading pathogens.
Experimental models such as bacterial binding to intestinalucus, extracellular matrix (ECM) proteins (Styriak et al. 2003;e Leeuw et al. 2006), resected colonic tissue (Vesterlund et al.005) have been used to assess the adhesive capacity of lactobacilli.hese approaches endorse the view that complex interactions areccurring in the mucosal layer of the digestive tract, which repre-ent a fast method for the screening of strains and in most cases aood correlation has been found between them. Although the pur-orted role of Cbp protein in the adherence of probiotic cultures
s well recognized, a focused study on ability of purified collageninding protein from indigenous probiotic Lactobacillus to act asnti-adhesin for pathogen binding to ECM is lacking. Our previoustudies have confirmed that L. plantarum 91 (Lp 91) is a probiotictrain and has demonstrated excellent tolerance to low pH and highile salt concentrations (Kumar et al. 2011; Kumar et al. 2012), highell surface hydrophobicity (Duary et al. 2010), adhesion ability toaco-2 cell line and immunomodulatory effects in gut (Duary et al.011, 2012a).
In the present study, we further screened 25 indigenous L. plan-arum strains and characterized them on the basis of their adhesionotential. The Lp91 emerged as the strain with better adhesion abil-
ty to human collagen among these strain also and was chosen forxtraction of Cbp protein. The purified surface layer Cbp protein wasssessed for anti-adhesion property against E. coli 0157:H7.
. Materials and methods
.1. Bacterial strains, media and growth conditions
The L. plantarum strains examined in this study are listed inable 1. Strains were isolated from healthy human faecal samples. L.lantarum CSCC5276 (NCDO5276, also designated as NCDO5276 orTTE-71034) (Crittenden et al. 2002) (received from Dr N.P. Shah
rom Victoria University, Australia) was used as a reference cul-ure. Isolates were cultured in MRS broth (deMan, Rogosa and Sharproth; HiMedia, Mumbai, India) at 37 ◦C. Frozen stock cultures weretored in 20% glycerol at −80 ◦C. E. coli 0157:H7 strain was collectedrom molecular Biology Lab (MBU), NDRI, Karnal, India, propagatedn brain heart infusion (BHI) media and incubated at 37 ◦C in aerobicondition.
.2. Culture purity
The purity of all bacterial cultures was always ascertained prioro use by Gram staining followed with microscopic examination.
.3. Genomic DNA extraction
The lactobacillus genomic DNA was extracted as per Pospiech Neikmann (1995) with some modification. 1.5 ml of overnightrown culture in MRS medium was centrifuged at 12,000 rpm for0 min The cell pellet was washed with sterile distilled water andesuspended in 0.5 ml of SET buffer (75 mM NaCl, 20 Mm Tris–HClnd 25 mM EDTA, pH 7.5), containing lysozyme (2 mg ml−1) and
Please cite this article in press as: Yadav AK, et al. Role of surface layer coladhesion and its anti-adhesion potential against gut pathogen. Microbiol R
ncubated at 37 ◦C for 1 h. The cells were additionally lysed bydding 1/10 volume (50 �l) of 10% SDS and further incubated at7 ◦C with an inversion for 30 min. One-third volume (150 �l) of 5 MaCl and 0.8 ml of phenol/chloroform/isoamyl alcohol (25:24:1 by
PRESSesearch xxx (2013) xxx– xxx
volume) was added and kept at room temperature for 30 min. Mix-ture was centrifuged at 4500 rpm for 15 min to extract cell lysate.Upper aqueous layer was then transferred into a new microcen-trifuge tube. Add equal volume of Isopropanol and kept at −20 ◦Cfor 30 min centrifuge the tube and pallet was washed with 70%ethanol. The pellet was dried in vacuum and finally dissolved in50 �l of TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) and stored at−20 ◦C for further use.
2.4. PCR-based identification of Lactobacillus isolates at genusand species level
Lactobacilli isolates were identified by PCR using genus andspecies specific primers (Table 2). Oligonucleotide primers target-ing 16S-rRNA, 23S-rRNA, their inter spacer and flanking regionswere used for the identification of Lactobacilli at genus and specieslevel.
