IDENTIFICATION OF HOST FACTORS

CONFERRING NATURAL RESISTANCE

IN CHILLI AGAINST

CHILLI LEAF CURL VIRUS

Submitted by

Dr. Supriya Chakraborty Associate Professor

School of Life Sciences Jawaharlal Nehru University

New Delhi – 110 067

Submitted to

The Department of Biotechnology

Government of India

2

PROFRMA – I

PROFORMA FOR SUBMISSION OF PROJECT PROPOSALS ON RESEARCH AND DEVELOPMENT, PROGRAMME SUPPORT

(To be filled by the applicant)

PART I : GENERAL INFORMATION 1. Name of the Institute/University/Organization submitting the Project Proposal:

JAWAHARLAL NEHRU UNIVERSITY 2. State: DELHI 3. Status of the Institute: CENTRAL UNIVERSITY (Please see Annexure-I) 4. Name and designation of the Executive Authority of the Institute/University forwarding

the application: ACADEMIC COORDINATOR (EVALUATION), JNU 5. Project Title: IDENTIFICATION OF HOST FACTORS CONFERRING NATURAL

RESISTANCE IN CHILLI AGAINST CHILLI LEAF CURL VIRUS

6. Category of the Project (Please tick) : R&D Demonstration Establishment of Infrastructural facility/ Centre of Excellence

7. Specific Area (Please see Annexure - II): PLANT MOLECULAR BIOLOGY 8. Duration : 3 Years 0 Months 9. Total Cost (Rs.) 50,90,820/- 10. Is the project Single Institutional or Multiple-Institutional (S/M) ? : S 11. If the project is multi-institutional, please furnish the following: not applicable Name of Project Coordinator: .. Affiliation : Address : 12. Scope of application indicating anticipated product and processes

• Identification of host factors governing resistance will provide us to develop better strategies for management of Chilli leaf curl virus. This study will be useful for identification of R genes from chilli.

• Elucidation of their role in restricting viral replication / movement may lead to better understanding of viral pathogenesis in plants. Certainly, this will be an avenue of research with good plant / begomovirus models.

• Development of highly infectious constructs can be exploited for screening large number of chilli germplasms for identification of resistant sources for genetic improvement of this important crop.

3

13. Project Summary (Not to exceed one page. Please use separate sheet). Geminiviruses are single-stranded DNA viruses that infect important crops worldwide, often occurring as mixed infections in the field. Whitefly (Bemisia tabaci Genn.) transmitted geminiviruses (WTGs) categorized as begomoviruses are reported since long in India. They cause enormous economic losses in several crops (like tomato, chilli, cotton, pulses, papaya, cucurbits, okra etc.) in the tropics, which provide ideal conditions for the perpetuation of viruses and the insect-vector. Intensive agricultural practices necessitated by the ever-increasing demands of rapidly growing population and the introduction of new genotypes, cropping pattern and crops have further aggravated the situation.

Chilli (Capsicum annuum), a member of the family Solanaceae is an important spice cum vegetable crop cultivated in tropical and sub-tropical countries. India is the only country in the world to have different varieties with rich quality factors. India is the largest producer (25% to total world production) and the largest consumer and exporter of chili today. However, the productivity is much below the world average productivity. During 2008-09, chilli production has been reduced by 30 per cent than earlier years. Among the diseases caused by pathogens, chilli leaf curl disease (ChLCD) is the most severe problem of chilli throughout the country and may result up to 100% loss under epidemic condition. We shall focus on ChLCD, since the leaf curl disease is evolving at a very fast rate and might assume an epidemic nature in not-so-distant future.

Although, chilli leaf curl etiology has been established long back in this country, detailed molecular characterization of the causal virus(es) has been carried out recently in our laboratory (under the recently completed DBT funded project on “Molecular diversity of begomoviruses causing chilli leaf curl disease and identification of virulence factors”) (paper is communicated to Journal of General Virology). We have identified 10 distinct species of chilli-infecting begomoviruses. Our study has suggested the prevalence of Chilli leaf curl Multan virus throughout India and infectious clone of this species is available in our laboratory. We have demonstrated Koch’s postulates of Chilli leaf curl Multan virus for the first time. We have also standardized agroinoculation technique for inoculation of chilli-infecting begomoviruses. Few chilli varieties are reported to be resistant to chilli leaf curl virus, although the mechanism of natural resistance is not understood yet. It is important to understand the mechanism of natural resistance so as to formulate better strategies against this virus.

Keeping this in view, I propose to identify the host factor(s) conferring natural resistance to chilli leaf curl virus. Information generated will also reveal a clear perspective on host plant resistance against begomoviruses. Also the project will aim for understanding host-virus interaction and identification of R genes. Highly infectious ChiLCV construct will be developed for inoculation into chilli plant. Development of ChiLCV based vector shall be useful for deciphering role of unknown host genes in the future.

4

PART II : PARTICULARS OF INVESTIGATORS Principal Investigator : 14. Name : Dr. Supriya Chakraborty

Date of Birth : December 13, 1969 Sex(M/F) : M

Indicate whether Principal Investigator/Co-Investigator : Principal Investigator

Designation : Associate Professor

Department :. School of Life Sciences

Institute/University : Jawaharlal Nehru University

Address :. School of Life Sciences, JNU, New Delhi - 110067

PIN : 110067

Telephone : 2670 4153 (O); 9868628684 (M) Telex : Fax: 2674 2558

e-mail : supriyachakrasls@yahoo.com; supriyachakra@sify.com

No. of Projects being handled at present :. 02 Co-Investigator 15. Name : .........not applicable

Date of Birth : not applicable Sex (M/F) : .. not applicable............

Indicate whether Principal Investigator/Co-Investigator : not applicable

Designation : not applicable

Department : not applicable..........................

Institute/University: not applicable

Address not applicable

Telephone : ………….. Telex : .............................. Fax:.........

e-mail : not applicable

No. of Projects being handled at present : ……………………………….

Co-Investigator 16. Name : ........ not applicable .....................................……………...........

Date of Birth : . not applicable.......... Sex(M/F) : .. not applicable...................

Indicate whether Principal Investigator/Co-Investigator : ..... not applicable ....

Designation : ..... not applicable......................

Department :........not applicable................................................…………..

Institute/University : ……..not applicable .........................................................................

Address : ………….... not applicable .........................................................................

PIN : ..............….........Telephone : .................…......... Telex : ...………...................... Fax ..............…......... e-mail : ………………………………............................ No. of Projects being handled at present : .............................................................................

Note : Use separate page, if more investigators are involved

5

Part III : TECHNICAL DETAILS OF THE PROJECT 16. Introduction 16.1 Origin of the proposal Geminiviruses are a group of plant viruses characterized by circular, single-stranded (ss) DNA genomes (~2.7 kb size) and twinned icosahedral virions (18 x 30 nm) (Stanley, 1983). Based on genome organization, host range and insect-vector, geminiviruses are divided into four genera: Mastrevirus, Curtovirus, Topocuvirus and Begomovirus (Stanley et al., 2005). Begomoviruses are transmitted by whiteflies (Bemisia tabaci Gennadius) and usually possess a bipartite genome of two DNA components approximately 2.7 kb in size, designated as DNA-A and DNA-B (Stanley et al., 2005). Monopartite begomoviruses are also known to occur (Czosnek et al., 1988; Kheyr-Pour et al., 1991; Dry et al., 1993; Muniyappa et al., 2000; Chatchawankanphanich and Maxwell, 2002; Chakraborty et al., 2003a, b; Chatttopadhyay et al., 2008). DNA-A encodes six proteins: AV1, the coat protein (CP); AV2, the pre-coat protein; AC1, the essential viral replication associated protein (Rep) (Laufs et al., 1995); AC2, transcriptional activator (TrAP) of viral sense AV1 and BV1 ORFs (Sunter and Bisaro, 1991, 1992); AC3, replicational enhancer (REn) which enhances the efficiency of viral replication (Sunter et al., 1990) and AC4, which is putatively responsible for symptom expression (Wezel et al., 2002). Out of these six proteins only the Rep is really indispensable for replication (Hanley-Bowdoin et al., 1999). DNA-B encodes two movement proteins, BV1 and BC1 required for local cell-to-cell movement of the virus and long distance movement through the phloem (Sanderfoot and Lazarowitz, 1996). The genes on each genomic component are transcribed in opposite direction from a ~200 nucleotides common region (CR) with high sequence identity (90-100%). The CR contains promoters and sequence elements required for DNA replication and transcription (Eagle et al., 1994; Laufs et al., 1995; Chatterji et al., 1999, 2000, 2001).

Satellite DNA β is found associated in economically important diseases like chilli leaf curl, cotton leaf curl, bhindi yellow vein and tomato leaf curl disease. There are four conserved features in all the β DNA isolated so far. They are (1) a predicted stem / loop sequence TAATATTAC/G like the origin of replication of begomoviruses (2) a region of high sequence similarity referred to as satellite conserved region (SCR) (3) An adenine ‘A’ rich region ~400nt upstream of SCR. (4) one positionally conserved open reading frame βCl which is variable and is a strong suppressor of post transcription gene silencing. The exact role of DNA β in the pathogenesis is yet to be elucidated. Their involvement in symptom production and viral nucleic acid accumulation has been established in the case of cotton leaf curl and Ageratum yellow vein mosaic disease. The satellite DNA β also interferes with host defense system either acting as suppressor of post transcription gene silencing or interfering with resistance genes. DNA β helps in diversification of host range as was shown in the case of Sri Lankan cassava mosaic virus molecules have co-evolved with their cognate helper viruses and undergoes recombination. Considering the important role, β DNA plays as

6

pathogenicity determinant and the ubiquitous association of it with begomoviruses in India. We have identified four distinct species of chilli leaf curl betasatellite in India (Chakraborty et al., 2009; 2010). ChiLCB is responsible for increasing DNA accumulation of helper begomoviruses.

Geminiviruses replicate via a rolling-circle mechanism analogous to the replication of bacteriophages with ssDNA genomes. The incoming geminivirus ssDNA is converted by host enzymes to double stranded DNA (dsDNA), which in turn serves as a template for the transcription of early, replication associated genes on the complementary strand. The Rep protein binds to the direct repeat sequence (iterons) in the viral replication origin and induces nicking in the stem-loop of the origin for initiation of DNA replication.

During the last two decades, several whitefly-associated diseases have caused enormous losses in several agricultural and horticultural crops including vegetable crops in the world. The symptoms commonly associated with these diseases are foliar distortion (curling, crumpling, rugosity, yellowing and mosaic pattern), over all stunting of the plants and dramatic decreases in expected yield. The losses are greater in the tropics and semi-tropics, which provided ideal condition for the perpetuation of vector, whiteflies.

Whitefly-transmitted geminiviruses of the genus Begomovirus have long been recognized as serious pathogens of vegetable and fiber crops in the subtropical and tropical agro-ecosystems and have, for many years, caused both economic and socio-economic problems (Brown et al., 1999; Varma and Malathi, 2003). Until the last decade, these epidemics were relatively localized but now they are wide spread. Despite concerted efforts to contain begomoviruses and their vectors, menacing disease epidemics caused by newly emerging or re-emerging begomoviruses are becoming frequent and appearing even in new regions, previously free from such diseases.

Major contributory factors for the emergence and spread of new geminivirus diseases are the evolution of variants of the viruses, the appearance of polyphagous whitefly B biotype and increase in the vector population. Variability in begomoviruses has arisen through mutation, recombination and pseudorecombination. Genomic recombination in geminiviruses, not only between the variants of the same virus but also between species and even between genera, has resulted in rapid diversification. From the disease point of view, most virulent variants have developed through recombination of viral genomes such as those associated with cassava, cotton, tomato and beans. In monopartite begomoviruses, variation and severity of begomoviruses was further complicated due to presence of species non-specific novel satellite DNA molecules, provided unlimited evolutionary possibilities for the emergence of new disease problems.

