Scientific Report 2016 - A to B communicationatob.fr/wp-content/uploads/2017/07/RA-IECB-x.pdf ·...

Institut Européen de Chimie et BiologieEuropean Institute of Chemistry and Biology

Scientific Report

2016

In september 2016, the iGEM Bordeaux team supervised by D. Dupuy obtained a Bronze Medal at the iGEM giant Jamboree in Boston, MA.

The International Genetically Engineered Machine (iGEM) competition open to undergraduate students with the goal of promoting synthetic biology and the development of an open community and collaborations.

Since 2012 Bordeaux is represented by a team of student who perform their summer laboratory work at IECB. In 2016 the team obtained a Bronze medal at the Giant Jamboree held at the Hynes Convention center (Boston, Ma) for their project of molecular control of sleep pattern : “Sleep with EpiC elegans”.

Publication director : Jean-Louis Mergny Graphic design : A to B communication Photo credits : Derek McCusker (front cover: Nanoscale organisation of Cdc42 on the plasma membrane of a yeast cell. Cdc42 is a key signalling protein in all eukaryotic cells. Image by Elodie Sartorel in the McCusker group), Yves Théobald (building, portraits), François Quenet (portraits), Lionel Lizet (IECB-CGFB technology platform), Pierre-Emmanuel Gaultier (portraits), Elodie Emaille (portraits), Céline Charrier (portraits).

Scientific Report

2016


Director’s Foreword

4 Director’sForeword

Many subjects have paved the life at IECB in 2016 and deserve to be highlighted: new group leaders, seminal papers, exciting workshops and symposia, ERC awardees... A quick look at the « News » page of our web site will give the reader a flavour of past events.

Year after year, IECB group leaders are awarded grants from highly competitive calls: an indisputable indication of the first rate quality of our scientists. Of note, two more group leaders have been awarded an ERC consolidator grant, Axel Innis and Rémi Fronzes, both in the Life Sciences (LS1) panel. This means that no less than 6 ERC awardees will be present in IECB in 2017 ! The publication output is steady, with several recent front covers for Angewandte Chemie, J. Am. Chem. Soc. and ChemBioChem.

The platform for Structural Biophysico-Chemistry of the Institute now benefits from a new FEI Arctica electron microscopy device, a powerful instrument for structural investigation that was previously unavailable in France. We have also rejuvenated our NMR platform: a new 600 MHz spectrometer was installed last summer. Several of our platforms are becoming a showcase for suppliers, with mutually beneficial consequences including an increased visibility.

The development of IECB continues to contribute to the strategy of the University of Bordeaux. For instance, both research teams and the Structural Biophysico-Chemistry platform take an active part into the BRIO network dedicated to translational research on cancer, and also in the university Action Thematique Transversale (ATT) focussed on Synthetic Biology. Of note, the iGEM team hosted at IECB earned a Bronze Medal in Boston this fall for their “Sleep with EpiC elegans” project. Even though IECB is not (yet) an official actor of the IdEx (« Initiative d’excellence ») of Bordeaux, the quality of the science performed by our teams, their international visibility, the strong attractivity of our institute, our demonstrated interest for technology transfer that translated into the creation of several companies, make IECB a key player of this ambitious project. I sincerely wish that links are strengthened with IdEx in the near future for mutual benefit.

A number of scientific events were organized at IECB (or by IECB members) in 2016. Some of them are annual events, such as the Young Scientists Symposium (YSS) or the RNA club. Both the Foldamer Symposium held on September and the “Congrès 2016 du Club Francophone de l’AuTophaGie” held the following month were successful. In addition, monthly internal seminars “Chemistry meets Biology” are now a tradition.

I hope the reader will find a wide range of useful information in the 2016 IECB scientific report and even, perhaps, reasons to collaborate or to join ! Natalia Carullà, David Santamaria and Rémi Fronzes are the latest recruits : welcome aboard! Hosting new groups in our institute is possible only if teams can leave at the end of their term; thanks to support from Inserm and University of Bordeaux, both Martin Teichmann and Sébastien Fribourg’s teams were relocated to the Carreire campus this year. Support from University Bordeaux is also acknowledged for the refurbishment of the ground floor of our institute.

So… what’s next ? Well, IECB is the prototype of an “out of equilibrium” reaction: no time to rest ! There are plenty of projects and plans for the forecoming years: new instruments to be installed, new groups… Stay tuned!

Dr Jean-Louis Mergny

Dr. Jean-Louis MergnyExecutive Scientific Director of the IECBResearch Director (DR) at Inserm (U1212)

5Director’sForeword

The Institut européen de chimie et biologie (IECB) is a research team incubator placed under the joint authority of the CNRS, the Inserm and the Université de Bordeaux. It was created in 1998 with the support of the Aquitaine Regional Council to provide promising European chemists and biologists with an environment designed to facilitate the development of first-class interdisciplinary research programs, in collaboration with international public and private research centres.

IECB’s International Scientific Advisory Board guides the selection and periodic evaluation of the team leaders. After a probative period of two years, research teams are then hosted for a maximum of 10 years. During their stay at IECB, teams enjoy full financial and managerial autonomy and benefit from state-of-the-art facilities and dedicated technical expertise through IECB’s technology platforms in structural biology and preparative and analytical techniques.

The IECB is the largest research team incubator in France, with 16 research teams accounting for 200 researchers and expert technicians.

Two companies - Fluofarma Porsolt, created by former IECB team leaders, and Ureka (Immupharma Group) - are hosted at the Institute.

Director’s foreword

Organisational structure

Research teams & output

Technology platforms

Technology transfer & start-ups

Scientific events

05

09

15

61

69

73

Contents

7Contents

8

The IECB International Scientific Advisory Board, chaired by Dr Moshe YANIv, interviewed candidates from all over the world for group leader positions.

Dr. Moshe YANIVInstitut Pasteur, Paris, France

Dr. Witold FILIPOWICZInstitut Friedrich Miescher,

Basel, Switzerland

Prof. Dinshaw PATELMemorial Sloan-Kettering

Cancer Center, New York, USA

Dr. Bernd GIESEDepartement of Chemistry,

University of Basel, Switzerland

Pr. Yves POMMIERNational Cancer Research, NIH,

Bethesda, USA

Dr Herbert WALDMANNMax Planck Institute of Molecular Physiology, Dortmund, Germany

Dr. Daniel SCHIRLINSanofi Aventis, Paris, France

Pr. Roeland NOLTERadboud University Nijmegen,

Netherlands

9

OrganisationalStructure

10

Board Members International scientific advisory board (ISAB) Dr. Moshe YANIV PresidentInstitut Pasteur, Paris, France

Dr. Witold FILIPOWICZInstitut Friedrich Miescher, Basel, Switzerland

Dr. Bernd GIESEDepartement of Chemistry, University of Basel, Switzerland

Pr. Roeland NOLTERadboud University Nijmegen, Netherlands

Prof. Dinshaw PATELMemorial Sloan-Kettering Cancer Center, New York, USA

Pr. Yves POMMIERNational Cancer Research, NIH, Bethesda, USA

Dr. Daniel SCHIRLINSanofi Aventis, Paris, France

Dr Herbert WALDMANNMax Planck Institute of Molecular Physiology, Dortmund,Germany

Former ISAB members

Dr. Daniel LOUVARDInstitut Curie, Paris, France (1999-2014)

Pr. Iain D. CAMPBELLDepartement of Biochemistry, University of Oxford, UK (1999-2013)

Dr. Simon CAMPBELLRoyal Society of Chemistry, London, UK

Pr. Claude HÉLÈNEMuséum National d’Histoire Naturelle, Paris, France (1999–2003)

Pr. Georges HUEZUniversité Libre de Bruxelles, Brussels, Belgium (2000–2005)

Pr. Steven LEYDepartement de Chemistry, University of Cambridge, UK (1999–2005)

Pr. Helmut RINGSDORFInstitut für Organische Chemie, Johannes Gutenberg Universität, Mainz, Germany (1999–2006)

Pr. Fritz ECKSTEINMax Planck Institute for Experimental Medicine, Göttingen, Germany (2003–2006)

Pr. Jack BALDWINDepartement of Chemistry, University of Oxford, UK (2005 – 2007)

Pr. Wilfred van GUNSTERENLaboratory of Physical Chemistry, ETH, Zürich, Switzerland (1999–2007)

Pr. François DIEDERICHDepartment of Chemistry and Applied Biosciences, ETH, Zürich, Switzerland (2006–2008)

Pr. Jean-Yves LALLEMANDInstitut de Chimie des Substances Naturelles, CNRS Gif-sur-Yvette, France (1999-2010)

Board of directors

Dr. Jean-Louis MERGNY Executive Scientific DirectorResearch director, U1212 (Inserm - Univ. Bordeaux)

Dr. Ivan HUC Deputy Scientific DirectorResearch director, UMR5248 (CNRS - Univ. Bordeaux)

Mrs. Sylvie DJIAN Administrative Director (CNRS)

Former directors

Dr. Jean-Jacques TOULMÉ Former Executive Scientific Director (2001-2014)

Pr. Jean-Yves LALLEMAND Former Executive Scientific Director (1998-1999)

Pr. Léon GHOSEZ Former Deputy Scientific Director (1998-2008)

Steering committee

Mrs. Sylvie DJIAN Administrative Director (CNRS)

Dr. Gilles GUICHARD Team leaderResearch Director, UMR5248 (CNRS - Univ. Bordeaux)

Dr. Ivan HUC Deputy Scientific DirectorResearch Director, UMR5248 (CNRS - Univ. Bordeaux)

Dr. Brice KAUFFMANN Head of IECB’s technology platformsEngineer, UMS3033 (CNRS - Univ. Bordeaux)

Dr. Cameron MACKERETH Team leaderSenior Research Associate, U1212 (Inserm - Univ. Bordeaux)

Dr. Jean-Louis MERGNY Executive Scientific DirectorResearch Director, U1212 (Inserm - Univ. Bordeaux)

Dr. Anne ROYOU Team leaderSenior Research Associate, UMR5095 (CNRS - Univ. Bordeaux)

Board of trustees

Centre National de la Recherche Scientifique3 rue Michel-Ange, 75794 Paris CEDEX 16

Institut National de la Santé et de la Recherche Médicale101 rue de Tolbiac, 75654 Paris CEDEX 13

Université de Bordeaux 35 Place Pey Berland, 33000 Bordeaux

Organisational Structure

11

Organic & medicinal chemistryPr. Léon Ghosez

Organisational Chart

Board of trustees

Board of directors

Steering committee

Administrative services

Research teamsPole 1 - Structural biology & biophysics

Translation regulation of gene expressionDr. Axel Innis

Solid-state NMR of molecular assembliesDr. Antoine Loquet

Pole 2 - Organic &bioorganic chemistry

Biomimetic supramolecular chemistryDr. Ivan Huc

Peptidomimetic chemistryDr. Gilles Guichard

Chemical neuroglycobiologyDr. Frédéric Friscourt

Pole 3 - Molecular recognition

NMR spectroscopy of protein-nucleic acid complexesDr. Cameron MackerethUnusual nucleic acid structuresDr. Jean-Louis Mergny

Pole 4 - Molecular & cellular biology

Dynamics of cell growth & cell divisionDr. Derek McCusker

Control & dynamics of cell divisionDr. Anne Royou

Genome regulation & evolutionDr. Denis Dupuy

Technology platforms Structural biology

Preparative & analytical techniques

International scientificadvisory board

InstitutEuropéende Chimieet Biologie

UMS3033 & US001

Technology transfer& start-ups

UMS3033 & US001

Associate members

Metabolism & cell signalingDr. Raul Duran

Organisational Structure

Structure and function of bacterial nano-machinesDr. Rémi Fronzes

Protein aggregation and diseaseDr. Natalià Carulla

Novel mediators in lung oncogenesisDr. David Santamaria

Mass spectrometry of nucleic acids and supramolecular complexesDr. Valérie Gabelica

12

In 2016, 193 people were part of the IECB : 156 research staff, 22 employees within the IECB’s support services unit and 15 employees of the companies Fluofarma and Ureka. Young researchers (Master and PhD students, postdoctoral researchers) represent 70% the IECB research staff. This population largely contributes to gender equality and internationalization at IECB. It also testifies to the attractiveness of the institute.

2016 Key Figures

IECB staff by professionnal category

Number of postdoctoral researchers over the past 10 years

IECB researchers and students by nationality & professional category

Key Figures

13

Support services at IECB consist of staff in administration and finance, infrastructure and maintenance, as well as 11 engineers and technicians dedicated to IECB’s technology platforms. The support services unit UMS3033 & US001 is jointly funded by the CNRS, the Inserm and the Université de Bordeaux, and receives financial support from the Nouvelle - Aquitaine Regional Council. Research teams also contribute to financing those general services.

Administration and financeAdministrative director Sylvie DJIAN, IE, CNRSExecutive assistant officerClaire-Hélène BIARD, AI, InsermAccounting and administration officersCatherine DUPRAT, Tech, InsermSandra LAVENANT, Tech., Univ. BordeauxLaurent KUBICKI, Tech., InsermPatricia MARTIN, Tech., InsermAmélie STOTZINGER, CDD, CNRS (IECBstore)IT managementGérald CANET, IE, InsermEric ROUBIN, Tech., InsermInfrastructure officerPatrice DUBEDAT, AJT, Univ. Bordeaux

Structural biology facilitiesHead of structural biology facilities and crystallography engineer Brice KAUFFMANN, IR, CNRSNMR engineerEstelle MORVAN, IE, CNRSMass spectrometry engineerFrédéric ROSU, IR, CNRSMass spectrometry technicianLoïc KLINGER, Tech., Univ. BordeauxCrystallography engineerStéphane MASSIP, IE, Univ. BordeauxSurface plasmon resonance engineerLaetitia MINDER, AI, Institut BergoniéElectron microscopy engineerArmel BEZAULT, CDD,CNRSQuality approachJulie KOWALSKI, Apprentice, Inserm

Analytical and preparative techniques facilitiesHead of the analytical and preparative techniques facilitiesLionel BEAUREPAIRE, CDD IE, InsermBiochemistry and molecular biology engineer Thierry DAKHLI, Tech., INSERMLaundryMyriam MEDERIC, AJT, Inserm

The budget of the institute, which amounts to 9,2 millions euros including salaries, can be divided into two separate parts: the budget of the support services (UMS3033/US001) and the research teams’ own resources.The first one is mainly granted by the trustees (CNRS, Inserm, Université de Bordeaux), while the other comes from public and private research grants and contracts.

SuppORt SERvICES(uMS3033 & uS001)

IECB’s 2016 budget

Support services funding

IECB research staff by gender & professional category

Key Figures

14

Three new group leaders joined IECB in 2016.

Dr. Natàlia CarullaGroup LeaderFondation pour la Recherche Médicale“Protein Aggregation and Disease”

Dr. David SantamariaGroup LeaderIDEX-Bordeaux / SIRIC-BRIO chair“Novel Mediators in Lung Oncogenesis”

Dr. Rémi FronzesGroup LeaderCR1, CNRS“Structure and Function of Bacterial Nano-Machines”In 2016, Rémi Fronzes was awarded an ERC consolidator grant

15

Research teams & Output

16

Ribosomes are the large macromolecular complexes responsible for translating genetic information contained within a messenger RNA into protein in all living organisms. As part of the process of translation, nascent polypeptides transit through a long molecular cavity spanning the large subunit of the ribosome - known as the exit tunnel - before they are released into the cytoplasm or delivered to the protein translocation machinery.

Our lab uses combined biochemical, structural and computational approaches to study some of the key events that take place within the functional nano-environment of the exit tunnel, including:

1. Peptide bond formation, which is catalyzed by the peptidyl transferase center located at the tunnel entrance.

2. Nascent chain-mediated translational arrest, a process whereby signals encoded in certain nascent polypeptides termed arrest peptides bring protein synthesis to a halt.

3. Translation inhibition by antimicrobial peptides or antibiotics that target the exit tunnel and the peptidyl transferase center of the ribosome.

Peptide Bond formationIn order to understand how peptides or antibiotics inhibit peptide bond formation, we must first have a clear picture of the mechanism by which ribosomes catalyze peptidyl transfer. Peptide bond formation takes place within an active site that is composed primarily of RNA. Our high-resolution structures of the bacterial ribosome in complex with full-length tRNA substrates reveal a network of hydrogen bonds (or “proton wire”) along which proton transfer could take place to assist catalysis (Polikanov et al., 2014). This has led us to propose a mechanism for peptide bond formation in which the ribosome together with the A- and P-tRNAs trigger the reaction by activating a water molecule (Fig. 1). As this proposed catalytic water is cut off from the bulk solvent by the N-terminus of ribosomal protein L27 in bacteria, we are currently investigating a possible regulatory role for this protein during translation.

Figure 1 : Arrest peptides regulate gene expression in bacteria. Nascent peptides sometimes block translation by interacting with the exit tunnel of the large ribosomal subunit. This often requires a small ligand – such as a drug or a metabolite (orange hexagon) – to be sensed by a ribosome nascent chain complex carrying a specific arrest peptide (blue). As a result, arrest peptides regulate gene expression in a metabolite-dependent manner in bacteria, using transcriptional or translational mechanisms.

translational Regulation of Gene Expression

Dr. Axel InnisSenior Research Associate (CR1), INSERM

Axel Innis did his PhD in structural biology at the University of Cambridge, under the supervision of Prof. Sir Tom Blundell (1998-2002). He then joined the group of Dr. R. Sowdhamini at the National Centre for Biological Sciences in Bangalore as a visiting fellow (2002-2004), where he developed a computational method for identifying functionally important sites in proteins. Following his time in India, Dr. Innis joined the laboratory of Prof. Thomas A. Steitz at Yale University (2004-2012). There, he chose to tackle what was, at the time, a little-known form of translational control: the regulation of ribosomal protein synthesis by the nascent polypeptide. He joined IECB as a group leader in January 2013 and was recruited as an Insem senior research associate (CR-1) the same year.

Research teamDr Britta SEIP Postdoctoral fellow (Univ. Bordeaux)Natacha PEREBASKINE ITA (Univ. Bordeaux)Carolin SEEFELDT PhD student (Inserm)Alba HERRERO DEL VALLE PhD student (Univ. Bordeaux)

This team is part of ARNA laboratory / Inserm U1212 – CNRS UMR5320

pole 1 - StructuralBiology & Biophysics

17

Nascent chain-mediated translational arrestTranslation inhibition by arrest peptides is critically dependent on their amino acid sequence, but often requires an additional low molecular weight ligand, such as a drug or a metabolite, to be sensed by the ribosome nascent chain complex (RNC). Thus, arrest peptides are used for metabolite-dependent gene regulation in both prokaryotes and eukaryotes (Seip & Innis (2016)) (Fig. 1). Biological processes that are regulated by arrest peptides in bacteria include the induction of the erm resistance genes by macrolide antibiotics (e.g. erythromycin), the sensing of soluble tryptophan by a ribosome-associated TnaC peptide, targeting of the expression of the SecA pre-protein translocase to the cell membrane by the nascent SecM polypeptide, the expression of the YidC2 membrane insertase by the MifM peptide and the regulation of SecDF2 in low-salinity environments by the arrest peptide VemP.Biochemical and structural studies have shown that interactions between nascent peptides and the ribosome that induce translational arrest do so by impairing tRNA accommodation, peptide bond formation or peptide release. However, the arrest code dictating whether a given nascent peptide is prone to inhibiting its own synthesis is yet to be elucidated, the range of metabolites that can be sensed by the nascent peptide is unknown and the molecular bases of the arrest mechanism itself are only partially understood. As a result, we are developing high-throughput tools to systematically address these issues on an unprecedented scale.

Antimicrobial peptidesThe threat posed by multidrug-resistant bacteria presents a major public health challenge that requires immediate and coordinated action on a global scale. The bacterial ribosome is a major target for antibiotics, many of which bind to the exit tunnel. This includes drugs that inhibit peptide bond formation (e.g. chloramphenicol), as well as compounds that selectively interfere with the movement of the nascent peptide down the exit tunnel (e.g. erythromycin and other macrolides).In addition, we have recently shown that proline-rich antimicrobial peptides (PrAMPs) produced by the host immune response of insects and mammals inhibit translation by blocking the exit tunnel and peptidyl transferase center of the ribosome (Seefeldt et al. 2015; Seefeldt et al. 2016) (Fig. 2). These natural compounds share structural similarities with arrest peptides, indicating that the latter could help steer the search for new peptide-based antimicrobials that are effective against antibiotic-resistant pathogens.

Figure 2 : Ribosome inhibition by antimicrobial peptides. The insect-derived proline-rich antimicrobial peptide Onc112 inhibits bacterial protein synthesis by blocking and destabilizing the translation initiation complex (Seefeldt et al. 2015). Other PrAMPs like Bac7, Metalnikowin or Pyrrhocoricin operate through a similar mechanism (Seefeldt et al. 2016).

Selected publicationsArenz, S., Bock, L.V., Graf, M., Innis, C.A., Beckmann, R., Grubmüller, H., Vaiana, A.C., Wilson, D.N. (2016). A combined cryo-EM and molecular dynamics approach reveals the mechanism of ErmBL-mediated translation arrest. Nat Commun. 7, 12026.

Seip, B. & Innis, C.A. (2016). How widespread is metabolite sensing by ribosome-arresting nascent peptides? J Mol Biol. 428, 2217-2227.

Seefeldt, A.C., Graf, M., Nguyen, F., Pérébaskine, N., Arenz, S., Mardirossian, M., Scocchi, M., Wilson, D.N., Innis, C.A.† (2016). Structure of the mammalian antimicrobial peptide Bac7(1-16) bound within the exit tunnel of a bacterial ribosome. Nucleic Acids Res. 44, 2429-2438.

Seefeldt, A.C., Nguyen, F., Antunes, S., Pérébaskine, N., Graf, M., Arenz, S., Inampudi, K.K., Douat, C., Guichard, G., Wilson, D.N., Innis, C.A.† (2015). The proline-rich antimicrobial peptide Onc112 inhibits translation by blocking and destabilizing the initiation complex. Nat. Struct. Mol. Biol. 22, 470-475.


18

Self-assembly is a fundamental process by which individual subunits assemble into ordered macromolecular entities, such as filaments, fibrils, oligomers, tubes or nanomachines. In biology, protein assemblies are involved in crucial cellular processes, ranging from the propagation of neurological disorders to viral and bacterial infections. the group aims at investigating atomic structures, and assembly processes of such sophisticated assemblies. We develop and apply solid-state NMR to capture structural and dynamic details at the atomic scale. Our group is also involved in the production of large protein assemblies to solve their structures based on solid-state NMR methods. Molecular assemblies either involved in cellular processes or engineered by supramolecular chemistry constitute the current research activities.

Development of new solid-state NMR approachesSolid-state NMR has for a long time been limited to 13C and 15N detection, because the 1H proton line-width shows broadening due to incomplete averaging of several NMR interactions. Although the application of the so-called magic-angle spinning (called MAS) can drastically increase the 13C and 15N spectral resolution, 1H detection has still been very limited. In the past decade, the use of ultra-fast MAS frequencies (up to 60kHz) has revolutionized solid-state NMR investigations on microcrystalline samples, insoluble assemblies, and membrane proteins by improving sensitivity and reducing the amount of sample required. Up to 60 kHz MAS, optimal proton resolution requires extensive dilution of the proton dipolar interaction network. This can be achieved by complete or partial deuteration, where 1H can be reintroduced by chemical exchange with water. Due to this dilution requirement, only amide protons have been used for detection in sequence specific protein assignment strategies. Analogous to the case in solution NMR, resonance assignment proceeds efficiently using a series of 3D spectra with common 15N and 1H dimensions, and with a third dimension encoding 13Cα, 13C’ or 13Cβ of either the same or the preceding residue, allowing linking of sequential 15N-1H pairs. The upper limit of MAS frequency was recently increased to 111 kHz with the introduction of 0.7 and 0.8 mm probes, allowing higher sensitivity in multidimensional experiments and a further reduction of sample volume. Most importantly, this extends the methodology to fully protonated proteins, allowing the detection of alpha and side-chain protons at a resolution comparable with those of the amide groups. We are developing a strategy for 1H, 13C and 15N resonance assignment for fully protonated biological samples based on a suite of 3D spectra sharing Hα-Cα pairs as sensitive and resolved probes at >100 kHz MAS and high magnetic field. Importantly, this technique requires a sample amount < 500ug. We additionally use the same Hα-Cα resonances as a starting point for propagation of assignments throughout side-chains. We expect this approach to be of critical importance for the determination of protein structures by solid-state NMR, since no deuteration is required, which previously limited 1H detection-based strategies due to problems with expression yields, protein refolding and amide proton exchange. This work, performed in collaboration with the group of G. Pintacuda (CNRS, Lyon), was published in Angewandte Chemie.

NMR of Molecular Assemblies

Dr. Antoine LoquetSenior Research Associate (CR1), CNRS

Antoine Loquet graduated from the University of Lyon / Ecole Normale Supérieure de Lyon. He did his PhD (2006-2009) under the guidance of Anja Böckmann (IBCP Lyon), working on the development of solid-state NMR to solve protein structures. In 2008 he joined the group of Beat Meier (ETH Zürich) to study prion fibrils by solid-state NMR. He then focused his research on molecular assemblies by solid-state NMR as an EMBO postdoctoral fellow with Adam Lange at the Max Planck Institute for Biophysical Chemistry (Göttingen, Germany). There, he developed solid-state NMR methods to determine atomic structures of large biological supramolecular assemblies. He obtained a CNRS position in 2013 at the CBMN (Institute of Chemistry & Biology of Membranes & Nanoobjects) in Bordeaux. In 2014, he was recruited as a group leader at the IECB and since 2016, he is leading the group “NMR of Membranes and Protein Assemblies” at CBMN. His current research concentrates on the structural investigation of molecular assemblies using solid-state NMR.

Research teamJulie GEAN MUC (U. Bordeaux, IUT Perigueux)Axelle GRÉLARD Research Engineer IR1 (CNRS)Birgit HABENSTEIN Research Associate (CR2, CNRS)Denis MARTINEZ Postdoctoral fellow (CNRS)Ahmad SAAD PhD student (U. Bordeaux)Mélanie BERBON Engineer (CNRS)James TOLCHARD Postdoc (CNRS)Antoine DUTOUR Engineer (CNRS)

The team is part of the unit “Chemistry and Biology of Membranes & Nanoobjetcs” (CBMN), CNRS/Université Bordeaux/UNITAB (UMR CNRS 5248)


19

Characterization of a novel cell death-inducing amyloid.Recent findings have revealed the role of prion-like mechanisms in the control of host defense and programmed cell death cascades. In fungi, HET-S, a cell death-inducing protein containing a HeLo pore-forming domain, is activated through amyloid templating by a Nod-like receptor (NLR). Here we characterize the HELLP protein beha- ving analogously to HET-S and bearing a new type of N-terminal cell death-inducing domain termed HeLo-like (HELL) and a C-terminal regulatory amyloid motif known as PP. The gene encoding HELLP is part of a three-gene cluster also encoding a lipase (SBP) and a Nod-like receptor, both of which display the PP motif. The PP motif is similar to the RHIM amyloid motif directing formation of the RIP1/RIP3 necrosome in humans. The C-terminal region of HELLP, HELLP(215-278), encompassing the motif, allows prion propagation and assembles into amyloid fibrils, as demonstrated by X-ray diffraction and FTIR analyses. Solid-state NMR studies reveal a well-ordered local structure of the amyloid core residues and a primary sequence that is almost entirely arranged in a rigid conformation, and confirms a β-sheet structure in an assigned stretch of three amino acids. HELLP is activated by amyloid templating and displays membrane-targeting and cell death-inducing activity. HELLP targets the SBP lipase to the membrane, suggesting a synergy between HELLP and SBP in membrane dismantling. Remarkably, the HeLo-like domain of HELLP is homologous to the pore-forming domain of MLKL, the cell death-execution protein in necroptosis, revealing a transkingdom evolutionary relationship between amyloid-controlled fungal programmed cell death and mammalian necroptosis.