2.5. Microbial adhesion to hydrocarbons (MATH)
The bacterial adhesion to hydrocarbons was examined byfollowing the method of Rosenberg et al. (1983) with few modifica-tions to measure the cell surface hydrophobicity. Briefly, Cells wereharvested after growth by centrifugation at 8000 × g for 15 minin refrigerated centrifuge. Washed twice in Phosphate urea mag-nesium sulfate (PUM) buffer (K2HPO4 3H2O 22.2 g L−1, K2HPO47.26 g L−1, Urea 1.8 g L−1, MgSO4 7H2O 0.2 g L−1, pH 7.1) and resus-pended in the same buffer and the absorbance (Ainitial) was adjustedto 0.7 OD at 600 nm. Lactobacillus cell suspension (3.0 ml) andn-hexadecane or toluene (1.0 ml) were mixed by vortexing andincubated at 37 ◦C for 20 min for temperature equilibration. Themixture was again vertex and incubated at 37 ◦C for 1 h for phaseseparations. The lower aqueous phase was carefully taken out witha sterile pasteur pipette to measure its absorbance (Afinal) at 600 nm.The surface hydrophobicity (%) was calculated as percent decreasein the absorbance of the aqueous phase after mixing and phaseseparations relative to that of original suspension (AInitial) as
Screening of collagen binding of lactobacillus strains was per-formed using In vitro adhesion assay (Tallon et al. 2006) with minormodifications. Briefly, microtitter 96-well plate was coated withsolution of type-I human collagen (50 mM phosphate buffer, pH5.5) at a concentration of 100 �g ml−1 and subsequently incubatedovernight at 4 ◦C. After washing, wells were saturated with a 2%(w/v) bovine serum albumin (BSA) (Sigma) solution for 4 h at 4 ◦C. Aminimum of three replicates were used twice to estimate the adhe-sion of the strains. Fresh bacterial culture (100 �l of 108 CFU ml−1)of individual strain was added and plates were incubated for 2 hat 37 ◦C. Repeated washing was followed with treatment of wellswith 200 �l of a 0.05% (v/v) triton X-100 solution to desorb thebound bacteria and 100 �l was aspirated from each well. This wasdiluted in sterile PBS and plated on MRS agar plates. After 18–24 hof incubation at 37 ◦C, bacterial colonies were counted from eachplate.
2.7. Real time quantitative PCR analysis of the Cbp protein
lagen binding protein from indigenous Lactobacillus plantarum 91 ines (2013), http://dx.doi.org/10.1016/j.micres.2013.05.003
Total RNA was isolated from early- to mid-exponential phasebacterial cultures, three each from Low, moderate, high collagenbinding ability (NCDO5276, Lp 8, Lp82, Lp 98; Lp 40, Lp 80, Lp 122;Lp 9, Lp 72 and Lp 91; OD600 ∼0.5–1.0 in MRS) using the standard
A.K. Yadav et al. / Microbiological Research xxx (2013) xxx– xxx 3
Table 1Origin of L. plantarum strains, cell surface hydrophobicity (%) of L. plantarum strains by MATH, adhesion properties immobilized human type-1 collagen.
L. plantarum strain Sources of isolation % Hydrophobicity to hexadecane % Hydrophobicity to Toluene Adhesion to collagen (CFU well−1)
ote: The data represent the mean values of % hydrophobicity and CFU, ±standard
rizol method to examine relationship between level of Cbp genexpression and adhesion capacity. The integrity and purity of theNA preparation was determined by agarose gel electrophoresisnd by spectrophotometry in a NanoQuant (TECAN). First-strandDNA was synthesized from 1 �g of RNA as per manufacturer pro-ocol (Fermentas, USA) with random hexamer and oligo dT primersnd it was diluted to 5 times before performing the quantitationssay. qRT-PCR was carried out using LightCycler 480 SYBR Green Iaster technology (Roche Diagnostics, Mannheim, Germany) with
bp gene-specific primer pairs CbpRT F/CbpRT R (Table 2). 16SDNA was used as internal control gene (Table 2).
.8. Extraction of surface layer
The surface layer protein was isolated from L. plantarum strainsing Guanadine-HCl (Jaaskelainen et al. 2008) and LiCl (Turnert al. 1997). Cells were harvested from 200 ml MRS cultures byentrifugation at 10,000 × g for 5 min and washed three timesith 0.85 M saline water and then pellet was resuspended in
0 ml of 2 M Guanidine–HCl (Gu–HCL) and incubated for 2 h at7 ◦C. The cells were pelleted by centrifugation and supernatantas dialyzed against water at 4 ◦C for overnight to remove the
alts. The precipitated proteins were collected by centrifugation for◦
Please cite this article in press as: Yadav AK, et al. Role of surface layer coladhesion and its anti-adhesion potential against gut pathogen. Microbiol R
0 min at 10,000 × g at 4 C and lyophilized. The lyophilized pro-eins dissolved in PBS buffer and electrophoresis was done on 10%DS-PAGE.
able 2rimers used for genus and species identification of Lactobacilli isolates.
Primer Primers sequence (5′—3′) Product size References
LbLMA1 CTCAAAACTAAACAAAGT 250 bp Dubernet et al. (2002)R16-1 CTTGTACACACCGCCCGTCALpla-3 ATTCATAGTCTAGTTGGAGGT 248 bp Song et al. (2000)Lpla-2 CCTGAACTGAGAGAATTTGACbpRT F ACAACTGAACCAAGCCAACC 269 bp This studyCbpRT R CCAAAGCCGTTCATACCAGT
29.83 ± 2.53 41.66 ± 4.50
ion from three independent experiments on different days.