7

Leaf curl disease of chilli is a very severe problem in India where the causal virus causes considerable losses. Under severe epiphytotic conditions the infected plants do not bear any fruit thus resulting cent per cent losses under natural conditions. The characteristic field symptoms are upward curling, puckering and reduced size of leaves. Severely affected plants are stunted and produced no fruit. The virus is transmitted by whitefly under field condition. Electron microscopic examination of field samples revealed few, typical geminate particles.

Although, chilli leaf curl etiology has been established long back in this country, detailed molecular characterization of the causal virus(es) has been carried out recently in our laboratory (under the DBT funded project on ,"Molecular diversity of begomoviruses causing chilli leaf curl disease and identification of virulence factors”; completed recently) (Chakraborty et al., 2009; 2010). We have cloned full-length genomes of DNA-A, DNA-B and satellite DNA-βs of 30 chilli-infecting begomovirus isolates from several major chilli growing regions of the country. Based on phylogenetic analyses of the DNA-As, we have identified association of 10 distinct species of begomoviruses viz., Chilli leaf curl Multan virus (ChiLCV-Mul), Chilli leaf curl India virus (ChiLCV-In), Pepper leaf curl Bangladesh virus (PepLCBDV), Tomato leaf curl Joydebpur virus (ToLCJoV), Tomato leaf curl New Delhi virus, Tomato leaf curl Gujarat virus (ToLCGV), Tomato leaf curl Karnataka virus including two new species reported in this study. Out of these, four begomovirus species viz., Chilli leaf curl Multan virus, Chilli leaf curl India virus, Pepper leaf curl Bangladesh virus and Tomato leaf curl Joydebpur virus are the predominant ones associated with ChiLCD throughout the country, not being restricted to any particular geographical area. Occurrence of DNA-B and satellite DNA-βs were also found to be associated with the disease in some cases. Mixed infection of genomic components of ChiLCV-Mul & ToLCNDV (in New Delhi), ToLCJoV & PepLCBDV (in Ghazipur), and ToLCJoV & ToLCGV (in Kolkata) were found to be associated with this disease (Chakraborty et al., 2009, 2010). Our research has shown that leaf curl disease of chilli may be due to association of more than one virus (Chakraborty et al., 2003; 2009; 2010).

Symptom caused by ChiLCV depends upon virus strain / species, environmental condition and plant age. Curling of leaves is most characteristics and common symptom. Leaves of some cultivar remain smaller, curled and distorted. Disease symptoms are most obvious on smaller and younger leaves. Young infected plants become stunted and deformed. Most of their flowers drop before fruit formation, if fruit produced remains distorted. This devastating disease has been spread and reported from almost all geographical part of the India. Leaf curl disease of chillies is so serious that they have eliminated the ability of small farmers to cultivate chillies in several major production areas, especially during peak of whitefly infestation season.

Many effort and strategies have been carried out to control this disease but all of them are either failed or insufficient. However, resistant sources against chilli leaf curl virus have been identified viz., GKC-29, BS-35, EC-49763 (Kumar et al., 2006). In addition, chilli varieties like Punjab lal and Kalyanpur Chanchal are also reported to be resistant to the virus. These

8

varieties are being used by the plant breeders as sources of resistance to ChiLCV. However, the mechanism of natural resistance in these chilli varieties is still to be revealed.

In plant, resistance mechanism are categorised into two types - (1) Dominant Resistance - It is the result of gene for gene interaction which involve allele specific genetic interaction between a host R gene and a pathogen avirulence (Avr) gene and eventually activates defence response involving hypersensitive reaction (2) Recessive resistance - The incompatible interactions between viruses and plants controlled by most recessive genes differ from dominant R-gene-related mechanisms in that they use a passive mechanism. Instead of leading to a defence response such as the hypersensitive response, most recessive mutations that render hosts non- permissive to viral infection affect specific cellular factors required by the virus to complete its life cycle. This loss-of-susceptibility conferred by the lack of such factors or the production of their mutated form has been demonstrated for several viruses, but only a limited number of host factors so far have been identified.

Although viruses are simple biological entities, with DNA or RNA encoding genetic information that is required for their multiplication in host cells, the mechanisms by which viruses invade cells and subvert sub-cellular machinery and how plants defend themselves from viral infection are in general poorly understood. As a result, viruses continue to be a major threat to farmers and reduce both the quantity and the quality of crops including chillies.

16.2 Rationale of the study proposed With the rapidly increasing Indian population and yield saturation of several important crops, the major challenge ahead is to grow more food for providing nutritional security to human being. Horticultural crops occupy 6.7 per cent of gross cropped area of India. This sector contributes 18 per cent of gross value of agricultural output and 52 per cent of export earnings in Agriculture. In the current scenario, considering the significance of diversification, vegetables play a protective role in the nutritional especially for rural population. Vegetable crop like chilli is rich sources of minerals, vitamins, micronutrients and antioxidants essential for healthy life. The current status of vegetable production is approximately 90 million tons in 6.2 million ha, being second in the world after China. However, there is further need to produce at least 110 million tons vegetables to provide minimum requirement of vegetables as per balance diet.

Chilli (Capsicum annuum), a member of the family Solanaceae is an important spice crop cultivated in tropical and sub-tropical countries. It is also called as the nature’s wonder. India is the only country in world to have different varieties with rich quality factors. There are two important commercial qualities; some varieties are famous for red colour because of the pigment capsanthin and others are known for biting pungency attributed by capsaicin. Its fruit appears in different sizes, shapes and colour. India is the largest consumer and exporter of

9

chili peppers today. Exporting over 51,900 tons of chili peppers annually, India also exports chili oleoresin (a combination of oil and resin), powder, and crushed chili peppers. Spices oils and oleoresins are exported to the US, EU, Australia and Japan, while the exports of chilli is mainly to the US, Sri Lanka, Bangladesh, West Asia and the Far-East. The top growing states for chili peppers in India are Andra Pradesh, Orissa, Mahrashtra, West Bengal, Tamil Nadu, and Rajasthan. The major producers of chilli in the country are Andhra Pradesh (49 per cent), Karnataka (15 per cent) Orissa (8 per cent), Maharashtra (6 per cent), West Bengal (5 per cent), Rajasthan (4 per cent) and Tamil Nadu (3 per cent) while rest 10% of the production is shared by other chilli growing states of the country. United States of America is the major importer of Chillies from India which contributes 24% to the total exports from India. India is the major exporter in the world market and the total export of chillies from India is on an average only 4% of total production. In all, India produces close to 8 million tons of dry chili pepper a year. Although Mexico is also the leading source for imported chilli pepper spices, accounting for $25 million of the total in 2005, India is also important sources for dried and dehydrated chilli products (Vegetables and Melons Outlook, Economic Research Service, USDA VGS-313/ 2006). India ranks first in world in chilli production but the productivity is much below the world average productivity. During 2009, chilli production in India has been reduced by 30 per cent than 2008 (FAO, 2009).

Huge fluctuations in Indian exports are mainly due to increased domestic demand and uneven production interrupted by biotic and abiotic stresses. In India, chilli crop is attacked by a number of pathogens, including viruses, bacteria and fungi. Within each group of pathogens, there are several species and strains, which damage the crop with varying degrees. For example, chilli-infecting viruses could be classified as several species of chilli leaf curl virus (ChiLCVs), chilli vein mottle virus (CVMV) etc., besides others for which chilli is not a natural host. Among the viral diseases, chilli leaf curl disease (ChiLCD) is the most severe problem of chillies throughout the country and may result up to 100% loss under epidemic condition. We shall focus on ChiLCD, since the leaf curl disease is evolving at a very fast rate and might assume an epidemic nature in not-so-distant future.

Chilli leaf curl disease (ChiLCD) occurs in many chilli-producing regions of the world, including India and is considered as one of the major constraints in cultivation of this crop (Kumar and Rai, 2006; Chattopadhyay et al., 2008). Leaf curl disease of chilli is a very severe problem in India causing considerable losses. Under severe epiphytotic conditions the infected plants do not bear any fruit thus resulting cent percent losses under natural conditions. Although, chilli leaf curl etiology has been established long back in this country, detailed molecular characterization of the causal virus has been done recently. Chilli leaf curl virus (ChiLCV) is widespread throughout the entire country and can not be controlled. Full-length infectious clones of begomoviruses causing leaf curl disease of chilli have been developed and for the first time, Koch’s postulates of any ChiLCV have been demonstrated in the world (Chattopadhyay et al., 2008).

Although2009; 20machinerunderstoothe quandevastati

Genetic rthan a ceand plandevelop genes identifiedconventiodominantresistanceMonogento precisand reliinteractio(R) gene(Avr) genincompatcell deatknowledgmolecula2005). ACucurbitthe R genmost of 2005). Inby basal

Dominan

Dominanalthough predictedeight clanucleotidR genes coil dom

h characteriz010), the mery, and howod. As a res

ntity and theng and caus

resistance reentury it has nt breeding disease resfor resistad. The onal breedint monogene genes nic resistancse host–pathes on alle

ons betweene and a pane (Baker etible plant–vth, termed ge of molear biology haA majority otaceae and Lnes isolated the genes th

n the absencor innate de

nt Resistanc

nt resistancethe molecul

d protein strasses (Martinde binding sican be furth

main or a Toll

zation of Chechanisms bw chilli plasult, ChiLCVe quality ofe 100% loss

emains the prbeen knownhas been u

istant cropsance have

successesng generally nic or po

(Fraser, ce is usually hogen relatiele-specific n a host reathogen avit al., 1997).virus interacas the ‘‘hy

ecular eventas led so farof the studiLeguminosaetill date shohat control e of specificfense respon

ce

against plalar processesructural domn et al., 200ite (NBS) anher divided ol-interleukin

hiLCVs havy which theants defendVs continue f crops. Fors, if infected

referred metn that plant rused to s, when

been s of rely on

olygenic 1990). limited

ionships genetic

sistance irulence . The strongction is freqypersensitives that unde

r to the identes of disease families anw monogenbacterial an

c host–pathonses.

ant viruses iss that trigger

mains, curren03). The largnd C-terminaon the basis n 1 homology

e been carriese viruses id themselves

to be a majr example, bat an early s

thod to proteresistance to

g defense requently accoe response’erlie gene-totification of se resistancnd several fric inheritanc

nd fungal paogen interact

s often assor the HR arently known gest class isal leucine-ricof N-terminy region dom

ied out in dinvade cells s from virajor threat to begomovirustage of plan

ect crop plano disease can

sponse that mpanied by’ (HR) (Ba

o-gene interover 220 vie involve p

from the Poace and 50% athogens aretions, virus i

ciated with e not well undominant R characterizch repeats (L

nal domains, main (Belkh

detail (Chakrand subver

al infection farmers and

ses infectingnt growth.

nts from virun be genetica

results fromy localized haker et al.,ractions andirus R genesplants in theaceae. Moreare dominane dominant infections m

HR (Baker nderstood. OR genes are ed by a cen

LRR) of diff which cons

hadir et al., 2

raborty et alrt sub-cellula

are not yd reduce botg chillies ar

uses. For morally inherite

m this type ohypersensitiv, 1997). Oud progress is (Kang et ale Solanaceae than 80% ont; in contras(Kang et al

may be limite

et al., 1997On the basis o

grouped intntrally locateferent lengthsist of either 2004). Amon

l., ar et th re

re d,

of ve ur in l.,

ae, of st, l., ed

7), of to ed hs. r a ng

11

the dominant plant virus R genes, approximately 10 genes have been isolated and sequenced. Interestingly, all reported dominant R genes that provide resistance to plant viruses fall in the NBS-LRR class. Resistance imparted by dominant Sw-5 gene to tomato spotted wilt virus (TSWV) has been introgressed in tomato (Solanum esculentum) from S. peruvianum and provides a broad spectrum and stable resistance against TSWV (Rosello et al., 1998).

