+ All Categories
Home > Documents > s3-eu-west-1.amazonaws.com · Web viewMelaleuca alternifolia (TTO) used in this study was kindly...

s3-eu-west-1.amazonaws.com · Web viewMelaleuca alternifolia (TTO) used in this study was kindly...

Date post: 01-Jan-2020
Category:
Upload: others
View: 0 times
Download: 0 times
Share this document with a friend
13
SUPPLEMENTARY MATERIAL Antibacterial activity of essential oils mixture against PSA. Elisabetta Vavala a , Claudio Passariello a , Federico Pepi b , Marisa Colone c , Stefania Garzoli b , Rino Ragno d , Adele Pirolli d , Annarita Stringaro c , Letizia Angiolella a* . a Department of Public Health and Infectious Diseases. University of Rome "Sapienza", Piazzale Aldo Moro, 5, 00161 Roma, Italy. b Department of Drugs Chemistry and Technology, University of Rome "Sapienza",Piazzale Aldo Moro, 5, 00161 Roma, Italy. c Department of Technology and Health, Italian National Institute of Health. Viale Regina Elena 299, 00161 Rome, Italy. d Rome Center for Molecular Design, Department of Drugs Chemistry and Technology, University of Rome "Sapienza", Italy *Corresponding author. Mailing address: Department of Public Health and Infectious Diseases. University of Rome "Sapienza". Piazzale Aldo Moro, 00161-Rome (Italy). 1
Transcript
Page 1: s3-eu-west-1.amazonaws.com · Web viewMelaleuca alternifolia (TTO) used in this study was kindly gifted by Talia (Rome, Italy, http:/ ). It was constituted principally by 53.8 % terpinen

SUPPLEMENTARY MATERIAL

Antibacterial activity of essential oils mixture against PSA.

Elisabetta Vavalaa, Claudio Passarielloa, Federico Pepib, Marisa Colonec, Stefania Garzolib,

Rino Ragnod, Adele Pirollid, Annarita Stringaroc, Letizia Angiolellaa*.

a Department of Public Health and Infectious Diseases. University of Rome "Sapienza",

Piazzale Aldo Moro, 5, 00161 Roma, Italy.

b Department of Drugs Chemistry and Technology, University of Rome

"Sapienza",Piazzale Aldo Moro, 5, 00161 Roma, Italy.

c Department of Technology and Health, Italian National Institute of Health. Viale Regina

Elena 299, 00161 Rome, Italy.

d Rome Center for Molecular Design, Department of Drugs Chemistry and Technology,

University of Rome "Sapienza", Italy

*Corresponding author. Mailing address: Department of Public Health and Infectious

Diseases. University of Rome "Sapienza". Piazzale Aldo Moro, 00161-Rome (Italy).

Phone: +3964468625,

Fax: +3964468625.

E-mail: [email protected]

1

Page 2: s3-eu-west-1.amazonaws.com · Web viewMelaleuca alternifolia (TTO) used in this study was kindly gifted by Talia (Rome, Italy, http:/ ). It was constituted principally by 53.8 % terpinen

Abstract

Pseudomonas syringae pv actinidiae (PSA) is the causal agent of bacterial canker of kiwifruit. It is

very difficult to treat pandemic disease. The prolonged treatment with cupric substances, has

resulted in failure and resistance and alternatives to conventional antimicrobial therapy are needed.

The aim of our study was to analyse the phenotypic characteristics of PSA, identify new substances

from natural source i.e essential oils able to contain the kiwifruit canker and investigate their

potential use when utilised in combination. Specially, we investigated the morphological

differences of PSA isolates by scanning electron microscope (SEM), and the synergic action of

different essential oils by time-kill and checkerboard methods. Our results demonstrated that PSA

was able to produce extracellular polysaccharides when it was isolated from trunk, and, for the

first time, that it was possible to kill PSA with a mixture of essential oils after 1 h of exposition. We

hypothesise on its potential use in agriculture.