2.9. Purification of collagen binding protein
Crude extracted protein was resuspended in Tris–HCl (pH 7.5)buffer and load on a strong cation exchanger “Resource S” col-umn (GE Health Care). Elution was carried out with Tris buffer(0.05 M) with 1 M NaCl with flow rate 0.5 ml min−1 and size frac-tions 5 ml. The purified fractions containing surface proteins werepooled separately concentrated and desalted using centricon cen-trifugal filter units (Millipore, USA) and subjected to SDS-PAGEusing commassie brilliant blue staining or transferred to nitrocel-lulose membrane for western blot analysis. For western blot, themembrane was incubated with HRP conjugated collagen at 1:1000dilutions. Immunosignal was detected by using DAB as a substrate.
2.10. Conjugation of collagen with horseradish peroxidase
Human type-1 collagen was conjugated with HRP using mod-ified method of Rojas et al. (2002). Briefly, 1.5 ml of HRP(2.5 mg ml−1) and 300 �l of 0.1 M of sodium periodate (NaIO4) wasmixed, stored at 20 ◦C for 20 min and dialyzed at 4 ◦C overnightagainst 0.05 M sodium acetate buffer (pH 4.6). Collagen (1 mg) wasadded and incubated at 20 ◦C for 4 h. Equal amount of glycerol wasadded and stored at -20 ◦C in the dark.
2.11. Anti-adhesion assay
The anti-adhesive activity of purified surface protein againstpathogen (E. coli 0157:H7) was performed as reported byHeinemann et al. (2000) with minor modifications. Briefly, the wellsof microtiter plates (Nunc, Denmark) were treated with 200 �l ofthe solution of purified surface Cbp protein. The plate was incu-bated for 16–18 h at 4 ◦C and subsequently washed twice with PBS.Control wells contained buffer only. E. coli 0157:H7 was grown at37 ◦C 12–16 h under aerobic conditions. An amount of 200 �l of
lagen binding protein from indigenous Lactobacillus plantarum 91 ines (2013), http://dx.doi.org/10.1016/j.micres.2013.05.003
E. coli 0157:H7 culture suspension (1 × 108 cfu ml−1) in PBS wasadded and incubated in the wells for 4 h at 4 ◦C. Unattached bacte-ria were removed by washing the wells three times with PBS. Theadherent bacteria were plated on MRS-agar plate. After 18–24 h
4 A.K. Yadav et al. / Microbiological Research xxx (2013) xxx– xxx
Fig. 1. PCR Amplification of 16S–23S rRNA intergenic spacer and 16S rRNA sequencefrom genomic DNA of Lactobacillus isolates using genus specific primers LBLMA1/R-161. Lane: 1. L. plantarum 5276, 2. L. plantarum 9, 3. L. plantarum 72, 4. L. plantarum7l
opo
2
s(
3
stet(
Fig. 2. Amplification of 16S–23S rRNA interspacer region and its flanking fromgenomic DNA of Lactobacillus plantarum isolates using species specific primersLpla3/Lpla2, Lane: 1. L. plantarum 5276, 2. L. plantarum 9, 3. L. plantarum 40, 4. L.
All 25 L. plantarum strains were isolated from human fae-
Fi
7, 5. L. plantarum 99, 6. L. plantarum 91, 7. L. lactis (negative control), M. 100 bp DNAadder.
f incubation at 37 ◦C, bacterial colonies were counted from eachlate. The change in adherence was used to calculate the inhibitionf adhesion.
.12. Data analysis
Data analysis was carried out with SigmaStat software (ver-ion 3.0). All data are presented as mean value ± standard deviation±SD) of three independent experiments at different days.
. Results
All the bacterial cultures including reference strains used in thistudy were subjected to microscopic examination and were foundo be catalase negative, gram positive, rod shaped organisms. After
Please cite this article in press as: Yadav AK, et al. Role of surface layer coladhesion and its anti-adhesion potential against gut pathogen. Microbiol R
nsuring the purity of lactobacillus isolates from different sources, aotal of 26 cultures that included one reference Lactobacillus strainsNCDO5276) were used for further studies.
ig. 3. Adhesion assay of different L. plantarum strains. The percentages of adhesion to, A.
mmobilized on microtitre plates, Error bars show standard deviations.
plantarum 70, 5. L. plantarum 72, 6. L. plantarum 75, 7. L. plantarum 77, 8. L. plan-tarum 78, 9. L. plantarum 90, 10. L. plantarum 91, 11. L. acidophilus LA1, M. 100 bpDNA ladder.