Recessive Resistance

Along with dominant R genes, studies on plant resistance to viruses have led to the identification of several recessive R genes that are used to protect crops (Diaz-Pendon et al., 2005) against begomoviruses, cucomoviruses, luteoviruses, potyviruses, and tobamoviruses. Recessive R genes mostly work at the single cell level or they affect cell-to-cell movement (Kang et al., 2005). Absence of recessive R genes or mutation in them makes hosts non-permissive for infection and is called passive resistance (Fraser, 1990). This ‘‘loss of susceptibility,’’ conferred by such mutations, has been demonstrated for several viruses, but a limited number of host factors have thus far been identified (Diaz-Pendon et al., 2005). Studies on recessive genes to date have focused largely on viruses in the Potyviridae family. Mutations in Arabidopsis and a host of other viruses such as the beet curly top virus (BCTV), cucumber mosaic virus (CMV), tobacco etch virus (TEV), tobacco mosaic virus (TMV), tomato golden mosaic virus (TGMV), and others have led to the identification of many recessive R genes. The translation initiation factor eIF4E has been identified as a recessive resistance factor in pepper (pvr1=2), lettuce (mo1), and pea (sbm1) (Kang et al., 2005), and has been implicated in barley as candidate for rym4=5. eIF4E and its isoform eIF (iso) 4E confer resistance against the potyviruses TEV, potato virus Y, and pepper mottle virus (PepMoV) infection in Arabidopsis and pepper. Mechanisms of resistance to potyviruses, conferred by mutations in eIF4E, are not clear but mutations in eIF4 are located around the cap-binding pocket of the protein and they interfere with virus encoded replicase protein and result in the inhibition of viral accumulation and movement in plants (Kang et al., 2005).

Other examples of virus resistance have been identified but mechanisms of action of R genes remain undetermined Albar et al. (2003). Although natural virus resistance genes have been used extensively to develop crop plants that have resistance to viruses, the transfer of resistance characters from a wild plant species or a nonadapted variety to a useful crop is a lengthy and difficult process. In many instances, important agronomic and organoleptic qualities of crop plants are lost during the process of plant breeding; in other cases, sources of resistance to specific genes were not found.

12

The early output of research work on resistant gene helped to find out some genes which confer resistant to plant viruses except geminiviruses. Very little information has been reported regarding geminivirus resistant gene.

Keeping these information in view, it is necessary to identify the host factor(s) conferring resistance in chilli against ChiLCVs. Role of the identified host factors in relation to ChiLCV resistance needs to be understood in detail.

16.3 Hypothesis

• Highly infectious construct of ChiLCV can be developed. • Agroinoculation with infectious construct may be useful for screening chilli

germplasm for identification of resistant sources. • Resistance in chilli is governed by host encoded factors. • Resistant factor(s) can be isolated from chilli plant. • Role of the host factor(s) in governing resistance can be elucidated.

16.4 Key questions

• Whether it is possible to develop highly infectious tandem repeat construct of ChiLCV ?

• Whether highly infectious construct is useful for screening of chilli germplasms? • How known chilli varieties (both susceptible and resistant) will perform following

agroinoculation with cloned DNAs? • Whether differential gene expression can be observed on resistant varieties as

compared to susceptible one? • Whether it is possible to identify resistance factor in chilli? • Whether the mechanism of natural resistance can be elucidated?

16.5 Current status of research and development

A. International status

Various DNA viruses are known to cause severe infectious diseases in both plants and mammals, including humans (Knipe and Howley, 2001). For many of these infectious diseases, we have yet to find an effective prevention or treatment. Hence, it is essential to develop an alternative resistance strategy that confers broad-based, stable immunity to geminivirus infection. Under natural conditions, mixed virus infections in a single plant, possess biological and epidemiological implications which lead to either synergistic interaction or pseudorecombination between two distinct viruses.

In the last 25 years, significant progress has been made in the study of plant viruses, in terms of understanding their structure, movement in and between plants, and interactions with their

13

hosts. This has been supplemented with a wealth of information generated by genomic studies and the description of more than 220 virus resistant genes. Among the dominant plant virus R genes, approximately 10 genes have been isolated and sequenced. Interestingly, all reported dominant R genes that provide resistance to plant viruses fall in the NBS-LRR class. Resistance imparted by dominant Sw-5 gene to tomato spotted wilt virus (TSWV) has been introgressed in tomato (Solanum esculentum) from S. peruvianum and provides a broad spectrum and stable resistance against TSWV (Rosello et al., 1998). A classic model system for plant-virus interaction was demonstrated where N gene (isolated from N. glutinosa) when introduced into tobacco confer resistance against TMV (Holmes 1938; Steve et al., 1996). Similarly, role of Rx1 in mediating resistance in potato against Potato virus X has been elucidated (Kohm et al., 1993).

Studies on recessive genes to date have focused largely on viruses in the Potyviridae family from plants like Arabidopsis, lettuce, pea, pepper. The translation initiation factor eIF4E has been identified as a recessive resistance factor in pepper (pvr1=2), lettuce (mo1), and pea (sbm1) (Kang et al., 2005). Mechanisms of resistance to potyviruses, conferred by mutations in eIF4E, are not clear but mutations in eIF4 are located around the cap-binding pocket of the protein and they interfere with virus encoded replicase protein and result in the inhibition of viral accumulation and movement in plants (Kang et al., 2005).

Researches for identification of resistant factor(s) against geminiviruses still lies in it’s infancy. A Recessive Allele (tgr-1) conditioning tomato resistance to TYLCV infection was found to be associated with impaired viral movement (Bian et al., 2007). Tomato yellow leaf curl virus (TYLCV) infection of a resistant tomato line with a silenced sucrose transporter gene LeHT1 resulted in inhibition of growth, enhanced virus spread, and necrosis (Eybishtz et al., 2010). Recovery of symptom expression in pepper against Pepper golden mosaic virus have been attributed to complementary action of transcriptional and post transcriptional gene silencing (Rodriguez et al., 2009). But information on mechanism of natural resistance of chillli against ChiLCV is not available.

B. National status

Although pepper leaf curl etiology has been established long back in the country (Mishra et al., 1963; Dhanraj and Seth, 1968), detailed molecular characterization of the causal virus(es) has been carried out recently in our laboratory. We have cloned full-length genomes of DNA-A, DNA-B and satellite DNA-βs of 30 chilli-infecting begomovirus isolates from several major chilli growing regions of the country. Based on phylogenetic analyses of the DNA-As, we have identified association of 10 distinct species of begomoviruses viz., Chilli leaf curl Multan virus (ChiLCV-Mul), Chilli leaf curl India virus (ChiLCV-In), Pepper leaf curl Bangladesh virus (PepLCBDV), Tomato leaf curl Joydebpur virus (ToLCJoV), Tomato leaf curl New Delhi virus, Tomato leaf curl Gujarat virus (ToLCGV), Tomato leaf curl Karnataka virus including two new species (Chakraborty et al., 2003a,b; 2009, 2010).

14

Recently, we have demonstrated that tomato cultivar tolerant to Tomato leaf curl New Delhi virus infection induces virus specific short interfering RNA accumulation and defense associated host gene expression (Sahu et al., 2010).

However, in none of the Indian laboratory detailed research on molecular identification of resistant factor(s) of chilli infecting begomoviruses being carried out and mechanism of natural resistance is being investigated.

16.6 The relevance and expected outcome of the proposed study

A. Relevance of the proposed study in the context of current research

Geminiviruses are ssDNA viruses that infect important crops worldwide, often occurring as mixed infections in the field (Varma and Malathi, 2004; Pita et al., 2001). In India, they cause significant losses in crops like chillies, tomato, cotton, pulses, papaya, cucurbits, okra etc.

Chilli pepper is one of the most important vegetable crops in India on which livelihood of many small marginal farmers depend. Leaf curl disease of chilli papper (ChiLCD) is the most severe disease of this crop in India, resulting in losses upto 100% under epidemic condition. Although, some of the varieties are known to be resistant to ChiLCV, no systemic study has been carried out to identify the host factor(s) conferring natural resistance. Identification of host factor(s) conferring resistance against ChiLCV occurring in India will certainly help in formulating better strategies against this virus. At the end of this research, we expect to identify chilli lines resistant to begomoviruses infecting chilli, suitable for the Indian market through Agrbocterium mediated inoculation of cloned DNAs. Identified resistant lines can be recommended for cultivation as such or can be used as resistant donor for genetic improvement of these crops. Highly infectious viral clones will be helpful for screening of large number of germplasms for their resistance. The identified host factor may be useful developing transgenic chilli with resistance to ChiLCVs. The advantages of such a cultivar over the currently used varieties are multiple: 1. There will be no need to spray of cover the plants. 2. Because begomoviruses are spreading rapidly, worldwide, resistant cultivar may be suitable for other regions of the country or even for other countries where ChiLCV is a serious problem. 3. Commercial advantages are obvious. As geminiviruses evolves through mutation, it is necessary to identify as many resistant sources as possible.

Knowledge gathered on variability of Chilli leaf curl virus isolates will be important to determine their effect on existing resistance genes. This study will help in development of virus resistant varieties to different strains of country or region specific resistance to particular strain. The project will lead to better understanding of host virus interaction using ChiLCuV and chilli as a model.

It is clear that the discovery of R gene(s) will have a profound impact both on the understanding of the plant–virus interactions and on the control of plant viruses. Further

15

exploitation of this wealth of knowledge is essential to improve the efficiency and the durability of each disease resistance strategy, and to develop additional strategies to cope with the emergence of resistance-breaking viruses.

Expected out come :-

• Identification of host factors governing resistance will provide us to develop better strategies for management of Chilli leaf curl virus. This study will be useful for identification of R genes from chilli.

• Identification of resistant factors and elucidation of their role in restricting viral replication / movement may lead to better understanding of viral pathogenesis in plants. Certainly, this will be an avenue of research with good plant / begomovirus models.

16.7 Preliminary work done so far

We have studied in detail about the molecular diversity among the chilli-infecting begomoviruses in our country. We have cloned full-length genomes of DNA-A, DNA-B and satellite DNA-βs of 30 chilli-infecting begomovirus isolates from several major chilli growing regions of the country. Recently, we have demonstrated that tomato cultivar tolerant to Tomato leaf curl New Delhi virus infection induces virus specific short interfering RNA accumulation and defense associated host gene expression (Sahu et al., 2010). We have standardized the methodologies required to carry out the proposed study. Efforts are in progress to develop highly infectious construct so that not a single plant can escape infection.

17. Specific objectives

• To develop highly infectious clone of Chilli leaf curl virus (ChiLCV)

Highly infectious clone of the ChiLCV will be developed by introducing tandem repeat of ChiLCV DNA A and satellite DNA β in a single vector (pCAMBIA2300). After confirmation of the clone by digestion, PCR and its mobilization into Agrobacterium, its infectivity will be analyzed in N. benthamiana.

Variable indicator of progress:- highly infectious clone of ChiLCV A and betasatellite.

• Screening of resistant chilli variety

Infectious clone will be inoculated on different chilli variety in order to screen the resistant variety. PCR, semi quantitative PCR, southern blotting will be carried out for screening process.

Variable indicator of progress:- identification of resistant variety.

• To identify host factor(s) responsible for resistance against ChiLCV

16

Suppressive subtractive hybridization will be carried out in order to find host factor(s) which may involve in mechanism of résistance. Transcripts from SSH will be cloned, sequenced and annotated. Relative level of accumulation of these transcripts shall be studied on both resistant and susceptible cultivars.

Variable indicator of progress:- differentially expressed chilli transcripts shall be generated.