Study of an amyloid fold involved in signal transductionIn the fungus Podospora anserina, the [Het-s] prion induces programmed cell death by activating the HET-S pore-forming protein. The HET-s β-solenoid prion fold serves as a template for converting the HET-S prion-forming domain into the same fold. This conversion, in turn, activates the HET-S pore-forming domain. The gene immediately adjacent to het-S encodes NWD2, a Nod-like receptor (NLR) with an N-terminal motif similar to the elementary repeat unit of the β-solenoid fold. NLRs are immune receptors controlling cell death and host defense processes in animals, plants and fungi. We have proposed that, analogously to [Het-s], NWD2 can activate the HET-S pore-forming protein by converting its prion-forming region into the β-solenoid fold. Here, we analyze the ability of NWD2 to induce formation of the β-solenoid prion fold. We show that artificial NWD2 variants induce formation of the [Het-s] prion, specifically in presence of their cognate ligands. The N-terminal motif is responsible for this prion induction, and mutations predicted to affect the β-solenoid fold abolish templating activity. In vitro, the N-terminal motif assembles into infectious prion amyloids that display a structure resembling the β-solenoid fold. In vivo, the assembled form of the NWD2 N-terminal region activates the HET-S pore-forming protein. This study documenting the role of the β-solenoid fold in fungal NLR function further highlights the general importance of amyloid and prion-like signaling in immunity-related cell fate pathways.

Selected publications

NMR Spectroscopic Assignment of Backbone and Side-Chain Protons in Fully Protonated Proteins: Microcrystals, Sedimented Assemblies, and Amyloid Fibrils. (2016)Stanek J, Andreas LB, Jaudzems K, Cala D, Lalli D, Bertarello A, Schubeis T, Akopjana I, Kotelovica S, Tars K, Pica A, Leone S, Picone D, Xu ZQ, Dixon NE, Martinez D, Berbon M, El Mammeri N, Noubhani A, Saupe S, Habenstein B, Loquet A, Pintacuda G.Angew Chem Int Ed Engl.

Daskalov A, Habenstein B, Sabaté R, Berbon M, Martinez D, Chaignepain S, Coulary-Salin B, Hofmann K, Loquet A, Saupe SJ. (2016) Identification of a novel cell death-inducing domain reveals that fungal amyloid-controlled programmed cell death is related to necroptosis.Proc Natl Acad Sci U S A., 113(10):2720-5

Habenstein B, Loquet A. (2015) Solid-state NMR: An emerging technique in structural biology of self- assemblies. Biophys Chem., 210:14-26

Daskalov A, Habenstein B, Martinez D, Debets AJ, Sabaté R, Loquet A, Saupe SJ. (2015) Signal transduction by a fungal NOD-like receptor based on propagation of a prion amyloid fold. PLoS Biol., 13(2):e1002059

Habenstein B, Loquet A, Hwang S, Giller K, Vasa SK, Becker S, Habeck M, Lange A. (2015) Hybrid Structure of the Type 1 Pilus of Uropathogenic Escherichia coli. Angew Chem Int Ed Engl., 54(40):11691-5

Falson P, Bartosch B, Alsaleh K, Tews BA, Loquet A, Ciczora Y, Riva L, Montigny C, Montpellier C, Duverlie G, Pécheur EI, le Maire M, Cosset FL, Dubuisson J, Penin F. (2015) Hepatitis C Virus Envelope Glycoprotein E1 Forms Trimers at the Surface of the Virion. J Virol., 89(20):10333-46

Fasshuber HK, Lakomek NA, Habenstein B, Loquet A, Shi C, Giller K, Wolff S, Becker S, Lange A. (2015) Structural heterogeneity in microcrystalline ubiquitin studied by solid-state NMR. Protein Sci., 24(5):592-8


20

Aggregation of the amyloid-β peptide (Aβ) is recognized as paramount in the origin and progression of Alzheimer’s disease (AD). Specifically, Aβ oligomers, species formed early during Aβ aggregation, are considered the pathogenic molecular form of Aβ in AD. However, no major advances have been made in the rational design of therapeutic strategies targeting them. One of the main reasons for this failure is the lack of knowledge on the chemical and structural features responsible for Aβ oligomer neurotoxicity. Dr. Carulla´s team focuses on developing innovative chemical and structural biology strategies with the aim of obtaining a detailed molecular level understanding on Aβ oligomers.

Throughout this year, we have focused on the study of chemical modifications that affect the primary structure of Aβ oligomers caused by oxidative stress, and on the possibility that Aβ oligomers form in a membrane environment.

Figure 1 : The fate of Aβ oligomers in the brain. Middle: Schematics of Aβ aggregation into amyloid fibrils throughout the formation of diverse oligomers. Top: Aβ oligomers are chemically modified through covalent cross-linking. Bottom : Aβ oligomers interact with the membrane.

Cross-linked Aβ oligomersAβ dimers, the smallest Aβ oligomers, have been isolated from the brains of AD patients and have been shown to induce neurobiological effects characteristic of AD. Furthermore, the abundance of these dimers in brain tissue is strongly associated with this disorder. However, their exact molecular form has not been established. In this context, one of the biggest challenges has been to determine whether these dimers are non-covalent or covalently linked. Settling this question is critical because work with synthetic cross-linked (CL) Aβ dimers has revealed that the cross-link makes them more neurotoxic. Moreover, establishing that brain-derived dimers are cross-linked would facilitate their isolation and manipulation from biological fluids, thus making them suitable candidates for biomarker development.In the brain, CL Aβ dimers could form by means of hydroxyl radicals, one of the reactive oxygen species (ROS) formed as a result of oxidative stress. Notably, the reaction intermediates and products that lead to the formation of CL Aβ oligomers through

protein Aggregation and Disease

Dr. Natàlia CarullaIA recherche médicale : Fondation pour la Recherche Médicale

Natàlia Carulla obtained her B.Sc. in Chemistry from the University of Barcelona in 1996 and her Ph.D. in Biological Chemistry from the University of Minnesota in 2001. Afterwards, she moved to the University of Cambridge to work as a Marie Curie post-doctoral researcher in Prof. Christopher M. Dobson laboratory in the field of protein aggregation. In 2004, she returned to Barcelona to the laboratory of Prof. Ernest Giralt at IRB Barcelona, where she extended the project initiated in Cambridge. In 2011, she was awarded a Ramon y Cajal fellowship from the Spanish Government, which enabled her to start her own research program at IRB Barcelona. Since December 2016, she has been Group Leader at the Institut Européen de Chimie et Biologie (IECB).

Research team Dr Sonia CIUDAD Postdoctoral fellow (IRB Barcelona & CNRS)Martí NINOT PhD student (IRB Barcelona & CNRS)Eduard PUIG PhD student (IRB Barcelona & CNRS)

The team is part of the unit “Chimie et Biologie des Membranes et Nanoobjets” (CBMN), CNRS/Univ. Bordeaux/IPB (UMR CNRS 5248)

pole 1 - Structural Biology & Biophysics

21

hydroxyl radicals under oxidative stress conditions are the same as those proposed by means of the photo-induced cross-linking of unmodified proteins (PICUP) reaction. We have taken advantage of this parallelism to optimize the PICUP reaction as well as a subsequent fractionation protocol. This has allowed us to prepare well-defined synthetic CL Aβ dimers, trimers, and tetramers. These samples will be essential to set up methodologies to later prove the presence of CL Aβ dimers in the brains of AD.

Figure 2 : Preparation of well-defined synthetic CL Aβ dimers, trimers, and tetramers by means of the PICUP reaction followed by a disaggregation treatment and by Size Exclusion Chromatography (SEC) fractionation.

Membrane-associated Aβ oligomersThe brains of millions of people suffering from AD are slowly being depleted of neurons. However, the exact cause of neuronal death is still unknown. Specifically, numerous studies propose that the interaction of Aβ oligomers with the neuronal membrane causes neurotoxicity. However, the exact structural features responsible for Aβ oligomer membrane neurotoxicity remain unknown.To contribute to this area of research, we worked with the two major Aβ variants, Aβ40 and Aβ42, of 40 and 42 residues long, respectively. Aβ40 is the most abundantly produced while Aβ42 is the most strongly linked to the origin of AD. By working under biomimetic membrane conditions, we established that Aβ40 and Aβ42 exhibited very different behaviour. Aβ40 aggregated into amyloid fibrils. This type of aggregates corresponds to the end product of Aβ aggregation, which does not correlate with AD severity. Instead, Aβ42 formed stable oligomers that adopt a specific barrel-like structure. This type of structure—which is present in other proteins found in nature— has the capacity to form pores in cell membranes. In the context of AD, this discovery suggests that this oligomer can perforate the membrane of neurons, alter the equilibrium of these cells, and trigger their death. We named this type of oligomer as β-barrel Pore-Forming Aβ42 Oligomers (βPFOsAβ42). Notably, since Aβ42, relative to Aβ40, has a more prominent role in AD, the higher propensity of Aβ42 to form βPFOsAβ42 constitutes a first indication of βPFOsAβ42 relevance in AD.

Figure 3 : Figure 3. Evolution of Aβ40 and Aβ42 under optimized micelle conditions, mimicking a membrane environment. After incubation for 24 h at 37°C, Aβ40 aggregates into amyloid fibrils (top) while Aβ42 assembles into specific pore-forming β-barrel oligomers, βPFOsAβ42 (bottom).

Having optimized conditions for the preparation of stable βPFOsAβ42, the next steps involve obtaining the 3D structure of the oligomer and studying the role of this oligomer in relevant models of AD. These will be decisive experiments for the validation of βPFOsAβ42 as a therapeutic target for AD.

Selected publicationsSerra-Batiste, M.; Garcia-Castellanos R.; Ninot-Pedrosa, M.; Serra-Vidal B., Berrow, N.S.; Carulla, N. Alzheimer’s disease-associated Aβ42 peptide: expression and purification for NMR structural studies Curr. Chem. Biol. (2017) in press.

Serra-Batiste, M.; Bayoumi, M.; Gairí, M.; Ninot-Pedrosa, M.; Maglia, G., Carulla, N. Aβ42 assembles into specific β-barrel pore-forming oligomers in membrane-mimicking environments Proc. Natl. Acad. Sci. USA 113, 10866-10871(2016).

Pujol-Pina, R.#; Vilaprinyó-Pascual, S.#; Mazzucato, R.; Arcella, A.; Vilaseca, M.; Orozco, M.; Carulla, N. (#both authors contributed equally to this work) SDS-PAGE analysis of Aβ oligomers is disserving research into Alzheimer´s disease: appealing for ESI-IM-MS Sci. Rep. 5, 14809 (2015).

pole 1 - Structural Biology & Biophysics

22 pole 1 - Structural Biology & Biophysics

Dr. Rémi FronzesSenior Research Associate (CR1), CNRS

Rémi Fronzes has a long-term research experience in biochemistry and structural biology of macromolecular assemblies. He trained as a membrane protein biochemist during his PhD in Bordeaux (France). In 2005, he moved to Gabriel Waksman’s laboratory at the Institute of Structural and Molecular Biology in London (UK) to work as a postdoctoral research associate. In 2009, he was appointed as a junior research scientist at the CNRS (Centre National de la Recherche Scientifique) and as a group leader at institut Pasteur, in Paris (France). In October 2009, he set up his independent research group at institut Pasteur. In 2011, he was awarded a ERC (European Research Council) starting grant. In 2015, Rémi Fronzes was awarded a “Chaire d’excelence Senior” by the university of Bordeaux and Aquitaine regional Council. he moved his research group to IECB and CNRS unit UMR 5234 “Microbiologie Fondamentale et Pathogénicité” in july 2016. In 2017, he was awarded a ERC consolidator grant.

Research team Dr Esther MARZA Conference master (Univ. Bordeaux)Prof. Jean-Paul BOURDINEAUD Teacher (Univ. Bordeaux)Dr Chiara RAPIDARDA Postdoctoral Fellow (Univ. Bordeaux)Thomas PERRY PhD student (Univ. Pierre & Marie Curie)Pauline PONY Master student (Univ. Bordeaux)

The team is part of the unit “Microbiologie Fondamentale et Pathogénicité”, UMR5234.

the group “Structure and function of bacterial nanomachines” aims at understanding how macromolecules are transferred through the bacterial cell envelope.Over the years, we have been interested in the structure of the type 4, type 6 and type 8 secretion systems. these systems are involved in the transfer of proteins through the cellular envelope of Gram-negative bacteria. We are also very interested in understanding how DNA can be uptaken and recombined in the bacterial genome during bacterial transformation.

Over 7 years, our research aimed at answering a simple question. How macromolecules are transferred through the bacterial cell envelope? Indeed, we study the structure and function of several bacterial secretion systems as well as of the apparatus involved in bacterial transformation (DNA uptake and recombination). Recently, we have been interested in the structure of the Type 4 and Type 6 secretion systems. These systems are involved in the transfer of proteins through the cellular envelope of Gram-negative bacteria.

- Type 4 secretion (T4S) systems mediate bacterial conjugation and are used by many bacterial pathogens to infect their host cells. As a post-doc in Gabriel Waksman’s laboratory in London (UK), Rémi Fronzes isolated the core complex of the T4S machinery (3 out of 12 proteins composing the T4SS). In tight collaboration with Waksman’s team, we deployed a tremendous effort to isolate a complete T4SS. Eventually, we managed to isolate a membrane complex of 3 MDa in which just two of the T4S components were missing. We determined the first structure of this complex using electron microscopy (Nature 2014).

- The bacterial Type 6 secretion (T6S) system is one of the key players for microbial competition, as well as an important virulence determinant during bacterial infections. It assembles a nano-crossbow-like structure that propels an arrow made of Hcp tube and VgrG spike into the cytoplasm of the attacker cell and punctures the prey’s cell wall. The nano-crossbow is stably anchored to the cell envelope of the attacker by a membrane core complex. In collaboration with Eric Cascales’ laboratory in Marseille (France), we recently have shown that this membrane complex is assembled by the sequential addition of three proteins -TssJ, TssM and TssL- and presented a structure of the fully assembled complex (Nature 2015).

We are also very interested in understanding how DNA can be uptaken and recombined in the bacterial genome during bacterial transformation. Natural genetic transformation, first discovered in Streptococcus pneumoniae by F. Griffith in 1928, is observed in many Gram-negative and Gram-positive bacteria. This process promotes genome plasticity and adaptability. In particular, it enables many human pathogens such as Streptococcus pneumonia, Neisseria gonorrhoeae or Vibrio Cholerae to acquire resistance to antibiotics and/or to escape vaccines through the binding and incorporation of new genetic material. While it is well established that this process requires the binding, internalization of external DNA and its recombination in the bacterial genome, the molecular details of these steps are unknown. In this project, we aim at acquiring a detailed understanding of each of these steps. We discovered a new appendage at the surface of S. pneumoniae cells and showed that this appendage is similar in morphology and composition to appendages called Type IV pili commonly found in Gram-negative bacteria. We

Structure and Function of Bacterial Nano-Machines

23pole 1 - Structural Biology & Biophysics

demonstrated that this new pneumococcal pilus is essential for transformation and that it directly binds DNA (PLOS Pathogens 2013 and 2015). We are also actively studying the DNA translocation apparatus. We isolated most of its components and are in the process of determining their structure and studying their function in vitro and in vivo. Finally, we identified a new key ATPase involved in the recombination process. We determined the crystal structure of this protein and identified its function in vitro and in vivo in collaboration with Patrice Polard’s team in Toulouse (France).

Selected publicationsLéa Marie, Chiara Rapisarda, Violette Morales, Mathieu Bergé, Thomas Perry, Anne-Lise Soulet, Clémence Gruget, Han Remaut, Rémi Fronzes* & Patrice Polard*. Nature Communications, 2017, In Press

Durand E, Nguyen VS Zoued A, Logger L, Péhau-Arnaudet G, Aschtgen MS, Spinelli S, Desmyter A, Bardiaux B, Dujeancourt A, Roussel A, Cambillau C*, Cascales E*, Fronzes R*. Biogenesis and structure of a type VI secretion membrane core complex. Nature. 2015 Jul 30;523(7562):555-60. doi: 10.1038/nature14667. Epub 2015 Jul 22.

Laurenceau R, Krasteva P*, Ouarti S, Malosse Ch, Duchateau M, Chamot-Rooke J, Fronzes R*. Streptococcus pneumoniae Spirosomes Suggest a Single Type of Transformation Pilus in Competence. PLoS Pathog. 2015 Apr 15;11(4):e1004835.

Low HH, Gubellini F, Rivera-Calzada A, Braun N, Connery S, Dujeancourt A, Lu F, Redzej A, Fronzes R*, Orlova E*, Waksman G*. Structure of a type IV secretion system. Nature, 2014 Apr 24;508(7497):550-3.

Goyal P, V. Krasteva P, Nani Van Gerven, Gubellini F, Van den Broeck I, Troupiotis-Tsaïlaki A, Jonckheere W, Péhau-Arnaudet G, S. Pinkner J, R. Chapman M, J. Hultgren S, Howorka S, Fronzes R*, Remaut H*. Structural and mechanistic insights into the bacterial amyloid secretion channel CsgG. Nature, 2014 Dec 11, 516:250-3. doi: 10.1038/nature13768.

Laurenceau R, Péhau-Arnaudet G, Baconnais S, Gault J, Malosse C, Dujeancourt A, Campo N, Chamot-Rooke J, Le Cam E, Claverys JP, Fronzes R*.A type IV pilus mediates DNA binding during natural transformation in Streptococcus pneumoniae. PLoS Pathog. 2013 Jun;9(6):e1003473.

24

Foldamers – artificial folded molecular architectures – have shifted our knowledge of biopolymer folding in showing that molecular backbones chemically remote from those that nature uses are also able to adopt secondary and tertiary structures. Our group has developed several families of aromatic oligoamides which fold into exceptionally stable, predictable, and tunable conformations. Our current efforts aim at exploring how these aromatic oligoamides may mimic protein tertiary structures and functions, and nucleic acids hybridized architectures, and at investigating their molecular recognition properties and potential biological applications as, for example, ligands for G-quadruplex DNA or protein-protein interaction inhibitors.

Nanosized foldamer assemblies by translation of rod-like template sequences. We have developed a method to construct large molecular structures through the self-assembly of helical sub-components around a molecular strand that serves as a template. This approach represents an important advance in the fabrication of nanometric objects with atomic precision (Nat. Nanotech 2017). The strategy consists in controlling helix self-assembly along a molecular strand thanks to dedicated binding sites that can each be specific to a helix type, e.g. according to helix length, single or double helical nature, or handedness. The resulting assemblies may serve as scaffolds onto which functional groups can be attached at precise positions in space across nanometric distances).

Interactive structure-based receptor design. The group routinely prepares a number of heterocyclic amino acid monomers (quinoline, pyridine, naphthyridines, aza-anthracenes…) for the synthesis of aromatic amide foldamers. Monomers notably differ from one another in that they code for helices of various diameters. We have introduced the concept of molecular containers built from the folding of an oligomer into a helix whose diameter is large in the center and small at the ends, and investigated the diastereoselective recognition of chiral guests within these containers. We have shown that structural information, in particular crystal structure of the host-guest complexes, allows for interative improvements of the receptors’selectivty for a given guest. After a first example targeted to monosaccharide fructo-pyranose (Nat. Chem. 2015), we successfully applied this approach to produce a receptor that discriminates malic acid form tartaric acid, two molecules that differ by a single oxygen atom (J. Am. Chem. Soc. 2016).

Electron transfer and hole migration in nanosized helical aromatic oligoamide foldamers. Long helical aromatic foldamers spanning up to 13 helix turns have been synthesized and equipped with donor and acceptor chromophores. Time-resolved fluorescence and transient absorption spectroscopic studies showed that these foldamers achieve long

Biomimetic Supramolecular Chemistry

Dr. Ivan HucResearch Director (DR1), CNRS

Ivan Huc was born in Besançon, France, in 1969. He studied chemistry at the Ecole Normale Supérieure (Paris, France) and received his PhD in 1994 from the Univ. Pierre & Marie Curie (Paris) for research work carried out both at the Ecole Normale Supérieure and at the Massachusetts Institute of Technology (Cambridge, USA). He spent one year as a post-doc in Strasbourg Univ., then was offered a tenured CNRS researcher position and later obtained his habilitation there. Since 1998, he has been a group leader at the European Institute of Chemistry and Biology (Univ. of Bordeaux, France) where he holds a CNRS research director position. In 2008, he started to serve as co-director of IECB. His current research interests are foldamers and the biomimetic chemistry of peptides and nucleotides.

Research teamDr. Yann FERRAND Senior Research Associate (CR1, CNRS)Dr. Victor MAURIZOT Senior Research Associate (CR1, CNRS)Dr. Lucile FISCHER Senior Research Associate (CR1, CNRS)Dr. Eric MERLET Assistant Engineer (CNRS)Dr. Subrata SAHA Postdoctoral fellow (CNRS)Dr. Soumen DE Postdoctoral fellow (CNRS)Dr. Pedro MATEUS Postdoctoral fellow (CNRS)Dr. Pradeep MANDAL Postdoctoral fellow (CNRS) Dr. Valentina CORVAGLIA Postdoctoral fellow (CNRS) Dr Albano GALAN Postdoctoral fellow (Univ. Bordeaux)Dr Barbara WICHER Research Engineer (CNRS)Dr. Sunbum KWON Postdoctoral fellow (CNRS)Dr. Michal JEWGINSKI Postdoctoral fellow (Polish Gov.)Xiaobo HU PhD Student (Univ. Bordeaux)Jinhua WANG PhD Student (Univ. Bordeaux)Maelle VALLADE PhD Student (Univ. Bordeaux)Antoine JACQUET PhD Student (Univ. Bordeaux)Arthur LAMOUROUX PhD Student (Univ. Bordeaux)Antoine MEUNIER PhD Student (Univ. Bordeaux)Xiang WANG PhD Student (Univ. Bordeaux)

This team is part of the joint research unit “Chimie et Biologie des Membranes et Nanoobjets” (CBMN), CNRS/Univ. Bordeaux/IPB (UMR CNRS 5248)

pole 2 - Organic & Bioorganic Chemistry

25

range (300 Å through bonds) transport of holes at very fast rates upon photo-excitation (J. Am. Chem. Soc. 2016). Charge transport follows a hopping mechanism reminiscent of the charge transport mechanism observed in DNA. Recent extensions of this work entail the fabrication of foldamer monolayers on gold substrates and the demonstration by conducting atomic force microscopy of fast charge transport with weak length dependence through these monolayers that thus constitute a first example of foldamer-based metal-organic-metal junction.

Foldamer-protein recognitionIn a joint effort with biocrystallographers at CBMN (CNRS-Univ. Bordeaux, France), and biomolecular NMR specialist Dr. C. Mackereth at IECB, we have identified foldamers that interact with a protein surface and characterized the structure of protein-foldamer complexes by single crystal x-ray diffraction in the solid state and by NMR in solution. We used carbonic anhydrase as a model protein. Foldamers were tethered to the protein surface through the covalent attachment of a nanomolar ligand of the protein active site and foldamer-protein interactions were screened by detecting induced circular dichroism, i.e. the emergence of a preferred foldamer helix handedness induced by interactions with chiral groups at the protein surface. A first study revealed protein-foldamer complexes with 2:2 stoichiometry (Angew. Chem. Int. Ed. 2014, ChemBioChem 2016). Subsequent efforts unraveled complexes with intriguing 2:3 and 2:2:1 stoichiometries (J. Am. Chem. Soc. 2017). This ensemble of results represents a major milestone towards the design of medium-sized synthetic ligands for protein surfaces.


Quan G, Wang X, Kauffmann B, Rosu F, Ferrand Y, Huc I. Translation of rod-like template sequences into homochiral assemblies of stacked helical oligomers. Nat. Nanotech 2017.

Jewginski M, Granier T, Langlois d’Estaintot B, Fischer L, Mackereth CD, Huc I. Self-assembled protein-aromatic foldamer complexes with 2:3 and 2:2:1 stoichiometries. J. Am. Chem. Soc. 2017;139:2928

Chandramouli N, Ferrand Y, Lautrette G, Kauffmann B, Mackereth CD, Laguerre M, Dubreuil D, Huc I. Structure-based iterative evolution of a helically folded aromatic oligoamide sequence for the selective encapsulation of fructose. Nat. Chem. 2015;7:334.

Mandal PK, Collie G, Huc I. Racemic DNA crystallography. Angew. Chem. Int. Ed. 2014;53:14424.

Li X, Markandeya N, Jonusauskas G, McClenaghan ND, Maurizot V, Denisov SA, Huc I. Photoinduced electron transfer and hole migration in nanosized helical aromatic oligoamide foldamers. J. Am. Chem. Soc. 2016;138:13568

Sebaoun L, Maurizot V, Granier T, Kauffmann B, Huc I. Aromatic Oligoamide β-Sheet Foldamers. J. Am. Chem. Soc. 2014;136:2168.

Tsiamantas C, de Hatten X, Douat C, Kauffmann B, Maurizot V, Ihara H, Takafuji M, Metzler-Nolte N, Huc I. Selective dynamic assembly of disulfide macrocyclic helical foldamers with remote communication of handedness. Angew. Chem. Int. Ed. 2016;55:6848.

Li X, Qi T, Srinivas K, Massip S, Maurizot V, Huc I. Segment doubling synthesis and multi-bromination of nanosized helical aromatic amide foldamers. Org. Lett. 2016;18:1044.


26

the ability of the peptide chain to fold correctly into well-ordered tertiary structures that can ultimately assemble into defined quaternary structures is a major determinant of protein function. Multiple approaches, at the interface between biology, synthetic organic and polymer chemistries are currently explored to elaborate synthetic systems with protein-like structures and functions. By using peptidomimetic chemistry, the general aims of our research are (i) to create folded systems mimicking protein secondary structure elements, (ii) to understand how to program folded molecules with the ability to assemble into complex and functional nanostructures, (iii) to design effective protein mimics, and (iv) to study molecular recognition properties and develop biomedical applications.

Our main line of research focuses on Peptidomimetic and Foldamer Chemistry and more specifically on aliphatic oligourea foldamers. We are now using the knowledge gained from earlier structural studies to develop functional foldamers. Early work in this direction led to the discovery of cationic amphiphilic helices mimicking antimicrobial peptides (J Med Chem 2016) and to sequences that interact with plasmid DNA for the delivery of nucleic acids (Angew Chem 2015). The finding that oligourea foldamers can be interfaced with peptide helices is another feature of particular significance in the context of peptide and protein mimicry (Highlight #1). We have also shown that the helical oligourea backbone is well pre-organized for anion recognition (Highlight #2). A recent focus of our research is the design of amphiliphilic water-soluble foldamer sequences for the precise construction of nanometer scale assemblies mimicking protein quaternary structures (Highlight#3). X-ray crystallography has played a major role in this research and we have described practical approaches that facilitated crystallization and structure determination of amphiphilic water-soluble oligoureas (Chem Commun & Chem Sci. 2016).