3.1. Identification of isolates as Lactobacillus by genus andspecific PCR
For establishing the identity of all 25 bacterial cultures used inthis study as lactobacilli, these were subjected to PCR assay employ-ing genus specific primer LbLMA1/R161 (Table 2) targeted against16S-rRNA gene (Dubernet et al. 2002) (Annealing 52 ◦C). The DNAsamples extracted from the probiotic cultures when used as thetemplate in the PCR assay yielded the specific amplicon of 250 bp(Fig. 1) which was specific for genus Lactobacillus only. The con-firmed lactobacillus specific PCR were also subjected to PCR analysisfor further identification at species level. The formation of specific248 bp amplicon indicated L. plantarum species (Fig. 2).
3.2. Microbial adhesion to hydrocarbons
lagen binding protein from indigenous Lactobacillus plantarum 91 ines (2013), http://dx.doi.org/10.1016/j.micres.2013.05.003
cal samples along with standard strain NCDO5276. These wereinvestigated for their adhesion potential based on in vitro cell sur-face hydrophobicity and adherence on immobilized type-1 collagen
hexadecane, B. Toluene, C. Binding of L. plantarum strains to human type-1 collagen
A.K. Yadav et al. / Microbiological Research xxx (2013) xxx– xxx 5
Fi
otlhL(b
3p
wmmt4rbO(wbve1tscC
iacOgra(assNi
The purified Cbp protein was examined for its anti-adhesion activity against E. coli 0157:H7 on immobilizedcollagen. E. coli 0157:H7 strain adhered with microtitre platecontaining immobilized collagen was taken as control. The
ig. 4. Microscopic view of adhering L. plantarum strains on human type-1 collagenmmobilized on microtitter plate.
n microtitter well plate (Table 1and Fig. 3A, B and C). Analysis ofhe hydrophobicity data revealed that about 40% of the isolates hadow percentage hydrophobicity (<25%) and only 20% isolates wereaving high percentage hydrophobicity (>35%). Four L. plantarump9, Lp72, Lp91 and Lp122 strains displayed higher hydrophobicityTable 1) to n-hexadecane and toluene. Lp91 isolate demonstratedetter adhesion capability to hydrocarbons amongst all the isolates.
.3. Collagen binding property of probiotic Lactobacilluslantarum strains
The quantitative binding of the selected L. plantarum culturesas also investigated on immobilized type-1 collagen by enu-eration of CFU count after platting on MRS agar and examinedicroscopically (Fig. 3C and 4). All the test cultures adhered
o immobilized collagen although at different levels. More than0% isolates demonstrated significant binding to collagen in theange of 100–177 CFU well−1, while 60% isolates had very lowinding capacity in the range of 31–100 CFU well−1 (Table 1).n comparative evaluation, Lp9 (148 ± 6.55 CFU well−1), Lp72
164.33 ± 9.50 CFU well−1) and Lp91 (177.66 ± 11.50 CFU well−1)ere the most adhesive strains based on their respective adhered
acterial cells to collagen (Table 1 and Fig. 3C). Some isolatesiz. Lp40, Lp71, Lp80, Lp121 and Lp122 on the other handxhibited moderate binding (119.66, 131.66, 120.33, 119.33 and10.66 ± 5.13 CFU well−1 respectively). Remaining isolates werehe least adhesive strain. More or less, a similar trend in adhe-ion property of these test cultures was recorded with immobilizedollagen although relatively at a lower rate as indicated by theirFU well−1 (Table 1, Fig. 4).
To further characterize the possible link between binding abil-ty to collagen and Cbp production in selected lactobacillus strainsnd to explore correlation between adhesion capability and trans-riptional level of Cbp gene, real time PCR analysis was performed.n the basis of adhesion capability to immobilized collagen threeroups were observed (low, moderate and strong adhesive strains),andomly three strains were selected from each groups viz. lowdhesive strains (Lp8, Lp82 and Lp98), moderate adhesive strainsLp40, Lp80 and Lp122) and strong adhesive strains (Lp9, Lp72nd Lp91). Relative expression of Cbp gene in strain Lp82 was
Please cite this article in press as: Yadav AK, et al. Role of surface layer coladhesion and its anti-adhesion potential against gut pathogen. Microbiol R
ignificantly different (<0.05), while other tested strains demon-trated non-significant difference (>0.05) with reference strainsCDO5276 used as control. Expression was up-regulated approx-
mately 1.10, 1.03 and 1.2 fold in strains Lp9, Lp72 and Lp91
Fig. 5. Relative expression of cbp gene in selected L. plantarum strains as compareto NCDO5276. Error bars show standard deviations (±SD).