• To decipher role of host factors providing natural resistance against ChiLCV

Virus Induced gene silencing vectors shall be used to down regulate expression of selected host genes and effect on viral replication will be studied. Efforts will also be made to identify viral protein interacting with the host factor.

Variable indicator of progress:- Role of the transcript in governing resistance shall be elucidated.

18. Work plan:-

18.1 Work plan (Methodology / experimental design to accomplish the stated aim)

Construction of highly infectious tandem repeat DNAs of ChiLCV

Partial tandem repeats of genomic DNAs of ChiLCV (GenBank accession no. EF190215) will be made in a single T-DNA derrivative plant transformation vector like pCAMBIA2300 (Chakraborty et al., 2003b; Chattopadhyay et al., 2008). The orientations of partial tandem repeats will be confirmed by restriction of digestion with appropriate enzymes. All the tandem repeat constructs will be confirmed by appropriate restriction analysis followed by hybridization with specific probes.

Screening of chilli genotypes as potential source for resistance in breeding programs

Commercial hybrids and cultivars, local accessions or hybrids developed by different Institutions (like IIVR) or State Agricultural Universities like BCKV etc. will be tested in the greenhouse. These lines will also be agroinoculated using partial tandem repeats of ChiLCV clones. Plants will be examined regularly for disease symptoms. Leaves from artificially inoculated chilli plants will be analyzed for virus presence. The selected promising lines identified as resistant to ChiLCV through whitefly inoculation will be challenged using cloned DNAs in order to identify varieties / germplasms which are real resistant to ChiLCV DNAs in order to test the non-preference of whiteflies.

DNA isolation

Total DNA will be extracted from the youngest newly emerging leaves of the test plants (chilli genotypes) at different dpi as described by Dellaporta et al. (1983).

PCR detection of ChiLCV

Total DNA, extracted from test plants will be subjected to PCR amplification. ChiLCV specific primer will be used for detection according to Chattopadhyay et al. (2008). The PCR conditions for amplification in both cases will be an initial strand separation at 94°C for 2 min and then 30 cycles of 1 min at 94°c, 1 min at 55°C and 1 min at 72°C, followed by a

17

final extension period of 10 min at 72°C (the conditions may be modified if required). PCR products will be resolved on 1.2% agarose gel previously stained with ethidium bromide.

Electrophoresis and Southern blot analysis of plants inoculated with cloned DNAs

Total DNA (4 µg) will be fractionated on a 1.2% agarose gel without ethidium bromide and transferred to Hybond N+ membranes (Amersham Inc.). Viral DNA will be detected by hybridizing blots separately using specific radiolabelled probes of ChiLCV as required for the experiment. The probes were labelled with [32p] CTP using random oligonucleotide primed synthesis (Feinberg and Vogelstein, 1984). Viral DNA levels will be quantified by using a Phosphorimager Image analysis system.

Subtractive Hybridization

Fifteen days old chilli plants resistant – [either of BS35, Kalyanpur chanchal, Punjab lal,] as well as susceptible [Kashi Anmol) will be challenged with Chilli leaf curl virus and subtractive hybridization will be carried out according to Sahu et al (2010). Frozen leaves will be ground in liquid nitrogen and total RNA will be isolated using TRIzol reagent (Sigma) according to the manufacturer’s instructions. RNA integrity will be examined by electrophoresing samples on denaturing formaldehyde–1.2% agarose– ethyl bromide gel. The quantity and quality of isolated total RNA will be examined spectrophotometrically. Messenger RNA (mRNA) will be purified from total RNA using the MagneSphere mRNA Purification Kit (Promega, Madison, USA) according to the manufacturer’s protocol. A forward subtraction will be performed between 21-day-old ChiLCV-infected BS-35 as tester and mock-infected BS-35 (with Agrobacterium harbouring vector pCAMBIA2301 only) as driver. Purified mRNA (2 mg) will be used for reverse transcription and first-strand cDNA thus prepared will be used for SSH with the Clontech PCR Select-cDNA Subtraction kit (BD Biosciences, Clontech, CA, USA). In brief, driver and tester cDNAs will be RsaI digested, extracted with phenol–chloroform, ethanol precipitated and resuspended in water. Tester cDNA will be split into two pools and each will be ligated to a different adapter (provided with the cDNA subtraction kit). Unsubtracted tester control cDNA will be ligated to both adapters. Two rounds of hybridization and PCR amplification were carried out to normalize and enrich the differentially expressed cDNAs according to the manufacturer’s protocol, with the following changes: the primary PCR will be performed for 30 cycles (94 °C, 30 s; 65 °C, 30 s; 72 °C, 90 s) and the secondary PCR will be performed for 16 cycles (94 °C, 30 s; 66 °C, 30 s; 72 °C, 90 s). Products of the secondary PCR were purified and cloned into pGEMTeasy vector (Promega) and transformed into DH5a Escherichia coli competent cells.

DNA sequencing and data analysis

Sequences of the recombinant plasmids will be determined with an automated sequencer (ABI Sequencer, Version No.3770, Applied Biosystems, USA) using M13 forward and reverse primers. Nucleotides and translated sequences will be compared with nonredundant sequences of the GENBANK database using the BLAST sequence alignment program (Altschul et al., 1997). ESTs of more than 100 nucleotides in length and an E-value of less than 1E-05 will be considered to be significant. Further functional classification will be performed according to the MIPS data base (http://mips.helmholtz-uenchen.de/proj/funcatDB/search_main_frame.html).

Reverse Northern hybridization

Reverse Northern hybridization will be carried out according to Sahu et al (2010). Individual clones of the subtracted cDNA library will be amplified in a 96-well PCR plate using M13 forward and reverse primers in a 50-mL reaction at an annealing temperature of 60°C for 30 cycles. The products will be analysed on agarose gel to confirm the insert size, quality and

18

quantity. Purified PCR products will be denatured by adding an equal volume of 0.6 M sodium hydroxide.

An equal volume of each denatured PCR product (about 100 ng) of above 300 bp in size will be spotted onto two Hybond N+ membranes (Amersham Bioscience) using a BIO-DOT dot-blot apparatus (Bio-Rad) in 96-well formats to prepare two identical arrays. In addition, a PCR product of a-tubulin cDNA (produced using primer sequences 5′-GGTACTGGTCTTCAAGGTTTC-3′ and 5′-TTGTCATAGATAGCCTCATTGT-3′) will be spotted as internal control to normalize the signals of two different blots corresponding to ToLCNDV-treated and mock-treated samples. A PCR product of the neomycin phosphotransferase II (NPTII) gene from the vector pCAMBIA1305.1 using primer sequences (5′-TTTTCTCCCAATCAGGCTTG-3′ and 5′-TCAGGCTCTTTCACTCCATC-3′) will be also spotted as a negative control to subtract the background noise. The membranes were neutralized with neutralization buffer (0.5 M Tris-Cl, pH 7.4, 1.5 M NaCl) for 3 min, will behed with 2% standard saline citrate (SSC) and cross-linked using UV cross-linker (Stratagene, La Jolla, CA, USA).

qRT-PCR analysis

Highly up-regulated transcripts (based on reverse northern analysis), differential expression will be confirmed using qRT-PCR. Total RNA will be isolated at 7, 14, 21 and 28 dpi from the leaves of ChiLCV- and mock inoculated tolerant (BS-35) and susceptible (Kashi Anmol) chilli cultivars byTRIzol reagent (Sigma). Total RNA (2 mg) will be used to synthesize first-strand cDNA from each sample using Superscript reverse transcriptase (Invitrogen, Carlsbad, CA, USA) according to the supplier’s manual. The primers used for qRT-PCR were designed from the sequences of selected transcripts using Primer ExpressVersion 3.0. qRT-PCR will be performed on a Step One Real-Time PCR System (Applied Biosystems) using Power SYBR Green dye (Applied Biosystems). PCR will be performed for each sample in triplicate; a-tubulin, a constitutively expressed protein, will be used as internal control. The amount of transcript of each gene, normalized to the internal control a-tubulin, will be analysed using the 2-DDCt method (Livak and Schmittgen, 2001). The amount of transcript of each target gene under the mock condition will be designated as 1.0.The PCR conditions were kept as 95 °C for 10 min, 95 °C for 15 s, 60 °C for 1 min for 40 cycles, 95 °C for 15 s and 60 °C for 1 min. The experiment will be repeated three times to check the reproducibility. Primer for Rep Protein (FP- TCTACACGTGCTCGTCCAAT & RP- GAAATGTGCTGACCTGGTTG) and coat protein primer (FP-AAGCGACCAGCAGATATAATCA & RP- GCATAAGGGCTGTCGAAGTT) will be used for real time detection of ChiLCV.

Yeast two hybrid system:-

Attempts will be made to identify the corresponding Avr gene of the pathogen using Yeast two hybrid assays using all of the viral encoded ORFs according to manufacturer’s recommendations (Clonetach). ChiLCV genes will be cloned in to pGBKT7 and host resistance gene will be cloned in to pGADT7. All constructs will be confirmed by sequencing. The recombinant plasmid will be transformed into yeast strain Y187 containing the lac Z reporter plasmid pSH18-34 using the lithium acetate method. Yeast cell containing pSH18-34 and pGBKT7 will subsequently be transformed with the pGADT7. For two hybrid assays transformants will be grown on complete minimal medium lacking histidine, tryptophan and uracil supplemented with 2% galactose, 1% raffinose and X-gal. The degree of interaction will be determined by the ß-galactosidase liquid assay and protein expression will be assayed by immunoblots probed with protein of interest (New England biolab) to assure equivalent expression and stability in al treatment.

19

Validation of Resistant factor(s)

Confirmation of host factor in providing resistance will be tested by complementary test by co-inoculation of candidate resistance gene and ChiLCV in N. benthamiana and susceptible chilli plants. Degree of susceptibility will be tested.

Silencing of the host factor using VIGS vector

ChiLCV based vector will be developed by replacing the Coat protein of the virus with a gene of interest. This recombinant vector will be used to down-regulate expression of the putative resistant factor in resistant chilli variety. These plants will be challenged inoculated with ChiLCV infectious clones and viral title will be used by southern hybridization and semi quantitative PCR analysis. In addition, ChiLCV based vector will be developed to validate the role of the identified transcripts.

High- and low-molecular-weight RNA isolation and Northern blot analysis

Total high-molecular-weight RNA (10 μg) will be extracted from the infiltrated leaf patches and will be separated in a 1.5% denaturing agarose gel and transferred to Hybond-N+ (Amersham). Low-molecular-weight RNA will be isolated following the method as described by Chellappan et al. (2004). Hybridizations will be carried out using specific probes at 42°C with 50% formamide, and post hybridization washes (each for 30 min) will be done sequentially with 2X SSC, 0.5X SSC, and 0.2X SSC, along with 0.1% sodium dodecyl sulfate. The blots will be scanned and quantified.

18.2 Connectivity of the participating institutions

The proposed work will be carried out in PI’s laboratory (Plant Virology laboratory) in School of Life Sciences, JNU, New Delhi. The research programme will be executed sequentially as described below :-

Work Plan /Technical Programme of the proporsed study:-

• Construction of highly infectious partial tandem repeats ChiLCV genomic components • Testing pathogenicity of infectious clone on N. benthamiana and chillies through

Agrobacterium mediated inoculation. • Screening of chilli varieties and identification of resistant & susceptible varieties. • Analysis of relative accumulation of ChiLCV in resistant and susceptible ones. • Determination of small RNA level in resistant plants • Construction of subtracted cDNA library • DNA sequencing and data analysis • Identification and classification of ChiLCV-responsive genes in the resistant cultivar • Identification of differentially expressed clones by reverse Northern analysis • qRT-PCR of the identified differentially expressed clones • Identification of genes preferentially expressed in ChiLCV-resistant plants • Development of ChiLCV based vector • Cloning of resistant gene(s) in ChiLCV based vector • Silencing of the resistant gene(s) gene using a VIGS vector • Inoculation of chilli plants with ChiLCV

20

• Observation of plant phenotype and disease reaction • Detection of small RNA related to silenced host gene(s) • To investigate role of host factors in limiting ChiLCV pathogenesis • Compilation of experimental results and submission of final report.

