Specific detection of similar pathogen variants at room temperature using DNA based assay. The assay is based on oligonucleotide probes design to tolerate variations in assay performance. Ideal for point-of-care diagnostic device, or in-field diagnostic. Example based on genotyping 39 types of human papilloma virus (HPV). This hybridization-based assay is suitable for array - chip - based, nano - technology.
Hybridization assay performed at ambient temperaturefor typing high-risk human papillomaviruses
Ivan Brukner a,∗, Razan El-Ramahi a, Jacob Sawicki b,Izabella Gorska-Flipot b,d, Maja Krajinovic a,c, Damian Labuda a,c,∗∗
a Centre de Recherche, Hopital Sainte-Justine, Universite de Montreal, 3175 Cote Sainte-Catherine,Montreal, Que. H3T 1C5, Canada
b Centre de Recherche, Hopital Hotel-Dieu, Universite de Montreal, Montreal, Que., Canadac Departement de Pediatrie, Universite de Montreal, Montreal, Que., Canadad Department de Pathologie, Universite de Montreal, Montreal, Que., Canada
Received 21 September 2006; received in revised form 21 March 2007; accepted 27 March 2007
bstract
ackground: Human papillomavirus (HPV) infection with oncogenic types is a prerequisite for cervical cancer development. HPV typing isequired in the management of pre-cancerous lesions, epidemiological studies, and vaccination trials. None of the available HPV assays areatisfactory for routine diagnosis.bjectives: In order to develop an assay for clinically relevant HPV types, we generated HPV probes using in vitro selection scheme of
terative hybridization.tudy design: Starting from a mixture of random oligonucleotides, through several rounds of hybridization with 39 type-specific GP5+/6+1 sequences, we aimed to obtain specific probes to discriminate between these HPV types.esults: In vitro selection led to pools of specific probes, from which individual probes were cloned and tested for their diagnostic performancet ambient temperature. Typically, 10-fold stronger hybridization signals were obtained between each of the selected probes and their specificargets compared to signals with the remaining 38 HPV types. High sensitivity and specificity of selected probes was demonstrated a series
f clinical samples in the hybridization assay.onclusions: A new panel of probes for detecting HPV types is described. Probes can be adapted for use in a simple clinical setting, or
ncorporated into different detection systems.2007 Elsevier B.V. All rights reserved.
V typi
aw
eywords: Ambient temperature hybridization; Oligonucleotide probes; HP
. Introduction
Infection with the human papillomavirus (HPV) is theause of cervical cancer (Munoz et al., 2003), the second mostommon malignancy affecting women worldwide (Parkin et
l., 2001). HPV consists of more than 100 types, many ofhich are detected in the anogenital mucosa. They are divided
nto high-risk types that are associated with anogenital cancer,nd low-risk types that are not carcinogenic and are primarilyound in genital warts (Munoz et al., 2003). HPV diagnosis,ncluding both detection and typing, is a recommended mea-ure in the management of pre-cancerous lesions (ACOG,003). Typing is necessary to investigate the epidemiology
f particular HPV types, and for monitoring the efficacyf the HPV vaccines. Several diagnostic kits are commer-ially available and numerous diagnostic systems have beenescribed (see Cuschieri and Cubie, 2005; Klaassen et al.,
004; Kleter et al., 1999; Lin et al., 2005; Molijn et al., 2005;an den Brule et al., 2002; van Ham et al., 2005).
A recent study by the World Health Organization (Quintt al., 2006) was undertaken to examine detection of 24amples of the seven most frequent HPV types, using com-ercially available individual typing kits, such as PGMY
ine blot (Gravitt et al., 2000), SPF10-LiPa (Kleter et al.,999; van Hamont et al., 2006), Deg GP5+/6+ reverse linelot (van den Brule et al., 2002) and DNA chip (Biomedab Seoul, Korea). The measurements were performed in9 independent laboratories and 12 different countries. Theverall detection rate of HPV16 was 62% and that of HPV18as 73.9%; approximately half of the laboratories failed to
dentify HPV31 and many did not detect types 35, 52 and. New, multiplex high throughput assays were developed,sing system of primers MY09/MY11 (Jiang et al., 2006),GMY09/11 (Wallace et al., 2005), or GP5+/GP6+ (Schmittt al., 2006), aiming at detection of 22 up to 45 distinct HPVypes. However, they either miss some clinically relevantypes (Jiang et al., 2006; Schmitt et al., 2006), or the vali-
ation of the full set of probes was not performed (Wallacet al., 2005).