3.4. Purification and immunoblotting of Cbp protein
Surface layer proteins were extracted with 5 M Gu–HCl and LiClmethod (Turner et al. 1997). Better recovery was observed in caseof Gu–HCl extraction (Jaaskelainen et al. 2008). The extracted sur-face protein was analyzed on 10% SDS-PAGE electrophoresis asshown in Fig. 6 A. The 200 �l protein (32 mg of total crude pro-tein containing 3.2 mg ml−1) was applied on strong ion-exchange“Resource ‘S’-6 ml (GE Health Care) FPLC (Akta prime GE healthcare)column. Three major peaks were collected at 0.21 M, 0.31 M, 0.53 MNaCl. The fractions obtained at 0.31 M NaCl concentration whenpooled yielded 128 �g of total protein while fractions from peaksat 0.21 M and 0.53 M yielded 85 �g and 62 �g total protein respec-tively. The fraction eluted at 0.31 M NaCl revealed a protein band ofabout 72 kDa which is the expected size of Cbp protein. SDS-PAGEof other two fractions at 0.21 M NaCl and 0.53 M NaCl demonstratedproteins of 24 kDa and 35 kDa respectively (Fig. 6B). The HRP con-jugated collagen demonstrated specific interaction between theeluted protein (0.31 M NaCl elution) and the collagen, resulting insuccessful confirmation of 72 kDa Cbp protein (Fig. 6C).
3.5. Anti-adhesion assay against pathogen
lagen binding protein from indigenous Lactobacillus plantarum 91 ines (2013), http://dx.doi.org/10.1016/j.micres.2013.05.003
Fig. 6. Purification and western blot analysis of Cbp protein. A, SDS-PAGE analysisof surface layer protein extracted from L. plantarum using GuHCl, Lane 1 proteinmarker, Lane 2 Lp5276, Lane 3 Lp91, B, a purified Cbp protein, Lane 1 Protein marker,Lane 2 Protein fraction at 0.31 M NaCl, C, western blot analysis of purified Cbp protein.
ig. 7. Inhibition of E. coli 0157:H7 strain by Cbp protein with type-1 collagen immo-ilized on microtitre plates, Error bars show standard deviations (±SD).
athogenic strain showed strong binding to immobilized collagen238.33 ± 15.27 CFU well−1), as expected. The immobilized col-agen coated with purified Cbp protein was used for examiningnti-adhesion activity of the Cbp protein. The quantitative bindingf the E. coli 0157:H7 strain decreased from 238.33 ± 15.27 to6.0 ± 9.07 CFU well−1 immobilized type-1 collagen coated withbp, as observed after platting on BHI agar (Fig. 7 and Table 3). Onomparative assessment it was found that purified Cbp proteinnhibits 59.71% adhesion of E. coli 0157:H7 strain on immobilizedollagen (Fig. 7).
. Discussion
Probiotic lactobacilli possess the ability to colonize the guty adhering to the mucosal epithelial cell lining. This results inxtended transit time and elicits beneficial response over a pro-onged period. In this regard, cell surface hydrophobicity andpecific proteins expressed on the surface of bacterial strains haveeen reported as the two key elements contributing in efficientolonization in the gut (Xu et al. 2009). Our results pertaining toercentage hydrophobicity of indigenous isolates of probiotic L.lantarum strains and the reference strains are comparable withhose obtained from the study of Draksler et al. (2004). Their studyeported that L. plantarum from goat had surface hydrophobicity inhe range 47% to 69% depending upon the solvent used. Xu et al.2009) also reported that Bifidobacterium longum B6 and Lacto-acillus rhamnosus GG demonstrated 53.6% and 46.5% cell surfaceydrophobicity to hexadecane and xylene respectively. The con-iderable differences in the cell surface hydrophobicity could bettributed to variation in the level of expression of cell surfaceroteins amongst different strains and species.
Collagen is found abundantly in mucus layer of the gut androvides active receptors for binding of Cbp. Collagen bindingroperty of a probiotic strain is essentially influenced by the
Please cite this article in press as: Yadav AK, et al. Role of surface layer coladhesion and its anti-adhesion potential against gut pathogen. Microbiol R
resence of Cbp as its surface layer protein among others, whichventually determines adhesion capability of a probiotic strainAleljung et al. 1991; Styriak et al. 2003). Hence, this protein can
able 3nti-adhesion activity of Cbp protein against pathogens (E. coli 0157:H7).
Experiments Adhering cells (E. coli0157:H7) (CFU well−1)
Immobilized collagen (control) 238.33 ± 15.27Immobilized collagen (coated with Cbp
protein)96.0 ± 9.07
ote: The data represent the mean values of CFU, ±standard deviation from threendependent experiments on different days.
PRESSesearch xxx (2013) xxx– xxx
serve as potential probiotic biomarker. Lp91 binding capacity withcollagen (177.66 ± 11.50 CFU well−1) and percentage hydropho-bicity (39.49 ± 6.12%) was consistently better amongst all the testcultures. The results indicated a constant correlation amongstthese two major functional attributes (Van der Mei et al. 2003).The hydrophobicity has been positively correlated with adhesionabilities and competitive inhibition in several studies, suggesting agood relationship between in vitro adhesion and in vivo coloniza-tion (Collado et al. 2007; Deepika and Charalampopoulos 2010;Duary et al. 2011).