Key words: Pseudomonas syryngae pv actinidiae, kiwifruit canker, exopolymeric material,

SEM, Essential oils, synergism.

3. Experimental

3.1 Microorganism and growth conditions.

Strains of Pseudomonas syryngae pv actinidiae (PSA) were obtained from a case of bacterial

canker on A. chinensis in central Italy (Latina province) in 2011. Bacteria were isolated from trunk

and from exudates and were identified by the techniques described below. The strains were cultured

on nutrient agar (Oxoid) supplemented with 5% sucrose (NSA) and incubated at 25–27°C or room

temperature for 24 h.

3.2 Exopolysaccharides Production.

The exopolysaccharides production (EPS) was evaluated by streaking fresh culture of bacteria

isolated from trunk or exudate on NSA agar supplemented with 5% (w/v) sucrose (Sigma). After

incubation at 25-27°C under anaerobic conditions for 72 h, the development of a mucoid colony on

agar medium indicated the production of exopolysaccharides (Ruas-Madiedo & de los Reyes-

Gavilan 2005).

3.3 Molecular identification of PSA.

Cultures of both strains for DNA extraction were grown overnight in Luria Bertani Broth (LB) at

26°C on a rotating shaker at a speed of 150 rpm. DNA was extracted using the DNeasy Kit

2

Page 3: s3-eu-west-1.amazonaws.com · Web viewMelaleuca alternifolia (TTO) used in this study was kindly gifted by Talia (Rome, Italy, http:/ ). It was constituted principally by 53.8 % terpinen

(Qiagen). DNA concentration was determined spectrophotometrically at 260 nm, assuming that an

OD=1 corresponded to a DNA concentration of 50 ng/l. For amplification of PSA specific DNA

fragments of the 16S–23S rDNA inter transcribed spacer region was used as the PCR protocol of

Rees-George (Rees-George et al. 2010). (Primers: PsaF1 Forward

TTTTGCTTTGCACACCCGATTTT, PsaR2 Reverse CACGCACCCTTCAATCAGGATG

amplifying a 280 bp specific fragment).

The PCR reaction mixture (25 l final volume) contained 10 ng template DNA, primers at 0.5 M

each, dNTPs at 200 M each, 0.5 U DreamTaq DNA polymerase (Fermentas), Dream Taq DNA

polymerase buffer containing 20 mM MgCl2. Amplification was obtained by an initial denaturation

at 95°C for 2 min, followed by 30 cycles at 95°C for 30 s (denaturing), 65°C for 30 s (annealing)

and 72°C for 30 s (elongation). Final elongation was at 72°C for 5 min. PCR amplification products

were detected by ethidium bromide staining, following separation on 2% agarose gel in Tris Acetate

EDTA buffer. The 1kb DNA Ladder (Fermentas) was used as the molecular weight internal

standard.

3.4 Scanning electron microscope (SEM).

For SEM observations, bacteria were grown in5% glucose-supplemented NA medium (see above)

at 25-27 °C for 24h. After being washed twice in calcium and magnesium-free PBS, the cellular

pellets resulting from the centrifugation were fixed for 20 minutes at room temperature with 2.5%

(v/v) glutaraldehyde in a 0.2M cacodylate buffer (pH 7.4) containing 2% (w/v) sucrose. After three

washes in the same buffer, the cells were post-fixed with 1% (w/v) OsO4 for 1 h, dehydrated on an

ethanol gradient, critical point dried in CO2 and sputter bv coated with gold (Stringaro et al. 2014).

The samples were examined under a Cambridge Stereoscan 360 scanning electron microscope

(Cambridge Instruments, Cambridge, UK).