2016 HIGHLIGHTS:

Highlight #1 : Chimeric α-Peptide/Oligourea HelicesWe have obtained very promising results trying to interface urea-based foldamers with α-peptides (Angew Chem 2015 & C R Chimie 2016). The rationale was that the oligourea helix shares a number of features with the α-helix such as helix polarity and pitch. In this work (see Figure 1), we have investigated the ability of aliphatic oligoureas fused to short peptide segments to nucleate α-helical structures. We found that the resulting chimeras were fully helical in the solid state as well as in polar solvents, with as few as three urea units sufficient to propagate an α-helical conformation in the fused peptide segment. The remarkable compatibility of α-peptide and oligourea backbones, along with the simplicity of the technology is of particular significance for future applications of foldamers in biology and medicine including the inhibition of protein-protein interactions (PPIs).

peptidomimetic Chemistry

Dr. Gilles GuichardResearch Director (DR1), CNRS

Gilles Guichard graduated in chemistry from the Ecole Nationale Supérieure de Chimie in Toulouse (1991) and Univ. Montpellier (1992) in France. He received his PhD from the Univ. Strasbourg (1996), working on immune recognition of pseudopeptides and synthetic vaccines. Following post-doctoral research with Prof. Dieter Seebach at the ETH in Zürich (1997) in the field of β-peptide foldamers, he joined the Institut de Biologie Moléculaire et Cellulaire (IBMC) in Strasbourg as a CNRS Chargé de Recherche (1998). Since 2006, he has been a CNRS Research Director. In 2009, he joined CBMN and moved as a new group leader to the Institut Européen de Chimie et Biologie (IECB) in Bordeaux. His current research focuses on biomimetic chemistry of peptides, foldamer chemistry, self-assembled nanostructures and recognition of biological surfaces.

Research teamDr. Céline DOUAT Senior Research Associate (CR1, CNRS)Dr. Christel DOLAIN Lecturer (MCU, Université Bordeaux)Dr. Morgane PASCO Research Associate (CR2, CNRS)Dr Jérémie BURATTO Postdoctoral fellow (Univ. Bordeaux)Dr Christophe ANDRÉ Postdoctoral fellow (Univ. Bordeaux)Julen ETXABE PhD student (CNRS)Laura MAURAN PhD student (UREkA - ANRT)Diane BÉCART PhD student (Univ. Bordeaux)Johanne MBIANDA PhD student (Ligue contre le cancer)Léonie CUSSOL PhD student (Univ. Bordeaux)Camille PERDRIAU PhD student (CNRS)Mégane BORNERIE Phd student (Univ. Bordeaux)Ivan BORIC Phd (Univ Bordeaux / Univ. Belgrade)Ana VAZQUEZ ALBISU Phd Student (Univ. of Basque Country / CNRS)

The team is part of the unit “Chimie et Biologie des Membranes et Nanoobjets” (CBMN), CNRS/Université Bordeaux/Bordeaux INP (UMR 5248)


27Selected publicationsDiemer, V.; Fischer, L.; Kauffmann, B.; Guichard, G., Anion Recognition by Aliphatic Helical Oligoureas, Chem. Eur. J. 2016, 22, 15684-15692.

Lombardo, C. M.; Collie, G. W.; Pulka-Ziach, K.; Rosu, F.; Gabelica, V.; Mackereth, C. D.; Guichard, G., Anatomy of an Oligourea Six-Helix Bundle, J. Am. Chem. Soc. 2016, 138, 10522-10530.

Collie, G. W.; Pulka-Ziach, K.; Guichard, G., Surfactant-facilitated crystallisation of water-soluble foldamers, Chem. Sci. 2016, 7, 3377-3383.

Collie, G. W.; Pulka-Ziach, K.; Guichard, G. In situ iodination and X-ray crystal structure of a foldamer helix bundle. Chem. Commun. 2016, 52, 1202-1205.

Collie, G. W.; Pulka-Ziach, K.; Lombardo, C. M.; Fremaux, J.; Rosu, F.; Decossas, M.; Mauran, L.; Lambert, O.; Gabelica, V.; Mackereth, C. D.; Guichard, G. Shaping quaternary assemblies of water-soluble non-peptide helical foldamers by sequence manipulation. Nat Chem 2015, 7, 871-878.

Mauran, L.; Kauffmann, B.; Odaert, B.; Guichard, G., Stabilization of an α-helix by short adjacent accessory foldamers, C. R. Chimie 2016, 19, 123-131.

Fremaux, J.; Mauran, L.; Pulka-Ziach, K.; Kauffmann, B.; Odaert, B.; Guichard, G. α-Peptide–Oligourea Chimeras: Stabilization of Short α-Helices by Non-Peptide Helical Foldamers. Angew. Chem. Int. Ed. 2015, 54, 9816-9820.

Teyssières, E.; Corre, J.-P.; Antunes, S.; Rougeot, C.; Dugave, C.; Jouvion, G.; Claudon, P.; Mikaty, G.; Douat, C.; Goossens, P. L.; Guichard, G., Proteolytically Stable Foldamer Mimics of Host-Defense Peptides with Protective Activities in a Murine Model of Bacterial Infection, J. Med. Chem. 2016, 59, 8221-8232.

Douat, C.; Aisenbrey, C.; Antunes, S.; Decossas, M.; Lambert, O.; Bechinger, B.; Kichler, A.; Guichard, G. A Cell-Penetrating Foldamer with a Bioreducible Linkage for Intracellular Delivery of DNA. Angew. Chem. Int. Ed. 2015, 54, 11133-11137.

Nelli, Y. R.; Antunes, S.; Salaün, A.; Thinon, E.; Massip, S.; Kauffmann, B.; Douat, C.; Guichard, G. Isosteric Substitutions of Urea to Thiourea and Selenourea in Aliphatic Oligourea Foldamers: Site-Specific Perturbation of the Helix Geometry. Chem. Eur. J. 2015, 21, 2870-2880.

Fig. 1 : Crystal structure of a α-helix (green) stabilized by two short adjacent accessory foldamers (grey).

Highlight #2 : Anion recognition by oligourea helicesLike other helical peptidomimetic foldamers, oligoureas typically mediate molecular recognition events through arrays of side chains displayed at the helix surface. We have now shown (Chem Eur J 2016) that the main chain itself is well suited to bind small guest molecules such as anions (Figure 2). 1H NMR studies in various organic solvents including DMSO revealed that anions bind at the positive end of the helix macrodipole without causing significant helix disruption. These findings pave the way for new developments of aliphatic oligourea helices in areas such as chiral ion recognition, sensing, anion transport, and catalysis. One noteworthy example in this direction is the recent finding that a screw-sense preference may be inducedin achiral meso-oligourea helices by selective formation of a 1:1 hydrogen-bonded complex with a chiral carboxylate anion (Angew Chem 2016).

Fig. 2 : Schematic principle for anionic guest recognition by aliphatic oligourea helices.

Highlight #3 : Self-assembly of Amphiphilic Non-peptide Helical FoldamersTaking inspiration from protein tertiary and quaternary structures, we have successfully transposed folding and assembly processes to artificial (non-peptide) molecular chains to create nanostructures with unusual shapes (e.g. bundles or nanotubular assemblies) in aqueous conditions (Nature Chem, 2015, Chem Commun 2016, J. Am. Chem. Soc. 2016). Several high-resolution crystal structures of unique foldamer quaternary arrangements have been described, supported by high-field NMR and electron microscopy studies (Figure 3). The sequences of these oligomers were designed to contain a certain proportion of residues with polar and nonpolar side chains which depending on their arrangement at the surface of the helix determine how the helices self-assemble in water. Synthesis automation together with sequence diversity suggests that the approach could be used to generate a much broader range of architectures with different stoichiometries, new geometries, functional properties and, consequently, applications.

Fig. 3 : Assemblies of designed amphiphilic oligoureas.


28

Glycans are chains of monosaccharides that are covalently linked to cell surface proteins and lipids. they have been recognized as key participants in cell-cell communications and for instance, in the brain, are crucial mediators in neurite outgrowth, synapse formation and plasticity. From a pathological point of view, changes in the neuro-glycome of cells are associated with developmental disorders, can mark the onset of glioma and neuro-inflammation. Despite these intriguing observations, the molecular mechanisms by which these complex carbohydrates influence neural cells are not well understood due to a lack of suitable biochemical methods. We aim at unravelling the functional roles of glycans in the nervous system by exploiting organic chemistry to develop novel tools that can probe glycans in the brain.

Imaging glycans: a daunting taskAlthough protein tracking in living cells has become routine experiments in cell biology laboratories thanks to the utilization of genetic reporters (i.e., fusion proteins such as GFP), glycans are, unfortunately, not amenable to these imaging techniques, as they are not directly encoded in the genome.As an emerging alternative, the bioorthogonal chemical reporter strategy, which elegantly combines the use of metabolically labeled azido sugars and highly reactive cyclooctyne probes, through strain-promoted alkyne azide cycloadditions (SPAAC), is a versatile technology for labeling and visualizing glycans. However, cyclooctyne probes are often highly hydrophobic, which can promote their sequestration by membranes, thereby increasing background signal. To address these difficulties, we have developed two novel dibenzocyclooctynes: 1) a highly polar O-sulphated-dibenzocyclooctyne (S-DIBO) and 2) a fluorogenic cyclooctyne (Fl-DIBO) that generate strongly fluorescent labeled products.

S-DIBO: the first water soluble cyclooctyne probe We designed an efficient synthetic route for introducing hydrophilic O-sulfate functionalities onto the aromatic rings of the parent dibenzocyclooctyne probe (DIBO). The novel highly polar sulfated probe (S-DIBO) (J. Am. Chem. Soc. 2012) was found to be fully soluble in aqueous medium, making its utilization optimum for biological applications. While employing S-DIBO for the labeling of azido- glycoconjugates in living cells, we uncovered that the substitution pattern of the dibenzylcyclooctyne probes can strongly influence their subcellular location. In particular, we showed that DIBO can enter cells, thereby labeling intra- and extracellular azido-modified glycoconjugates, whereas S-DIBO cannot pass the cell membrane and therefore is ideally suited for selective labeling of cell surface molecules.

Chemical Neuroglycobiology

Dr. Frédéric FriscourtATIP-Avenir, CNRS / Univ. Bordeaux

Frédéric Friscourt received his PhD from the University of Glasgow, UK in 2009, under the guidance of Prof. P. Kočovský, on the development of novel chiral ligands for enantioselective catalysis. He then joined the group of Prof. G-J. Boons at the Complex Carbohydrate Research Center, GA, USA, as a post-doctoral research associate (2009-2014) in order to transition to chemical biology research. There, he became involved in the design of probes for imaging the glycome. In 2014, he obtained a Junior Chair of Excellence from the University of Bordeaux and was soon after recruited as a group leader at the IECB in Bordeaux. He recently received the prestigious CNRS-ATIP-Avenir award (2017). His current research focuses on using organic chemistry to develop novel tools that can probe the influence of glycans in the brain, notably in neuro-disorders.

Research teamDr. Jürgen SCHULZ Research Engineer (IR2) (CNRS)Dr. Meriem SMADHI Postdoctoral fellow (Université Bordeaux)Camille FAVRE PhD Student (Université Bordeaux)Lucie de CREMOUX IUT Student (Université Paris Sud)

This team is part of the “Institut de Neurosciences Cognitives et Intégratives d’Aquitaine” (INCIA), CNRS/Université Bordeaux (UMR5287).


29

Fl-DIBO: a fluorogenic cyclooctyne probeFluorogenic bioorthogonal reactions, in which non- or weakly fluorescent reagents produce highly fluorescent products, offer therefore the unique opportunity to label biomolecules without the need for probe washout. We have recently developed a fluorogenic cyclooctyne Fl-DIBO (J. Am. Chem. Soc. 2012), which upon reaction with an azide, can produce a cycloaddition product that is more than 1000-fold brighter compared to the unreacted reagent. Interestingly, where cycloadditions of Fl-DIBO with other dipoles such as nitrones, nitrile oxides or di-substituted diazo reagents mostly generate quenched cycloadducts, reactions of mono-substituted diazo compounds with Fl-DIBO give highly fluorescent 1H-pyrazoles (10,000 times brighter than Fl-DIBO) (Chem. Eur. J 2015).

Fl-DIBO for the detection of inorganic azidesOn/Off fluorescent probes are ideal for fast and inexpensive in-field detections of contaminants in samples of interest. Due to recent poisoning reports regarding ingestion of inorganic azides, we have decided to employ our fluorogenic probe Fl-DIBO for a quick and easy detection of sodium azide in aqueous solution. Although 1,3-dipolar cycloadditions with azide anions are known to be sluggish compared to their organic azido-counterparts, a strong fluorescence emission was immediately detected upon reaction between Fl-DIBO and sodium azide. The probe was found to be highly selective toward inorganic azide in comparison to other common anions with good sensitivity and a low detection limit of 10 μM.To test the utility of our novel azido-sensor in real life, we analyzed the presence of various concentrations of sodium azide in tea samples. Increase in fluorescence intensity was linearly proportional to the azido concentration with a sensitivity in pair within the pathologically relevant range. The fluorescence emission was easily observed by the naked eye using a hand-held UV lamp (λexc=365 nm) (Bioorg. Med. Chem. Lett. 2016).


Lorenz H, Price M, Mastour N, Brunet J-F, Barrière G, Friscourt F, Badaut J (2016) Increase of Aquaporin 9 Expression in Astrocytes participates in Astrogliosis, J. Neurosci. Res., Manuscript accepted

Wang K, Friscourt F, Dai C, Wang L, Zheng Y, Boons G-J, Wang S, Wang B (2016) A metal-free turn-on fluorescent probe for the fast and sensitive detection of inorganic azides. Bioorg. Med. Chem. Lett., 26: 1651-1654.

Friscourt F, Fahrni CJ, Boons G-J (2015) Fluorogenic strain-promoted alkyne-diazo cycloadditions. Chem. Eur. J., 21: 13996-14001.

Ledin PA, Xu W, Friscourt F, Boons G-J, Tsukruk VV. (2015) Branched polyhedral oligomeric silsesquioxane nanoparticles prepared via strain-promoted 1,3-dipolar cycloadditions. Langmuir, 31: 8146-8155.

Friscourt F, Boons G-J (2013) Bioorthogonal reactions for labeling glycoconjugates. Click chemistry in glycoscience: John Wiley & Sons, Inc, Chapter 8: 211-233.

Friscourt F, Fahrni CJ, Boons G-J (2012) A fluorogenic probe for the catalyst-free detection of azide-tagged molecules. J. Am. Chem. Soc., 134: 18809-18815.

Friscourt F, Ledin PA, Mbua NE, Flanagan-Steet HR, Wolfert MA, Steet R, Boons G-J (2012) Polar dibenzocyclooctynes for selective labeling of extracellular glycoconjugates of living cells. J. Am. Chem. Soc., 134: 5381-5389.


30

the lab studies molecular details of large protein-nucleic acid macromolecules and other complexes using a variety of new NMR techniques as well as established biophysical approaches. For large complexes, we combine small angle neutron or X-ray scattering (SANS/SAXS), NMR paramagnetic spin labeling to acquire information on long-range contacts, as well as in vitro mutational analysis and other binding assays. Equally important to the lab is the traditional strength of NMR as a tool to probe the dynamics of biological samples, the characterization of transient interactions, and the possibility to look at structures that exhibit a significant amount of unstructured elements.

Molecular details of RNA binding.A major focus of the group continues to be the study of protein-RNA interactions, especially those involved in tissue-specific alternative splicing. In general, precise regulation of mRNA processing, translation, localization, and stability, relies on specific and regulated interactions with RNA-binding proteins. The biological function of these proteins, along with their target preferences, are determined by their preferred RNA motifs. This year we have published our work on the RBPMS protein family, including the MEC-8 splicing factor from the small worm C. elegans, as well as couch potato from the fruit fly Drosophila melanogaster, and human RBPMS (RNA-binding protein with multiple splicing). These proteins play important roles in tissue development in many species, and includes normal human development. To determine the molecular basis for how this protein interacts with RNA, we have collected atomic details of the RNA-binding domain common to all family members.

Fig. 1 : From Soufari and Mackereth, RNA, 23:308-316.

NMR Spectroscopy of protein-Nucleic Acid Complexes

Dr. Cameron MackerethSenior Research Associate (CR1), INSERM

Cameron Mackereth began his scientific training at the University of Waterloo (Canada) where he completed a degree in Biochemistry in 1996. His Ph.D. at the University of British Columbia (Canada) under the supervision of Dr. Lawrence McIntosh dealt with the structural investigation of a domain common to several protein families involved in transcription and cellular signaling. He continued to use nuclear magnetic resonance (NMR) spectroscopy at the European Molecular Biology Laboratory (EMBL) in Heidelberg, Germany, where he looked at domain arrangements of large protein-RNA splicing complexes in the group of Dr. Michael Sattler. In the fall of 2007, he joined the IECB as a group leader. In 2011 he was also recruited as a senior research associate within the French National Institute of Health and Medical Research (Inserm).

Research teamDr. Pierre BONNAFOUS Associate professor, MdC (Univ. Bordeaux)Sabrina ROUSSEAU, Engineer, IE (Inserm)Dr. Kashyap MARUTHI, Postdoctoral fellow (ANR/Inserm)Heddy SOUFARI PhD student (Inserm/Aquitaine Region)Amiirah BIBI ADOO Master student (Inserm)Daisy AWITI Master Student (Inserm)Pauline BROCHET Sudent (Inserm)

This team is part of the Inserm – CNRS unit U1212 – UMR 5320.

pole 3 - MolecularRecognition

31

An RNA-binding domain, shown highlighted orange in the figure 1 (RRM = RNA recognition motif), is common to all members of the RBPMS protein family. We have determined the crystal structure of the MEC-8 N-terminal RRM domain from C. elegans bound to a ligand containing two GCAC motif sequences. This RRM forms a tight dimer as shown by the labelled amino acids along the interface. We have used the biophysical technique of isothermal titration calorimetry(ITC) to find the optimal binding sequence with six nucleotides, and find that the middle four bases are preferred to be GCAC. In addition, the dimer nature of the domain means that two motifs on the same ligand bind better than a single motif. Apart from the manner by which the CAC are bound by MEC-8, a key finding is that MEC-8, couch potato and RBPMS, all prefer a guanine as the first base in the RNA motif. This preference is explained by the atomic details of the complex. Using the structural and binding information will improve our understanding of how these proteins interact with their targets, and thus enable improved design of mutants to test for in vivo consequences of a precise lack of MEC-8, couch potato or RBPMS function in binding RNA.

Solution studies of foldamer interactionsOther major projects this year included collaborations with IECB chemistry groups. The interaction between synthetic quinolone oligoamide foldamers and protein surfaces continues to be studied with the team of Ivan Huc. Starting with a crystal structure of a foldamer-driven dimer of human carbonic anhydrase II (HCA), we wanted to characterize this interaction and assembled complex by using the solution state techniques of circular dichroism (CD) and nuclear magnetic resonance (NMR) spectroscopy. In addition, we used a new foldamer (molecule 2 in the figure below) to study protein-foldamer interaction in the absence of foldamer-foldamer dimerization. Comparison of NMR spectra of the complex formed with this new foldamer revealed areas on HCA that come into contact with the foldamer. The three main sites of interaction can be modeled as interacting with hydrophobic, acidic and basic regions on the surface of the protein. These contacts also importantly explain how the surface of HCA stabilizes a single handedness of the bound foldamer. This information will directly aid in the design of new foldamer with higher specificity, and also against new protein targets.

Fig. 2 : From Jewginski et al, ChemBioChem, 23:308-316.

A similar contribution of techniques from biomolecular NMR spectroscopy to study chemical complexes also continues with the IECB team of Gilles Guichard. This year includes a publication on the effect of changing the nature of the side chains that point to a central cavity within hexameric oligourea bundles (Lombardo et al, JACS, 138:10522-10530).


Soufari H, Mackereth CD. Conserved binding of GCAC motifs by MEC-8, couch potato, and the RBPMS protein family. RNA. 2017 Mar;23(3):308-316. doi: 10.1261/rna.059733.116. Epub 2016 Dec 21. PubMed PMID: 28003515; PubMed Central PMCID: PMC5311487.

Jewginski M, Fischer L, Colombo C, Huc I, Mackereth CD. Solution Observation of Dimerization and Helix Handedness Induction in a Human Carbonic Anhydrase-Helical Aromatic Amide Foldamer Complex. Chembiochem. 2016 Apr 15;17(8):727-36. doi: 10.1002/cbic.201500619. Epub 2016 Mar 4. PubMed PMID:26807531.

Lombardo CM, Collie GW, Pulka-Ziach K, Rosu F, Gabelica V, Mackereth CD, Guichard G. Anatomy of an Oligourea Six-Helix Bundle. J Am Chem Soc. 2016 Aug 24;138(33):10522-30. doi: 10.1021/jacs.6b05063. Epub 2016 Aug 15. PubMed PMID: 27434817.

Collie GW, Pulka-Ziach K, Lombardo CM, Fremaux J, Rosu F, Decossas M, Mauran L, Lambert O, Gabelica V, Mackereth CD, Guichard G. Shaping quaternary assemblies of water-soluble non-peptide helical foldamers by sequence manipulation. Nat Chem. 2015 Nov;7(11):871-8. doi: 10.1038/nchem.2353. Epub 2015 Sep 28. PubMed PMID: 26492006.

Chandramouli N, Ferrand Y, Lautrette G, Kauffmann B, Mackereth CD, Laguerre M, Dubreuil D, Huc I. Iterative design of a helically folded aromatic oligoamide sequence for the selective encapsulation of fructose. Nat Chem. 2015 Apr;7(4):334-41. doi: 10.1038/nchem.2195. Epub 2015 Mar 16. PubMed PMID: 25803472.


32

Nucleic acids are prone to structural polymorphism: in addition to the well-known double helix, a number of alternative structures may be formed. However, most non-canonical conformations are stable only under non-physiological conditions and have been considered as simple curiosities. Among these oddities, a family of nucleic acid secondary structures known as G-quadruplexes (G4) has emerged as more than a novelty. these structures can be formed by certain guanine-rich sequences and are stabilized by G-quartets. G-quadruplexes can be stable under physiological conditions and the evidence for quadruplex formation in vivo is now compelling. Our goals are to i) to apply these oddities to nanotechnologies and biotechnologies; ii) to understand their structures, rules of recognition and formation; iii) to conceive new biochemical, bioinformatic, and physico-chemical tools and finally iv) to apply G4-based strategies to various pathologies. In addition, we are also interested in the unusual structures formed by C-rich DNA sequences, called the i-motif.

Our objectives are to answer the following questions:

Where and when ?High-throughput sequencing methods and whole genome approaches are now being used to generate massive amounts of sequence data. Sometimes, statistical analyses point out the potential role of G-rich DNA or RNA motifs. However, the answer to the seemingly simple question “Is my sequence G4-prone?”, based on somewhat flawed or oversimplified search algorithms, is often inaccurate. For example, we previously demonstrated that stable quadruplexes may be formed by sequences that escape the consensus used for bioinformatics. We have built a new prediction algorithm (G4Hunter, recently published in Nucleic Acids Research) that we are experimentally testing first on DNA. We validated an experimental procedure to demonstrate G4 formation for a large set of sequences.

G-quadruplexes: Friends or foes?Comparison of sequencing data with theoretical sequence distributions suggests that there is a selection against G-quadruplex prone sequences in the genome, probably as they pose real problems during replication or transcription and generate genomic instability (see below). Nevertheless, “G4-hot spots” have been found in certain regions of the genome: in telomeres, in repetitive sequences such as mini and microsatellite DNAs, in promoter regions, and in first exons of mRNAs. There might be a specific positive role for these sequences that compensates for the general selection against G4 forming sequences. Our goals are to understand the factors that modulate these effects. A number of proteins that interact with these unusual structures have been identified, including DNA binding proteins, helicases, and nucleases. We are currently developing a fluorescent-based assay to follow the activity of helicases in real time (Mendoza, Nucleic Acids Res. 2015; Gueddouda, BBA, 2017).

unusual Nucleic Acid Structures

Dr. Jean-Louis MergnyResearch Director (DR1), INSERM

Jean-Louis Mergny graduated from Ecole Normale Supérieure de la rue d’Ulm (Paris) and got his PhD in Pharmacology (University Paris VI) in 1991 under the supervision of T. Garestier & M. Rougée (Triple-helices: spectroscopic studies). He went for a postdoctoral position in Basel, Switzerland with W. Gehring (Biozentrum). Afterwards he was hired by INSERM in 1993 in the Muséum National d’Histoire Naturelle, where he worked mainly on nucleic acids structures from a biophysical point of view. He was promoted Research Director in 2002. JL Mergny joined the IECB at the end of 2009 and became IECB director in January 2015.

Research teamDr. Anne BOURDONCLE Teaching Assistant (MdC, Université Bordeaux)Dr. Gilmar SALGADO Teaching Assistant (MdC, Université Bordeaux)Dr. Carmelo DI PRIMO Senior Research Associate (CR1, Inserm)Dr. Samir AMRANE Research Associate (CR2, Inserm)Aurore GUÉDIN Tech. assistant (AI, Inserm)Nassima GUEDDOUDA PhD student (Université Bordeaux)Mona SAAD PhD student (Univ. Bordeaux)Laura BERTOLUCCI PhD student (Univ. Bordeaux)Julien MARQUEVIELLE Student (Univ. Bordeaux)Romain DELZOR Student (Univ. Bordeaux)Amandine HOC Student (Univ. Lille)Dr Rabindra NATH DAS Postdoctoral fellow (Idex)Dr Oscar MENDOZA Postdoctoral fellow (Fondation ARC)Dr Vasantha KUMAR Postdoctoral fellow (ANR)Dr. Aurore DE RACHE Postdoctoral fellow (ANR)Marion PETITET Tech. assistant (Inserm/Aquitaine Region)Caitlin MIRON Phd student (Queens univ.)Mathilde AREVALO PhD student (Grenada univ.)Dr Natalia BUSTO Postdoctoral fellow (Burgos univ.)

This team is part of the unit “Acides nucléiques: Régulations Naturelles et Artificielles” (ARNA), INSERM U1212 – CNRS UMR5320 – Université de Bordeaux.


33

G-quadruplex ligands: Treats or tricks?One may achieve structure-specific rather than sequence-specific recognition of DNA. Because of their particular geometric configuration and electrostatic potential, G-quadruplexes may indeed specifically accommodate small artificial ligands, such as planar molecules, and an impressive number of candidates have been evaluated. Together with chemists we successfully identified a variety of G4 ligands and we wish to improve and functionalize these compounds, analyse their biological effects, and ultimately find new classes of anti-proliferative agents with anticancer properties.

Beyond biologyQuadruplexes may well be biologically relevant, but they could also be used for various applications that are disconnected from cells. DNA is an attractive material for nanotechnologies because of its self-assembly properties. The ability of nucleic acids to self-assemble into a variety of nanostructures and nanomachines is being exploited by a growing number of researchers. Extremely sophisticated structures and nanodevices may be constructed with DNA. We believe that quadruplex structures offer interesting new possibilities and we have demonstrated that quadruplexes can be incorporated into nanodevices.