Work Plan /Technical Programme Year-I

• Construction of highly infectious partial tandem repeats ChiLCV genomic components in a single vector pCAMBIA2300.

• Confirmation of infectious clone by PCR using specific primer as well as restriction digestion using appropriate enzymes.

• Mobilization of constructs into Agrobacterium tumefaciens and confirmation • Testing pathogenicity of infectious clone on N. benthamiana and chillies through

Agrobacterium mediated inoculation. • Screening of chilli varieties and identification of resistant & susceptible varieties. • Observation of plant phenotype and analysis of relative accumulation of ChiLCV in

resistant and susceptible ones through Southern hybridization and semi-quantitative PCR.

• Determination of comparative level of small RNA level in resistant and susceptible plants

• Isolation of total RNA from resistant chilli variety and separation of total mRNA • Suppression subtractive hybridization to sort out differentially expressed transcripts in

resistant chilli variety • Construction of subtracted cDNA library

Year II

• Cloning of all the transcripts and DNA sequencing • Data analysis and annotation of sequences obtained • Classification of ChiLCV-responsive genes in the resistant cultivar • Identification of differentially expressed clones by reverse Northern analysis • Determination of level of the identified differentially expressed transcripts by qRT-

PCR • Identification of genes preferentially expressed in ChiLCV-resistant plants • Development of ChiLCV based vector

Year III

• Cloning of identified resistant gene(s) in ChiLCV based vector

21

• Silencing of the resistant gene(s) gene using a VIGS vector • Inoculation of chilli plants with ChiLCV highly infectious constructs • Observation of plant phenotype and disease development • Detection of small RNA related to silenced host gene(s) • Elucidation of role of host factors in limiting ChiLCV pathogenesis • Compilation of experimental results and submission of final report.

18.3 Alternate strategies

Alternatively, particle delivery based method will be employed to introduce ChiLCV genome into chilli plants. Cloning of resistant genes in TRV based vector will be attempted to down regulate their expression in planta.

18.5 Time schedule of activities giving milestone

S. No.

Activity Year 1

Year 2

Year 3

1. Construction of highly infectious partial tandem repeats ChiLCV genomic components

=

2. Pathogenicity of infectious clone on N. benthamiana and chillies through Agrobacterium mediated inoculation.

=

3. Screening of chilli varieties and identification of resistant & susceptible varieties.

=

4. Analysis of relative accumulation of ChiLCV in resistant and susceptible ones.

=

5. Accumulation of siRNA in resistant plants =

6. Construction of subtracted cDNA library = =

7. DNA sequencing and data analysis =

8. Identification and classification of ChiLCV-responsive genes in the resistant cultivar

=

9. Identification of differentially expressed transcripts by reverse Northern analysis

=

10. qRT-PCR of the identified differentially expressed transcripts =

11. Identification of genes preferentially expressed in ChiLCV-resistant plants

= =

12. Development of ChiLCV based vector = =

13. Cloning of resistant gene(s) in ChiLCV based vector = =

14. Silencing of the resistant gene(s) gene using a VIGS vector =

15. Inoculation of chilli plants with ChiLCV =

22

16. Observation of plant phenotype and disease reaction =

17. Detection of small RNA related to silenced host gene(s) =

18. Elucidation of role of host factors in limiting ChiLCV pathogenesis

=

19. Compilation of experimental results and submission of final report.

=

19. Timelines : (Please provide quantifiable outputs)

Period of study Achievable targets

6 months Highly infectious clone of ChiLCV having tandem repeat of both DNA A and satellite DNA β in a single vector, pCAMBIA2300; Screening of chilli varieties for resistance

12 months Analysis of DNA and small RNA level on resistant and susceptible cultivars following inoculation with ChiLCV; subtracted cDNA library

18 months Sequence of clones and annotation; categorization of transcripts obtained from resistant cultivar;

24 months Identification of differentially expressed transcripts by reverse Northern analysis and their quantification over time

30 months Development of ChiLCV based vector and cloning of resistant gene(s); role of identified transcripts in providing resistance

36 months Detection of small RNAs related to silenced host transcripts; Compilation of data and analysis; Preparation of final report and submission

20. Name and address of 5 experts in the field: Sr. No.

Name Designation Address

1. Prof. S. M. Paul Khurana Director School of Biotechnology University of Amity Noida, Uttar Pradesh. e-mail: smpkhurana@amity.edu smpaulkhurana@gmail.com

2. Prof. M. V. Rajam

Professor

Department of Plant Molecular Biology University of Delhi South Campus New Delhi - 21 e-mail : rajam.mv@gmail.com

3. Dr. V. G. Malathi

Emeritus Scientist Division of Plant Pathology Indian Agricultural Research Institute New Delhi – 110 067, India e-mail: vgmalathi@rediffmail.com

4. Dr. K. Veluthambi Professor and Head Department of Plant Biotechnology

23

Madurai Kamraj University Madurai, Tamil Nadu e-mail:- kveluthambi@rediffmail.com

5. Dr. D. Chattopadhyay Staff Scientist IV National Centre for Plant Genome Research, Aruna Asaf Ali Marg, New Delhi – 110 067. e-mail: chattod@yahoo.co.in; debasis_chattopadhyay@nipgr.res.in

Selected References:

Albar, L, Ndjiondjop, M.N., Esshak, Z., Albar, L., Ndjiondjop, M.N., Esshak, Z., Berger, A., Pinel, A., Jones, M., Fargette, D., and Ghesquiere, A. 2003. Theoretical and Applied Genetics 107, 371–378.

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D.J. 1997. Nucleic Acids Research 25:3389–3402.

Anandalakshmi, R., G. J. Pruss, X. Ge, R. Marathe, A. C. Mallory, T. H. Smith, and V. B. Vance. 1998. Proceedings of the National Academy of Sciences,USA 95:13079–13084.

Baker, B., Zambryski, P., Staskawicz, B. and Dinesh- Kumar, S.P. 1997. Science, 276, 726–733.

Belkhadir, Y., Subramaniam, R. and Dangl, J.L. 2004. Current Opinion in Plant Biology 7, 391–399.

Bian, X.-Y., Thomas, M. R., Rasheed, M. S., Saeed, M., Hanson, P., De Barro, P. J., and Rezaian, M. A. 2007. Phytopathology 97:930-937.

Birnboim, H.C. and Doly, J. 1979. Nucleic Acids Research 7: 1513-1523. Chakraborty, S., Pandey, P.K., Banerjee, M.K., Kalloo, G. and Fauquet, C.M. 2003a. Plant

Disease, 87, 313. Chakraborty, S., Pandey, P.K., Banerjee, M.K., Kalloo, G. and Fauquet, C.M. 2003b.

Phytopathology, 93, 1485-1496. Chakraborty, S., Singh, A.K., Chattopadhyay, B., Kushwaha ,.N., Vinoth Kumar R, Basu,

S. 2009. The 6th Solanaceae genome workshop, held at New Delhi during November 8-13, (abstract pp. 171).

Chakraborty, S., Singh, A.K., Vinoth Kumar R, Chattopadhyay, B., Kushwaha, N., 2009. In: 6th Geminivirus meeting held at Guanajuato, Mexico during November 7-12, (abstract, pp. 68).

Chatchawankanphanich, O. and Maxwell, D. P. 2002. Phytopathology, 92, 637-645. Chatterji, A., Beachy, R.N. and Fauquet, C.M. 2001. Journal of Biological Chemistry

276, 25631-25638. Chatterji, A., Chatterji, U., Beachy, R.N., and Fauquet, C.M. 2000 Virology, 273, 341-350. Chatterji, A., Padidam, M., Beachy, R.N., and Fauquet, C.M. 1999 Journal of Virology 73,

5481-5489. Chattopadhyay, B., Singh, A.K., Yadav, T., Fauquet, C.M., Sarin, N.B. and Chakraborty,

S. 2008. Archieves of Virology 153(3):533-539. Chellappan, P., R. Vanitharani, and C. M. Fauquet. 2004. Journal of Virology 78:7465–

7477.

24

Czosnek, H., Ber, R., Antignus, Y., Cohen, S., Navot, N., and Zamir, D. 1988. Plant Disease, 77, 1168.

Dellaporta, S.L., Wood, J. and Hicks, J.B. 1983. Plant Molecular Biology Reporter 4 : 19-21.

Dhanraj, K.S. and Seth, M.L. 1968. Indian Journal of Horticulture 25: 70-71. Diaz-Pendon, J.A.; Truniger, V.; Nieto, C.; Garcia-mas, J.; Bendahmane, A.; Aranda, M.

2005. Molecular Plant Pathology 5, 223–233. Dry, I.B., Rigden, J.E., Krake, L.R., Mullineaux, P.M. and Rezaian, M.A. 1993. Journal

of General Virology 74, 147-151. Eagle, P.A., Orozco, B.M. and Hanley-Bowdoin, L. 1994. Plant Cell, 6, 1157-1170. Eybishtz , A., Yuval P., Dagan S., Rena G. and Henryk C., 2010. Planta 231:537–548 Faria, J.C., Gilbertson, R.L., Hanson, S.F., Morales, F.J., Ahlquist, P., Loniello, O. and

Maxwell, D.P. 1994. Phytopathology, 84, 321-329. Feinberg, A.P. and Vogelstein. 1984. Annals of Biochemistry. 137, 266-267 Fondong, V.N., Pita, J.S., Rey, M.E.C., de Kochko, A., Beachy, R.N. and Fauquet, C.M.

2000. Journal of General Virology 81, 514-521. Fraser, R.S.S. 1990. Annual Review of Phytopathology, 28, 179– 200. Gilbertson, R.L., Hidayat, S.H., Paplomatas, E.J., Rojas, M.R., Hou, Yu-Ming and

Maxwell, D.P. 1993. Journal of General Virology 74, 23-31. Green, S.K. and Kalloo. G. 1994. Tech. Bull. No. 21, AVRDC, Taiwan, ROC. Holmes, F. O. 1948. Phytopathology 38:467–73. Hong, Y. G and Harrison, B.D. 1995. Journal of General Virology 76, 2043-2049. Ingham, D.J. and Lazarowitz, S.G. 1993. Virology 196, 694-770. Kang, B.C.; Yeam, I.; Jahn, M.M. 2005. Annual Review of Phytopathology, 43, 1–41. Khan MS, Raj SK and Singh R, 2006. Plant Pathology 55, 289. Kheyr-Pour, A., Bendahmane, M., Matzeit, V., Accota, G. P., Crepsi, S., and Gronenborn,

B. 1991. Nucleic Acids Research 19, 6763-6769. Knipe, D. M. and Howley, P.M. (ed.) 2001. Fields Virology, 4th ed, Lippincott Williams

and Wilkins, Philadelphia, Pa. Kohm BA., Goulden MG., Gilbert JE., Kavanagh TA. and Baulcombe DC.1993. Plant

Cell 5:913–20. Kumar, S., Kumar, S., Singh, M., Singh, A.K., Rai, M.. 2006. Scientia Horticulturae 110:

359–361. Laemmli, U.K. 1970. Nature, 227 : 680-685. Laufs, J., Jupin, I., David, C., Schumacher, S., Heyraud-Nitschke, F. and Gronenborn, B.