We describe an application of a novel empirical probeesign, the iterative hybridization method (Brukner et al.,
wBat
ig. 1. Alignments of 39 HPV target sequences. The alignment of HPV sequencesy Clustal (http://www.ebi.ac.uk/cgi-bin/clustalw/).
Virology 39 (2007) 113–118
002, 2007), which yielded clinically useful probes for typ-ng 39 mucosal HPV types. The procedure was optimizedo generate probes that differentiate between distinct shortPV amplicons with as much as 87% sequence identity, in a
imple typing assay at ambient temperature.
. Materials and methods
.1. Oligonucleotides
Oligonucleotides were synthesized by Integrated DNAechnologies (Coralville, IA). Targets were 91–100ucleotides-long type-specific segments (GP5+ strands) ofhe GP5+/6+ amplicons (Fig. 1), located between posi-ions 6647 and 6740 of HPV16 sequence (accession number02718) (Seedorf et al., 1985). They were synthesizedon-modified or with biotin at their 5′ ends. Biotiny-ated targets were immobilized in streptavidin-coated tubesRoche Diagnostics GmbH, Mannheim, Germany) or 96-
ell plates (Pierce Reacti-Bind Streptavidin Coated Highinding Capacity Black plates, Rockford, Il) for preparativend analytical purposes, respectively, following manufac-urers’ instructions. Initial random oligonucleotides mix-
, between positions 6647 and 6740 as in HPV16 (GI: 333031), as obtained
ure, ROM22, was GCCTGTTGTGAGCCTCCTGTCGAA-N)22-TTGAGCGTTTATTCTTGTCTCCCA.
The 5′ block TTCGACAGGAGGCTCACAACAGGCnd 3′ block TGGGAGACAAGAATAAACGCTCAA weresed to “block” the anchoring segments of ROM22. Theorward primer GCCTGTTGTGAGCCTCCTGTCGAA andhe 5′-phosphorylated 3′ block (used as reverse primer)erved to amplify ROM22 and the derived probes. The for-ard GP5+ primer was as described by de Roda Husman et
l. (1995) and we used a mixture of four oligonucleotides as aeverse GP6+ primer: GAAAAATAAACTGTAAATCATAT-C, GAAAAATAAACTGTAAATCATACTC, GAAAAA-AAACTGTAAATCAAATTC and GAAAAATAAACTG-AAATCAAACTC.
.2. Iterative hybridizations
ROM22 (1 nmol) was used initially to obtain the firstffinity-selected mixture of oligonucleotide probes, referredo as pooled probes, PP. All subsequent hybridization cyclessed PP from the previous cycle. Prior to use, PP were PCR-mplified and converted to single stranded (GP5+ strand)orm as described (Brukner et al., 2007). ROM22 or PP wasixed with block oligonucleotides (0.05–0.25 and 0.5 �M,
espectively) in 200 �l of TMN buffer. After heating to 90 ◦Che solution was transferred to tubes containing pre-boundargets (1 pmol, except in the first step, when 100 pmol wassed), cooled down to 22–24 ◦C and left for 4 h. After rins-ng, oligonucleotides bound to the target were dissociated byeating at 90 ◦C for 2 min. Following positive hybridization
ycles described above, we carried subtractive hybridizationhat differed only by the presence, in the hybridization solu-ion, of 0.5 �M (total) of the remaining 38 non-biotinylatedarget oligonucleotides (i.e. all other than the immobilized
hbLi
ig. 2. Hybridization of the selected pooled probes, PPs (A) and of the individuafter five rounds of positive and two rounds of subtractive hybridization, CPOs asntensities.