Quadruplexes are very good model for investigating the contribution of conformational changes to the signal measured by surface plasmon resonance (SPR). The dogma is that the signal is due to the mass changes that result from the interaction between an immobilized partner and an injecting one. However some published works suggest that conformational changes following the interaction itself could contribute. Most of these studies are based on the assumptions that the partners are fully “active” and that their refractive index increment is similar. We are analysing how conformational changes that can be easily triggered with G-quadruplexes by potassium influence the SPR signal. The expected results should help to avoid misinterpretation of the SPR data that are too often seen even in high ranked journals.

DNA double-helix (center); G-quadruplex and corresponding G-quartet (left) and i-motif and C.C+ base pair (right)


Mendoza O, Mergny JL, Aimé JP, Elezgaray J. G-Quadruplexes Light up Localized DNA Circuits. Nano Lett. 2016; 16:624-8

Largy E, Marchand A, Amrane S, Gabelica V, Mergny JL. Quadruplex Turncoats: Cation-Dependent Folding and Stability of Quadruplex-DNA Double Switches. J Am Chem Soc. 2016; 138:2780-92

Bedrat A, Lacroix L, Mergny JL. Re-evaluation of G-quadruplex propensity with G4Hunter. Nucleic Acids Res. 2016; 44:1746-59.

Mendoza O, Bourdoncle A, Boulé JB, Brosh RM Jr, Mergny JL. G-quadruplexes and helicases. Nucleic Acids Res. 2016; 44:1989-2006.

Saintomé C, Amrane S, Mergny JL, Alberti P. The exception that confirms the rule: a higher-order telomeric G-quadruplex structure more stable in sodium than in potassium. Nucleic Acids Res. 2016 Apr 7;44(6):2926-35.

Noer SL, Preus S, Gudnason D, Aznauryan M, Mergny JL, Birkedal V. Folding dynamics and conformational heterogeneity of human telomeric G-quadruplex structures in Na+ solutions by single molecule FRET microscopy. Nucleic Acids Res. 2016; 44(1):464-71.

Wang M, Mao Z, Kang TS, Wong CY, Mergny JL*, Leung CH, Ma DL. Conjugation of a groove binding motif to an Ir(III) complex for the enhancement of G-quadruplex probe behavior Chem Sci. 2016; 7:2516-2523 DOI: 10.1039/c6sc00001k.

Lin S, Lu L, Kang TS, Mergny JL*, Leung CH, Ma DL. The interaction of an iridium(III) complex with G-quadruplex DNA and its application in luminescent switch-on detection of Siglec-5. Analytical Chem. 2016 88(20):10290-10295

De Rache A, Gueddouda NM, Bourdoncle A, Reissig H, Mergny JL. A flexible terpyridine derivative interacts specifically with G-quadruplexes. Chemistry. 2016; 22(36):12651-4

Safa L, Gueddouda NM, Thiébaut F, Delagoutte E, Petruseva I, Lavrik O, Mendoza O, Bourdoncle A, Alberti P, Riou JF, Saintomé C. 5’ to 3’ Unfolding Directionality of DNA Secondary Structures by Replication Protein A: G-QUADRUPLEXES AND DUPLEXES. J. Biol. Chem. 2016; 291:21246-21256.

Zhou J, Tateishi-Karimata H, Mergny JL, Cheng M, Feng Z, Miyoshi D, Sugimoto N, Li C. Reevaluation of the stability of G-quadruplex structures under crowding conditions. Biochimie. 2016; 121:204-8.

Lecarme L, Prado E, De Rache A, Nicolau-Travers ML, Gellon G, Dejeu J, Lavergne T, Jamet H, Gomez D, Mergny JL, Defrancq E, Jarjayes O, Thomas F. Efficient Inhibition of Telomerase by Nickel-Salophen Complexes. ChemMedChem. 2016; 11(11):1133-6

Carvalho J, Ferreira J, Pereira P, Coutinho E, Guédin A, Nottelet P, Salgado GF, Mergny JL,, Queiroz JA, Sousa F, Cabrita EJ, Cruz C. Stabilization of novel immunoglobulin switch regions G-quadruplexes by naphthalene and quinoline-based ligands. Tetrahedron 2016; 72:1229-1237.

Sabharwal NC, Mendoza O, Nicoludis JM, Ruan T, Mergny JL, Yatsunyk LA. Investigation of the interactions between Pt(II) and Pd(II) derivatives of 5,10,15,20-tetrakis (N-methyl-4-pyridyl) porphyrin and G-quadruplex DNA. J Biol Inorg Chem. 2016; 21(2):227-39.

Largy E, Mergny JL, Gabelica V. Role of Alkali Metal Ions in G-Quadruplex Nucleic Acid Structure and Stability. Met Ions Life Sci. 2016; 16:203-58.

Dausse E, Barré A, Aimé A, Groppi A, Rico A, Ainali C, Salgado G, Palau W, Daguerre E, Nikolski M, Toulmé JJ, Di Primo C. Aptamer selection by direct microfluidic recovery and surface plasmon resonance evaluation. Biosens Bioelectron. 2016; 80:418-25.

Arfi Y, Minder L, Di Primo C, Le Roy A, Ebel C, Coquet L, Claverol S, Vashee S, Jores J, Blanchard A, Sirand-Pugnet P. MIB-MIP is a mycoplasma system that captures and cleaves immunoglobulin G. Proc Natl Acad Sci U S A.2016; 113(19):5406-11.

Visentin J, Minder L, Lee JH, Taupin JL, Di Primo C. Calibration free concentration analysis by surface plasmon resonance in a capture mode. Talanta. 2016; 148:478-85.

Visentin J, Guidicelli G, Couzi L, Merville P, Lee JH, Di Primo C, Taupin JL. Deciphering IgM interference in IgG anti-HLA antibody detection with flow beads assays. Hum Immunol. 2016; 77(11):1048-1054.


34

Cells grow, duplicate their genome and divide via a series of events collectively termed the cell cycle. Coordination between the cell cycle machinery and proteins that regulate cell growth ensures the fidelity of cell division; however, the underlying mechanisms are unclear. Failure of these control mechanisms has been directly linked to tumour formation. the goal of the Cell Growth and Division Laboratory is to understand how cell growth is controlled and how growth is coordinated with cell cycle progression. We address these fundamental questions using cutting edge interdisciplinary approaches.

Scaffold-mediated gating of Cdc42 signalling flux.Specific signalling pathways control spatial and temporal aspects of cell growth, generating the myriad cell types observed in nature. Scaffold proteins are important constituents of these signalling pathways, yet the mechanisms through which they exert their control on signalling is not well understood. In budding yeast, the scaffold Bem1 contributes to the axis used for cell growth by regulating the GTPase Cdc42. While different models have been proposed for Bem1 function, there is little direct evidence for an underlying mechanism. In a manuscript published in eLife as part of a collaboration with Dr. Steven Gygi’s lab at Harvard Medical School, we found that Bem1 directly augments the Guanine Exchange Factor (GEF) activity of Cdc24, the activator of Cdc42. Bem1 also increases GEF phosphorylation by the p21-activated kinase (PAK), Cla4. Phosphorylation abrogates the scaffold-dependent stimulation of GEF activity, rendering Cdc24 insensitive to additional Bem1. Thus, Bem1 stimulates GEF activity in a reversible fashion, contributing to flux through the Cdc42 signalling pathway. The contribution of Bem1 to GTPase dynamics was borne-out by in vivo imaging: active Cdc42 was enriched at the cell pole in hypophosphorylated Cdc24 mutants, while hyperphosphorylated cdc24 mutants that were resistant to scaffold stimulation displayed a deficit in active Cdc42 at the pole. These findings illustrate the self- regulatory properties that scaffold proteins confer on signalling pathways that control key aspects of cell growth. • The scaffold Bem1 directly increases the rate of Cdc24 GEF activity. See Figure 1A - compare

blue curve (GEF activity without Bem1) and red curve (GEF activity with Bem1). The curves show FRET signals between mant-GTP and Cdc42 during nucleotide exchange of Cdc42-GDP to Cdc42-mant-GTP.

• Bem1 increases the rate and extent of Cdc24 GEF phosphorylation by the kinase Cla4. See Figure 1B - showing the electrophoretic mobility shift of Cdc24, which is caused by phosphorylation. Note how Cdc24 in the bottom blot containing Cla4 and Bem1 displays an increase in the rate and extent of phosphorylation compared to the upper and middle blots.

• When Cdc24 is phosphorylated, Bem1 is no longer able to stimulate Cdc24 GEF activity in vitro. See Figure 1C - compare blue curve (GEF activity of non- phosphorylated Cdc24) and green curve (GEF activity of phosphorylated Cdc24 after the addition of Cla4 and Bem1).

• When Cdc24 phosphorylation sites that were mapped by mass spectrometry are mutated to aspartate in vivo, reminiscent of the negative charge imparted by phosphorylation, the resulting mutant cells are temperature sensitive (Figure 1D). These results suggest a model, consistent with our in vitro assays, in which non- phosphorylated Cdc24 is amenable to Bem1 stimulation, while phosphorylated Cdc24 is resistant to Bem1 stimulation.

• The cdc24-Ala mutant is enriched at the cell pole (Figure 1E), as is Cdc42 and Cdc42-GTP (not shown), while the cdc24-Asp mutant displays reduced levels at the cell pole, as does Cdc42-GTP (not shown). However, the cdc24-Ala mutant cells do not display obvious morphological defects, despite producing excess Cdc42-GTP, while cdc24-Asp mutants do display strong morphological defects.

• Reasoning that the cdc24-Ala mutant may not display an obvious phenotype associated with excessive Cdc42-GTP production because Cdc42 GAPs may antagonise such an effect, we deleted the Cdc42 GAP RGA1. Consistent with this hypothesis, deletion of RGA1 in cdc24-Ala mutants produced highly elongated cells, consistent with excessive Cdc42-GTP production in this mutant. In contrast, deletion of the GAP did not produce this phenotype in wild type or cdc24-Asp mutant cells (Figure 1F).

Dynamics of Cell Growth & Cell Division

Dr. Derek McCuskerResearch Director (DR2), CNRS

Derek McCusker studied Immunology at Glasgow University and focused on the role of the proteasome in immunity in Prof. John Trowsdale’s lab at Cancer Research UK during his thesis. During postdoctoral work with Dr Robert Arkowitz at the Laboratory of Molecular Biology in Cambridge he became interested in the control of cell growth. He then joined Prof Douglas Kellogg’s group at the University of California, Santa Cruz, where he investigated how cells coordinate cell growth and cell division, a key problem in cell biology. He was recruited by CNRS in September 2009 and joined IECB as a group leader. The group uses interdisciplinary approaches to study how cell growth is coordinated with progression through the cell cycle.

Research teamAurélie MASSONI-LAPORTE AssistantEngineer (AI, CNRS)Dr. Peter RAPALI Postdoctoral fellow (Aquitaine Region)Dr. Elodie SARTOREL Postdoctoral Fellow (CNRS)Dr. Çaner ÜNLU Postdoctoral Fellow (CNRS)Julien MECA PhD student (University of Bordeaux)

This team is part of the unit “Institut de Biochimie et Genetique Cellulaire” (IBGC), CNRS UMR 5095

pole 4 - Molecular& Cellular Biology

35• In conclusion, we propose that Bem1 stimulates Cdc24 GEF activity, which produces Cdc42-GTP

and activates the PAK Cla4. Cla4 phosphorylation of Cdc24 then reduces Cdc24 GEF activity back to a basal state. This self-limiting mechanism may be used in other signalling systems that display fine spatial and temporal regulation.

Figure 1 : Scaffold-mediated gating of Cdc42 signalling flux. A. FRET assay of mant-GTP-Cdc42 activation +/- the GEF Cdc24 and +/-the scaffold Bem1 indicates that Bem1 stimulates Cdc24 GEF activity. B. A time course of kinase reactions probed for Cdc24 in which the indicated proteins were incubated. The electrophoretic mobility shift of Cdc24 is due to phosphorylation. C. A FRET assay of mant-GTP-Cdc42 activation in the presence of phosphorylated Cdc24 shows that Bem1 no longer stimulates GEF activity. D. Cdc24 phospho-mimetic mutants that were generated after mapping sites by mass spectrometry are temperature sensitive in vivo. E. Localisation of mEOS-tagged cdc24 phospho-mutants. Note that the Ala mutant is enriched at the pole, while the Asp mutant is diminished, in part because it is sequestered in the nucleus. F. Deletion of the Cdc42 GAP RGA1 in the cdc24-Ala mutant results in hyper-elongated cells, consistent with excessive Cdc42-GTP production in this mutant.

A quantitative imaging-based screen reveals the exocyst vesicle tethering complex as a network hub connecting endo and exocytosisWe performed an imaging-based mutant screen to identify proteins required for the establishment and maintenance of polarised endo- and exocytic membrane trafficking compartments in budding yeast. Surprisingly little is known about the mechanisms linking these two essential trafficking pathways, despite intensive study of each individual pathway during the past 30 years. Developing methods in yeast cells that enable the precise tracking of vesicle dynamics, our study identified many new players involved in the organisation of endo- and exocytic trafficking domains. In brief :• We performed a candidate screen in over 400 deletions or temperature sensitive mutants and

identified 80 mutants in which either endocytosis, exocytosis or both pathways are depolarised (Figure 2A).

• A functional interaction map of components affecting the spatial organisation of endo- and exocytic sites revealed the exocyst vesicle-tethering complex as a hub linking the two processes.

• Exocyst mutants display a striking phenotype in which the organisation of endo- and exocytic sites seen become interspersed.

• We introduce the use of super-resolution vesicle imaging and high density tracking to provide a novel quantitative view of vesicle dynamics in live cells (Figure 2B).

Figure 2 : An imaging-based screening approach to identify proteins required for the spatial organisation of endo- and exocytic trafficking domains. A Schematic representation of the mutant phenotypes identified by our screen. Endocytic vesicles are sown in red, while exocytic vesicles are shown in cyan. B Super-resolution imaging and very high-density tracking to monitor exocytic vesicle dynamics in the mutants identified by the screen. Using this approach, thousands of vesicle movements can be monitored in each cell.

Selected publicationsRapali P, Mitteau R, Braun CR, Massoni-Laporte A, Ünlü C, Bataille L, Saint Arramon F, Gygi SP, McCusker D. Scaffold-mediated gating of Cdc42 flux. eLife. 2017 Mar 17;6. pii: e25257.

Derive, N., Landmann, C., Montembault, E., Claverie, M.C., Pierre-Elies P, Goutte-Gattat, D., Founounou, N., McCusker, D., Royou, A. 2015. Bub3-associated BubR1 sequesters Fizzy/Cdc20 at DNA breaks and promotes the correct segregation of broken chromosomes. The Journal of Cell Biology. 211: 517-32

Jose, M., Tollis, S., Nair, D., Mitteau, R., Massoni-Laporte, A., Velours, C., Sibarita, JB. and McCusker D. 2015. A quantitative imaging-based screen reveals the exocyst complex as a network hub linking endo- and exocytosis. Molecular Biology of the Cell. 26: 2519-2534.

pole 4 – Molecular & Cellular Biology

36

We pursue the characterization of C. elegans genetic regulation programs. My work so far has been focused on transcriptional regulation. I have shown that it is possible to systematically study the activity of proximal promoters in vivo. Our goal is to perform a systematic and quantitative analysis of post-transcriptional regulation in vivo in C. elegans. More specifically, we combine the quantitative analysis methods I developed during my post-doctoral training with genome-wide RNAi screens to systematically identify all the genetic components involved in post-transcriptional regulation and characterize their functional interactions.

In 2015, we published a collaborative works with E. Chevet’s Lab: during her postdoctoral stay in my lab E. Marza performed a reporter-based genome-wide RNAi screen for gene able to restore ckb-2 expression under stress in CDC-48 mutants in C. elegans. In wild type situation, the accumulation of misfolded proteins in the endoplasmic reticulum (ER) activates the Unfolded Protein Response (UPRER) to restore ER homeostasis. The AAA+ ATPase CDC-48 plays key roles by promoting both ER protein degradation and transcription of UPRER genes. Although the mechanisms associated with protein degradation are now well established, the molecular events involved in the regulation of gene expression by p97 remained unclear. The results of our RNAi screen, in combination with a quantitative proteomic analysis identified RUVB-2, another AAA+ ATPase, as a novel repressor of a subset of UPRER genes. This ATPase is degraded by CDC-48 thus promoting ER stress-mediatd gene expression through an XBP-1 dependent mechanism. This functional interplay between the two ATPases controlling the transcription of select UPRER genes appears conserved in human cells. We have thus uncovered a new mechanism through which for CDC-48 integrates its protein degradation activity with the activation of the ER stress response.

The second work published that year was produced by a PhD student co supervised by J. Ceron at the Univesity Pompeu-Fabra (Barcelona) and myself. Through a comprehensive functional study of the LSM family members, we found that lsm-1 and lsm-3 are not essential for C. elegans viability, but their perturbation, by RNAi or mutation, produces defects in development, reproduction and motility. We further investigated the function of lsm-1, which encodes the distinctive protein of the cytoplasmic complex. RNA-Seq analysis of lsm-1 mutants suggests that they have an impaired Insulin/IGF-1 signaling (IIS), which is involved in the response to various types of stress through the action of the FOXO transcription factor DAF-16 in metazoans. Further analysis using a DAF-16::GFP reporter indicated that rapid heat stress-induced translocation of DAF-16 to the nuclei is dependent on lsm-1. Consistently, we observed that lsm-1 mutants display heightened sensitivity to thermal stress and starvation, while overexpression of lsm-1 has a protective effect. At the subcellular level, we observed that under stress, cytoplasmic LSM proteins aggregate into granules in an LSM-1 dependent manner. Moreover, we found that lsm-1 and lsm-3 have a shorter lifespan and a lower pathogens resistance, but ectopic expression of lsm-1 did not extend lifespan or protect against pathogens.

In 2016, we participated in study in collaboration with the laboratories of Andrew Fire and Eric Jorgensen identifying genomic DNA motifs affecting gene expression in C. elegans. Cells need to identify and silence foreign genetic elements while avoiding spurious silencing of endogenous genes. Here we demonstrate that a non-coding DNA feature, which is characterized by periodic An/Tn-clusters (PATCs) can promote germline activity in Caenorhabditis elegans within broad domains of repressive

Genome Regulation & Evolution

Dr. Denis DupuySenior Research Associate (CR1), INSERM

During my post-doctoral training I first implemented a multisite Gateway-based promoter cloning strategy to create the “Promoterome”, a resource of over 6,500 promoter clones that can be easily shuttled into various destination vectors (Dupuy et al., Genome Research 2005).Second, I developed a novel high-throughput expression analysis method to analyze in vivo spatiotemporal expression for ~2,000 C. elegans strains (Dupuy et al. Nature Biotechnology, 2007).

Research teamSabrina ROUSSEAU Engineer (INSERM) Jonathan MILLET PhD student (INSERM- MNRT)Eric CORNES PhD student (University Pompeu Fabra, Spain)

This team is part of the unit “Acides Nucléiques : régulations naturelles et artificielles”, INSERM U869 (now U1212 since Jan 2016), CNRS UMR 5320


37

chromatin. Transgenes containing natural or synthetic PATCs are resistant to epigenetic silencing normally mediated by endogenous non-coding RNAs. By comparing nematode orthologs that have moved between active and repressive domains, we observe large changes in intron length and PATC-content, indicating a dynamic character to the An/Tn periodicity. PATCs constitute a substantial fraction of nematode genomes (5-10%), and may participate in cellular recognition of endogenous genes to prevent inappropriate silencing of host genes.

Figures 1 & 2 : For the 5th consecutive year D. Dupuy has supervised the team of students who represented Bordeaux University at the iGEM international Synthetic Biology Competition. The Team obtained a Bronze Medal at the Boston Giant Jamboree 2016 for their project on Epigenetic control of sleep patterns


Frøkjær-Jensen C, Jain N , Hansen L., Davis W, Li Y, Zhao D, Rebora K, Millet JRM, Liu X, Kim S K , Dupuy D, Jorgensen EM, Fire AZ. An Abundant Class of Non-coding DNA Can Prevent Stochastic Gene Silencing in the C. elegans Germline. Cell 166(2):343-57 (2016)

Marza E, Taouji S, Barroso K, Raymond AA, Guignard L, Bonneu M, Pallares N, Dupuy JW, Fernandez-Zapico ME, Rosenbaum J, Palladino F, Dupuy D, Chevet E. Genome-wide screen identifies a novel p97/CDC-48-dependent pathway regulating ER stress-induced gene transcription. Embo Reports, 16, 332-340 (2015)

Cornes E, Porta-De-La-Riva M, Aristizábal-Corrales D, Brokate-Llanos AM, García-Rodríguez FJ, Ertl I, Díaz M, Fontrodona L, Reis K, Johnsen R, Baillie D, Muñoz MJ, Sarov M, Dupuy D, Cerón J. Cytoplasmic LSM-1 protein regulates stress responses through the insulin/IGF-1 signaling pathway in Caenorhabditis elegans. RNA. 21(9):1544-53 (2015)


38

the mechanisms that safeguard cells against aneuploidy are of great interest as aneuploidy contributes to tumorigenesis. using live imaging approaches, we have identified two novel mechanisms that permit the accurate transmission of chromosomes during cell division. the first mechanism involves the faithful segregation of damaged chromosomes. Our studies reveal that chromosome fragments segregate properly to opposite poles. this poleward motion is mediated through DNA tethers that connect the chromosome fragments. the second mechanism involves the coordination of chromosome segregation with cell cleavage. We found that cells can adapt to a four-fold increase in chromatid length by elongating transiently during anaphase. this mechanism ensures the clearance of chromatids from the cleavage plane at the appropriate time during cytokinesis, thus preserving genome integrity.

Mitosis is the final stage of the cell cycle where a copy of the duplicated genome condensed into chromosomes is transmitted to each daughter cell. Failure to do so produces daughter cells with an inappropriate genome content, also called aneuploidy. The mechanisms that safeguard cells against aneuploidy are of great interest as aneuploidy contributes to tumorigenesis. Our group has identified two novel mechanisms that permit the accurate transmission of chromosomes during cell division. The first mechanism involves the faithful segregation of damaged chromosomes. The second mechanism coordinates chromosome segregation with cell cleavage.

Mechanism that permits faithful transmission of broken chromosomes The presence of DNA double-strand breaks during mitosis is particularly challenging for the cell as it produces broken chromosomes lacking a centromere. This situation can cause genomic instability due to improper segregation of the broken fragments into daughter cells. We have recently uncovered a process by which broken chromosomes are faithfully transmitted, via the tethering of the two broken chromosome ends. Three mitotic kinases, BubR1, Polo and Aurora B are required to maintain this tether and to prevent un-correct segregation of broken chromosome fragments. BubR1 requires interaction with its kinetochore partner Bub3 to localize on the broken chromosome fragments and to mediate their proper segregation. We also find that Cdc20, a co-factor of the E3 ubiquitin ligase Anaphase-Promoting-Complex/Cyclosome (APC/C), which activity is required to trigger anaphase, accumulates on DNA breaks in a BubR1 KEN box-dependent manner. A biosensor for APC/C activity demonstrates a BubR1-dependent local inhibition of APC/C around the segregating broken chromosome. We therefore propose that the Bub3/BubR1 complex on broken DNA inhibits the APC/C locally via the sequestration of Cdc20, thus promoting proper transmission of broken chromosomes.

Mechanism that coordinates chromosome segregation with cell cleavageChromosome segregation must be coordinated with cell division to ensure proper transmission of the genetic material into daughter cells. Our group identified a novel mechanism by which Drosophila neuronal stem cells coordinate chromosome segregation with cell division. Cells adapt to the presence of trailing chromatids at the cleavage site by transiently, but dramatically, elongating during anaphase, thus increasing the rate at which the lagging chromatids clear the cleavage plane. This adaptive elongation depends on myosin activity and the Rho Guanine-nucleotide exchange factor, Pebble. cells promote the clearance of trailing chromatids from the cleavage site by undergoing two phases of adaptive elongation. The first phase relies on assembly of a wide contractile ring at the onset of cytokinesis. The second phase requires outward flux of

Control & Dynamics of Cell Division

Dr. Anne RoyouSenior Research Associate (CR1), CNRS

Following a bachelor degree in physiology and cell biology, Anne Royou did a postgraduate degree in molecular and cellular genetics at the Université Paris XI. She did her PhD thesis under the guidance of Dr. Roger Karess, at the Centre de Génétique Moléculaire in Gif-sur-Yvette, studying the role of non-muscle myosin II during development in Drosophila. Following her PhD, she joined Dr. William Sullivan’s lab at the University of California, Santa Cruz, as a post-doctoral fellow. There, she became interested in the mechanisms that preserve genome integrity during cell division. She obtained a CNRS permanent position in 2009, an ATIP/Avenir grant in 2010 and was recruited as a team leader at IECB in 2011. In 2014 she was awarded an ERC starting grant.

Research teamMarie-Charlotte CLAVERIE Assistant Engineer (Université Bordeaux)Dr. Emilie MONTEMBAULT Researcher (CNRS)Priscillia PIERRE-ELIES Assistant Engineer (ERC-STG-2012 NoAneuploidy)Lou BOUIT Assistant Engineer (ANR retour post-doc)Dr. Damien GOUTTE-GATTAT Postdoctoral fellow (ERC-STG-2012 NoAneuploidy)Cédric LANDMANN PhD student (Région Aquitaine/CNRS)Enzo CAMARA, Master 2 (CNRS)Camille VACHON, Master 2 (CNRS)Dr Jérôme TOUTAIN Visiting scientist (CHU Bordeaux/CNRS)Dr James JENKINS Postdoctoral (ERC-STG-2012 NoAneuploidy)

This team is part of the “Institut de Biochimie et Génétique Cellulaire” (IBGC), CNRS/Université Bordeaux (UMR5095)


39

myosin from the ring toward the polar cortex during ring constriction. Myosin efflux is a novel feature of cytokinesis and its duration is coupled to nuclear envelope reassembly (NER) and the ensuing nuclear sequestration of the Rho-GEF Pebble. Trailing chromatids induce a delay in NER concomitant with a prolonged period of cortical myosin activity, thus providing forces for the second adaptive elongation. The cytoplasmic retention of Pebble is sufficient to prolong myosin efflux and promote elongation in the absence of trailing chromatids. We propose that the modulation of cortical myosin dynamics is part of the cellular response triggered by a “chromatid separation checkpoint” that delays NER when trailing chromatids are present at the midzone.

Figure 1: Bub3 and Cdc20 but not Spc105 localize on the tether. Third instar larval neuroblasts expressing H2Av::RFP (Red) and Spc105::GFP (Cyan), GFP::Bub3 (Cyan) or GFP::Cdc20 (Cyan) were monitored by time lapse spinning disk confocal microscopy. Spc105::GFP signal accumulated on the kinetochore at metaphase and anaphase. However, no signal was detected on the tether connecting the lagging acentric chromatid (white arrowhead) to their centric partners during anaphase. Both GFP::Bub3 and GFP::Cdc20 signals were found on the kinetochore at metaphase and faded away during anaphase. Stretched GFP-Bub3 and GFP- Cdc20 signals (gold arrowheads) were detected on the lagging acentric (white arrowheads).