However, wide diversity in the adhesion properties has beenrecorded amongst the putative probiotic bacterial strains, includ-ing L. plantarum, Lactobacillus acidophilus (Diego et al. 2009)and bifidobacterium (Mukai et al. 1996) as in the present study(31.33–177.66 CFU well−1). Majority of the probiotic lactobacillihave the inherent capacity to express collagen binding protein. Theresults also implicate that the adhesion capability is not speciesor strain specific. Different environmental conditions used in therespective assays could also have affected the expression of sur-face proteins as reported in some previous studies (De Vries et al.2006; Ramiah et al. 2008).
qRT-PCR was carried out to determined the level of Cbp in dif-ferent L. plantarum strains along with reference strain NCDO5276.Studies such as by MacKenzie et al. (2010), have reported thatin vitro adhesion ability of lactobacillus to immobilized mucus andlevel of mub gene expression are substantially correlated and con-cluded that presence of adhesin proteins on bacterial surface isextensively correlated with binding capability of a particular lacto-bacillus strain. Another study reported successful display of matureadhesin on the surface of probiotics lactobacilli as a crucial factor forbinding to ECM components (Castaldo et al. 2009; Sun et al. 2012;Duary et al. 2012b). In the present study Cbp transcripts level weresignificantly up-regulated in three strains Lp9, Lp72 and Lp91 andthese three strains demonstrated strong adhesion to immobilizedcollagen. The findings further endorse the view that adhesion capa-bility of a particular bacterial strain is relative to the Cbp gene attranscript level. Consequently, surface layer Cbp protein might beconsidered as potential biomarker for screening of novel probioticlactobacillus strains for optimal functionality in the gut.
The method of purification adopted in this investigation waslargely supported by a study of Boot et al. (1993). The proteinis suggested to be anchored to the cell surface by electrostaticinteractions with acidic groups and was removed easily from thecell surface with acidic buffers such as 2 M GuHCl (Jaaskelainenet al. 2008). The affinity of Cbp protein towards collagen was alsoexploited by Aleljung et al. (1991) using custom synthesized HRP-conjugated collagen which was directly applied on collagen bindingprotein blotted PVDF membrane (Rojas et al. 2002). The samestrategy was explored in this study where it worked. The resultsobtained from using the strategy in our study in this regards are inclose agreement with those of Aleljung et al. (1991).
Adhesive characteristics of pathogenic bacteria to epithelial sur-face have also been comprehensively studied. Pathogenic adhesionto host tissues is a critical early phase in many infectious diseasesand related to their virulence (Sun et al. 2012). Probiotic strains arealso likely to mimic the same mechanism as used by the pathogens.The binding ability of probiotic strains to collagen, which is oneof the ECM components, can be utilized as an important parame-ter to determine and to use bacteria for competitive exclusion ofpathogens.
Surface layer protein of L. helveticus R0052 inhibit the adhesionof E. coli on HEp-2 cell lines and S. typhimurium was also inhibited
lagen binding protein from indigenous Lactobacillus plantarum 91 ines (2013), http://dx.doi.org/10.1016/j.micres.2013.05.003
by S-layer protein of L. crispatus on HeLa cell with competitiveexclusion (Chen et al. 2007). Lp91 is a proven probiotic and itssignificant adhesion capability has already been studied on Caco-2cell lines (Kumar et al. 2011; Duary et al. 2011). However, the
nderlying mechanisms and also the responsible surface factorsre not fully understood. The present study, conducted with a prag-atic approach involving adhesion experiments with Cbp (72 kDa),
solated from Lp91, showed 59.71% inhibition of E. coli adhesion onmmobilized collagen. Findings from the study suggest that Cbp areot only involved in the adhesion of lactobacilli to host tissues, buthat release of these proteins also plays an important role in thebility of lactobacilli to protect the host against invading pathogens.
In conclusion, the three L. plantarum strains (Lp9, Lp72 and Lp91)solated from the human faecal samples showed better hydropho-icity and ability to adhere immobilized human type-1 collagennder in vitro conditions as compared to other isolates. The col-
agen binding surface layer protein isolated from Lp91 strain hasnti adhesion activity against E. coli 0157:H7. The role of Cbp indhesion of bacterial strains with ECM and potential as an effec-ive anti-adhesin also becomes apparent. Lp91, an indigenous strainan serve as the ideal candidate probiotic and can be targeted as theubject for more intensive in vivo studies to explore its novel healthromoting functions due to better colonization in the gut.
cknowledgement
The authors greatly appreciate the financial support receivedrom Department of Biotechnology, India. None of the authors have
conflict of interest for the publication of the manuscript.
eferences
leljung P, Paulsson M, Emody L, Andersson M, Naidu AS, Wadstrom T. Collagenbinding by lactobacilli. Curr Microbiol 1991;23:33–8.
oot HJ, Kolen CP, Noort JM, Pouwels PH. S-layer protein of Lactobacillus acidophilusATCC4356: purification, expression in Escherichia coli, and nucleotide sequenceof the corresponding gene. J Bacteriol 1993;175:6089–96.