Virology 39 (2007) 113–118 115
arget). Ultimately, the affinity-selected PPs were cloned intolasmids, using TOPO TA Cloning kit (Invitrogen, CA), tobtain individual cloned probes, CPs. The presence of insertas confirmed by sequencing, using the LiCor apparatus
Lincoln, NE). PCR-amplified PPs and CPs were validatedy hybridization. Hybridization with FAM-6 label ampli-ons was quantified by measuring fluorescence in SpectraAX Gemini XS (22 ◦C, λex = 485 nm and λem = 538 nm)
nd expressed in relative fluorescence unit, RFU.
.3. HPV typing assay
We used synthetic HPV16 GP5+/6+ oligonucleotide andre-characterized clinical samples as a source of HPV tem-lates for PCR amplification (van den Brule et al., 2002).he resulting amplicons were converted into single strandedNA, mixed with blocking oligonucleotides, and hybridized
o immobilized CPs (100 pmol). To detect hybridization sig-al, we used the FAM-6 labeled GP6+ primer serving here asdetection probe: an exact complement of the GP5+ primer
nd FAM-6 labeled GP6+ primer were added at 1 �M each.fter washing off the unbound material, the hybridizationas expressed in RFU.
. Results
.1. Selection, cloning and validation of specific probes
The probes were selected in a series of iterative
ybridization experiments (Brukner et al., 2007). Briefly,iotinylated target oligonucleotides representing “GP5+/6+”1 sequences of 39 distinct HPV types (Fig. 1) were
mmobilized in the streptavidin-coated tubes and hybridized
l cloned probes, CPs (B) with each of the HPV type. PPs were obtaineddescribed in the text. Gray scale expresses relative extent of hybridization
1 linical Virology 39 (2007) 113–118
tlwtEtewi3as2Hafi(3ht
optco4utwhtsCgt
3
i5
Fl
Fig. 4. HPV typing of pre-characterized clinical samples containing HPV6amH
(wctlso
3
c
16 I. Brukner et al. / Journal of C
o a mixture of random oligonucleotides (ROM22). Fol-owing hybridization, the unbound oligonucleotides wereashed away, whereas the bound ones were dissociated from
heir target, re-amplified by PCR, and hybridized again.very additional hybridization cycle “iteratively” enriched
he resulting mixture of probes, PPs, in sequences that bindfficiently to their target. The non-specific binders, whichould also recognize other HPV types, were eliminated dur-
ng cycles of subtractive hybridization. As shown in Fig. 2, all9 PPs (5+2−), each obtained after five cycles of the positivend two cycles of the subtractive hybridization, bound theirpecific targets efficiently. Yet, a few of them (PPs 22, 23, 25,7 and 29—see Fig. 2A) also cross-reacted with few otherPVs. To eliminate the cross-reacting species, we added
nother cycle of subtractive hybridization using only theseve targets. Thereafter, all the resulting type-specific PPs5+3−) efficiently discriminated each of their corresponding9 HPV targets. On average we observed a 10-fold strongerybridization signal with the specific target as compared tohe remaining non-specific ones.
The unique probe sequences, cloned probes, CPs werebtained by cloning PPs into plasmids. Individual clonedrobes were tested for binding to the whole panel of 39argets. In 29 out of 39 such experiments, the first testedlone displayed signal/noise ratio of at least 7. Cloned probesbtained from the remaining PPs, for HPV types 6, 34, 40,3, 45, 52, 64, 70, 72 and MM7, cross-hybridized withp to four HPV types. Therefore, we performed an addi-ional subtractive hybridization to obtain PPs (5+4−) thatere subsequently cloned. Fig. 2B shows a summary of theybridization results of 39 type-specific CPs, tested againsthe whole panel of immobilized HPV targets. In turn, Fig. 3hows hybridization intensities of all selected type-specificPs with the immobilized HPV16, the most common onco-enic HPV variant. The signal obtained with CP16 was ∼20imes stronger than with the remaining non-specific CPs.