Figure 2: Myosin efflux during cytokinesis is prolonged in the presence of long chromatids and absent in pbl mutants. Time-lapse images of wild type cells with normal chromosomes (top row), wild type cells carrying an abnormally long chromosome (second row), and cells mutant for the Rho-GEF Pebble (pbl, bottom row). The chromosomes are marked with H2Av::RFP (red) and myosin with Sqh::GFP (Gray). In control cell, half way through cytokinesis, myosin undergoes flux from the contractile ring and invades transiently the whole cortex (yellow rectangle) before dissociating from the cortex. This myosin efflux is prolonged during the segregation of long chromatids (yellow rectangle). No myosin efflux is detected in the pebble mutant. Time=min:second.


Montembault E*1, Claverie M-C1, Bouit L1, Landmann C1, Jenkins J1, Tsankova A2; Cabernard C2, Royou A*1. Myosin efflux promotes cell elongation to coordinate chromosome segregation with cell cleavage. Nature Communications (2017) In press

Derive N*, Landmann C*, Montembault E, Claverie MC, Pierre-Elies P, Goutte-Gattat D, Founounou N, McCusker D and Royou A (2015) Bub3/BubR1-dependent sequestration of Cdc20Fizzy at DNA breaks facilitates the correct segregation of broken chromosomes. J Cell Biol. 211(3):517-32. * denotes equal contribution

Malmanche N, Dourlen P, Gistelinck M, Demiautte F, Link N, Dupont C, Vanden Broeck L, Werkmeister E, Amouyel P, Bongiovanni A, Bauderlique H, Moechars D, Royou A, Bellen HJ, Lafont F, Callaerts P, Lambert JC, Dermaut B. (2017) Sci Rep. 23;7;40764

Jose M, Tollis S, Nair D, Mitteau R, Velours C, Massoni-Laporte A, Royou A, Sibarita JB, McCusker D (2015) A quantitative imaging-based screen reveals the exocyst as a network hub connecting endocytosis and exocytosis. Mol. Biol. Cell. 26(13):2519-34


40

We study the mechanisms by which the de-regulation of cell signaling contributes to metabolic transformation in cancer. particularly, we focus our research on the regulation of glutamine addiction by the mtORC1 pathway in cancer cells. First, we investigate the biochemical and cellular mechanisms of the interaction between glutaminolysis and mtORC1. Second, we study the interplay between glutamine metabolism and mtORC1 in cancer models of lymphoblastic leukemia driven by Notch upregulation. third, we analyze the role of glutamine-dependent activation of mtORC1 in cell death and senescence in cancer models. those investigations will permit, in collaboration with the Institut Bergonié, the implementation of clinical trials evaluating glutamine and mtOR as potential therapeutic co-targets against cancer.

Glutamine metabolism in cancer cellsGlutamine, the most abundant amino acid in the blood, plays a particularly important role in cell growth and metabolism. The importance of glutamine as a nutrient is further underscored by the observation that cancer cells are particularly dependent on this amino acid (Tennant, Duran & Gottlieb, Nature Rev. Cancer 2010). Glutamine is metabolized through glutaminolysis, catalyzed by glutaminase (GLS) and glutamate dehydrogenase (GDH), to produce αKG. The essential amino acid leucine directly binds and activates GDH to stimulate deamination of glutamate and thereby αKG production. Our recent findings showed that glutamine in combination with leucine activates mTOR pathway by enhancing glutaminolysis and αKG production (Duran et al., Cell Cycle 2012).

mTOR signaling and glutamine metabolismmTOR is a serine/threonine kinase highly conserved from yeast to humans. mTOR forms two functionally and structurally distinct complexes termed mTORC1 and mTORC2. mTORC1 regulates protein synthesis, ribosome biogenesis, nutrient uptake and autophagy in response to growth factors, amino acids, and cellular energy. The Rag GTPases activate mTORC1 in response to amino acids (Duran & Hall, EMBO Rep. 2012). Addition of amino acids allows the Rag heterodimer to bind and thereby recruit mTORC1 to the lysosome, where mTORC1 is activated. Our results showed that glutaminolysis is a critical step in the Rag-dependent recruitment of mTORC1 to the lysosome. Inhibition of glutaminolysis prevents the Rag-dependent lysosomal translocation and subsequent activation of mTORC1. Conversely, enhanced glutaminolysis or a cell permeable αKG analogue stimulates lysosomal translocation and activation of mTORC1. Finally, cell growth and autophagy, two processes controlled by mTORC1, are regulated by glutaminolysis. Thus, mTORC1 senses and is activated by glutamine and leucine via glutaminolysis and αKG production upstream of Rag (Duran et al., Mol. Cell 2012).

Metabolism & Cell Signaling

Dr. Raul V. DuranGroup Leader (CR1), INSERM

Raul V. Duran obtained his PhD at the University of Seville (Spain) in 2005 on cellular bioenergetics under the supervision of Prof. Miguel Angel de la Rosa. Then, he joined the lab of Prof. Eyal Gottlieb at Cancer Research UK (Glasgow, UK) as a postdoctoral researcher (2006-2009). During this period, he worked on the metabolism of cancer cells, with especial emphasis on the role of prolyl hydroxylases as regulators of cell metabolism. Later, he moved to the lab of Prof. Michael N. Hall at the Biozentrum (University of Basel, Switzerland) as a senior postdoc (2010-2013) to study the role of the metabolism of glutamine in the control of cell growth. In June 2013, he joined the IECB as a Junior Group Leader, focusing on the crosstalk between metabolism and cell signaling in cancer cells. In 2015 he obtained a CR1 position at INSERM.

Research teamDr. Victor H. VILLAR Postdoctoral fellow (SIRIC - U. Bordeaux)Tra Ly NGUYEN PhD student (CRA)Clement BODINEAU PhD Student (U. Bordeaux)Sarah COURTOIS Visitor PhD (U. Bordeaux)Angela RUBIO Visitor PhD (U. Salamanca)Cynthia ABANE Medicine Master Student(U. Bordeaux)Marion MULLER Undergraduate Student(U. Bordeaux)Emmanuelle CHEVAL Undergraduate Student (U. Bordeaux)

This team is part of the unit ACTION U1218, INSERM – Université de Bordeaux


41

Prolyl hydroxylases as regulators of cell metabolismOur studies also suggest that prolyl hydroxylases (PHD) are the αKG sensors that mediate the activation of mTORC1 by glutaminolysis. PHDs are considered the oxygen sensors of cells. However, under normoxic conditions, the availability of αKG is critical for the activity of PHD. Importantly, amino acid starvation causes depletion of αKG that leads to PHD inactivation. Loss of PHD activity during amino acid starvation does not activate HIF, likely due to a lack of HIF expression. In agreement with this result, PHD inhibition blocks the response of mTORC1 to amino acids and induces autophagy independently of HIF (Duran et al., Oncogene 2013). Therefore, PHDs act as general metabolic sensors in the cell, detecting scarcity not only of oxygen, but also of amino acids, and forming a link between glutaminolysis and the mTORC1 pathway (Nguyen & Duran, Int J Biochem Cell Biol 2016) (Figure 1).

Glutamoptosis: a new autophagy-inhibited cell death mechanism during nutritional imbalanceDespite the role of both glutaminolysis and mTORC1 in the promotion of cell growth, we recently observed that the unbalanced activation of the glutaminolysis/mTORC1 pathway in the absence of other amino acids induced apoptotic cell death in human cells. We termed this unusual type of cell death as “glutamoptosis” (Villar & Duran, Autophagy 2017). During glutamoptosis, the long-term production of glutaminolysis-derived αKG in the absence of other amino acids was sufficient to activate mTORC1 and to inhibit autophagy, but concomitantly reduced cell viability and activated apoptosis. Inhibition of mTORC1 or re-activation of autophagy were sufficient to suppress the glutaminolysis-induced apoptosis. We additionally observed that the ability of rapamycin to prevent apoptosis resides in its pro-autophagic potential: re-inhibition of autophagy prevented cell survival in rapamycin-treated cells (Villar et al., Nature Comm 2017) (Figure 2). The surprising role of glutaminolysis as a cell death inducing mechanism during nutrient restriction points at the importance of nutritional imbalance in the control of cell viability and the potential use of this metabolic disequilibrium to identify new metabolic components and targets with potential implication in the treatment of nutrition-related diseases, such as obesity, diabetes, cancer, or cardiovascular diseases.


Villar VH and Durán RV (2017) Glutamoptosis: a new cell death mechanism inhibited by autophagy during nutritional imbalance. Autophagy in press, doi: 10.1080/15548627.

Villar VH, Nguyen TL, Terés S, Bodineau C and Durán RV (2017) Escaping mTOR inhibition for cancer therapy: tumor suppressor functions of mTOR. Mol. Cell. Oncol., in press.

Villar VH, Nguyen TL, Delcroix V, Terés S, Bouchecareilh M, Salin B, Bodineau C, Vacher P, Priault M, Soubeyran P and Durán RV (2017) mTORC1 inhibition in cancer cells protects from glutaminolysis-mediated apoptosis during nutrient limitation. Nature Comm. 8, 14124

Terés S, Nguyen TL and Durán RV (2016) Metabolic transformation in Notch-driven acute lymphoblastic leukemia. Int. J. Mol. Biol. Med. 1

Nguyen TL and Durán RV (2016) Prolyl hydroxylase domain enzymes and their role in cell signaling and cancer metabolism. Int. J. Biochem. Cell Biol. 80, 71-80.

Klionsky DJ et al. (2016) Guidelines for the use and interpretation of assays for monitoring autophagy. Autophagy 12, 1-222.

Villar VH, Mehri F, Djavaheri-Mergny M and Durán RV (2015) Glutaminolysis and autophagy in cancer, Autophagy 11, 1198-208.

Figure 1 : Regulation of mTORC1 signaling by glutaminolysis Figure 2 : Molecular model of glutamoptosis


42

We have recently utilized mouse models to study the very early stages of lung adenocarcinoma (LuAD). this approach bypassed the difficulties imposed by tumour heterogeneity in full-blown tumours and facilitated the identification of novel therapeutic targets with low toxicity and potential clinical applicability. Our study also revealed that cancer cell fate and tumour malignancy are established at an unanticipated early step. We plan to continue using mouse models and tissue organoids to identify and investigate novel signalling pathways and oncogenic functions that govern the onset of LuAD. We also intend to pay particular attention to the significant percentage (up to 40 %) of LuAD patients without identified oncogenic driver to potentially translate this knowledge into novel therapeutic treatments.

Lung cancer is the leading cause of cancer-related mortality worldwide, with an average 5-year survival of 15%. LUAD patients are stratified based on driver mutations such as those in K-RAS, EGFR and ALK genes. Among these subtypes, adenocarcinomas positive for K-RAS mutations have worse overall survival due in part to the fact that EGFR and ALK mutant tumors are treated with targeted therapies. Selective inhibitors for the MEK kinases have been tested in K-RAS mutant LUAD although their efficacy is limited due to excessive toxicity. Thus, in spite of being the most frequent subtype, LUAD patients harboring K-RAS activating mutations currently lack specific therapeutic treatments.

We have recently used mouse genetics to identify and functionally validate targets with potential therapeutic value to devise novel strategies for the treatment of K-RAS driven LUAD. By means of the transcriptional profiling of K-RasG12V-driven early hyperplasias we identified the tyrosine kinase receptor Ddr1 as a potential mediator of K-Ras oncogenic properties. Indeed genetic and pharmacological inhibition of Ddr1 blocked tumour development. Moreover, concomitant inhibition of Ddr1 and Notch signalling, a pro-survival mediator of Ddr1, thwarted progression of murine K-RasG12V;p53-null adenocarcinomas. Importantly, this combined treatment induced regression of K-RAS;p53 mutant patient-derived lung orthoxenografts (PDX) with therapeutic efficacy superior to standard chemotherapy. Our data indicate that combined inhibition of DDR1/NOTCH could be an effective therapy for K-RAS mutant LUAD patients (Ambrogio et al, Nat Medicine 22, 270-7, 2016).

Novel Mediators inLung Oncogenesis

Dr. David SantamariaGroup leader (IDEX-Bordeaux/SIRIC-BRIO chair)

David Santamaría received his PhD from Univ. Autónoma of Madrid (Spain) in 1999, under the guidance of Prof. Jorge B. Schwartzman, studying replication fork barriers. He then joined the team of Prof. Ronald A. Laskey, (1999-2003) at the Wellcome/CRC Institute (Cambridge, UK) where he dealt with the initiation of DNA replication and its connection with cell cycle control. He returned to Spain (2003-2016) as a staff scientist in Prof. Mariano Barbacid group (CNIO, Madrid) where he has used mouse genetics to conduct a comprehensive analysis of the Cyclin Dependent Kinase family and to identify putative therapeutic targets in lung adenocarcinoma. He was recently recruited as a group leader at the IECB to continue his research on novel oncogenic pathways and signalling mediators in lung adenocarcinoma.

Research team Dr Benjamin DROGAT Postdoctoral fellow (INSERM)

The team is part of the unit INSERM U1218.


43

In addition, the initiating oncogenic event in almost half of human lung adenocarcinomas is still unknown. This lack of knowledge complicates the development of selective targeted therapies and we are making an effort to identify potential driver events in this patient group. For instance, these tumours harbour a number of alterations without obvious oncogenic function including B-RAF inactivating mutations. Actually, inactivating B-RAF mutants in lung predominate over the activating V600E allele frequently observed in other tumor types. We have recently demonstrated that the activation of an endogenous B-RafD594A kinase inactive isoform triggers lung adenocarcinoma in vivo, indicating that B-RAF inactivating mutations represent novel oncogenic drivers. We plan to continue our research to identify novel oncogenic mediators in those LUAD patients without known driver mutations.


Ambrogio, C., Gómez-López, G., Falcone M., Kim, H.G., Byun, S., Crosetto, N., Blasco, R., Sánchez-Céspedes, M., Ren, X., Wang, Z., Ding, K., Hidalgo, M., Serrano, M., Santamaría, D.* and Barbacid, M.* Combined inhibition of DDR1 and Notch signaling is a therapeutic strategy for KRAS-driven lung adenocarcinoma. Nature Medicine 2016 22, 270-7. *Co-corresponding authors.

Ambrogio, C., Barbacid, M. and Santamaría, D. In vivo oncogenic conflict triggered by co-existing KRAS and EGFR activating mutations in lung adenocarcinoma. Oncogene 2016 Oct 24. doi: 10.1038/onc.2016.385.

Trakala, M., Rodríguez-Acebes, S., Maroto, M., Symonds, C.E., Santamaría, D., Ortega, S., Barbacid, M., Méndez, J. and Malumbres, M. Functional reprogramming of polyploidization in megakaryocytes. Dev Cell 2015 32, 155-67.

Viera, A., Alsheimer, M., Gómez, R., Berenguer, I., Ortega, S., Symonds, C.E., Santamaría, D., Benavente, R. and Suja J.A. CDK2 regulates nuclear envelope protein dynamics and telomere attachment in mouse meiotic prophase. J Cell Sci 2015 128, 88-99.


44

Mass Spectrometry of Nucleic Acids & Supramolecular Complexes

Dr. Valérie GabelicaResearch Director (DR2), INSERM

Valérie Gabelica studied Chemistry and obtained her PhD in Sciences in 2002 at the University of Liège. After a postdoc in Frankfurt as Humboldt fellow, she rejoined the Mass Spectrometry Laboratory in Liège where she obtained an FNRS research associate position in October 2005. She joined the IECB in 2013 with the support of an Atip-Avenir grant, and became an Inserm research director (DR2) in December 2013. She obtained an ERC Consolidator grant in 2014. Her main research interests are fundamental aspects of mass spectrometry and its application to non-covalent complexes in general and nucleic acid complexes in particular, with research themes spanning from physical chemistry to biophysics, structural chemistry and biology.

Research teamDr Massimiliano PORRINI Postdoctoral fellow (INSERM)Dr Josephine ABI-GHANEM Postdoctoral fellow (CNRS - INSERM)Dr Nina KHRISTENKO Postdoctoral fellow (INSERM)Dr. Emma-Dune LERICHE ATER (University of Bordeaux)Adrien MARCHAND PhD Student (INSERM)Clémence RABIN PhD Student (INSERM)Stefano PICCOLO PhD student (INSERM)Sandrine LIVET IE (INSERM)Solenne DELAHAYE M2 Student (University Paris Diderot)Michael J. LECOURS Visiting M.Sc. student (University of Waterloo, Canada)Ahdia ANWAR Visiting M.Sc. student (University of Waterloo, Canada)

This team is part of the unit “RNA: Natural and Artificial Regulation” (ARNA), Inserm U1212/CNRS UMR5320/Univ. Bordeaux

Our aim is to decipher the relationship between structures and energetics—Angstroms and Calories—in non-covalent complexes. Non-covalent interactions govern the structure and function of myriads of systems, from supramolecular assemblies to biological complexes. High-resolution structural methods help to understand what interactions are at stake in specific states of well-defined assemblies. Yet function is linked to energetics: How prevalent is a structural form? How does it switch to other states? How fast? to bridge the gap between structure and energetics, our team develops new mass spectrometry approaches to separate, quantify, and structurally characterize the different ensembles of structures (the different states) simultaneously present in solution.

Unveiling the role of cations in nucleic acids folding and ligand selectivity For nucleic acid complexes, the mass indicates how many strands of each sort assemble together, with how many cations and how many ligands. In the presence of mixtures, we obtain equilibrium information for each complex. Further, with time-resolved mass spectrometry experiments, we can investigate the reaction pathways. This led us to new insight into the folding pathways of G-quadruplexes: we found that all sequences first form long-lived misfolded structures (off-pathway compared to the most stable structures) containing 1 K+ and 2 quartets in an antiparallel stacking arrangement. The results highlight the particular ruggedness of G-quadruplex nucleic acid folding landscapes: misfolded structures can play important roles for designing artificial G-quadruplex based structures, and for conformational selection by ligands (Figure 1) or proteins in a biological context.

Figure 1 : The folding pathways of telomeric G-quadruplexes were revealed by the number of cations encapsulated in the structure (NAR 2016). Mass spectrometry also revealed ligand binding modes, selectivities, and conformational selection: PhenDC3 (left) favors antiparallel, 2-quartet structures (JACS 2015 & BBA 2017). L2H2 (right) prefers the hybrid structures but grabs an extra cation upon binding (JACS 2015). Cu(ttpy) (bottom) binds cooperatively and select antiparallel structures with three G-quartets (Chem Eur J 2016).

AssociateMembers

45

Adding a structural dimension to mass spectrometryThe biggest challenge in mass spectrometry of intact folds and intact complexes lies in the characterization of the different states. We developed molecular modeling approaches to link ion mobility spectrometry data to molecular models, and are currently building unprecedented instrumentation to measure the circular dichroism spectra of ions separated in mass. The aim is to characterize each ensemble after separation by mass and shape.

Understanding what happens during electrospray ionizationBefore native mass spectrometry can be applied to study nucleic acids conformations from solution, it is however essential to understand to what extent the different types of DNA/RNA secondary structures are preserved, or affected, by the transition from the solution to the gas phase. We found that nucleic acid double helix structures are not necessarily preserved in the gas phase, but undergo compaction due to extra phosphate-phosphate contacts formed during gradual desolvation (Figure 2). These fundamental studies are important to pave the way to wiser applications of mass spectrometry, for nucleic acids and for other biomolecular or synthetic systems.

Figure 2 : Modeling the gradual desolvation and declustering of ions upon electrospray is essential to account for the compaction experimentally observed for DNA duplex ions (ACS Cent. Sci. 2017).


Marchand A, Granzhan A, Iida K, Tsushima Y, Ma Y, Nagasawa K, Teulade-Fichou MP, Gabelica V. Ligand-induced conformational changes with cation ejection upon binding to human telomeric DNA G-quadruplexes.J. Am. Chem. Soc. (2015) 137: 750-756.

Marchand A, Gabelica V. Folding and misfolding pathways of G-quadruplex DNA. Nucleic Acids Res. (2016) 44: 10999-11012.

Marchand A, Strzelecka D, Gabelica V. Selective and Cooperative Ligand Binding to Antiparallel Human Telomeric DNA G-Quadruplexes. Chem. Eur. J. (2016) 22: 9551-9555.

Lecours MJ, Marchand A, Anwar A, Guetta C, Hopkins WS, Gabelica V. What stoichiometries determined by mass spectrometry reveal about the ligand binding mode to G-quadruplex nucleic acids. Biochim. Biophys. Acta (BBA) – Gen. (2017) doi: 10.1016/j.bbagen.2017.01.010.

Porrini M, Rosu F, Rabin C, Darré L, Gomez H, Orozco M, Gabelica V. Compaction of Duplex Nucleic Acids upon Native Electrospray Mass Spectrometry. ACS Cent. Sci. (2017), DOI: 10.1021/acscentsci.7b00084.

AssociateMembers

46

1. Synthesis of privileged scaffolds designed after natural products Natural products are unique templates for the design of privileged scaffolds (pS) for the construction of libraries of biologically relevant natural products analogs. these pS have to be accessible in multigram amounts by efficient synthetic routes. the group has designed and synthesized pS derived from aspidospermine, lycorine, ottelione ….by short and stereoselective syntheses based on the use of novel reagents. 2. Synthetic and biological studies of highly potent spirocyclic ligands of glucocorticoid receptorsA short and efficient synthetic sequence of pure diastereomeric spirocyclic analogs of fluorocortivazol was developed. preliminary testing led to the identification of several subnanomolar hits.3. Sustainable electrophilic catalysts for the activation of highly functionalized and sensitive moleculesthe project aims at finding solutions to the often encountered problems associated with the use of many electrophilic catalysts : chemoselectivity, low turnover, too high molecular weight, in particular for asymmetric catalysis, toxicity and generation of much waste. New ionic solvents and silicon-derived Lewis superacids have been found to provide solutions to these problems. New electrophilic catalysts for cycloaddition and alkylation reactioins involving highly functionalized acid-sensitive molecules have been developed.

Synthesis of privileged scaffolds designed after natural products Spirocyclic glucocorticoids were designed, synthesized and evaluated for their activity toward hGRs and IL1/IL6 receptors. A diastereoselective approach was conducted in order to evaluate the biological activity of specific diastereoisomers. The synthetic sequence, without details, is shown in scheme 1. The replacement of fused- by spiranic rings gives more conformational freedom to ring C. Thus both diastereomeric alcohols were shown to have an axial hydroxyl group in the most stable conformation. The homologues in 5-, 6- and 7-series have different conformations with huge impact on their binding properties. Our synthetic studies were supported by several single crystal X-rays analysis and DFT calculations performed by Dr. F. Robert of ISM, Univ. Bordeaux. This project led to interesting biological findings. Compounds with nano-molar ranges of activities were obtained and, more interestingly, we found dissociation of the activity profile (hGRs vs IL1/IL6 receptors) for some compounds. This study also led to an unprecedented application of Burgess reagent (Scheme 2) which led an interesting expansion of ring B.

Organic & Medicinal Chemistry

Pr. Léon GhosezProf. Emer. UCL, associate member IECB, University of Bordeaux

Léon Ghosez was born in Aalst, Belgium, in 1934. He studied at the University of Louvain where he got a PhD in 1958 under the supervision of Prof. G. Smets,. He then spent 2 years as postdoctoral researcher at Harvard University (Prof. R.B. Woodward) and also collaborated for a few months with Prof. R. Huisgen in the Department of chemistry of the University of Münich He got his “Habilitation” at the age of 32 for his independent work on the stereochemistry of synthesis and rearrangement of halocyclopropanes. In 1969 he became “Professeur Ordinaire” at the University of Louvain where he created the laboratory of organic synthesis. During his career in Louvain (1963-1999) he supervised the research of 125 PhD students and 135 postdoctoral associates. He also hold appointments at the University of Liége ( 1969-1999) and the Ecole Polytechnique in Palaiseau (1993-1999). He took an active part in the creation of IECB where he established a research group in 1998. Since 2000, he shared the directorship of IECB with Dr J.J. Toulmé. Since 2011 he is an invited scientist in the same institute. His current research interests include the design and total synthesis of biologically active molecules and the search of mild, efficient and “green” Lewis acid catalysts. In 2007, he received the medal of the Société Française de Chimie as a recognition of his support to the development of organic chemistry in France. Léon Ghosez is an emeritus member of the Royal Academy of Sciences of Belgium and a fellow of the Royal Society of Chemistry.

Research team Dr. Eduard BADARAU Postdoctoral fellow (Université Bordeaux)Wafa GATI Postdoctoral fellow (Université Bordeaux)Etienne PAIR Postdoctoral fellow (Université Bordeaux)

The team is part of the unit “Chimie et Biologie des Membranes et Nanoobjets” (CBMN), CNRS/ Université Bordeaux (UMR 5248)

AssociateMembers

47

Scheme 1 : A short synthesis of a lycorine-inspired privileged scaffold

Synthetic and biological studies of highly potent spirocyclic ligands of glucocorticoid receptorsWe have designed spirocyclic analogs of fluorocortivazol as potential ligands for hGR. An efficient and practical synthesis of the target compounds was developed to yield eventually 8 compounds which were tested for their binding to hGR. The best ligand in this series had an IC50 of 0.4 nM (Scheme 2). The corresponding diastereoisomers was devoided of any activity. Interestingly our studies also revealed that the dehydrated derivatives bound significantly to hGR. The results also showed a selectivity of these new ligands for hGR (vs PR).

Scheme 2 : Binding of spirocyclic analogs of fluorocortivazol to hGR

Sustainable electrophilic catalysts for the activation of highly functionalized and sensitive moleculesAn ANR application has been filed this year to pursue this project in collaboration with J. Cossy at the Ecole de Chimie de Paris. It has obtained a score of 42 and 43/45 at the first selection. In the mean time we have completed our study of the ionic solvents made from high concentrations of LiNTf2 in organic solvents such as ethers, esters, acetonitrile. The goal was publish a full paper on this subject at the end of the postdoctoral training of E. Pair. The results confirmed that the lithium cation could act as a strong acid but kept intact many functional groups which are acid-sensitive.


Munyemana, F. ;George, I.; Devos, A.; Colens,A.; Frisque-Hesbain.; A-M, Badarau.; E, Loudet, A.; Differding, E.; Damien,J-M.; Rémion, J.; Van Uytbergen, J.; Ghosez, L. A mild method for the replacement of an hydroxyl group by halogen. Scope and chemoselectivity. Tetrahedron 2016, 72, 420-430.

Badarau, E.; Robert Frédéric, ; Massip, S.; Jakob, F.; Lucas, S.; Frormann, S.; Ghosez, L. submitted April 2017

AssociateMembers

48

peer-reviewed Articles 1. Arenz S, Bock LV, Graf M, Innis CA, Beckmann R, Grubmüller H,

Vaiana AC, Wilson DN. A combined cryo-EM and molecular dynamics approach reveals the mechanism of ErmBL-mediated translation arrest. Nat Commun. 7, 2016; 12026.

2. Jewginski M, Fischer L, Colombo C, Huc I, Mackereth CD. Solution Observation of Dimerization and Helix Handedness Induction in a Human Carbonic Anhydrase-Helical Aromatic Amide Foldamer Complex. Chembiochem. 2016 Apr 15; 17(8):727-36

3. Ambrogio C, Barbacid M and Santamaría D. In vivo oncogenic conflict triggered by co-existing KRAS and EGFR activating mutations in lung adenocarcinoma. 2016 Oct 24; Oncogene.