3.5 Extraction and chemical characterization of Essential oils.

Mentha suaveolens essential oil was obtained from areal part of wild-type plants recovered in the

Tarquinia contry-side (Viterbo province) as previously described (Angiolella et al. 2010) (EOMS

patent WO 2011092655 A3) Rosmarinus officinalis (REO), Salvia officinalis (SEO) and Laurus

nobilis (LEO) were obtained from leaves of wild-type plants in Poggio Moiano country-side (Rieti

province) by four-hour hydro distillation (Clevenger-type apparatus) and then analysed for chemical

composition by GC/MS analyses (Perkin Elmer Clarus 500) and GC-FID equipped with a Restek

Stabilwax fused-silica capillary column (60 m long, 0.25 mm i.d.), operating at 60°C for 5 min and

then programmed at 220°C rate of 5°C/min.; helium was used as carrier gas with 1 ml/min. Relative

weight percentages of the components were calculated by electronic integration of the GC-FID peak

areas and were identified by comparison of their GC-MS mass spectra with those reported in the

3

Page 4: s3-eu-west-1.amazonaws.com · Web viewMelaleuca alternifolia (TTO) used in this study was kindly gifted by Talia (Rome, Italy, http:/ ). It was constituted principally by 53.8 % terpinen

NIST and NBS libraries. Compounds were identified by the application of the NIST 08 Mass

Spectral Library. Analysis, as reported in table S 2, revealed that 90% of EOMS was constituted by

piperitenone oxide (Angiolella et al. 2010). REO was constituted principally by 20.3 % borneole,

13.0 % alpha pinene, 11.4 % camphor, 8 % eucalyptol and by other minor constituents. The main

chemical components of SEO were 25.8% caryophillene, 22.4% caryophyllene 16.5% eucalyptol

and other minor constituents. 18.1% camphene,16.9% cynnamil acetate and 15% eucalyptol

represent the main components of LEO. The essential oil of Melaleuca alternifolia (TTO) used in

this study was kindly gifted by Talia (Rome, Italy, http:/ www.taliaessenze.com). It was constituted

principally by 53.8 % terpinen 4-olo, 14.3 % gamma terpinene and 9.6 % alpha terpineol.

3.6 Antimicrobial assays.

The susceptibility of the microbial cells to EOs and ampicillin sodium salt, used as a control

(Sigma -Aldrich), was determined by broth microdilution assays of the Clinical and Laboratory

Standards Institute (CLSI 2009) with inoculum of approximately 105colony forming units per

milliliter (CFU/ml) of each microorganisms. The EOs were 1:10 diluted in DMSO and

subsequently diluted in water. The cellular growth was observed after 24h. The dilutions of the

EOs, ranging from 0.01219 to 12.48 g/L, were prepared in a 96-well plate. The minimum inhibitory

concentration (MIC) was defined as the lowest concentration of essential oils without visible

growth. To determine the Minimum Bactericidal Concentration (MBC), NSA dextrose agar plates

were seeded with 10μl cell suspensions taken from the wells of the MIC assay plates where cell

growth was not observed. These plates were incubated at 25-30°C for 48h and CFU growth was

evaluated.

3.7 EOs synergism

To evaluate synergism between different essential oils,three-dimensional chequerboard assay was

used (Bhusal et al. 2005). To test and optimise synergistic combinations, serial dilution of the three

oils (REO, TTO and EOMS) was used in a 96-well plate starting from twice the MIC of the

individual antimicrobial agents. The presence and extent of synergism was evaluated by calculating

the fractional inhibitory concentration index (FICI) as the combined EO effect of agents A,B and C

(where A is EOMS,B is TTO and C is REO) and was calculated as follows:

Fractional inhibitory concentration index (FICI) = FICA + FICB +FICC = A/MICA + B/MICB+

C/MICc where A,B and C are the MICs of each EO in combination and MICA, MICB and MICC are

the MICs of each EO alone. The results of the FICI assay were analysed according to the

checkerboard method (Rej-Jurado et al. 2013) adapted to three drugs in combination. In this case

the synergism was defined when FICI was lower or equal to 0.75; indifferent was determined from

0.75 to 4; and a FICI> 4 was considered as antagonistic activity.