1995. Biochimie (Paris), 77, 765-773. Lazarowitz, S.G. 1991. Virology, 180, 70-80. Livak, K.J. and Schmittgen, T.D. 2001. Methods, 25:402–408. Llave, C., K. D. Kasschau, and J. C. Carrington. 2000. Proceedings of the National

Academy of Sciences, USA 97:13401–13406. Martin, G.B.; Bogdanove, A.J.; Sessa, G. 2003. Annual Review of Plant Biology, 54, 23–

61. Mishra, M.D., Raychaudhuri, S.P. and Jha, Ashrafi. 1963. Indian Journal of Microbiology

3: 73-76.

25

Muniyappa, V., Venkatesh, H.M., Ramappa, H.K., Kulkarni, R.S., Zeidan, M., Tarba, C.Y, Ghanim, M. and Czosnek, H. 2000. Archieves of Virology, 145, 1583-1598.

Noueiry, A.O., Lucas, W.J. and Gilbertson, R.L. 1994. Cell, 76, 925-932. Padidam, M., Beachy, R.N. and Fauquet, C. M. 1999. Journal of Virology, 73(2):1609-

1616. Pita, J.S., Fondong, V.N., Sangare, A., Otim-Nape, G.W., Ogwal, S. and Fauquet, C.M.

2001. Journal of General Virology, 82, 655-665. Rosello, S.; Diez, M.J.; Nuez, F. 1998. European Journal of Plant Pathology,104, 499–

509. Roye, M.E., Wernecke, M.E., McLaughlin, W.A., Nakhla, M.K. and Maxwell, D.P. 1999.

Plant Pathology, 48(3): 370-378. Rybicki, E., Briddon, R.W., Brown, J.E., Fauquet, C.M., Maxwell, D.P., Harrison, B.D.,

Markham, P.G., Bisaro, D.M., Robinson, D. and Stanley, J. 1999. Geminiviridae. Pages 285-297 in: Virus Taxonomy. Seventh report of the International Committee on Taxonomy of Viruses. M.H.V. van Regenmortel, C.M. Fauquet, D.H. L. Bishop, E.B. Carsten, M.K. Estes, S.M. Lemon, J. Maniloff, M.A. Mayo, D.J. McGeoch, C.R. Pringle, and R.B. Wickner, eds. Academic Press, San Diego.

Sahu, P.P, Rai, N.K, Chakraborty, S., Singh, M., Prasanna, H.C., Ramesh, B., Chattopadhyay, D. and Prasad, M. 2010. Molecular Plant Pathology. 11(4): 531-544.

Sambrook, J., Fritsch, E.F. and Maniatis, T. 1989. Molecular Cloning (Cold Spring Harbor, NY : Cold Spring Harbor Laboratory Press).

Sanderfoot, A.A. and Lazarowitz, S.G. 1996. Trend in Cell Biology, 6, 353-358. Senanayake, D.M.J.B., Mandal, B., Lodha, S.and Varma A. 2006. Plant Pathology 55,

675. Shih, S.L., Tsai, W.S., Green, S.K., Khalid, S., Ahmad, I., Rezaian, M.A. and Smith, J.

2003. Plant Disease. 87(2): 200. Srivastava, K. M., Hallan, V., Raizada, R. K., Chandra, G., Singh, B. P., and Sane, P. V.

1993. Journal of Virological Methods, 51, 297-304. Stanley, J. 1983. Nature 305: 643-645. Stanley, J., Townsend, R. and Curson, S.J. 1985. Journal of general Virology,66: 1055-

1061. Steve W., Shiela M., and Baker, B.1996 Proceedings of the National Academy of

Sciences, USA 93(16):8776-8781 Sunter, G. and Bisaro, D.M. 1991. Virology, 180, 416-419. Sunter, G. and Bisaro, D.M. 1992. Plant Cell, 4, 1321-1331. Sunter, G., Harititz, M.D., Hormuzdi, S.G., Brough, C.L. and Bisaro, D.M. 1990 Virology,

179, 69-77. Vanitharani, R., Chelleppan, P. and Fauquet, C.M. 2004. Journal of Virology, 9487-9498. Varma, A and Malathi, V.G. 2003. Annals of Applied Biology,142: 145-164. Vasudev, R.S. and Sam Raj, J. 1948. Phytopathology, 38:364-369. von Arnim, A., and Stanley, J. 1992. Virology, 186, 286-293. Wezel, R.V., Dong, X., Blake, P., Stanley, J. and Hong, Y. 2002. Molecular Plant

Pathology, 3, 461-471.

26

PART IV: BUDGET PARTICULARS Budget (In Rupees) A. Non-Recurring (e.g. equipments, accessories, etc.)

S. No.

Item Year 1 Year 2 Year 3 Total

1. High precision electronic balance 200000 200000 2. Micropipettes 50000 50000 3. Table top centrifuge 50000 50000 Total 3,00,000 3,00,000

Sub-Total (A) 3,00,000

B. Recurring B.1 Manpower (See guidelines at Annexure-III)

S. No.

Position No.

Consolidated Emolument (Rs. per month)

Year 1 Year 2 Year 3 Total

1

Junior Research Fellow

15600 for (year I and II) 18200 for the 3rd year (HRA included @30%)

187200 187200 218400 592800

2 Laboratory attendant (semi-skilled)

6500 (consolidated) 78000 78000 78000 234000

265200 265200 296400 826800 Sub-Total (B.1) = Rs. 8,26,800

B.2 Consumables

S. No.

Item

Quantity Year 1 Year 2 Year 3 Total

1. Fine chemicals, growth media components, radioactive material, glass wares and plastic wares, pots, soilrites etc

As required

5,00,000

5,00,000 5,00,000 1500000

2. DNA oligos, DNA/RNA isolation kits, restriction and other emzymes; subtractive hybridization kit, sequencing of large number of clones (ESTs) through commercial services; siRNA isolation kits etc.

As required

5,00,000

5,00,000 5,00,000 1500000

Sub-Total (B.2) = 30,00,000

Other items Consolidated

Emolument Year 1 Year 2 Year 3 Total

B.3 Travel

50,000 50,000 50,000 1,50,000

27

B.4 Contingency 50,000 50,000 50,000 1,50,000 B.5 Overhead Charges (15%) 6,64,020 6,64,020 Sub-Total (B = B.1 + B.2 + B.3 + B.4 + B.5)

47,90,820 47,90,820

Grand Total (A + B) 50,90,820 50,90,820 Note : Please give justification for each head and sub-head separately mentioned in the above table. Financial Year : April - March In case of multi-institutional project, the budget estimate to be given separately for each institution. Justification of Budget: A: Non-recurring (e.g. equipments, accessories, etc) The PI has recently joined the School of Life Sciences, Jawaharlal Nehru University and has very minimum laboratory facilities. Hence, it is requested to provide the basic essential equipments, which will be dedicated for successful completion of this research programme.

• High precision electronic balance is required for weighing fine chemicals of lesser volume

accurately to increase the success of experiment. • Table top centrifuge shall be useful for carrying out for isolation of DNA/ RNA from plant,

plasmid DNA from E. coli etc. • Micropipette sets are required for carrying out routine use during molecular biological

experiments. B: Recurring The proposed project involves extensive bench work including molecular biological and genetic analyses. The PI is also involved in teaching activities in the university and shall contribute 50% of their time for the proposed project. Thus, at least one JRFs/SRFs is required to perform the experiments within the time frame. One contractual labourer will be required for different activities viz., washing of glasswares, preparation of routine media for bacterial culture, filling of pots in glass houses etc. The proposed research work involves a lot of sequencing analysis of host transcripts obtained; chemicals and kits required for substractive hybridization, yeast two hybrid assays, siRNA analysis, DNA-protein and protein-protein interaction viral and host protein which are very expensive. Hence, consumable grant of Rs. 30 lacs is requested and absolutely needed for proper execution of the programme successfully within the stipulated period. Contingencies are requested as per requirement for the different types of experiment to be conducted.

28

PART V: EXISTING FACILITIES Resources and additional information

1. Laboratory:

a. Manpower: In PI’s laboratory four Ph. D students and one M. Sc student are currently carrying out their project work.

b. Equipments: The equipments available with the PI are:- pH meter, refrigerator, table

refrigerated table top centrifuge, PCR machine, Gel documentation system, Gel electrophoresis system; ligation bath, incubator shaker, dry heat bath (one indigenous) and UV transilluminator, Inverted microscope, electroporator etc.

However, the following major equipments will be used from the Central Instrumentation Facilities, available with School of Life Sciences, JNU as and when required

S. No. Name of equipment/ accessories

Make

1. Cold room Blue star 2. PCR Eppendorf 3. Ultra centrifuge Beckman 4. High Speed centrifuge Sorvall 5. Ice maker Icemetic 6. Dark room 7. Microarray facilities Applied Biosystems 8. MALDI TOF Applied Biosystems 9. Realtime PCR Perkin Elmer 10. Phosphor image analyzer Amersham

2. Other resources such as clinical material, animal house facility, glass house facility,

experimental garden, pilot plant facility etc. We have centralized radioactive room for hybridization analysis and animal house facility. The school has a glasshouse for growing transgenic plants. The PI has initiated research work on Plant viruses in the University and also has a tissue culture facility.

29

PART VI : DECLARATION/CERTIFICATION It is certified that a) the research work proposed in the scheme/project does not in any way duplicate the work

already done or being carried out elsewhere on the subject. b) the same project has not been submitted to any other agency/agencies for financial

support. c) the emoluments for the manpower proposed are those admissible to persons of

corresponding status employed in the institute/university or as per the Ministry of Science & Technology guidelines (Annexure-III)

d) necessary provision for the scheme/project will be made in the Institute/University/State budget in anticipation of the sanction of the scheme/project.

e) if the project involves the utilization of genetically engineered organism, it is agreed that we will ensure that an application will be submitted through our Institutional Biosafety Committee and we will declare that while conducting experiments, the Biosafety Guidelines of the Department of Biotechnology would be followed in toto.

f) if the project involves field trials/experiments/exchange of specimens, etc. we will ensure that ethical clearances would be taken from concerned ethical Committees/Competent authorities and the same would be conveyed to the Department of Biotechnology before implementing the project.

g) it is agreed that any research outcome or intellectual property right(s) on the invention(s) arising out of the project shall be taken in accordance with the instructions issued with the approval of the Ministry of Finance, Department of Expenditure, as contained in Annexure-V.

h) we agree to accept the terms and conditions as enclosed in Annexure-IV. The same is signed and enclosed.

i) the institute/university agrees that the equipment, other basic facilities and such other administrative facilities as per terms and conditions of the grant will be extended to investigator(s) throughout the duration of the project.

j) the Institute assumes to undertake the financial and other management responsibilities of the project.

Signature of Project Coordinator (applicable only for multi-institutional projects)

Signature of Executive authority of Institute / University with Seal

Date:- Date:-

Signature of Principal Investigator : Date :

Signature of Co-Investigator Signature of Executive Authority of

University with sealDate: Date:

30

PART VII : BIODATA OF PRINCIPAL INVESTIGATOR

Name : SUPRIYA CHAKRABORTY Designation : Associate Professor Department/Institute/University: School of Life Sciences, Jawaharlal Nehru University Date of Birth : December 13, 1969 Sex : Male SC/ST : No Education (Post-Graduation onwards & Professional Career) Sl. No

Institution Place

Degree Awarded

Year Field of study

1. Banaras Hindu University, Varanasi

M.Sc. (Ag.) Plant Pathology

1991-1993

Plant Pathology; Plant Virology

2. Indian Agricultural Research Institue, New Delhi

Ph.D. (Plant Virology)*

1993-1997 Molecular Biology of Plant viruses

3. Danforth Plant Science Center, St. Louis, Missourie, USA

BOYSCAST Fellowship (Post Doctoral)

2002-2003 Molecular characterization of tomato infecting begomoviruses

* Ph. D. thesis title: Biological and Molecular Characterization of mungbean yellow mosaic virus.