4. Ambrogio C, Gómez-López G, Falcone M, Kim H.G, Byun S, Crosetto N, Blasco R, Sánchez-Céspedes M, Ren X, Wang Z, Ding K, Hidalgo M, Serrano M., Santamaría D.* and Barbacid, M.* Combined inhibition of DDR1 and Notch signaling is a therapeutic strategy for KRAS-driven lung adenocarcinoma. Nature Medicine 2016; 22, 270-7. *Co-corresponding authors.

5. Antunes S, Douat C, and Guichard G. Solid-Phase Synthesis of Hybrid Urea Oligomers Containing Conservative Thiourea Mutations, Eur. J. Org. Chem. 2016; 2131-2138.

6. Arfi Y, Minder L, Di Primo C, Le Roy A, Ebel C, Coquet L, Claverol S, Vashee S, Jores J, Blanchard A, Sirand-Pugnet P. MIB-MIP is a mycoplasma system that captures and cleaves immunoglobulin G. Proc Natl Acad Sci U S A. 2016; 113(19):5406-11.

7. Bedrat A, Lacroix L, Mergny JL. Re-evaluation of G-quadruplex propensity with G4Hunter. Nucleic Acids Res. 2016; 44:1746-59. Recommended by Faculty of 1000.

8. Beyrath J, Chekkat N, Smulski CR, Lombardo CM, Lechner MC, Seguin C, Decossas M, Spanedda MV, Frisch B, Guichard G and Fournel S. Synthetic ligands of death receptor 5 display a cell-selective agonistic effect at different oligomerization levels, Oncotarget 7. 2016; 64942-64956

9. Borre E, Dahm G, Guichard G and Bellemin-Laponnaz S. Post-functionalization of platinum-NHC complexes by oxime ligation for ligand targeted therapy, New J. Chem. 2016; 40, 3164-3171.

10. Carvalho J, Ferreira J, Pereira P, Coutinho E, Guédin A, Nottelet P, Salgado GF, Mergny JL,, Queiroz JA, Sousa F, Cabrita EJ, Cruz C. Stabilization of novel immunoglobulin switch regions G-quadruplexes by naphthalene and quinoline-based ligands. Tetrahedron 2016; 72:1229-1237.

11. Chandramouli N, El-Behairy MF, Lautrette G, Ferrand Y, Huc I. Polar solvent effects on tartaric acid binding by aromatic oligoamide foldamer capsules. Org. Biomol. Chem. 2016; 14:2466

12. Chandramouli N, Ferrand Y, Kauffmann B, Huc I. Citric acid encapsulation by a double helical foldamer in competitive solvents. Chem.Commun. 2016; 52:3939

13. Chekkat, N., Dahm, G, Chardon, E, Wantz, M., Sitz, J, Decossas, M, Lambert, O, Frisch, B, Rubbiani, R, Gasser, G, Guichard, G, Fournel, S, and Bellemin-Laponnaz, S. N-Heterocyclic Carbene–Polyethylenimine Platinum Complexes with Potent in Vitro and in Vivo Antitumor Efficacy, Bioconjug. Chem. 2016; 27, 1942-1948.

14. Collie GW, Pulka-Ziach K and Guichard G. In situ iodination and X-ray crystal structure of a foldamer helix bundle, Chem. Commun. 52. 2016; 1202-1205.

15. Collie GW, Pulka-Ziach K and Guichard G. Surfactant-facilitated crystallisation of water-soluble foldamers, Chem. Sci. 2016; 7, 3377-3383.

16. Daskalov A, Habenstein B, Sabaté R, Berbon M, Martinez D, Chaignepain S, Coulary-Salin B, Hofmann K, Loquet A, Saupe SJ. Identification of a novel cell death-inducing domain reveals that fungal amyloid-controlled programmed cell death is related to necroptosis. Proc Natl Acad Sci U S A. 2016; 113(10):2720-5

17. Dausse E, Barré A, Aimé A, Groppi A, Rico A, Ainali C, Salgado G, Palau W, Daguerre E, Nikolski M, Toulmé JJ, Di Primo C. Aptamer selection by direct microfluidic recovery and surface plasmon resonance evaluation. Biosens Bioelectron. 2016; 80:418-25.

18. De Rache A, Gueddouda NM, Bourdoncle A, Reissig H, Mergny

JL. A flexible terpyridine derivative interacts specifically with G-quadruplexes. Chemistry. 2016; 22(36):12651-4

19. Denisov SA, Gan Q, Wang X, Scarpantonio L, Ferrand Y, Kauffmann B, Jonusauskas G, Huc I, McClenaghan ND. Electronic energy transfer modulation in a dynamic foldaxane: proof-of-principle of a lifetime-based conformation probe. Angew. Chem. Int. Ed. 2016; 55:1328.

20. Diemer V, Fischer L, Kauffmann B and Guichard G. Anion Recognition by Aliphatic Helical Oligoureas, Chem. Eur. J. 2016; 22, 15684-15692

21. Diveshkumar KV, Sakrikar S, Rosu F, Harikrishna S, Gabelica V, Pradeepkumar PI. Specific Stabilization of c-MYC and c-KIT G-Quadruplex DNA Structures by Indolylmethyleneindanone Scaffolds. Biochemistry. 2016; 55(25):3571-3585.

22. Frøkjær-Jensen C, Jain N , Hansen L., Davis W, Li Y, Zhao D, Rebora K, Millet JRM, Liu X, Kim S K , Dupuy D, Jorgensen EM, Fire AZ. An Abundant Class of Non-coding DNA Can Prevent Stochastic Gene Silencing in the C. elegans Germline. Cell. 2016; 166(2):343-57

23. Hu X, Dawson SJ, Nagaoka Y, Tanatani A, Huc I. Solid-phase synthesis of water-soluble helically folded hybrid α-amino acid/quinoline oligoamides. J. Org. Chem. 2016; 81:1137

24. Jewginski M, Fischer L, Colombo C, Huc, Mackereth CD. Solution observation of dimerization and helix handedness induction in a human carbonic anhydrase-helical aromatic amide foldamer complex. ChemBioChem 2016; 17:727.

25. Kudo M, Carbajo López D, Maurizot V, Masu H, Tanatani A, Huc I. Synthesis and conformational analysis of quinoline–oxazole peptides. Eur. J. Org. Chem. 2016; 2457.

26. Largy E, Marchand A, Amrane S, Gabelica V, Mergny JL. Quadruplex Turncoats: Cation-Dependent Folding and Stability of Quadruplex-DNA Double Switches. J Am Chem Soc. 2016; 138(8):2780-2792.

27. Lautrette G, Wicher B, Kauffmann B, Ferrand Y, Huc I. Iterative evolution of an abiotic foldamer sequence for the recognition of guest molecules with atomic precision. J. Am. Chem. Soc. 2016; 138:10314.

28. Lecarme L, Prado E, De Rache A, Nicolau-Travers ML, Gellon G, Dejeu J, Lavergne T, Jamet H, Gomez D, Mergny JL, Defrancq E, Jarjayes O, Thomas F. Efficient Inhibition of Telomerase by Nickel-Salophen Complexes. ChemMedChem. 2016; 11(11):1133-6

29. Li X, Markandeya N, Jonusauskas G, McClenaghan ND, Maurizot V, Denisov SA, Huc I. Photoinduced electron transfer and hole migration in nanosized helical aromatic oligoamide foldamers. J. Am. Chem. Soc. 2016; 138:13568

30. Li X, Qi T, Srinivas K, Massip S, Maurizot V, Huc I. Segment doubling synthesis and multi-bromination of nanosized helical aromatic amide foldamers. Org. Lett. 2016; 18:1044.

31. Lin S, Lu L, Kang TS, Mergny JL*, Leung CH, Ma DL. The interaction of an iridium(III) complex with G-quadruplex DNA and its application in luminescent switch-on detection of Siglec-5. Analytical Chem. 2016; 88(20):10290-10295

32. Lombardo CM, Collie GW, Pulka-Ziach K, Rosu F, Gabelica V, Mackereth CD, Guichard G. Anatomy of an Oligourea Six-Helix Bundle. J Am Chem Soc. 2016; 138(33):10522-10530.

33. Lopez S, Voisset, E, Tisserand, J.C., Mosca, C., Prebet, T., Santamaria, D., Dubreuil, P. and De Sepulveda, P. An essential pathway links FLT3-ITD, HCK and CDK6 in acute myeloid leukemia. 2016 Jun 13; Oncotarget.

34. Lorenz H, Price M, Mastour N, Brunet J-F, Barrière G, Friscourt F, Badaut J, Increase of Aquaporin 9 Expression in Astrocytes participates in Astrogliosis, J. Neurosci. Res., 2016; Manuscript accepted

35. Mandal PK, Baptiste B, Langlois d’Estaintot B, Kauffmann B, Huc I. Multivalent interactions between an aromatic helical foldamer and a DNA G-Quadruplex in the solid state. ChemBioChem 2016;17:1911.

36. Mandal PK, Collie GW, Srivastava SC, Kauffmann B, Huc I. Structure elucidation of the Pribnow box consensus promoter sequence by racemic DNA crystallography. Nucleic Acids Res, 2016; 44:1936.

37. Mandal PK, Kauffmann B, Destecroix H, Ferrand Y, Davis AP, Huc I. Crystal structure of a complex between b-glucopyranose and a macrocyclic receptor with dendritic multicharged water solubilizing chains. Chem.Commun. 2016; 52:9355.

38. Marchand A, Gabelica V. Folding and misfolding pathways of G-quadruplex DNA. Nucleic Acids Res. 2016; 44: 10999-11012.

39. Marchand A, Strzelecka D, Gabelica V. Selective and Cooperative Ligand Binding to Antiparallel Human Telomeric DNA G-Quadruplexes. Chem. Eur. J. 2016; 22(28):9551-9555.

publications

49

40. Mauran L, Kauffmann B, Odaert B and Guichard G. () Stabilization of an α-helix by short adjacent accessory foldamers, C. R. Chimie. 2016; 19, 123-131.

41. Mendoza O, Bourdoncle A, Boulé JB, Brosh RM Jr, Mergny JL. G-quadruplexes and helicases. Nucleic Acids Res. 2016; 44:1989-2006. Review.

42. Mendoza O, Mergny JL, Aimé JP, Elezgaray J. G-Quadruplexes Light up Localized DNA Circuits. Nano Lett. 2016; 16:624-8.

43. Munyemana F, George I, Devos A, Colens A, Frisque-Hesbain AM, Badarau E, Loudet A, Differding E, Damien JM, Rémion J, Van Uytbergen J, Ghosez L. A mild method for the replacement of an hydroxyl group by halogen. Scope and chemoselectivity. Tetrahedron 2016; 72, 420-430.

44. Stanek J, Andreas LB, Jaudzems K, Cala D, Lalli D, Bertarello A, Schubeis T, Akopjana I, Kotelovica S, Tars K, Pica A, Leone S, Picone D, Xu ZQ, Dixon NE, Martinez D, Berbon M, El Mammeri N, Noubhani A, Saupe S, Habenstein B, Loquet A, Pintacuda G. NMR Spectroscopic Assignment of Backbone and Side-Chain Protons in Fully Protonated Proteins: Microcrystals, Sedimented Assemblies, and Amyloid Fibrils. Angew Chem. Int. Ed. Engl. 2016; 55(50):15504-15509

45. Noer SL, Preus S, Gudnason D, Aznauryan M, Mergny JL, Birkedal V. Folding dynamics and conformational heterogeneity of human telomeric G-quadruplex structures in Na+ solutions by single molecule FRET microscopy. Nucleic Acids Res. 2016; 44(1):464-71.

46. Noguchi H, Takafuji M, Maurizot V, Huc I, Ihara H. Chiral separation by a terminal chirality triggered P-helical quinolineoligoamide foldamer. J. Chromatogr. A 2016; 1437:88

47. Romanucci V, Marchand A, Mendoza O, D’Alonzo D, Zarrelli A, Gabelica V, Di Fabio G. Kinetic ESI-MS Studies of Potent Anti-HIV Aptamers Based on the G-Quadruplex Forming Sequence d(TGGGAG). ACS Med Chem Lett. 2016; 26;7(3):256-260.

48. Sabharwal NC, Mendoza O, Nicoludis JM, Ruan T, Mergny JL, Yatsunyk LA. Investigation of the interactions between Pt(II) and Pd(II) derivatives of 5,10,15,20-tetrakis (N-methyl-4-pyridyl) porphyrin and G-quadruplex DNA. J Biol Inorg Chem. 2016; 21(2):227-39.

49. Safa L, Gueddouda NM, Thiébaut F, Delagoutte E, Petruseva I, Lavrik O, Mendoza O, Bourdoncle A, Alberti P, Riou JF, Saintomé C. 5’ to 3’ Unfolding Directionality of DNA Secondary Structures by Replication Protein A: G-QUADRUPLEXES AND DUPLEXES. J. Biol. Chem. 2016; 291:21246-21256.

50. Saintomé C, Amrane S, Mergny JL, Alberti P. The exception that confirms the rule: a higher-order telomeric G-quadruplex structure more stable in sodium than in potassium. Nucleic Acids Res. 2016 Apr 7; 44(6):2926-35.

51. Seefeldt, A.C., Graf, M., Nguyen, F., Pérébaskine, N., Arenz, S., Mardirossian, M., Scocchi, M., Wilson, D.N., Innis, C.A.†. Structure of the mammalian antimicrobial peptide Bac7(1-16) bound within the exit tunnel of a bacterial ribosome. Nucleic Acids Res. 2016; 44, 2429-2438.

52. Serra-Batiste, M.; Bayoumi, M.; Gairí, M.; Ninot-Pedrosa, M.; Maglia, G., Carulla, N. Aβ42 assembles into specific β-barrel pore-forming oligomers in membrane-mimicking environments Proc. Natl. Acad. Sci. USA, 2016; 113, 10866-10871.

53. Teyssières E, Corre J-P, Antunes,S, Rougeot C, Dugave C, Jouvion G, Claudon P, Mikaty G, Douat C, Goosens P L, and Guichard G. Proteolytically stable foldamer mimics of host-defense peptides with protective activities in a murine model of bacterial infection, J. Med. Chem., 2016; 59, 8221-32.

54. Tsiamantas C, Dawson SJ, Huc I. Solid phase synthesis of oligoethylene glycol-functionalized quinolinecarboxamide foldamers with enhanced solubility properties. C. R. Chimie 2016; 19:132

55. Tsiamantas C, de Hatten X, Douat C, Kauffmann B, Maurizot V, Ihara H, Takafuji M, Metzler-Nolte N, Huc I. Selective dynamic assembly of disulfide macrocyclic helical foldamers with remote communication of handedness. Angew. Chem. Int. Ed. 2016; 55:6848.

56. Upadhyay SK, Mackereth CD. (1)H, (15)N and (13)C backbone and side chain resonance assignments of the RRM domain from human RBM24. Biomol NMR Assign. 2016 Oct; 10(2):237-40.

57. Visentin J, Guidicelli G, Couzi L, Merville P, Lee JH, Di Primo C, Taupin JL. Deciphering IgM interference in IgG anti-HLA antibody detection with flow beads assays. Hum Immunol. 2016; 77(11):1048-1054.

58. Visentin J, Minder L, Lee JH, Taupin JL, Di Primo C. Calibration free concentration analysis by surface plasmon resonance in a capture mode. Talanta. 2016; 148:478-85.

59. Wang K, Friscourt F, Dai C, Wang L, Zheng Y, Boons G-J, Wang S,

Wang B A metal-free turn-on fluorescent probe for the fast and sensitive detection of inorganic azides. Bioorg. Med. Chem. Lett., 2016; 26: 1651-1654.

60. Wang M, Mao Z, Kang TS, Wong CY, Mergny JL*, Leung CH, Ma DL. Conjugation of a groove binding motif to an Ir(III) complex for the enhancement of G-quadruplex probe behavior Chem Sci. 2016; 7:2516-2523.

61. Wechsel R, Raftery J, Cavagnat D, Guichard G and Clayden, J. The meso Helix: Symmetry and Symmetry-Breaking in Dynamic Oligourea Foldamers with Reversible Hydrogen-Bond Polarity, Angew. Chem. Int. Ed. 2016; 55, 9657-9661.

62. Wojtowicz H, Prochnicka-Chalufour A, de Amorim GC, Roudenko O, Simenel C, Malki I, Pehau-Arnaudet G, Gubellini F, Koutsioubas A, Pérez J, Delepelaire P, Delepierre M, Fronzes R, Izadi-Pruneyre N. Biochem J. 2016 Jul 15;473(14):2239-48.

63. Zhou J, Tateishi-Karimata H, Mergny JL, Cheng M, Feng Z, Miyoshi D, Sugimoto N, Li C. Reevaluation of the stability of G-quadruplex structures under crowding conditions. Biochimie. 2016; 121:204-8.

64. Zoued A, Durand E, Brunet YR, Spinelli S, Douzi B, Guzzo M, Flaugnatti N, Legrand P, Journet L, Fronzes R, Mignot T, Cambillau C, Cascales E. Priming and polymerization of a bacterial contractile tail structure. Nature. 2016 Mar 3;531(7592):59-63.

publications

50

Other publications 1. Dawson SJ, Hu X, Claerhout S, Huc I. Solid phase synthesis of

helically folded aromatic oligoamides. Meth. Enzym. 2016;580:279.2. Largy E, Mergny JL, Gabelica V. Role of Alkali Metal Ions in

G-Quadruplex Nucleic Acid Structure and Stability. Met Ions Life Sci. 2016; 16:203-58. Book Chapter

3. Ambrogio C, Nadal E, Villanueva A, Gómez-López G, Cash TP, Barbacid M, Santamaría D. KRAS-driven lung adenocarcinoma: combined DDR1/Notch inhibition as an effective therapy. ESMO Open 2016 Sep 6;1(5):e000076.

4. Gabelica V, Jeroen Kool and Wilfried M. A. Niessen (Eds.): Analyzing biomolecular interactions by mass spectrometry. Anal Bioanal Chem. (2016) 408(24):6515-6516. (book review)

5. Largy E, Mergny JL, Gabelica V. Role of Alkali Metal Ions in G-Quadruplex Nucleic Acid Structure and Stability. Met Ions Life Sci. (2016) 16:203-58. (book chapter)

patents• Amyloid beta peptide oligomers and uses thereof, Serra-Batiste,

M.; Ninot-Pedrosa, M.; Maglia, G., Carulla, N. EP16382123.4, IRB Barcelona and University of Leuven

• Y. Fu, O. Mendoza, J.L. Mergny. pH-responsive polynucleotide complexes. EP16305270, March 11, 2016.

prizes, Awards• Schulich Guest Professor, Technion – Israel Institute of Technology,

I. Huc• Prix Michelin, 18ème Journée Scientifique de l’EDSC, D. Bécart• ATIP-Avenir, CNRS, F. Friscourt

Journal & Scientific Society Boards• Reviewer, JACS and Biophysical Journal, N. Carulla• Reviewer for Nature Communications, PNAS, Cell Reports, JACS,

Nature Chemical Biology, A. Innis• Vice-President, Bordeaux Association for Crystallography, I. Huc• Member of the International editorial advisory board, European

Journal of Organic Chemistry, I. Huc• President, Groupe Français des peptides et des proteins (GFPP), C.

Douat• Scientific advisor, Société de Chimie Thérapeutique (SCT), G. Guichard• Vice President, Société Chimique de France – Section Aquitaine, G.

Guichard• Associate Editor, Biochemistry and Call Biology, C. Mackereth• Editor, Biochimie, JL. Mergny• Reviewer, Molecular Biology of the Cell, Biochemistry and Cell Biology,

United States-Israel Binational Science Foundation, D. McCusker• Reviewer, Cell Cycle, Journal of Cell Science, A. Royou• Peer-review evaluation of publications, Nature Cell Biology, Scientific

Reports, Cell Death and Differentiation, Cell Death and Disease, Journal of Neurochemistry, RV. Duran

• Editorial board, Molecular Cancer, D. Santamaria• Review editor, Frontiers in Cell and Developmental Biology, D.

Santamaria• Editorial Board Member, Journal of the American Society for Mass

Spectrometry, V. Gabelica• Member, Publications committee of the American Society for Mass

Spectrometry, V. Gabelica• Board member, and Secretary, Société Française de Spectrométrie de

Masse, V. Gabelica• Regional Editor, Tetrahedron, L. Ghosez

Evaluation Boards• Grant Revision, Alzheimer Forschung Initiative, N. Carulla• Management committee member for Spain, COST Action BM1403

“Native Mass Spectrometry and related Methods for Structural Biology”, N. Carulla

• Comité de Pilotage Axe 1, Cancéropôle Grand Sud-Ouest, G. Guichard• Membre de section, Comité National de la Recherche scientifique, G.

Guichard• Commission Recherche, Université de Bordeaux, JL. Mergny• Award selection Committee, Hites Award (year’s best paper in J. Am.

Soc. Mass Spectrom.), V. Gabelica• Management committee member for France, Co-leader of WG4, COST

Action BM1403 “Native Mass Spectrometry and Related Methods for Structural Biology”, V. Gabelica

• Chairman of the Scientific Board, Fondation pour la Recherche en Chimie, L. Ghosez

• Member of the Japanese Panel, JST-ANR , L. Ghosez

publications, patentsprizes & Boards

51

teaching• Structural biology (10 hours), Master 1 students (“Biologie, Santé”),

University of Bordeaux, A. Innis• Chimie générale, Chimie organique, Biomolécules du vivant: 192

HETD (192h), BSc Level (L1 SVSTC Chimie, L2 SVSTC Chimie), MSc Level (M1 MMF/COSV Chimie du vivant), C. Dolain

• Structural Biochemistry (43h) L1, Methodology (40h) L2, Bioinformatics (40h) L3, Spectroscopy (12h) L3, Bioinformatics (50h) M1, P. Bonnafous

• Physical Chemistry, Biophysics, Scientific English, Chemistry (96.25h), University of Bordeaux, G. Salgado

• Synthesis of Biomolecules (3h) M1 - Univ. Bordeaux, Instrumentation (7h) L3 - Tecsan Univ. Bordeaux, Biophysics (9h) L2, school of engineer - ENSTBB Bordeaux, C. Di Primo

• Synthesis of Biomolecules (6h), M1 - Univ. Bordeaux, JL. Mergny• Thermodynamics, kinetics and physical-chemistry (70h) L2

undergraduated, Enzymology (40h) L2 undergraduated, Physics for biology (30h) L1 undergraduated, Methodology in science (20h) L1 undergraduated, Biophysics (15h) L3 undergraduated, Computer sciences (10h) L1 undergraduated, A. Bourdoncle

• Irreversibility and switch-like characteristics of the cell cycle, Cell Cycle class M2 program, University of Bordeaux, D. McCusker

• Checkpoints, Aneuploidy and Cancer (4h), Cell cycle class- M2 program, D. Goutte-Gattat

• Cancer Metabolism, M2 Master Course, MV. Duran• Ecole thématique CNRS « Ion Mobility and Mass Spectrometry »,

Mobilité ionique et activation des ions (1H30), V. Gabelica

phD theses• Xuesong Li “Synthesis and physical properties of helical nanosized

quinoline-based foldamers”, I. Huc, V. Maurizot, Univ. Bordeaux., Erasmus Mundus, 2016

• Xiang Wang “Orchestration of self-assembly and molecular motions in helical pseudo-rotaxanes”, I. Huc, Y. Ferrand, Univ. Bordeaux, China Scholarship Council, 2016

• Maëlle Vallade “Recognition of protein surfaces by aromatic oligoamide foldamers”, I. Huc, L. Fischer, Univ. Bordeaux, Ministry of research, 2016

• Nassima Gueddouda, “Unwinding and stabilisation of G-quadruplexes: interaction with helicases and screening of new ligands“, A. Bourdoncle, ANR

• Adrien Marchand, “ Mass Spectrometry Study of G-Quadruplex Nucleic Acids: Folding Pathways and Ligand Binding Modes”, V. Gabelica, Université de Bordeaux, Inserm/Conseil Régional Aquitaine, 2016

Science & Society• General public conference on molecular machines - CNAM, Paris,

France, September 2016, I. Huc• Radio broadcast on molecular machines, Paris, France, September

2016, I. Huc• General public conference on molecular machines, Arcachon, France,

March 2017, I. Huc• Fêtes de la Science, Bordeaux, France, MC. Claverie• Testimony at the colloquium “Ruptures, Evolutions, Innovations: la

Chimie aux frontières”, CNRS, Paris, France, May 2016, V. Gabelica

teaching & Science Outreach

52

team FundingEuropean fundingCoordinated by IECB researchers/IECB researchers as participants

IECB Researcher(s) Funding body Research project period

R. Fronzes ERC Consolidator Grant PneumoTransfo : Structure and function of the bacterial transformasome 2017 - 2022

V. Gabelica ERC-2013-CoG DNAFOLDIMS : Advanced mass spectrometry approaches to reveal nucleic acid folding energy landscapes 2014 - 2019

I. Huc ERC Advanced A2F2 : Functional Aromatic Amide Foldamers: Beyond Biopolymers 2013 - 2018

A. Innis ERC Consolidator Grant NascenTomiX : Ribosome inhibition by nascent or antimicrobial peptides 2017 - 2022

A. Royou ERC Starting Grant NoAneuploidy : Mechanisms that prevent aneuploidy 2013 - 2017

International fundingCoordinated by IECB researchers/IECB researchers as participants

IECB Researcher(s) Funding body Research project period

N. Carulla COST Action Native mass spectrometry and related methods for structural biology 2014 - 2018

V. Gabelica Marie Curie-2012-CIG BIOPHYMS : Mass spectrometry for nucleic acids biophysics: dealing with diversity 2013 - 2017

V. Gabelica H2020-MSCA-ITN-2014 MetaRNA : RNA-based technologies for single-cell metabolite analysis 2015 - 2018

G. Guichard H2020 Marie Curie IF Convention de collaboration 2014 - 2017

G. Guichard H2020 Marie Curie IF FOLDASYNBIO : Bioinspired nanostructures 2015 - 2017

I. Huc China Scholarship Council Foldamer based molecular motors 2012 - 2016

I. Huc China Scholarship Council Amphipathic foldamers 2013 - 2017

I. Huc Polish Government Foldamer based protein recognition 2014 - 2016

I. Huc H2020 – People – IEF RAMSES : Aryl amide metallo-foldamers as selective saccharide sensors 2015 - 2017

I. Huc China Scholarship Council Self-assembly of foldamers – applications in electron transport 2015 - 2019

I. Huc H2020 – People – IEF ResMoSys : Multi-stimuli responsive molecular systems 2015 - 2018

I. Huc H2020 – People – IEF PROFOLIG : Covalent-ligation-assisted elucidation of protein-aromatic foldamer interactions 2017 - 2019

A. Innis Marie-Curie CIG (Career Integration Grant)

transARREST : Translational regulation of gene expression by the nascent polypeptide chain 2014 - 2018

JL. Mergny ANR-internationale Oligoswitch : G4 ligands (with Hong Kong / Prof. E. Ma) 2013 - 2016

JL. Mergny Czech Rep. SYMBIT : Structural gymnastics of nucleic acids 2016 - 2022

E. Sartorel Marie-Curie Lipids & Polarity : The diffusion and nanoclustering of a polarity module in the lipid environment 2016 - 2018

team Funding

53

National fundingCoordinated by IECB researchers/IECB researchers as participants IECB Researcher Funding body Research project period