.2. HPV typing assay
The HPV typing assay was performed in a reverse format,n which all 39 HPV type-specific CPs, biotinylated at the′ terminus were immobilized in streptavidin-coated plates
ig. 3. Performance of 39 CPs with HPV16 target. Probes are in the sameinear order as HPV targets in Fig. 1.
btafiftbpsHvppasnsm
nd HPV16 to the array of 39 immobilized type specific CPs. (A) the arrange-ents of CP probes; (B) hybridization with HPV6; (C) hybridization witPV16. Arrows indicate the orientation of the probes array.
Fig. 4). Clinical samples containing HPV6 and HPV16 typesere amplified by PCR using GP5+/6+ primers. The ampli-
ons, converted to single stranded form, were hybridized tohe panel of immobilized probes in the presence of the FAM6-abeled detection probe and blocking oligonucleotides. Ashown in Fig. 4B and C significant hybridization signal wasnly detected with CP6 and CP16.
.3. Origin of specificity of the selected probes
Sequences of the selected CPs are shown in Fig. 5 andompared with the fragments of the HPV targets identifiedy BLAST analysis. Clearly, there is no full complemen-arity between probes and targets. Complementary segmentsre short and scattered, separated by mismatches. The speci-city of the probes appears thus to depend on differentactors. These include the position of the probe with respecto the target sequence, its length and sequence context. Aetter understanding can be obtained by analyzing eachrobe–target combination. The alignment of the sequenceegment of CP33 and its HPV 33 target with nine additionalPV types sharing high sequence identity with type 33 isery revealing (Fig. 6). We note A/C mismatch at the sixthosition of the otherwise fully complementary CP33:HPV33robe–target duplex (in gray). Interestingly, the same A is
lso present in other nine HPV targets, all of which alsohow mismatches in the adjacent sequence positions (2–5ucleotides apart). One may speculate that “logic of probeelection” was to introduce mismatch to further destabilizeismatches when interacting with non-specific targets.
I. Brukner et al. / Journal of Clinical Virology 39 (2007) 113–118 117
Fig. 5. Partial sequence alignment of HPV targets with sequences of their specific CPs as obtained by BLAST. Sequences of HPV targets are in plain text (upperrow) and the corresponding CPs, devoid of flanking priming segments are in italics below. Only 22-nucleotide long HPV target segment is shown, correspondingto the length of the CP sequence, in the region identified by BLAST (http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi). Full matches between probe andi y dashet atchings he show
4
grieaoooowH
co
ppfainblpi
ti
ts target are highlighted in grey with local insertions/deletions indicated bhe GP5+ primer 3′ end to the first nucleotide position of the probe–target mimilarly scored and for HPV 52 and MM7, where BLAST was equivocal, t
. Discussion
We applied in vitro selection scheme to obtain a neweneration of probes that discriminate among 39 clinicallyelevant HPV types, based upon the previously character-zed GP5+/6+ L1 segment of the HPV (de Roda Husmant al., 1995; Evans et al., 2005; Jacobs et al., 1997). In
series of hybridization steps, starting from a mixturef random oligonucleotides, we iteratively enriched it inligonucleotides that selectively recognized a specific HPVut of the 39 HPV targets (Figs. 2 and 3). The performancef the reverse format of the assay (CPs on the solid support)as examined using clinical samples containing HPV 16 and
PV 6 (Fig. 4).In a classic multi-probe typing experiment, hybridization
onditions represent a compromise to accommodate quasi-ptimal conditions for each of the participating probe–target
sttm
s. The number following each HPV type corresponds to the distance fromsegment shown in gray. For HPV 35, where two BLAST alignments weren alignments were obtained using Clustal (Fig. 1).
airs. The advantage of the method described here is theossibility of enforcing and optimizing uniform conditionsor all probes that are to be used in the resulting diagnosticssay. These conditions are those that are imposed/used dur-ng iterative selections of different probes and correspond toon-denaturing buffer hybridization at ambient temperatureetween 20 and 28 ◦C. Cross-hybridization was, on average,ess then 10% of the specific signal between the selectedrobe and its corresponding HPV target, and sensitivity wasn the range of low pmol level.