astaldo C, Vastano V, Siciliano RA, Candela M, Vici M, Muscariello L, et al. Surfacedisplaced alfa-enolase of Lactobacillus plantarum is a fibronectin binding protein.Microb Cell Factories 2009., http://dx.doi.org/10.1186/1475-2859-8-14.
hen X, Xu J, Shuai J, Chen J, Zhang Z, Fang W. The S-layer proteins of Lacto-bacillus crispatus strain ZJ001 is responsible for competitive exclusion againstEscherichia coli O157:H7 and Salmonella typhimurium. Int J Food Microbiol2007;115:307–12.
ollado MC, Meriluoto J, Salminen S. Role of commercial probiotic strainsagainst human pathogen adhesion to intestinal mucus. Lett Appl Microbiol2007;45:454–60.
rittenden R, Karppinen S, Ojanen S, Tenkanen M, Fagerstrom R, Matto J, et al. In vitrofermentation of cereal dietary fibre carbohydrates by probiotic and intestinalbacteria. J Sci Food Agric 2002;82:781–9.
e Leeuw E, Li X, Lu WY. Binding characteristics of the Lactobacillus brevisATCC 8287 surface layer to extracellular matrix proteins. FEMS Microbiol Lett2006;260:210–5.
e Vries MC, Vaughan EE, Kleerebezem M, de Vos WM. Lactobacillus plantarum-survival, functional and potential probiotic properties in the human intestinaltract. Int Dairy J 2006;16:1018–28.
eepika G, Charalampopoulos D. Surface and adhesion properties of lactobacilli. AdvAppl Microbiol 2010;70:127–52.
iego MP, Llopis M, Antolín M, de Torres I, Guarner F, Martínez GP, et al. Adhesionproperties of Lactobacillus casei strains to resected intestinal fragments andcomponents of the extracellular matrix. Arch Microbiol 2009;191:153–61.
raksler D, Gonzales S, Oliver G. Preliminary assays for the development of a pro-biotic for goats. Reprod Nutr Dev 2004;44:397–405.
uary RK, Batish VK, Grover S. Expression of the atpD gene in probiotic Lactobacillusplantarum strains under in vitro acidic conditions using RT-qPCR. Res Microbiol2010;161(5):399–405.
uary RK, Bhausaheb MA, Batish VK, Grover S. Anti-inflammatory and immunomod-ulatory efficacy of indigenous probiotic Lactobacillus plantarum Lp91 in colitismouse model. Mol Biol Rep 2012a;39(4):4765–75.
uary RK, Batish VK, Grover S. Relative gene expression of bile salt hydrolase and sur-
Please cite this article in press as: Yadav AK, et al. Role of surface layer coladhesion and its anti-adhesion potential against gut pathogen. Microbiol R
face proteins in two putative indigenous Lactobacillus plantarum strains underin vitro gut conditions. Mol Biol Rep 2012b;39(3):2541–52.
uary RK, Rajput YS, Batish VK, Grover S. Assessing the adhesion of putative indige-nous probiotic lactobacilli to human colonic epithelial cells. Indian J Med Res2011;134:664–71.
PRESSesearch xxx (2013) xxx– xxx 7
Dubernet S, Desmasures N, Gueguen M. A PCR-based method for identification oflactobacilli at the genus level. FEMS Microbiol Lett 2002;214:271–5.
Harty DWS, Patrikakis M, Knox KW. Identification of Lactobacillus strains isolatedfrom patients with infective endocarditis and comparison of their surface-associated properties with those of other strains of the same species. MicrbiolEcolog Health Dis 1993;6:191–201.
Horie M, Ishiyama A, Fujihira-Ueki Y, Sillanpaa J, Korhonen TK, Toba T. Identificationof Lactobacillus crispatus by polymerase chain reaction targeting S-layer proteingene. J Appl Microbiol 2002;92:396–403.
Ivory K, Chambers SJ, Pin C, Prieto E, Arques JL, Nicoletti C. Oral delivery of Lacto-bacillus casei Shirota modifies allergen-induced immune responses in allergicrhinitis. Clin Exp Allergy 2009;38:1282–9.
Jaaskelainen S, Hynonen U, Ilk N. Identification, characterization of domainsresponsible for self-assembly, cell wall binding of the surface layer protein ofLactobacillus brevis ATCC 8287. BMC Microbiol 2008;8:165–70.
Johnson-Henry KC, Hagen KE, Gordonpour M, Tompkins TA, Sherman PM.Surface-layer protein extracts from Lactobacillus helveticus inhibit enterohaem-orrhagic Escherichia coli O157:H7 adhesion to epithelial cells. Cellular Microbiol2007;9:356–67.