F. Bernard IDEX Bordeaux Genetic control of alternative splicing in response to environmental stress in C. elegans. 2016 - 2018

RV. Duran INSERM Dotation Exceptionnelle a l’installation 2016 - 2017

Y. Ferrand ANR – DFG FOLDHYD : Foldamer-peptide conjugates as hydrogenase mimics 2015 - 2018

F. Friscourt IDEX Bordeaux BSSPROBE : Bioorthogonal Probes for Chemical Glycobiology 2014 - 2017

G. Guichard ANR SIMI7 2012 FOLDART : Composite proteins 2013 - 2016

G. Guichard ANR ASTRID 2012 NEOTHERAPEUTICS : Antimicrobial foldamers against Bacillus anthracis 2013 - 2016

G. Guichard ANR Generic Call 2014 RiboFLEX : Structural studies of arrested ribosome nascent chain complexes 2014 - 2017

G. Guichard IMMI / INSERM/ AstraZeneca AnBRe : Antibiotics against Bacterial Replication 2015 - 2017

G. Guichard ANR Generic Call 2015 CHIMPP2I : CHIMPP2I –PPI inhibitors 2015 - 2019

A. Herrero del Valle Ministry of Research Identification and characterization of novel metabolite-sensing arrest peptides 2016 - 2019

I. Huc ANR – blanc FOSET : Foldamers Scaffolds for Electron Transport 2012 - 2016

I. Huc Ministry of research Pre-doctoral Fellowship 2013 - 2016

I. Huc Ministry of research Pre-doctoral Fellowship 2014 - 2017

I. Huc ANR – JST COFFIT : Molecular technologies for hybrid folded architectures 2015 - 2018

A. Innis ANR Générique riboFLEX : Structural studies of arrested ribosome nascent chain complexes prepared using a flexizyme-based approach 2014 - 2018

A. Loquet ANR Funhydro : NMR 2017 - 2020

C. Mackereth ANR SAFAPOLYA : Structural and functional analysis of yeast cleavage and polyadenylation factors 2012 - 2017

C. Mackereth ANR ChemMoPPI : Chemical tools for the modulation and monitoring of protein-protein interactions at the synapse 2013 - 2016

D. McCusker ANR Polarflux : Regulation and dynamics of a Rho-GTPase signalling module 2013 - 2017

JL. Mergny ANR – blanc BacTox1 2014 - 2016

JL. Mergny ANRS Rôle des G-quadruplexes dans le cycle de réplication du VIH 2016 - 2017

E. Montembault ANR ARC2-ChromSCeD : Adaptive response of the cell to coordinate chromosome segregation with cell division 2012 - 2016

C. Seefeldt INSERM Structural studies of arrested ribosome nascent chain complexes 2014 - 2017

team Funding

54

Regional fundingCoordinated by IECB researchers/IECB researchers as participants

IECB Researcher Funding body type of funding period

S. Amrane PEPS CNRS - Univ. Bordeaux ACRIVIR 2016 - 2017

C. Bodineau Univ. Bordeaux Role of AMPK and autophagy in mTOR-mediated cell death induction in cancer cells 2016 - 2019

N. Carulla Conseil Régional de Nouvelle-Aquitaine

Characterizing amyloid-β oligomers – a fundamental step to treat Alzheimer´s disease 2016 - 2019

C. Di Primo Conseil Régional de Nouvelle-Aquitaine Programme Maturation 2017

C. Douat PEPS/IDEX FoGNAD : Foldamer-Functionalized Gold Nanoparticules for Nucleic Acid Delivery 2015 - 2016

RV. Duran Conseil Régional de Nouvelle-Aquitaine

Interaction entre la signalisation TOR et le métabolisme de la glutamine dans les cellules cancéreuses 2013 - 2017

F. Friscourt Canceropole GSO (Emergence program) RadioProbe : Radiolabeling of bioorthogonal probe 2015 - 2016

F. Friscourt LabEx TRAIL FITTING : Traumatic Brain Injury Glycobiomarker 2016 - 2017

V. Gabelica Conseil Régional de Nouvelle-Aquitaine

Mass Spectrometry for nucleic acids biophysics: innovative approaches to study nucleic acid structure, self-assembly, and interactions with anticancer drugs

2013 - 2016

G. Guichard IDEX Univ. Bordeaux Bioinspired catalysis 2014 - 2017

G. Guichard Conseil Régional de Nouvelle-Aquitaine Bioinspired catalysis 2014 - 2017

G. Guichard /C. Dolain Univ. Bordeaux PPI Inhibitors 2015 - 2018

B. Habenstein PEPSRemorine : Remorine Dissection à l'échelle atomique des mécanismes d'insertion de la protéine Rémorine en microdomaines membranaires par RMN du Solide.

2016

I. Huc Conseil Régional de Nouvelle-Aquitaine

Ingénierie moléculaire : foldamères amides aromatiques pour la reconnaissance moléculaire 2015 - 2017

A. Innis Conseil Régional de Nouvelle-Aquitaine

La régulation de la synthèse des protéines par les peptides naissants / Regulation of Protein Synthesis by the Nascent Polypeptide Chain 2012 - 2016

A. Innis IDEX Univ. Bordeaux The nascent peptide as a natural and artificial regulator of gene expression 2015 - 2017

A. Innis Conseil Régional de Nouvelle-Aquitaine

The exit tunnel of the ribosome as a high-throughput selection platform for the development of novel antibiotics 2015 - 2019

C. Mackereth /K. Maruthi

Conseil Régional de Nouvelle-Aquitaine Biomimetics of synaptic proteins 2015 - 2016

D. McCusker Conseil Régional de Nouvelle-Aquitaine Regulation and Dynamics of a Rho GTPase signalling module 2015 - 2017

J.L. Mergny Conseil Régional de Nouvelle-Aquitaine Programme Maturation 2014 - 2016

TL. Nguyen Conseil Régional de Nouvelle-Aquitaine

Caractérisation biochimique de l’interaction entre le métabolisme de la glutamine et la signalisation de mTOR 2014 - 2017

A. Royou Conseil Régional de Nouvelle-Aquitaine Mechanisms that control chromosome transmission 2014 - 2017

G.F. Salgado Inserm - Univ. Bordeaux Chaire Inserm-Université 2016 - 2017

D. Santamaria IDEX Univ. Bordeaux Recruitment package 2016 - 2018

D. Santamaria Siric-BRIO Recruitment package 2016 - 2018

C. Seefeldt Conseil Régional de Nouvelle-Aquitaine Structural studies of arrested ribosome nascent chain complexes 2014 - 2017

team Funding

55

Charity-funded research projectsCoordinated by IECB researchers/IECB researchers as participants

IECB Researcher Charity Research project period

N. Carulla Fundació La Marató de TV3 Characterization and validation of a new druggable Ab oligomer target for Alzheimer´s disease 2015 - 2017

N. CarullaFondation pour la Recherche Médicale (FRM) – Amorçage de jeunes équipe

Characterizing amyloid-β oligomers – a fundamental step to treat Alzheimer´s disease 2016 - 2018

RV. Duran Ligue Contre le Cancer Analyse métabolique des leucémies aiguës lymphoblastiques causés par la dérégulation de la voie de signalisation Notch1 2016

RV. Duran Fondation ARC Role of mTOR and glutaminolysis in cancer cell death 2016 - 2017

G. Guichard /C. Douat Ligue Contre le Cancer PPI inhibitors 2014 - 2017

G. Guichard Fondation Arc PPI inhibitors 2017 - 2019

G. Salgado La Ligue contre le Cancer Gironde Ligand development against KRas G-quadruplex 2016 - 2017

Contracts with the industryCoordinated by IECB researchers/IECB researchers as participants

IECB Researcher Company Research contract period

E. Badarau / E. Pair Servier Synthèse d‘échafaudages polycycliques apparentés à l’acutumine 2016 - 2017

W. Gati DART Neuro sciences Synthesis of Scaffolds for Neurotherapeutics 2016 - 2017

G. Guichard ANRT/UreKa Foldamers for inhibiting PPIs 2014 - 2017

I. Huc CIVB New fluorescent probes for the simultaneous analysis of wine acids 2014 - 2017

IECB fundingCoordinated by IECB researchers

IECB Researcher Funding body Research contract period

N. Carulla IECB Complementary support of the IECB 2016 - 2017

D. Santamaria IECB / CNRS Recruitment package 2016 - 2017

team Funding

56

CollaborationsPole 1 - Structural biology & biophysics Translation regulation of gene expression Dr. Axel Innis

1. Daniel Wilson, Gene Center, LMU (U. of Munich), Munich, Germany

Solid-state NMR of molecular assembliesDr. Antoine Loquet

1. Dr. Sven Saupe, IBGC, UMR5095 CNRS, Bordeaux, France2. Dr. Guido Pintacuda, ENS Lyon, Luon, France

Protein aggregation and diseaseDr. Natalià Carulla

1. Pr. Giovanni Maglia, University of Groningen, Netherlands

Structure and function of bacterial nano-machinesDr. Rémi Fronzes

1. Dr. Cascales Eric, LISM CNRS, Marseille, France

Pole 2 - Organic & bioorganic chemistryBiomimetic Supramolecular ChemistryDr. Ivan Huc

1. Pr. Didier Dubreuil, Univ. Nantes, France2. Dr. Thierry Granier, CBMN, CNRS Univ Bordeaux, France3. Prof. Makoto Takafuji, Kumamoto University, Kumamoto, Japan4. Prof. Aya Tanatani, Ochanomizu University, Tokyo, Japan5. Prof. Nils Metzler-Nolste, Buchum University, Bochum, Germany6. Dr. Nathan McClenaghan, CNRS-Univ. Bordeaux, France7. Dr. Cameron Mackereth, INSERM-Univ. Bordeaux, France8. Prof. Anthony Davis, Univ. Bristol, UK9. Prof. Vojislava Pophristic, Univ. Sciences, Philadelphia, USA10. Dr. Andras Kotschy, Servier Laboratories, Budapest, Hungary

Peptidomimetic chemistryDr. Gilles Guichard

1. Pr. Jonathan Clayden, University of Bristol, Bristol, UK2. Dr. Stéphane Bellemin-Laponnaz, IPCMS, Strasbourg, France3. Pr. Sylvie Fournel, Faculté de Pharmarcie, Illkirch, France4. Dr. Benoit Odaert, CBMN, Pessac, France5. Dr. Olivier Lambert, CBMN, Pessac, France6. Dr. Axel Innis, ARNA, Pessac, France7. Dr. Valérie Gabelica, ARNA, Pessac, France8. Dr. Cameron Mackereth, ARNA, Pessac, France9. Dr. Pierre Gossens, Institut Pasteur, Paris, France

Chemical neuroglycobiologyDr. Frédéric Friscourt

1. Pr. Binghe Wang, Georgia State University, Atlanta, USA2. Dr. Jerome Badaut, CNRS UMR5287, Bordeaux, France

Pole 3 - Molecular recognitionNMR spectroscopy of protein-nucleic acid complexesDr. Cameron Mackereth

1. Dr. Ivan Huc, IECB, CNRS 5248 (CBMN), Pessac, France2. Dr. Gilles Guichard, IECB, CNRS 5248 (CBMN), Pessac, France3. Dr. Valerie Gabelica, IECB, Inserm U1212 (ARNA), Pessac, France4. Dr. Sébastien Fribourg, Inserm U1212 (ARNA), Bordeaux, France5. Dr. Lionel Minvielle-Sébastia, Inserm U1212 (ARNA), Bordeaux, France6. Dr. Michal Jewginski, Wroclaw University of Technology, Wroclaw,

Poland7. Dr. Santosh Upadhyay, CSIR-Institute of Genomics and Integrative

Biology, Dehli, India

Unusual nucleic acid structuresDr. Jean-Louis Mergny

1. Dr. Iyer K Swaminathan, School of Chemistry and Biochemistry, The University of Western Australia, Crawley, Australia

2. Dr. Jun Zhou, School of Chemistry & Chemical Engineering, Nanjing University, Nanjing, China

3. Dr. Dik-Lung Ma, Department of Chemistry Hong-Kong Baptist University (HKBU), Hong-Kong

4. Pr. Hiroshi Sugiyama, Department of Chemistry, Kyoto University, Kyoto, Japan

5. Pr. Liliya A. Yatsunyk, Department of Chemistry and Biochemistry, Swarthmore College, Swarthmore, PA, USA

6. Dr. Mirek Fojta, Dr. Lukas Trantirek, Dr. Michaela Vorlickova, Dr. Jiri Sponer, Dr. Jiri Fajkus, Institute of Biophysics, Czech Academy of Sciences, Brno, Czech Republic

7. Dr. Mauro Freccero, Università degli Studi di Pavia, Chemistry Department, Pavia, Italy

8. Pr. Hans-Ulrich Reißig, Institut fìr Chemie und Biochemie, Freie Universitït Berlin, Berlin, Germany

9. Dr. Juan Carlos Morales, CSIC - Instituto de Parasitología y Biomedicina, Armilla (Grenada), Spain

10. Dr. Victoria Birkedal, iNano, Aarhus, Danemark11. Pr. Carla Cruz, Uni. Beira Interior, Covilha, Portugal12. Dr. Jean-Baptiste Boulé, Dr. Patrizia Alberti, Pr. Jean-Francois Riou,

MNHN - CNRS UMR 7196 / INSERM U1154 - Sorbonne Universités, Paris, France

13. Dr. Jean-Luc Taupin, APHP, Hôpital Saint Louis, Paris, France14. Dr. Olivier Gascuel, Institut Pasteur, Paris, France15. Dr. Marie-Paule Teulade-Fichou, Dr. Anton Granzhan, Institut Curie,

Orsay, France16. Dr. Anny Slama-Schwok, INRA, Jouy-en-Josas, France17. Dr. Fabrice Thomas, Dr. Eric Defrancq, Université Grenoble Alpes,

Département de Chimie Moléculaire, Grenoble, France18. Dr. Geneviève Pratviel, Université de Toulouse, Toulouse, France19. Dr. Dennis Gomez, Université de Toulouse, Toulouse, France20. Dr. Eric Ennifar, University of Strasbourg, CNRS, Strasbourg, France21. Dr. Philippe Dumas, University of Strasbourg, CNRS, Strasbourg,

France22. Dr. Isabel Alves, CNRS, Bordeaux, France23. Dr. Jonathan Visentin, CHU Bordeaux, University of Bordeaux,

Bordeaux, France24. Dr. Macha Nikolski, Université de Bordeaux, Bordeaux, France25. Dr. Marie-Line Andreola, Dr. Michel Ventura, CNRS UMR5234,

Bordeaux, Bordeaux, France26. Dr. Yonathan Arfi, Université de Bordeaux, Bordeaux, France27. Dr. Jean-Jacques Toulmé, ARNA - Unversity of Bordeaux, Bordeaux,

France28. Dr. Jean-Pierre Aimé, Dr. Juan Elezgaray, CBMN - Unversity of

Bordeaux, Pessac, France29. Dr. Valérie Gabelica, IECB – ARNA - Unversity of Bordeaux, Pessac,

France

Collaborations

57

Pole 4 - Molecular & cellular biology

Dynamics of cell growth & cell divisionDr. Derek McCusker

1. Dr. Steven P. Gygi, Harvard Medical School, Boston, USA

Genome regulation & evolutionDr. Denis Dupuy

1. Dr. Frøkjær-Jensen Christian, Howard Hughes Medical Institute, Department of Biology, University of Utah, Salt Lake City, Utah, USA

Control and dynamics of cell divisionDr. Anne Royou

1. Dr. Dermaut Bart, Pasteur Institute, Lilles, France

Metabolism & cell signalingDr. Raul V. Duran

1. Dr. PRIAULT Muriel, CNRS, Bordeaux, France2. Dr. VACHER Pierre, INSERM, Bordeaux, France3. Dr. BOUCHECAREILH Marion, CNRS, Bordeaux, France

Associate membersMass spectrometry of nucleic acids and supramolecular complexesDr. Valérie Gabelica

1. Pr. Stephen J. Valentine, West Virginia University, Morgantown, USA2. Pr. Kazuo Nagasawa, Tokyo University of Agriculture and

Technology, Tokyo, Japan3. Pr. Modesto Orozco, Institute for Research in Biomedicine (IRB

Barcelona), Barcelona, Spain4. Pr. Giovanni Di Fabio, Federico II University of Napoli, Naples, Italy5. Dr. Marie-Paule Teulade-Fichou, Institut Curie, CNRS UMR176,

Centre Universitaire Paris XI, Orsay, Paris6. Dr. Janez Plavec, National Institute of Chemistry, Ljubljana, Slovenia7. Dr. Jean-Louis Mergny, IECB, U1212 ARNA, Pessac, France8. Dr. Gilles Guichard, IECB, UMR 5248 CBMN, Pessac, France9. Dr. Jean-Jacques Toulmé, U1212 ARNA, Bordeaux, France10. Pr. Pradeepkumar P.I., Indian Institute of Technology Bombay,

Mumbai, India11. Pr. Scott Hopkins, University of Waterloo, Waterloo, Canada12. Pr. Elisabeth Gwinn, University of California Santa Barbara, Santa

Barbara, USA

Collaborations

58

Invited ConferencesPole 1 - Structural biology & biophysics Translation regulation of gene expression

• EMBO Ribosome Structure and Function Conference, Strasbourg, France, July 2016, A. Innis

• Antimicrobial Peptide Symposium (AMP 2016), Montpellier, France, May 2016, A. Innis

• Future of Biophysics Burroughs Wellcome Fund Symposium, 60th Annual Meeting of the Biophysical Society, Los Angeles, USA, February 2016, A. Innis

NMR of molecular assemblies

• SFRMBM congress, Bordeaux, France, March 2016, A. Loquet• Journée Grand Sud de RMN, Montpellier, France, May 2016, A. Loquet• International meeting of the T3SS, Tubingen, Germany, April 2016,

A. Loquet• ETH Kolloquium, Zurich, Switzerland, May 2016, A. Loquet

Protein aggregation and disease

• Minisymposium on Protein Aggregation, Lund, Sweden, June 2016, N. Carulla

• Journée de l’Axe Interdisciplinaire du Pôle Rabelais. Intrinsic disorder: From molecular mechanisms to amyloidogenesis, Montpellier, France, October 2016, N. Carulla

• International Conference of the Centre for Protein Misfolding Diseases, Seville, Spain, November 2016, N. Carulla

Pole 2 - Organic & Bioorganic ChemistryBiomimetic supramolecular chemistry

• Polymat Seminar – Univ. of the Basque Country, San Sebastian, Spain, November 2016, I. Huc

• Basque Center for Biophysics – Univ. of the Basque Country, Department Seminar, Bilbao, Spain, November 2016, I. Huc

• Center for Integrated Protein Science. Scientific Oktoberfest 2016, Munich, Germany, September 2016, I. Huc

• Univ. of Fribourg, Department Seminar, Fribourg, Switzerland, August 2016, I. Huc

• ERC Grantees Conference 2016, Zandvoort, The Netherlands, August 2016, I. Huc

• New York foldamer workshop, New York, USA, June 2016, I. Huc• 1st Workshop on aromatic foldamers, Philadelphia, USA, June 2016,

I. Huc• Institut Quimic de Saria, Department Seminar, Barcelona, Spain,

April 2016, I. Huc• ETH Zürich Organic Chemistry Colloquium, Zürich, Switzerland,

March 2016, I. Huc• SFB749 meeting, Kloster Irsee, Germany, March 2016, I. Huc• Gordon Research Conference on Protein Folding Dynamics, Galveston,

USA, January 2016, I. Huc

Peptidomimetic chemistry

• SyCOCAL X (Symposium de Chimie Organique en Centre-Auvergne-Limousin), Clermont-Ferrand, France, August 2016, G. Guichard

• Foldamer Workshop, New-York, USA, June 2016, G. Guichard

Chemical neuroglycobiology

• Institut de recherches Servier, Department Seminar, Croissy sur Seine, France, April 2016, F. Friscourt

• 26eme Journées du Groupe Français des Glycosciences, Aussois, France, May 2016, F. Friscourt

• Service de Chimie Bioorganique et de Marquage, CEA Saclay, Department Seminar, Gif sur Yvette, France, June 2016, F. Friscourt

• Institut de Chimie Organique et Analytique (CNRS UMR7311), Department Seminar, Orléans, France, October 2016, F. Friscourt

• Les 12ème journées du Cancéropôle Grand-Sud-Ouest, La Grande Motte, France, November 2016, F. Friscourt

Pole 3 - Molecular Recognition

NMR spectroscopy of protein-nucleic acid complexes

• RNA Structural Biology, Bad Homburg, Germany, Novemer 2016, C. Mackereth

• 1st International Caparica Conference in Splicing, Lisbon, Portugal, September 2016, C. Mackereth

• 2nd Annual European MicroCal Meeting, Paris, France, September 2016, C. Mackereth

• 10th NMR Retreat of Protein-RNA Interaction, Parpan, Switzerland, March 2016, C. Mackereth

Unusual nucleic acid structures

• Developments in Protein Interaction Analysis, Berlin, Germany, June 2016, C. Di Primo

• Advances in Noncanonical Nucleic Acids - ANNA 2016, Ljubljana, Slovenia, May 2016, G. Salgado

• Advances in Noncanonical Nucleic Acids - ANNA 2016, Ljubljana, Slovenia, May 2016, JL. Mergny

• Interdisciplinary Medical, Dental & Soft Material Researches, Kitakyushu, Japan, January 2016, JL. Mergny

• Journées de la Matière condensée (JMC15), Bordeaux, France, August 2016, JL. Mergny

• RiboClub, Sherbrooke, Canada, September 2016, JL. Mergny

Pole 4 - Molecular & Cellular BiologyDynamics of cell growth & cell division

• American Society for Cell Biology, San Francisco, USA, December 2016, D. McCusker

Control and dynamics of cell division

• EMBO workshop on Cell cycle, Galway, Irland, June 2016, A. Royou• American Society for Cell Biology, San Francisco, USA, December,

2016, A. Royou• 23ème colloque de l’ACLF, Montpellier, France, September 2016,

J. Toutain

Metabolism and Cell Signaling

• IRCM, Montpellier, France, June 2016, RV Duran• INSERM U1053 Bordeaux Research in Translational Oncology,

Bordeaux, France, October 2016, RV Duran• Journées des chercheurs de la Ligue Contre le Cancer d’Aquitaine-

Charentes, Bordeaux, France, January 2016, RV Duran

Conferences

59

• Young Scientist Symposium IECB, Pessac, France, May 2016, Villar VH, Bodineau C

• 2nd Symposium Metabolism & Cancer - Canceropole, Palavas-les-Flots , France, Semptember 2016, Duran RV, Nguyen TL, Courtois S

• 6th CFATG Meeting, Talence, France, October, 2016, Duran RV, Nguyen TL, Bodineau C

Associate members

Mass spectrometry of nucleic acids and Supramolecular complexes

• IM-MS User Meeting and Workshop, Agilent Technologies, Waldbronn, Germany, January 2016, V. Gabelica

• Isolated Biomolecules and Biomolecular Interactions (IBBI), Oxford, UK, April 2016, V. Gabelica

• 64th Annual Conference of the American Society for Mass Spectrometry (ASMS), San Antonio (TX), USA, June 2016, V. Gabelica, M. Porrini

• Rencontre de Chimistes Théoriciens Francophones, RCTF 2016, Lyon, France, June 2016, J. Abi-Ghanem

• CECAM workshop “Computational methods for modelling multiply-charged droplets”, EPFL, Lausanne, Switzerland, July 2016, M. Porrini

• XXII International Roundtable on Nucleosides, Nucleotides and Nucleic Acids (IRT), Paris, France, July 2016, V. Gabelica

• 21st International Mass Spectrometry Conference (IMSC), Toronto, Canada, August 2016, V. Gabelica, C. Rabin, F. Rosu

• 33èmes Journées Françaises de Spectrométrie de Masse (JFSM), Bordeaux, France, September 2016, J. Abi-Ghanem, N. Khristenko

• 32nd Symposium on Chemical Physics (SCP), Waterloo, Canada, November 2016, V. Gabelica

• Invited seminar at University of Strathclyde, Glasgow, UK, March 2016, V. Gabelica

• Invited Seminar at University of Western Ontario, London (ON), Canada, November 2016, V. Gabelica

• MS-ESE/CRMS seminar at York University, York (ON), Canada, November 2016, V. Gabelica

• Invited seminar at Université de Strasbourg, Strasbourg, France, November 2016, V. Gabelica

Organic & medicinal chemistry

• Conference on Reactive Intermediates and Unusual Molecules, Heron Island, Australia, July 2016, L. Ghosez

• 12th Global Conference on Compound libraries, Berlin, Germany, October 2016, L. Ghosez

• Oxford University, Oxford, UK, June 2016, L. Ghosez• University of Queensland, Brisbane, Australia, July 2016, L. Ghosez• University of Sidney, Sidney, Australia, July 2016, L. Ghosez• University of New South Wales, Sidney, Australia, July 2016, L.

Ghosez• Australian National University, Canberra, Australia, August 2016,

L. Ghosez• University of Melbourne, Melbourne, Australia, August 2016, L.

Ghosez• Monash University, Melbourne, Australia, August 2016, L. Ghosez• University of Adelaide, Adelaide, Australia, August 2016, L. Ghosez• University of Western Australia, Perth, Australia, August 2016, L.

Ghosez

Conference Organisation

• 8th Bordeaux RNA Club Workshop, Bordeaux, France, June 2016, A. Innis, C. Mackereth, C. Di Primo, D. Dupuy

• Aptamers in Bordeaux, Bordeaux, France, June 2016, A. Innis• IECB Young Scientist Symposium (JJC), Bordeaux, France, C. Seefeldt• Euskadi – Nouvelle Aquitaine for magnetic resonance, Bordeaux,

France, February 2016, A. Loquet• Bordeaux 2016 Symposium on Foldamers, Bordeaux, France,

September 2016, I. Huc, G. Guichard, C. Douat, C. Dolain• Journée prix de these Société Chimique de France, Pessac, France,

October 2016, G. Guichard• BioSynSys, Bordeaux, France, D. Dupuy• Bordeaux Cell Biology Gathering, Bordeaux, France, A. Royou• 6th Meeting of the CFATG, Talence, France, October 2016, RV Duran• Symposium Metabolism & Cancer - Canceropole GSO/PACA 2016,

Palavas-les-Flots, France, September 2016, RV Duran• 33èmes Journées Françaises de Spectrométrie de Masse (JFSM 2016),

Bordeaux, France, September 2016, V. Gabelica• Workshop “Ion Mobility Spectrometry: How to Interpret the Data”

at the 64th Annual Conference of the American Society for Mass Spectrometry (ASMS), San Antonio (TX), USA, June 2016, V. Gabelica

Conferences

60 TechnologyPlatforms

61TechnologyPlatforms

technology platforms


IECB’s technology platform in biophysical and structural chemistry aims at answering structural and functional questions on molecules/complexes of biomedical interest, with particular emphasis on topics related to biomembranes gene expression and biomimetic molecules (foldamers). IBiSA-labelled since 2011, this open platform provides internal and external research teams with a privileged access to state-of-the-art instruments as well as dedicated scientific expertise from scientists located either at IECB or in other labs from Bordeaux. Since January 2008, IECB’s technology platform has been part of Bordeaux Functional Genomics Center (CGFB), a network of technology platforms that brings together and makes available to public and private research centers a wide range of biotechnological facilities (bioinformatics, proteomics, metabolomics, …).