Sequence analysis (Fig. 5) permits some speculations onhe “strategies” used by the selection process to achieve bind-ng specificity of the probes. This specificity is achieved by
electing short probe segments that are complementary to thearget and avoid matching with unintended targets. Similarly,he complementary segments tend also to be interrupted by
ismatches, as illustrated by the CP33-HPV33 complex that
Fig. 6. Partial sequence alignment of CP33 with its specific and nine similarHPV targets. The mismatch that breaks an elongated stretch of complemen-tnNs
i(bmppl(
ditbWdiafm
A
Cis(pd
R
A
B
B
C
d
E
G
J
J
K
K
L
M
M
P
Q
S
S
v
v
v
arity between CP33 and its target is highlighted in gray. Dots representucleotide identity with the uppermost CP33 and different sequences below.ote that targets are in usual 5′–3′ orientation, while upper CP33 is repre-
ented by its antisense strand to facilitate the comparison.
s characterized by the presence of a characteristic mismatchFig. 6). This mismatch destabilizes probe–target complex,ut still allows for the complex to form. However, the sameismatch prevents binding to very similar sequence motifs
resent in the other 9 HPV targets to be discriminated (Fig. 6),resumably by interrupting stacking interactions and destabi-izing even further its nearest-neighbor mismatched positionsBrukner et al., 2007).
In conclusion, we describe a new panel of probes foretecting different types of HPV. These probes can be usedn a simple clinical setting incorporating different detec-ion systems. For example, combining the sensitivity of theead-based platform (Jiang et al., 2006; Schmitt et al., 2006;allace et al., 2005) with a wide spectrum of viral types
etected by our probes could produce a robust HPV typ-ng assay. Its miniaturization will be an important asset. Ourpproach can be easily applied to generate diagnostic toolsor typing other pathogens or even in the detection of pointutations in genes coding for known hereditary disorders.
cknowledgements
We would like to thank Drs Irina Nazarenko (Digeneorporation) and Kerry Kunning (IDT) for troubleshoot-
ng fluorescence quenching problem. This research wasupported by the Canadian Institutes of Health ResearchNTA-71859) and Research Center of Sainte-Justine Hos-ital. MK is a scholar of the Fonds de la Recherche en Santeu Quebec.
eferences
COG. American College of Obstetricians and Gynecologists, Newsrelease, July 31, 2003. Cervical Screening: Testing Can Start and LaterOccur Less Often Under New ACOG Recommendations.
rukner I, Tremblay GA, Paquin B. Generation of amplifiablegenome-specific oligonucleotide probes and libraries. Biotechniques2002;33:874–6, 878, 880 passim.
rukner, I., El-Ramahi, R., Gorska-Flipot, I., Krajinovic, M., Labuda, D.,2007. Generation of oligonucleotide probes to discriminate between
W
Virology 39 (2007) 113–118
closely related DNA sequences. Nucleic Acids Res, 2007; April 10;[epub ahead of print].
uschieri KS, Cubie HA. The role of human papillomavirus testing in cer-vical screening. J Clin Virol 2005;32(Suppl 1):S34–42.
e Roda Husman AM, Walboomers JM, van den Brule AJ, Meijer CJ, Sni-jders PJ. The use of general primers GP5 and GP6 elongated at their 3′ends with adjacent highly conserved sequences improves human papil-lomavirus detection by PCR. J Gen Virol 1995;76(Pt 4):1057–62.
vans MF, Adamson CS, Simmons-Arnold L, Cooper K. TouchdownGeneral Primer (GP5+/GP6+) PCR and optimized sample DNA concen-tration support the sensitive detection of human papillomavirus. BMCClin Pathol 2005;5:10.