Kumar R, Grover S, Batish VK. Hypocholesterolaemic effect of dietary inclusionof two putative probiotic bile salt hydrolaseproducing Lactobacillus plantarumstrains in Sprague-Dawley rats. Br J Nutri 2011;105:561–73.
Kumar R, Grover S, Batish VK. Bile salt hydrolase (Bsh) activity screening of Lacto-bacilli: in vitro selection of indigenous Lactobacillus strains with potential bilesalt hydrolysing and cholesterol-lowering ability. Probiot Antimicrob Proteins2012;4(3):162–72.
MacKenzie DA, Jeffers F, Parker ML, Vallet AV, Bongaerts RJ, Roos S, et al. Strain-specific diversity of mucus-binding proteins in the adhesion and aggregationproperties of Lactobacillus reuteri. Microbiology 2010;156:3368–78.
McGrady JA, Butcher WG, Beighton D, Switalski LM. Specific and charge interac-tions mediate collagen recognition by oral Lactobacilli. J Dent Res 1995;74:649–57.
Mukai T, Toba T, Ohori H. Collagen binding of Bifidobacterium adolescentis. CurrMicrobiol 1996;34:326–31.
Munoz MPD, Monedero V. Shotgun phage display of Lactobacillus casei BL23 againstcollagen and fibronectin. J Microbiol Biotechnol 2011;2:197–203.
Ramiah K, Reenen CA, Dicks LM. Surface-bound proteins of Lactobacillus plantarum423 that contribute to adhesion of Caco-2 cells and their role in competitiveexclusion and displacement of Clostridium sporogenes and Enterococcus faecalis.Res Microbiol 2008;159:470–5.
Rojas M, Ascencio F, Conway PL. Purification and characterization of a surface proteinfrom Lactobacillus fermentum 104R that binds to porcine small intestinal mucusand gastric mucin. Appl Environ Microbiol 2002;68:2330–6.
Rosenberg M, Judes H, Weiss E. Cell surface hydrophobicity of dental plaque microor-ganisms in situ. Infect Immun 1983;42:831–4.
Sillanpaa J, Martínez B, Antikainen J, Toba T, Kalkkinen N, Tankka S, et al. Character-ization of the collagen-binding S-layer protein CbsA of Lactobacillus crispatus. JBacteriol 2000;182:6440–50.
Song YL, Kato N, Liu CX, Matsumiya Y, Kato H, Watanabe K. Rapid identification of11 human intestinal Lactobacillus species by multiplex PCR assays using group-and species-specific primers derived from the 16S–23S rRNA intergenic spacerregion and its flanking 23S rRNA. FEMS Microbiol Lett 2000;187:167–73.
Styriak I, Nemcova R, Chang YH, Ljungh A. Binding of extracellular matrix moleculesby probiotic bacteria. Lett Appl Microbiol 2003;37:329–33.
Sun Z, Huang L, Kong J, Hu S, Zhang X, Kong W. In vitro evaluation of Lactobacil-lus crispatus K313 and K243: high-adhesion activity and anti-inflammatoryeffect on Salmonella braenderup infected intestinal epithelial cell. Vet Microbiol2012;14:212–20.
Szilagyi A, Shrier I, Heilpern D, Je J, Park S, Chong G, et al. Differentialimpact of lactose/lactase phenotype on colonic microflora. Can J Gastroenterol2010;24:373–9.
Tallon R, Arias S, Bressollier P, Urdaci MC. Strain and matrix dependent adhesion ofLactobacillus plantarum is mediated by proteinaceous bacterial compounds. JAppl Microbiol 2006;102:442–51.
Turner MS, Timms P, Hafner LM, Gi¡ard PM. Identification and characterization of abasic cell surface-located protein from Lactobacillus fermentum BR11. J Bacteriol1997;179:3310–6.
Van der Mei HC, van de Belt-Gritter B, Pouwels PH, Martinez B, Busscher HJ. Cellsurface hydrophobicity is conveyed by S-layer proteins – a study in recombinantlactobacilli. Colloids Surf B Biointerfaces 2003;28:127–34.
Vesterlund S, Paltta J, Karp M, Ouwehand AC. Adhesion of bacteria to resectedhuman colonic tissue quantitative analysis of bacterial adhesion and viability.Res Microbiol 2005;56:238–44.
Xu H, Jeong HS, Lee HY, Ahn J. Assessment of cell surface properties and adhe-sion potential of selected probiotic strains. Lett Appl Microbiol 2009;49:
lagen binding protein from indigenous Lactobacillus plantarum 91 ines (2013), http://dx.doi.org/10.1016/j.micres.2013.05.003
434–42.Heinemann C, Johan E, Vlieg VH, Janssen DB, Busscher HJ, van der Mei HC, et al.
Puri¢cation and characterization of a surface-binding protein from Lactobacil-lus fermentum RC-14 that inhibits adhesion of Enterococcus faecalis 1131. FEMSMicrobiol Lett 2000;190:177–80.