Services and expertise of IECB’s Structural Biology Platform

Liquid/Solid NMR

Electron microscopy

Mass spectrometry

Surface plasmon resonance (SpR)

Crystallogenesis

X-ray diffraction and diffusion

Biophysical & Structural Chemistry

Dr. Brice Kauffmann Head of IECB’s Biophysical and Structural Chemistry platform, IR, CNRS

After a PhD in protein crystallography (2003, University of Nancy I), Brice Kauffmann spent three years at the European Molecular Biology Laboratory (EMBL) in Hamburg (Germany) working on the development of a new macromolecular crystallography beamline (X12, DESY). He joined the European Institute of Chemistry and Biology in January 2006 as a staff Scientist.

Selected publicationsLombardo CM, Collie GW, Pulka-Ziach K, Rosu F, Gabelica V, Mackereth CD, Guichard G. Anatomy of an Oligourea Six-Helix Bundle. J Am Chem Soc. 2016 Aug 24; 138(33):10522-30.

Afonso D, Le Gall T, Couthon-Gourvès H, Grélard A, Prakash S, Berchel M, Kervarec N, Dufourc EJ, Montier T, Jaffrès PA. Triggering bilayer to inverted-hexagonal nanostructure formation by thiol-ene click chemistry on cationic lipids: consequences on gene transfection. Soft Matter. 2016 May 18;12(20):4516-20.

Arfi Y, Minder L, Di Primo C, Le Roy A, Ebel C, Coquet L, Claverol S, Vashee S, Jores J, Blanchard A, Sirand-Pugnet P. MIB-MIP is a mycoplasma system that captures and cleaves immunoglobulin G. Proc Natl Acad Sci U S A. 2016 May 10;113(19):5406-11.

Visentin J, Minder L, Lee JH, Taupin JL, Di Primo C. Calibration free concentration analysis by surface plasmon resonance in a capture mode. Talanta. 2016 Feb 1;148:478-85.

Lautrette G, Wicher B, Kauffmann B, Ferrand Y, Huc I. Iterative Evolution of an Abiotic Foldamer Sequence for the Recognition of Guest Molecules with Atomic Precision. J Am Chem Soc. 2016 Aug 17;138(32):10314-22.

Mandal PK, Collie GW, Srivastava SC, Kauffmann B, Huc I. Structure elucidation of the Pribnow box consensus promoter sequence by racemic DNA crystallography. Nucleic Acids Res. 2016 Jul 8;44(12):5936-43.


Liquid/solid NMR

Services and expertise

• NMR of membrane lipids in the context of bicelles and membrane domains (rafts), atherosclerosis, and cellular

• signalling (e.g. nano-objects oriented by magnetic fields, sterols and phosphoinositids)

• NMR of peptides and membrane proteins involved in cancer, apoptosis or featuring particular antibiotic and anti-microbial properties (e.g. neu/erbB-2, Bax, Bcl-2, melittin, surfactin, cateslytin, etc.)

• NMR of colloids associated with the food or pharmaceutical industry (e.g. tannins with saliva proteins, lipopeptides with active nebulisable substances)

• Auto-assembly of amphiphilic molecules • Synthesis and activity of natural substances of biological

interest (e.g. phenols and quinols) • Structures of nucleic acids, proteins and protein/nucleic

acid complexes • Chemistry of solids, materials and alloys • 2D, 3D and multidimensional NMR • Residual dipolar coupling (RDC) • Dynamics, 13C/15N relaxation

Equipment

• NMR 800 MHz, SB (TGIR CNRS : http://www.tgir-rmn.org/) • NMR 700 MHz, SB, Ultra-shield • NMR 500 MHz, WB, Ultra-shield • NMR 300 MHz, WB, Ultra-shield • Solid NMR, triple channel, MAS • NMR 300 MHz, SB, Ultra-shield • NMR 400 MHz, SB Ultra-shield

Technical contacts

Axelle Grélard, [email protected] Morvan, [email protected]

Scientific expertise

Erick Dufourc, [email protected] Loquet, [email protected] Mackereth, [email protected] Salgado, [email protected]

Electron microscopy


• Samples preparation for MET and Cryo-MET experiments • Preparation of biological samples and synthetic, organic

and metallic assemblies • Tissues, cells : inclusion techniques in resin,

ultramicrotomy • Sub-cellular preparation of proteins, protein-membrane

complexes : negative coloration, CryoMET of thin layers • MET cryoMET and Tomography of biological samples,

inorganic nanoparticules, polymers, natives or functional-• ized • AFM (Atomic force microscopy) of functionalized materials

(nanobiotechnology) • AFM of lipids and proteins assemblies

Equipment

• Tecnai-F20 200kV-FEG (FEI)• CM-120 120 kV (FEI)• Nanoscope-IV AFM (Veeco)• Talos Arctica 200kV-FEG (FEI) + Falcon camera

Technical contact

Marion Decossas, [email protected] Bezault, [email protected]


Alain Brisson, [email protected]émi Fronzes, [email protected] Olivier Lambert, [email protected]


Surface plasmon resonance (SPR)


• Informations : interactions (yes or no answer), affinity, binding kinetics, thermodynamics (5°C to 40°C), stoichiometry and active concentrations.

• Samples : proteins, nucleic acids, small molecules (>180 Da), liposomes, bacteria, extracts.

• Recovery function: the instrument can recover compounds bound to the functionnalized surface.

• Sensorchips are available for the immobilisation of compounds via thiol, amines, aldehyde functions, for streptavidin/biotin coupling, Tag-HIS and liposomes capturing.

• Measured parameters : association rates 103 to 107 M-1s-1, dissociation rates : 5 10-6 to 10-1s-1, equilibrium constant 104 to 2.1010 M-1, concentration: 10-3 to 10-11 M.

Equipment

BiacoreTM T200BiacoreTM 3000

Technical contact

Laetitia Minder, [email protected]


Carmelo Di Primo, [email protected]

Mass spectrometry


• Synthesis or process verification, either with low resolution or with accurate mass measurement of small molecules (polyphenols, lipids, antimicrobial molecules, various synthetic compounds,…) and biomolecules (peptides, proteins and nucleic acids)

• Elementary composition determination (via the accurate mass) for small molecules (M < 1000 Da)

• Fragmentation spectra for structural elucidation of small molecules

• Native Mass Spectrometry: investigation of non-covalent complexes (stoichiometry determination, relative quantification, detection of minor complexes in mixtures).

• Ligand binding analysis : we design mass spectrometry experiments to characterize ligand binding to biomolecule or biomimetics targets, for ligand binding equilibrium constants (KD) determination, or monitor complex formation (min time scale and longer).

Equipment

• LCT Premier (Waters): optimized for large masses • LCQ Advantage (Thermo): available for external users 50%

of its operation time • Orbitrap Exactive (Thermo) • Waters Q-TOF Ultima Global : optimized for non-covalent

complexes• Agilent 6560 ESI-IMS-Q-TOF• Modified Bruker Amazon ESI-IMS-Trap

Technical contact

Frédéric Rosu, [email protected]ïc Klinger, [email protected]


Valérie Gabelica, [email protected] - Nucleic acids and supramolecular assemblies


Crystallogenesis


• Robotised cristallogenesis (screening and opitmization of cristallization conditions)

• Cristallogenesis of membrane proteins in mesophase • Cristallogenesis of supramolecular self-assemblies

Equipment

• Robot Cartesian Honeybee 961 Genomic solutions • Robot Mosquito TTP Labtech • Robot Beckman Coulter Biomek NX • Robot Beckman Coulter Biomek 3000 equipped with

a micro-seringe for pipeting small volumes of viscous solutions (cristallization in mesophase...)

• Robot Xtal Focus from Explora Nova for automatically images crystallization experiments and links images with crystallization conditions

Technical contact

Brice Kauffmann, [email protected]éphane Massip, [email protected]


• Supramolecular assemblies/foldamers - Ivan Huc, [email protected] and Gilles Guichard, [email protected]

• Macromolecules - Axel Innis, [email protected]

X-ray diffraction and diffusion


• Diffraction intensities measurements on single crystals of small organic molecules and macromolecules (proteins, nucleic acids, complexes, supramolecular assemblies) : structure resolution

• Small and wide angle X-ray scattering (SAXS, WAXS) experiments (q range of 0.08 to 3 Å-1) : low resolution structures (shape of the molecules)

• Diffuse scattering measurements on single crystals

Equipment

• Microfocus rotating anode Rigaku FRX 3kW with Dectris Pilatus detector

• Microfocus rotating anode Rigaku MM007 1.2kW with Spider IP detector

Technical contact

Brice Kauffmann, [email protected]éphane Massip, [email protected]


• Small organic molecules/foldamers - Ivan Huc, [email protected]

• SAXS/WAXS - Reiko Oda, [email protected]• Macromolecules - Axel Innis, [email protected]


the “analytical and preparative techniques” facilities opened in November 2007 with the aim of providing services in biochemistry, cell biology and molecular biology. As an open platform, it provides technical support and scientific expertise to internal or external research teams. Its activities complement the ones of the technology platform in structural biology.

Services and expertise of IECB’s technology platform in preparative and analytical techniques:

preparative & Analytical techniques

Lionel BeaurepaireHead of IECB’s technology platform in pre-parative and analytical techniques (IE),INSERM, UMS 3033/US001

Lionel Beaurepaire graduated from the Conservatoire des Arts et Métiers (CNAM) with a Master of Biological Engineering in 2009. He joined the European Institute of Chemistry and Biology in October 2015 as manager of the preparative and analytical facility in biology.

[email protected]

TeamMyriam MEDERIC, Adj., Inserm Thierry DAKHLI, Tech., Inserm

CloningGenotypingDirected site mutagenesis

Tests of protein expressionProtein production and purification

Generation of cDNA librariesPurification of oligonucleotides

Molecular biology

preparative biochemistry

Other services

Molecular biology


• CLONING - 2 cloning methods are proposed : T4 DNA ligase or “In-Fusion Advantage PCR Cloning Kit” Clontech.

• GENOTYPING - This test allows the differentiation between homozygous or heterozygous animals for a gene of interest. This technique is performed on blood samples and is used for the genotyping in the FTA technical of Wathman.

• DIRECTED SITE MUTAGENESIS - It consists in introducing a specific mutation or deletion in a target gene. Two different PCR methods are used : high fidelity Taq polymerase or Lightning Quick Change mutagenesis kit from Stratagene.

Equipment

• Thermocycler: Mastercycler Pro (Eppendorf).• Microvolume or cuvette determination: nanophotometer (Serlabo)

Technical [email protected]


Preparative biochemistry


• TESTS OF PROTEIN EXPRESSION - This test evaluates the level of expression and solubility of candidate proteins in different bacterial strains (8 strains of E. coli in total). A scaling is possible to evaluate the level of expression in different volumes. Plasmid constructs for expression assays may be provided either by the customer or performed by the facility.

• PROTEIN PRODUCTION AND PURIFICATION - This service offers the production and the purification of recombinant protein from a gene of interest. To allow easier purification, the gene of interest is cloned into a tagged vector. We carry out the expression of recombinant proteins in E. coli. Plasmid constructs containing sequence of interest may be provided either by the customer or by the facility.

Equipment

• Centrifuges: - AVANTI J26XP (Beckman coulter) equipped with rotors JLA 8.1000, JA25.50. - 5804R (Eppendorf) equipped with: Swing-bucker rotor for plates A-2-DWP, Standard rotor for 1,5/2ml tubes FA-45- 30-11, Rotor F-34-6-38 (Adaptator for 15ml, 15-18ml or 50ml tubes). - 5418 (Eppendorf) equipped with Rotor for 1,5/2ml tubes FA-45-18-11 • Ultracentrifuges: - OPTIMA-L80XP (Beckman coulter) equipped with rotors SW 40Ti, 50.2 Ti. - OPTIMA MAX (Beckman coulter) equipped with rotors: TLA 120, MLS 80, MLA 80. • Bacterial refrigerated incubator: MaxQ 6000 (Thermofisher). • Bacterial incubator: StabiliTherm (Thermofisher). • Benchtop Fermentor: Bioflo® 115 (New Brunswick).• FPLC system : Akta - Purifier (GE)


Other services


• GENERATION OF CDNA LIBRARIES - generation of various cDNA libraries based on mRNA isolated from organisms or organs upon request. The technique is based on addition of oligo nucleotides with the terminal transferase and amplification by PCR.

• PURIFICATION OF OLIGONUCLEOTIDES - performed on SDS-PAGE. The oligonucleotides can be deprotected.


Other laboratories


• L1 Laboratory – For the manipulation of eukaryotic cells classified: biosafety level 1

• L2 Laboratory – For the manipulation of eukaryotic cells classified: biosafety level 2

• Radioactivity laboratory - For the manipulation of radionuclides: 32P, 33P, 35S and 3H

Equipment

• PSMII, Herasafe ™ KS (Thermo Scientific)• CO2 incubator, Heracell 150i (Thermo Scientific) • Centrifuge 3K18 (sigma)

Technical contactAurore Guedin-Beaurepaire (Radioactivity), [email protected]

Scientific expertiseAll access those laboratories are regulated.For the L2 laboratory, all new demand will be considered by a management commitee.

68 Technology Transfer & Start-ups

69Technology Transfer & Start-ups

technology transfer& Start-ups

70 Technology Transfer & Start-ups

the scientific breakthroughs achieved at IECB are meant to nurture technological innovation. the skills, knowledge and technologies developed at the institute are transfered to economic players via different routes:

Collaborative research

Servier, Grünenthal, Ureka, Conseil Interprofessionnel du Vin de Bordeaux, … Several key industry players work with IECB teams. In 2015, the institut totalized 4 on-going projects with industrial partners.

Contract services and consulting

The IECB brings together a wide range of scientific equipments and expertise in chemistry and biology. Such resources are made available to public and private research centers through IECB’s technology platform in stuctural biology and the preparative and analytical techniques facilities.

Technology transfer

IECB researchers are strongly encouraged to patent their discoveries. In 2015, 4 additional patents were submitted by team leaders, Elisabeth Garanger and Jean-Louis Mergny.

The technology transfer unit, Novaptech, that has been hosted at the IECB from 2008 to 2013 is now settled down in Bordeaux.

Incubating start-ups

IECB has a 300m2 work space dedicated to start-ups. This area is presently occupied by Fluofarma, created in 2003 by two team leaders from the IECB, and Ureka, created in 2010 and located at the Institute since 2014.

71Technology Transfer & Start-ups

Fluofarma, a Porsolt compagny, is a preclinical contract research organization which provides tailored services in cell biology and high content analysis, an approach highly solicited in association with predictive tools and cell-based models, thereby fulfilling pharmaceutical industry requirements to optimize the drug discovery pipeline. Fluofarma’s expertise includes in vitro disease models, cell-cell interaction models, assay development, and tissue analysis, all combined with the latest technologies in automated flow cytometry, high content imaging, live imaging and high content histology.

Fluofarma’s parent company - Porsolt SAS - is a long established preclinical CRO with an international reputation for expertise in physio-pathological models. Porsolt holds an extensive portfolio of services in drug discovery.

Fluofarma services & capacities in drug discovery:

Development of complex in vitro models & cell-based assays • Generation of multi-cell type cultures & in vitro disease models in 384-well format• Production & analysis of 3D microtissues based on cell lines & primary cells• Development, multiplexing, miniaturization and automation of cellular assaysCell-based high-content screening (over 100 validated cellular assays)• High-throughput functional target validation: SiRNA screening• Phenotypic & molecular screening of compound libraries, lead optimization services• Preclinical proof-of-concept services : drug efficacy, predictive toxicology,

mechanism of action studiesQuantitative biomarker analysis in blood & tissues• Custom development of biomarker assays based on IF/IHC staining• High-content histology: automated biomarker quantification in tissue microrrays (TMAs) • Multiplexed detection of surface & intracellular biomarkers in whole blood

samples by flow cytometry

Year of creation 2003

Staff 9

2016 turnover Not disclosed

Website www.fluofarma.com

Established in the region of Bordeaux in March 2014, UREkA, a subdivision of ImmuPharma, proposes to revolutionize the way we make peptide-based drugs. Coming from the vision of Robert Zimmer, director of ImmuPharma and Gilles Guichard, Group Leader at the IECB, UREkA is the result of many years of research of foldamer chemistry in the laboratory of Gilles Guichard. UREkA is now performing research programs to apply its UrelixTM technology for the discovery of innovative therapeutics still in close collaboration with Gilles Guichard’s team.

Medicinal chemistry - diseases of interest• Metabolic diseases: diabetes• Viral infections• Cancer

Collaborative research projects • Implementation of UrelixTM technologies in partners projects.• Design and synthesis of bioactive foldamers.• Hit to lead• SAR• Development

Year of creation 2010

Staff 5 (4 CDI and 1 PhD student)

Collaborative projects with IECB teams in 2016 2

Website www.immupharma.com

Contact [email protected]

Dr. Sébastien GoudreauUreka Research Director

Guillaume Froget, PhDPorsolt / Fluofarma CEO

72 Scientific Events

Valérie Gabelica - IECB team leader - chaired the 33rd edition of Journées Françaises de Spectrométrie de Masse, held in Bordeaux on September 27-30 2016. Over 240 participants attended the conference (of which 30 international participants and 50 exhibitors).

73Scientific Events

Scientific Events


Workshops& symposia

IECB: Looking to the Future, October 13th

9th workshop of candidates for group leader positions at IECB took place in 2016.

Speakers :

• Dr. Matthieu BOULARD, Columbia University Medical Center, New York, USA

• Dr. Rodrigo LEDESMA-AMARO, French National Institute for Agricultural Research, Paris, France

• Dr. Lakxmi SUBRAMANIAN, University of Edinburgh, Scotland, UK

• Dr. Yaser HASHEM, Institute of Molecular and Cellular Biology, Strasbourg, France

• Dr. Riccardo PELLARIN, Institut Pasteur, Paris, France• Dr. Nicholas TAYLOR, Ecole Polytechnique Fédérale de

Lausanne, Switzerland• Dr. Laurent TERRADOT, Institute of Biology and Chemistry

of Proteins, Lyon, France• Dr. Peter CROWLEY, School of Chemistry, NUI Galway,

Ireland• Dr. Anton GRANZHAN, Institut Curie, Paris, France

8th Bordeaux RNA Club Symposium, June 23-24134 participants.

Invited speakers :• Jennifer Doudna, University of California, Berkeley, USA• Pascale Cossart, Institut Pasteur, Paris, France• Jamie Cate, University of California, Berkeley, USA• Luisa Cochella, IMP Viena, Autriche • Sam Griffiths-Jones, University of Manchester, England

UGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAAGGGUUUUUAGAGCCCAUAGUGUGACAUGAGACUACAUUGUCGGAGAGCGGAUUUACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGAUGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAGACUACAUUGUCGGAGAGCGGAUUUACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGAUGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAGACUACAUUGUCGGAGAGCGGAUUUACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGAUGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAGACUACAUUGUCGGAGAGCGGAUUUACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGAUGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAGACUACAUUGUCGGAGAGCGGAUUUACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGAUGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAGACUACAUUGUCGGAGAGCGGAUUUACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGAUGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAGACUACAUUGUCGGAGAGCGGAUUUACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGAUGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAGACUACAUUGUCGGAGAGCGGAUUUACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGAUGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAGACUACAUUGUCGGAGAGCGGAUUUACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGAUGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUAGAGACGAUACGAUCACGAAUUUGAAGAAUUUAUACUGAGGAGCAUAGAGACGAUACGAUCACGACUACUGAGAGCUAGACUACAUUGUCGGAGAGCGGAUUUACGCGCGCGGGAAUUAUUUUUCGCAUUUGGCAAUUUGGCGCCCCCGAGAAGUUUCGAUGUGUGCACUGGUGUGUUGACAUGGGGAAACGAGCAUAGA

CLUBRNA

Bordeaux

Bordeaux RNA ClubSymposium

8th

Invited speakers

Jennifer DoudnaUniversity of California, Berkeley

Pascale CossartInstitut Pasteur

Jamie CateUniversity of California, Berkeley

Luisa CochellaIMP Vienna

Sam Griffiths-JonesUniversity of Manchester

F. DarfeuilleC. Di PrimoD. DupuyS. FribourgC. Grosset

A. InnisC. MackerethL. Minvielle-SébastiaM. TeichmannJ.-J. Toulmé

Organizing committee

Organized

jointly with

www.aptamers-in-bordeaux.com

June 24-25,2016

Bordeaux, France

www.rnaclub.u-bordeaux.fr

@RNAbordeauxfacebook.com/RNAbordeaux

IECB Auditorium2, rue Robert Escarpit33600 Pessac, France23

JUNE

2016 24

JUNE

2016 Pôle Juridique et Judiciaire

35, Place Pey Berland33000 Bordeaux, France

n° ANR-10-IDEX-03-02

Looking to the Future 9th workshop of candidates for group-leader positions at IECB

ThursdayOctober13th,2016IECBAuditorium,free&opentoall

75Scientific Events

IECB Young Scientist Symposium, May 26-27In 2016, over 100 participants from France, UK, Spain, USA, Canada et Pologne. 26 oral communications and 25 posters were presented.

Keynote speakers : • Pr. Bernold Hasenknopf, France• Pr. Matthias Mack, Germany

Career session : • Dr. Anke Sparmann éditeur scientifique du journal NSMB,

England• Dr. Grant Green , avocat des brevets, USA• Dr Jean-Louis Brayer, directeur de Diverchim, France

33ème Journées Françaises de Spectrométrie de Masse, September 27-30 240 participants (of which 30 international participants and 50 exhibitors). Conference chair : Valérie Gabelica (“Cité Mondiale” Convention Center, Bordeaux)

Plenary speakers:• Richard D. Smith, Pacific Northwest National Laboratory,

Richland, USA• Sarah Trimpin, Wayne State University, Detroit, USA• Norman Dovichi, University of Notre Dame, USA• Rebecca Jockusch, University of Toronto, Canada• Andrea Sinz, Martin-Luther University Halle-Wittenberg,

Germany• Frédéric Aubriet, Université de Lorraine, France• Laurence Charles, Aix-Marseille Université, France

Y S S

A great opportunityto exchange knowledge on an interdisciplinary level !

Visit ourhomepage

Follow us onfacebook

[email protected]

9th Young Scientist Symposium

May 26th - 27th 2016at the IECB

(Pessac, France)

Registration is now open

Deadline for abstract submissionApril 15th 2016

Keynote Lectures

Prof. Matthias MACKMannheim University

Germany

Prof. Bernold HASENKNOPFUniversité Pierre et Marie Curie

Paris, France

yss2016.sciencesconf.org

ORAL COMMUNICATIONS & POSTER SESSIONSREGISTRATION IS FREE BUT MANDATORY

Institut Européen de Chimie et Biologie (IECB)2 rue Robert Escarpit33607 Pessac, FRANCE

Clémence Rabin


Seminars1. M 1. Léo Guignard INRIA project-team Virtual Plants, joint

with CIRAD and INRA, UMR AGAP, Université Montpellier 2, FRANCE

2. Prof. Takehiko Wada institute of Multidisciplinary Research for Advanced Materials (IMRAM), Tohoku University, Sendai, JAPAN: Novel Strategy of Supramolecular Asymmetric Photochirogenesis with Tailor-made Biopolymers as Chiral Reaction Media and Development of High Sensitive and High Time-Resolve Circular Dichroism (CD) Detection Method for Analysis of Supramolecular Dynamics

3. Jean-Pierre Vors Bayer S.A.S., Lyon, FRANCE: Mitochondrial respiration inhibitors, a success story in fungicides

4. François Vromman Dynamic Biosensors : The switchSENSE technology

5. Yaser Hashem Institut de Biologie Moléculaire et Cellulaire (IBMC), Strasbourg, France Cryogenic electron miscroscopy : case studies and latest advances applied to protein translation initiation in eukaryotes

6. Eugen Stulz School of Chemistry and Institute for Life Sciences, University of Southampton, Southampton, UK : Self-assembly of DNA : creating novel materials

7. Peter Parker, The Francis Crick Institute, London, UK: PKC and emergent properties in tumours, an opportunity or a liability

8. Eric Ennifar, Institut de Biologie Moléculaire et Cellulaire (IBMC), Strasbourg, France : Understanding complex molecular interactions using advanced ITC microcalorimetry

9. Niklaas Buurma, School of Chemistry, Cardiff University, Cardiff, UK: Three aqueous stories: predicting racemisation risk, DNA in sensors and nanoconstruction & taming palladium in catalysis

10. Christophe Génicot, Global Chemistry, UCB, Brussels, Belgium : Creating Value for Patients

11. Aurelie Goyenvalle, U1179 INSERM, University of Versailles saint Quentin, Montigny le bretonneux, France: Tricyclo-DNA: highly promising antisense oligonucleotides for splice switching therapeutic approaches

12. Pascal Collin, UMR 8601, CNRS-Paris Descartes, France: a putative new anti-cancer compound inhibiting mTOR kinase through a novel mechanism

13. Alberto Credi, Photochemical Nanosciences Laboratory, Dipartimento di Scienze e Tecnologie Agroalimentari, Bologna, Italy: Light on molecular machines and materials

14. Frédéric Coutrot, Supramolecular Machines and Architectures Team; IBMM, UMR 5247, Université Montpellier, France: Toward Multi-interlocked pH-Sensitive Molecular Machines

15. Gwénaël Rapenne, Université Paul Sabatier and NanoSciences Group, CEMES-CNRS, Toulouse, France: Technomimetic nanomachines: molecular wheels, vehicles, rotors and motors

16. Kurt Frederick, Department of Microbiology, Ohio State University, Columbus, OH, USA: Chasing down the role of conserved GTPase LepA (EF4)

17. Martin G. Banwell, Research School of Chemistry, Institute of Advanced Studies, The Australian National University, Canberra, ACT 2601, Australia: New methodologies for the synthesis of biologically active natural products

18. Nicolas Martin, University of Bristol, Bristol, UK: Bioinspired self-assemblies: from artificial chaperones to responsive protocells

19. Juewen Liu, Department of Chemistry, University of Waterloo, Waterloo, Ontario, Canada: New RNA-cleaving DNAzymes: in vitro selection, metal binding, and metal detection

20. Oliver Espeli, Center for Interdisciplinary Research in Biology - Collège de France, Paris, France: Management of E.coli sister chromatid cohesion in response to qenotoxic stress

21. Patrick A. Limbach, University of Cincinnati, OH, USA: The Epitranscriptome: Challenges in Measuring Dynamic RNA Modifications

22. Kensuke Osada, Department of Bioengineering, the University of Tokyo, Tokyo, Japan: Control of pDNA packaging by block copolymers toward systemic gene delivery

23. Hiroko Isoda, Faculty of Life and Environment/Alliance for Research on North Africa, University of Tsukuba, Tsukuba, Japan.

Institut Européen de Chimie et Biologie2, rue Robert Escarpit33607 Pessac FRANCE

Tél. : +33(0)5 40 00 30 38Fax. : +33(0)5 40 00 30 68www.iecb.u-bordeaux.fr


Date post:	06-Aug-2020
Category:	Documents
Upload:	others
View:	1 times
Download:	0 times

Scientific Report 2016 - A to B communicationatob.fr/wp-content/uploads/2017/07/RA-IECB-x.pdf ·...

Documents