ravitt PE, Peyton CL, Alessi TQ, Wheeler CM, Coutlee F, Hildesheim A,et al. Improved amplification of genital human papillomaviruses. J ClinMicrobiol 2000;38:357–61.
acobs MV, Snijders PJ, van den Brule AJ, Helmerhorst TJ, Meijer CJ, Wal-boomers JM. A general primer GP5+/GP6(+)-mediated PCR-enzymeimmunoassay method for rapid detection of 14 high-risk and 6 low-riskhuman papillomavirus genotypes in cervical scrapings. J Clin Microbiol1997;35:791–5.
iang HL, Zhu HH, Zhou LF, Chen F, Chen Z. Genotyping of human papil-lomavirus in cervical lesions by L1 consensus PCR and the LuminexxMAP system. J Med Microbiol 2006;55:715–20.
laassen CH, Prinsen CF, de Valk HA, Horrevorts AM, Jeunink MA, Thun-nissen FB. DNA microarray format for detection and subtyping of humanpapillomavirus. J Clin Microbiol 2004;42:2152–60.
leter B, van Doorn LJ, Schrauwen L, Molijn A, Sastrowijoto S, ter ScheggetJ, et al. Development and clinical evaluation of a highly sensitive PCR-reverse hybridization line probe assay for detection and identificationof anogenital human papillomavirus. J Clin Microbiol 1999;37:2508–17.
in H, Moh JS, Ou YC, Shen SY, Tsai YM, ChangChien CC, et al. Asimple method for the detection and genotyping of high-risk humanpapillomavirus using seminested polymerase chain reaction and reversehybridization. Gynecol Oncol 2005;96:84–91.
olijn A, Kleter B, Quint W, van Doorn LJ. Molecular diagnosis of humanpapillomavirus (HPV) infections. J Clin Virol 2005;32(Suppl 1):S43–51.
unoz N, Bosch FX, de Sanjose S, Herrero R, Castellsague X, Shah KV, et al.Epidemiologic classification of human papillomavirus types associatedwith cervical cancer. N Engl J Med 2003;348:518–27.
arkin DM, Bray FI, Devesa SS. Cancer burden in the year 2000. The globalpicture. Eur J Cancer 2001;37(Suppl 8):S4–66.
uint WG, Pagliusi SR, Lelie N, de Villiers EM, Wheeler CM. Results of thefirst world health organization international collaborative study of detec-tion of human papillomavirus DNA. J Clin Microbiol 2006;44:571–9.
chmitt M, Bravo IG, Snijders PJ, Gissmann L, Pawlita M, Waterboer T.Bead-based multiplex genotyping of human papillomaviruses. J ClinMicrobiol 2006;44:504–12.
eedorf K, Krammer G, Durst M, Suhai S, Rowekamp WG. Human papil-lomavirus type 16 DNA sequence. Virology 1985;145:181–5.
an den Brule AJ, Pol R, Fransen-Daalmeijer N, Schouls LM, Meijer CJ,Snijders PJ. GP5+/6+ PCR followed by reverse line blot analysis enablesrapid and high-throughput identification of human papillomavirus geno-types. J Clin Microbiol 2002;40:779–87.
an Ham MA, Bakkers JM, Harbers GK, Quint WG, Massuger LF, Melch-ers WJ. Comparison of two commercial assays for detection of humanpapillomavirus (HPV) in cervical scrape specimens: validation of theRoche AMPLICOR HPV test as a means to screen for HPV genotypesassociated with a higher risk of cervical disorders. J Clin Microbiol2005;43:2662–7.
an Hamont D, van Ham MA, Bakkers JM, Massuger LF, Melchers WJ.Evaluation of the SPF10-INNO LiPA human papillomavirus (HPV)
genotyping test and the roche linear array HPV genotyping test. J ClinMicrobiol 2006;44:3122–9.
allace J, Woda BA, Pihan G. Facile, comprehensive, high-throughput geno-typing of human genital papillomaviruses using spectrally addressableliquid bead microarrays. J Mol Diagn 2005;7:72–80.