4

Page 5: s3-eu-west-1.amazonaws.com · Web viewMelaleuca alternifolia (TTO) used in this study was kindly gifted by Talia (Rome, Italy, http:/ ). It was constituted principally by 53.8 % terpinen

3.8 In vitro time-kill synergy kinetics.

Time-kill curve methods were used to evaluate the synergistic activities of EOs in combination with

each other against PSA. An overnight broth culture of PSA was diluted in NSA broth to obtain a

starting inoculum of about 1 × 105 CFU/ml. Essential oils in combination were added to the

bacterial broth at different concentrations of synergy values (1/2x, 1x, 2x synergy values). 100μl

aliquots of broth were taken after 0, 30, 60, 120, 360 min and 24 h of incubation. Each aliquot was

serially diluted, plated onto NSA agar plates in duplicates and incubated overnight at 25-27°C. The

number of colony forming units was counted and CFU/ml was determined. The values were plotted

to obtain the kill-kinetics. Results are expressed as CFU/ml.

5

Page 6: s3-eu-west-1.amazonaws.com · Web viewMelaleuca alternifolia (TTO) used in this study was kindly gifted by Talia (Rome, Italy, http:/ ). It was constituted principally by 53.8 % terpinen

Figure S1 .Isolation and molecular identification of PSA. A) Top view of spot colonies of PSA,

at 2 days of incubation on nutrient agar supplemented with 5% sucrose (NSA),using a 10x

objective. B) PCR reactions to identify PSA. Line 1 represents DNA marker, lines 2 and 3 DNA

extracted by strains isolated both from trunk and exudate.

6

Page 7: s3-eu-west-1.amazonaws.com · Web viewMelaleuca alternifolia (TTO) used in this study was kindly gifted by Talia (Rome, Italy, http:/ ). It was constituted principally by 53.8 % terpinen

Table S2. GC-FID chemical composition of Essential Oils (weight %)

7

Page 8: s3-eu-west-1.amazonaws.com · Web viewMelaleuca alternifolia (TTO) used in this study was kindly gifted by Talia (Rome, Italy, http:/ ). It was constituted principally by 53.8 % terpinen

Figure S2. Time-kill curves of EOMS, REO and TTO against PSA. Bacteria were untreated (control) or treated with mixture of EOs at concentrations equivalent to ½, 1, or 2 times their synergic values (s.v.) for different time periods(0, 30 min, 1,2, 6 and 24 h). Data are representative of one of three independent experiments. The statistical significance was evaluated with the Student’s t-test (two-tailed). *P-values of < 0.05 were considered significant

References

Angiolella, L., Vavala, E., Sivric, S., Diodata, D’A. F., & Ragno, R. (2010). In vitro activity of Mentha suaveolens essential oil against Cryptococcus neoformans and dermatophytes. International Journal of Essential Oil Therapeutics, 4: 35-36.

Bhusal. Y., Shiohira, C.M., & Yamane, N. (2005) Determination of in vitro synergy when three antimicrobial agents are combined againstMycobacterium tuberculosis.International Journal of Antimicrobial Agents, 26: 292-297.

Clinical and Laboratory Standards Institute. (2009). Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically. 8th ed. Wayne: CLSI

Rey-Jurado, E., Tudo, G., de la Bellacasa, J.P., & Espasa, M. (2013). In vitro effect of three drug combinations of antitubercular agents against multidrug–resistant Mycobacterium tuberculosis isolates. International Journal of Antimicrobial Agents, 41: 278-280.

Ruas-Madiedo P., & de los Reyes-Gavilán, C.G. (2005). Invited Review: Methods for the Screening, Isolation, and Characterization of Exopolysaccharides Produced by Lactic Acid Bacteria. Journal of Dairy Science, 88: 843-856

Stringaro, A., Vavala, E., Colone, M., Pepi, F., Mignogna, G., GarzoliS.,Cecchetti, S., Ragno, R., & Angiolella, L. (2014). Effects of Mentha suaveolens essential oil alone or in combination with other drugs in Candida albicans. Evidence-Based Complementary and Alternative Medicine, 2014, 9 pages, article ID125904

.

8


Recommended