A. Position and Honors

Position and Employment (starting with the most recent employment) Sl No.

Institution Place

Position From (Date) To (date)

1. Jawaharlal Nehru University, New Delhi

Associate Professor

December 21, 2004

Continuing

2. Indian Institute of Vegetable Research, Varanasi

Scientist (Sr. Scale)

August28, 2000 December 20, 2004

3. Indian Institute of Vegetable Research, Varanasi

Scientist August 28, 1996 August 27, 2000

Honors /Awards : Name of award Conferring agency Year Pran Vohra Award Indian Science Congress Association 2005 Dr. Harbhajan Singh Award Indian Society of Vegetable Science 2004 BOYSCAST fellowship Department of Science and Technology, Govt. of India 2002 Lal Bahadur Shastri Award Indian Council of agricultural Research (ICAR), New

Delhi 2000

Jawahar Lal Nehru Award ICAR, New Delhi 1998 Best student of Institute Indian Agricultural research Institute (IARI), New Delhi 1997 IARI Merit medal IARI, New Delhi 1997 Best student of Plant Pathology IARI, New Delhi 1997 Best student of Plant Pathology Banaras Hindu University (BHU), Varanasi 1993

31

Best Oral paper presentation National Symposium on Biotechnology of Plant Protection held at BHU, Varanasi

2000

IARI Senior Research Fellowship

IARI, New Delhi 1993

MECON fellowship during B. Sc. (Ag.)

MECON India (Pvt.) Ltd. 1987

Merit certificate West Bengal Board of Secondary Education 1985 Professional experience and training relevant to the Project The PI has long and thorough experiences in the subject of Molecular Biology of Plant Viruses and crop development through generation of transgenic plants. During Ph. D, I have worked on, “Biological and molecular characterization of mungbean yellow mosaic geminivirus” where I have cloned full-length genome of two isolates of Mungbean yellow mosaic India virus (MYMIV) (mothbean and pigeonpea) and also a range of mutational analysis on viral genome to determine their effect on viral replication. Nucleotide sequence analysis of DNA A of MYMV isolates has been carried out and variable region has been identified. As a scientist at the Indian Institute of Vegetable Research, Varanasi I was engaged in “Molecular characterization of geminiviruses infecting vegetable crops”. We have cloned and sequenced Begomovirus genome from crops like Dolichos, cowpea, chilli, tomato etc. The viruses yellow mosaic diseases on cowpea and dolichos in Varanasi region have been identified as two isolates of MYMIV and are designated as mungbean yellow mosaic Indian virus - Cowpea [Varanasi] (MYMIV-Cp[Var]) and mungbean yellow mosaic Indian virus - Dolichos [Varanasi] (MYMIV-Dol[Var]) respectively. From tomato, we have identified a new species of Begomovirus, Tomato leaf curl Gujarat virus (ToLCGV) (Chakraborty et al., 2003a; 2003b). Isolates of two distinct begomovirus species, the Tomato leaf curl New Delhi virus Severe strain (ToLCNDV-Svr, bipartite) and the Tomato leaf curl Gujarat virus Varanasi strain (ToLCGV-[Var], mono-/bipartite) infect tomato and cause severe yield losses in North India. Molecular characterization of Tomato leaf curl Gujarat virus have been carried out in detal. Viral DNA replication in protoplast have been carried our. We have demonstrated for the first time of a more virulent pseudorecombination between two distinct species of begomoviruses, that infect tomato, and the second report of synergism between begomoviruses. In addition, our results reveal that ToLCGV-[Var] DNA-B is capable of associating with different DNA-As even having different iteron sequences. It shows that pseudo-recombination actually works to a certain limit and provides incompatible sequences for negative experiment. (Chakraborty et al., 2006, communicated). We have standardized transformation protocol of chilli though Agroinoculation with the sense and antisense replicase gene of ChiLCV-Var to develop transgenic resistance against this virus. We have confirmed the presence of transgene using primers specific for Rep and npt II gene. The transformants are being grown for T2 seeds. Earlier, as a member of multidisciplinary team at IIVR, we have identified resistant sources in crops like okra, tomato, pepper, bitter gourd against the begomoviruses infecting these respective crops. Scales for classifying disease reaction for cowpea golden mosaic begomovirus and okra leaf curl geminivirus have been developed. The studies on the sources and inheritance of resistance to the virus diseases are also being carried out. Viral DNA accumulation in resistant and susceptible genotypes has also been studied. We have been using molecular biology techniques to detect latent infection of a virus. Techniques known:- I have mastered on several techniques some of which are listed as below A) Nucleic acid analysis :- Isolation of DNA from plant, fungi and plasmid; PCR amplification of target DNA with specific and degenerate primers; Cloning of amplified genes in plasmid vector; DNA sequence of clones and their analysis using DNASTAR programme; Southern transfer of genomic and viral DNA; Preparation of competent cells of bacteria; Transformation of Eschericia coli and Agrobacterium tumefaciens; Restriction digestion of DNA.

32

B) Electrophoretic techniques :- Sub-marine and vertical gel electrophoresis C) Biochemical analysis :-Estimation of enzymes and proteins by biochemical methods; expression and purification of viral proteins. D) Microbiological and Plant Pathological techniques :- Screening of germplasm for virus resistance using Agrobacterium mediated inoculation and grafting; Construction of partial tandem repeats of viral genome in pCAMBIA2300 for agroinoculation. E) Plant tissue culture techniques:- Isolation and transfection of protoplast from tobacco; viral replication in tobacco protoplast; Tissue culture of cowpea and Agrobacterium mediated transformation. Trainings received 1. Advanced training on Biological and Molecular Characterization of Tomato Leaf Curl Virus

from Varanasi at the International Laboratory for Tropical and Agricultural Biotechnology, Danforth Plant Science Center, St. Louis, USA, (Under BOYSCAST Fellowship from the Government of India during May 2002 to May 2003.

2. Attended advanced training on Detection and Diagnosis of Plant Viruses held at Advanced Centre for Plant Virology, Indian Agricultural Research Institute (IARI),New Delhi during May 28, 2001 to June 21, 2001.

3. Attended Advanced Seed Production Technology in vegetable crops refresher course held at Indian Institute of Vegetable crops, Varanasi during 10 Sempetmber, 2003 to 11 October, 2003.

4. Succesfully completed Biological, Chemical and Radiation Right-to-know safety training at the Danforth Plant Science Center, St. Louis, USA.

5. Completed the Pesticide Handler and worker safety trainings and greenhouse training at the Danforth Plant Science Center, St. Louis, USA.

6. Advanced Training on Bio-process engineering with Genetically Modified Organisms at Department of Biotechnology, Indian Institute of Technology, PO. Kharagpur, Dist. - Midnapur, West Bengal, INDIA during during July 15, 1999 to August 4 , 1999.

B. Publications (Numbers only): 16 Books : 0 Research papers, reports: 15 General articles : 0 Patents : 0 Others (Please specify) : 17 (abstracts submitted in conferences/meetings) Sequence data of full length viral genome submitted : four

Selected peer-revied publications Singh, AK., Chattopadhyay, B. and Chakraborty, S. 2012. Biology and interactions of two distinct

monopartite begomoviruses and betasatellites associated with radish leaf curl disease in India. Virology Journal 2012, 9:43.

Vinoth Kumar, R., Singh, A. K. and Chakraborty, S. 2012. A new monopartite begomovirus species, Chilli leaf curl Vellanad virus, and associated betasatellites infecting chilli in the Vellanad region of Kerala, India. New Disease Reports (Plant Pathology) 25, 20.

Kumari, P., Singh AK, Sharma VK, Chattopadhyay B, Chakraborty, S. 2011. A novel recombinant tomato-infecting begomovirus capable of. Archieves of Virology 156(5):769-83.

Kumari, P., Singh AK, Chattopadhyay B, Chakraborty, S. 2011. A new begomovirus species and betasatellite causing severe tomato leaf curl disease in Ranchi, India. Plant Pathology (New Disease Report) 23,11.

Kumari, P., Singh AK, Chattopadhyay B, Chakraborty, S. 2010. Molecular characterization of a new species of Begomovirus and betasatellite causing leaf curl disease of tomato in India. Virus Research 152 (2010) 19–29

Sahu, P.P, Rai, N.K, Chakraborty, S., Singh, M., Prasanna, H.C., Ramesh, B., Chattopadhyay, D. and Prasad, M. 2010. Tomato cultivar tolerant to Tomato leaf curl New Delhi virus infection induces virus-specific short interfering RNA accumulation and defence-associated host gene expression. Molecular Plant Pathology. 11(4): 531-544.

33

Kushwaha, N, Singh, A.K., Chattopadhyay, B. Chakraborty S. 2010. Recent advances in Geminivirus detection. The Journal of Plant Protection Sciences,(1) : 1-18.

Kumari, P., Chattopadhyay, B., Singh, A.K and Chakraborty, S. 2009. A New Begomovirus Species Causing Tomato Leaf Curl Disease in Patna, India. Plant Disease. 95(5):595

Singh, A. K. Mishra K. K., Chattopadhyay, B. and Chakraborty, S. 2009. Biological and Molecular characterization of a Begomovirus associated with yellow mosaic vein mosaic disease of pumpkin from Northern India. Virus Genes. 39(3):359-70.

Chakraborty S. 2008. Tomato Leaf Curl Viruses from India. Encyclopedia of Virology, 5 vols. (B.W.J. Mahy and M.H.V. Van Regenmortel, Editors), pp. 124-133 Oxford: Elsevier.

Chakraborty, S., Vanitharani, R., Chattopadhyay, B. and Fauquet, C.M. 2008. More virulent recombination and asymmetric synergism between two distinct species of causing tomato leaf curl disease in India. Journal of General Virology, 89 (3), 818–828.

Chattopadhyay, B., Singh, A.K., Yadav, T., Fauquet, C.M., Sarin, N.B. and Chakraborty, S. (2008). Infectivity of the cloned components of a begomovirus: DNA beta causing chilli leaf curl disease in India. Archieves of Virology 153(3):533-539.

Singh AK, Chattopadhyay B, Pandey PK, Singh AK and Chakraborty, S. (2007). First report of a new species of Begomovirus causing leaf curl disease of radish in India. Plant Disease 91 (8), 1053.

Singh SK, Chakraborty S, Singh AK, Pandey PK. 2006. Cloning, restriction mapping and phylogenetic relationship of genomic components of MYMIV from Lablab purpureus. Bioresource Technology. 97:1807-1814.

Chakraborty, S., B Singh and P K Pandey. (2005). An evaluation of the reactions of okra cultivars and breeding Selections to okra leaf curl geminivirus. Annals of Applied Biology (Tests of Agrochemicals and Cultivars) 26: 32-33.

Singh SK, Chakraborty S, Singh AK, Pandey PK. 2005 Cloning, restriction mapping and phylogenetic relationship of genomic components of MYMIV from Lablab purpureus. Bioresour Technol. Oct 17; [Epub ahead of print] PMID: 16242317

Chakraborty, S., B Singh and P K Pandey. 2005. An evaluation of the reactions of okra cultivars and breeding Selections to okra leaf curl geminivirus. Annals of Applied Biology (Tests of Agrochemicals and Cultivars) 26: 32-33.

Chakraborty, S., Pandey, P.K., Banerjee, M.K., Kalloo, G. and Fauquet, C.M. 2003. Tomato leaf Gujarat virus, a new begomovirus species causing a severe leaf curl disease of tomato in Varanasi, India. Phytopathology 93 (12): 1485-1496

Chakraborty, S., Pandey, P.K., Banerjee, M.K., Kalloo, G. and Fauquet, C.M. 2003. A new begomovirus species causing tomato leaf curl disease in Varanasi, India. Plant Disease. 87(3): 313.

Chakraborty, S., Raj Kumar and M. 2003. Identification of resistant sources to cowpea golden mosaic geminivirus. Vegetable Science 30(2): 101-105.

Singh M, Kumar S, Srivastava K, Chakraborty S, Kumar PA, Kalloo G and Banerjee MK. 2003. Transfer of crystal protein gene (Cry1Ab) to brinjal (Solanum melongena L.). Indian J. Plant Physiol. (Spl. Issue) 630-633.

Chattopadhyay, B., B. Rai and Chakraborty, S. 2002. In vitro efficacy of some systemic fungicides against Fusarium oxysporum f. sp. Iycopersici. Annals of Applied Biology (Tests of Agrochemicals and Cultivars), 22:008-009.

Chakraborty, S. Anupam Varma and V.G. Malathi. 2001. Molecular characterization of mungbean yellow mosaic geminivirus - a novel approach for engineering transgenic resistance. In proceedings of International Conference on Environment and Agriculture, held in Kathmandu, Nepal, Nov. 1-3, 1998, p.376-382.

Chakraborty, S., M. Singh, G. Kalloo, M. K. Banerjee and P. K. Pandey. 2000. Screening of cowpea cultivars against cowpea golden mosaic geminivirus. Annals of Applied Biology (Tests of Agrochemicals and Cultivars) 20: 40-41.

Chakraborty, S., M. Singh, G. Kalloo, M. K. Banerjee and P. K. Pandey 1999. Screening of cowpea cultivars against cowpea golden mosaic geminivirus. Tests of Agrochemicals and Cultivars No. 20 (Annals of Applied Biology 134 Supplement), pp. 40-41.

34

Sequences submitted and available in GenBank (http://www.ncbi.nlm.nih.gov)

Singh,A.K., Chattopadhyay,B. and Chakraborty,S. 2010 Tomato leaf curl Karnataka virus-India [India:Banglore:Chilli:2008] DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007094.

Singh,A.K, Chattopadhyay,B. and Chakraborty,S. 2010 Tomato leaf curl Joydebpur virus-India [India:Baruipur:Chilli:2007] DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007095.

Singh,A.K., Vinoth kumar,R., Chattopadhyay,B. and Chakraborty,S. 2010 Pepper leaf curl Bangladesh virus -India [India:Coimbatore:2008] DNA-A, Complete sequence. Submitted to NCBI GenBank accession no HM007096.

Singh,A.K., Yadav,T., Chattopadhyay,B. and Chakraborty,S. 2010 Pepper leaf curl Bangladesh virus-India [India:Ghazipur: 2007] DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007097.

Singh,A.K., Yadav,T., Chattopadhyay,B. and Chakraborty,S. 2010 Tomato leaf curl Joydebpur virus-India [India:Ghazipur:Chilli:2007] DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007102.

Singh,A.K., Yadav,T., Chattopadhyay,B. and Chakraborty,S. 2010 Tomato leaf curl Bangladesh betasatellite[India:Ghazipur:Chilli:2007], complete sequence. Submitted to NCBI GenBank accession no HM007099.

Singh,A.K., Chattopadhyay,B. and Chakraborty,S. 2010 Chilli leaf Curl Multan Virus-India [India:Guntur:2009] DNA-A,complete sequence. Submitted to NCBI GenBank accession no HM007100.

Singh,A.K., Chattopadhyay,B. and Chakraborty,S. 2010 Pepper leaf curl Bangladesh virus-India [India: Jabalpur:2008]DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007101.

Chattopadhyay,B., Singh,A.K. and Chakraborty,S. 2010 Tomato leaf curl Joydebpur virus-India [India:Jaunpur:Chilli:2007] DNA-A, complete sequence Submitted to NCBI GenBank accession no HM007102.

Chattopadhyay,B., Singh,A.K. and Chakraborty,S. 2010 Tomato leaf curl Joydebpur betasatellite[India:Jaunpur:Chilli:2007], complete sequence. Submitted to NCBI GenBank accession no HM007103.

Singh,A.K., George,B., Chattopadhyay,B. and Chakraborty,S. 2010 Chilli leaf curl virus-India [India:Jodhpur:2009], Complete sequence Submitted to NCBI GenBank accession no HM007104.

Singh,A.K., George,B., Chattopadhyay,B. and Chakraborty,S. 2010 Tomato leaf curl Bangladesh betasatellite [India:Jodhpur:Chilli:2009], complete sequence. Submitted to NCBI GenBank accession no HM007105.

Singh,A.K., Khan,A., Chattopadhyay,B. and Chakraborty,S. 2010 Chilli leaf curl Kanpur virus [India:Kanpur:2008] DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007106.

Singh,A.K., Khan,A., Chattopadhyay,B. and Chakraborty,S. 2010 Tomato leaf curl Bangladesh betasatellite[India:Kanpur:Chilli:2008], complete sequence. Submitted to NCBI GenBank accession no HM007107.

Chattopadhyay,B., Singh,A.K. and Chakraborty,S. 2010 Tomato leaf curl Joydebpur virus-India [India:Kolkata:Chilli:2008]DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007108.

Chattopadhyay,B., Singh,A.K. and Chakraborty,S. 2010 Tomato leaf curl Joydebpur virus-India [India:Kolkata:Chilli:2007]DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007109.

Chattopadhyay,B., Singh,A.K. and Chakraborty,S. 2010 Tomato leaf curl Joydebpur betasatellite [India:Kolkata:Chilli:2007], complete sequence. Submitted to NCBI GenBank accession no HM007110.

35

Basu,S., Singh,A.K., Chattopadhyay,B. and Chakraborty,S. 2010 Pepper leaf curl Bangladesh virus-India [India:Mograhat:2007] DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007111.

Basu,S., Singh,A.K., Chattopadhyay,B. and Chakraborty,S. 2010 Tomato leaf curl Joydebpur betasatellite[India:Mograhat:Chilli:2007], complete sequence. Submitted to NCBI GenBank accession no HM007112.

Khuswaha,N., Singh,A.K., Chattopadhyay,B. and Chakraborty,S. 2010 Tomato leaf curl New Delhi virus-India [India:New Delhi:Chilli: 2009] DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007113.

Singh,A.K., Chattopadhyay,B. and Chakraborty,S. 2010 Chilli Leaf Curl Virus-India [India:Noida:2007]DNA-A, complete sequence Submitted to NCBI GenBank accession no HM007114.

Singh,A.K., Chattopadhyay,B. and Chakraborty,S. 2010 Tomato leaf curl Bangladesh betasatellite [India:Noida:Chilli:2007], complete sequence. Submitted to NCBI GenBank accession no HM007115.

Singh,A.K., Chattopadhyay,B. and Chakraborty,S. 2010 Chilli leaf curl virus-India [India:Pataudi:2007]DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007116.

Singh,A.K., Kumari,P., Chattopadhyay,B. and Chakraborty,S. 2010 Tomato leaf curl Joydebpur virus-India [India:Patna:Chilli:2008] DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007117.

Singh,A.K., Kumari,P., Chattopadhyay,B. and Chakraborty,S. 2010 Tomato leaf curl Bangladesh betasatellite[India:Patna:Chilli:2010], complete sequence. Submitted to NCBI GenBank accession no HM007118.

Singh,A.K., Vinothkumar,R., Chattopadhyay,B. and Chakraborty,S. 2010 Chilli Leaf Curl SalemVirus-India[India:Salem:2008]DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007119.

Singh,A.K., Chattopadhyay,B. and Chakraborty,S. 2010 Tomato leaf curl New Delhi virus-India [India:Tumkur:Chilli:2008]DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007120.

Singh,A.K., Vinothkumar,R., Chattopadhyay,B. and Chakraborty,S. 2010 Chilli Leaf Curl VellanadVirus[India:Vellanad:2008]DNA-A, complete sequence. Submitted to NCBI GenBank accession no HM007121.

Chattopadhyay,B., Yadav,T., Singh,A.K. and Chakraborty,S. 2009. Chilli Leaf Curl Pataudi-betasatellite, complete sequence Submitted to NCBI GenBank accession no EU582020.

Chakraborty, S., Pandey, P.K., Banerjee, M.K., Kalloo, G. and Fauquet, C.M. 2003. Complete DNA-A sequence of tomato leaf curl Gujarat virus – strain Varanasi. GenBank accession number (AY190290).

Chakraborty, S., Pandey, P.K., Banerjee, M.K., Kalloo, G. and Fauquet, C.M. 2003. Complete DNA-B sequence of tomato leaf curl Gujarat virus – strain Varanasi. GenBank accession number (AY190291).

Singh, S.K., Chakraborty, S., Singh, A. K. and Pandey, P.K. 2004. Complete DNA-A sequence of dolichos yellow mosaic virus – strain Varanasi. GenBank accession number (AY547317).

Chakraborty, S., Singh, S.K. and Pandey, P.K. 2006. Complete DNA-A sequence of cowpea golden mosaic virus – strain Varanasi. Submitted in GenBank .

List five recent publications relevant to the proposed area of work Singh, AK., Chattopadhyay, B. and Chakraborty, S. 2012. Biology and interactions of two distinct

monopartite begomoviruses and betasatellites associated with radish leaf curl disease in India. Virology Journal 2012, 9:43.

Kumari, P., Singh AK, Sharma VK, Chattopadhyay B, Chakraborty, S. 2011. A novel recombinant tomato-infecting begomovirus capable of. Archieves of Virology 156(5):769-83.

36

Kumari, P., Singh AK, Chattopadhyay B, Chakraborty, S. 2010. Molecular characterization of a new species of Begomovirus and betasatellite causing leaf curl disease of tomato in India. Virus Research 152 (2010) 19–29

Sahu, P.P, Rai, N.K, Chakraborty, S., Singh, M., Prasanna, H.C., Ramesh, B., Chattopadhyay, D. and Prasad, M. 2010. Tomato cultivar tolerant to Tomato leaf curl New Delhi virus infection induces virus-specific short interfering RNA accumulation and defence-associated host gene expression. Molecular Plant Pathology. 11(4): 531-544.

Chakraborty, S., Vanitharani, R., Chattopadhyay, B. and Fauquet, C.M. 2008. More virulent recombination and asymmetric synergism between two distinct species of causing tomato leaf curl disease in India. Journal of General Virology, 89 (3), 818–828.

Chattopadhyay, B., Singh, A.K., Yadav, T., Fauquet, C.M., Sarin, N.B. and Chakraborty, S. (2008). Infectivity of the cloned components of a begomovirus: DNA beta causing chilli leaf curl disease in India. Archieves of Virology 153(3):533-539.

C. Research Support Ongoing Research Projects:- Sl No.

Title of project Funding agency

Amount (Rs.) Date of sanction and duration

1. Engineering RNAi mediated broad-spectrum resistance against chilli begomoviruses

Department of Biotechnology

16,78,000 May 5, 2010 ; 3 years

2. Molecular Identification and Characterization of virulence factors of tomato leaf curl virus

Department of Science and Technology

45,79,000 January 8, 2010; 3 years

3. Molecular mechanism of PTGS mediated host recovery associated with tomato leaf curl virus infection

Department of Biotechnology

41,78,000 January 10, 2011; 3 years

Completed Research Projects (state only major projects of last 3 years) Sl. No.

Title of project Funding agency Amount Date of completion

1. Molecular characterization of pepper leaf curl virus and development of DNA based screening techniques

Department of Science and Technology, Young Scientist project

9,75,000 30.06.2008

2. Molecular diversity of Begomoviruses Causing Chilli Leaf Curl Disease And Identification Of Virulence Factors

Department of Biotechnology

33,38,974 31.8.2010

3. Strategy for engineering broad-spectrum resistance against geminiviruses

Department of Biotechnology

75,84,000 30.9.2010

Place : JNU, New Delhi Date : Signature of Principal Investigator