Church of St. Paul Church of St. Ann 82 Lake Road West 16 Jefferson Street Congers, NY 10920 Nyack, NY 10960
[email protected] Parish Office:
82 Lake Road West, Congers, NY 10920 Phone: (845) 268-4464/-4465 Fax: -6790
Email: [email protected] Website: spasaparish.org You Tube: Spasa Parish
Rev. Vladimir Chripko, C.O. Pastor Rev. Roman Dominik Palecko, C.O. Assistant Pastor
Rev. Narisetty Arogya Raju, C.O., Parochial Vicar ● Rev. Joseph Kumar Narisetty, Parochial Vicar Rev. Maniraguha Jean Paul Ruriho, Assistant Rev. George Torok, C.O., Weekend Assistant
SST. PAUL ST. ANN Deacons Dominic Buonocore
Mark Czerwinski, Director RCIA Luke Conroy, Director RCIA Charles DeGroat Gerald Fenton, Liturgy Coordinator
Parish Office Hours 9:00 am-3:00 pm Monday-Friday
Cemetery/Assistant to Pastor Lissette Diaz [email protected]
Religious Education Program (845-268-5442) Email: [email protected] Carmen Hernandez Lissette Diaz
St. Anthony-St. Paul School Dr. Anna Adams, Principal (845-623-2311); St. Anthony, grades 2 to 8 Jessica Perez, Asst. Principal (845-268-6506) St. Paul, PreK/UPK, Kindergarten, Gr. 1
Music Ministry Vincent Green
Sunday Masses
Saturday 5 pm Sunday 7:30 am 10 am (at St. Paul Church) 10 am (at Marydell Faith & Life Center) 12 pm, 6 pm
Saturday 5:30 pm Sunday 8:45, 11:30 am
Weekday Masses Monday—Saturday 6:30 & 8:30 am Monday—Saturday 7:30 am
Streamed Mass Daily including Sunday 8:15 am at YouTube Channel SPASA Parish
Confessions Saturdays 4:00-4:45 pm Anytime by request.
Saturdays 4:30-5:15 pm Anytime by request.
Sacrament of Baptism To schedule a Baptism at St. Paul or St. Ann please call the rectory at 845-268-4464. Baptism instruction classes are held the last Thursday of each month at 7 pm at the St. Ann School in Nyack. Please call the rectory to register.
Sacrament of Marriage Engaged couples should contact the Rectory at least six months in advance in order to arrange for their participation in the marriage preparation program. Please email [email protected].
Anointing of the Sick If someone is homebound or in the hospital, please notify the Rectory. Arrangements can be made for the sick person to receive the Sacrament of the Anointing of the Sick. Holy Communion is brought to the homebound by our Ministers of Holy Communion.
Sept. 13, 2020 24th Sunday in Ordinary Time
2
ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 12, 2020 Saturday Sept. 12, 2020
5:00 PM Carlos M. Taganas 5:30 PM Pastor’s Intention
Sunday Sept. 13, 2020 Sunday Sept. 13, 2020
7:30 AM Assunta Cecere, William Thomas & William James Sbordone 8:45 AM Christopher Bazile (L) — Birthday
10:00 AM Pastor’s Intention Marydell Faith & Life Center
10:00 AM Nicholas Cifuni St. Paul’s Church
12:00 PM Anna Mullane 6:00 PM Claramma Thomas Monday Sept. 14, 2020 Monday Sept. 14, 2020
6:30 AM Violeta V. Saulon 7:30 AM Steven R. Leardi 8:30 AM Michael McLoughlin — 46th Anniversary 8:15 AM ♦♦ Tuesday Sept. 15, 2020 Tuesday Sept. 15, 2020
6:30 AM Violeta V. Saulon 7:30 AM Maria Ramirez, Dr. Diana Ramirez & Daphne C. Ramirez
8:30 AM Martin Cullen 8:15 AM ♦♦ Eduardo Alphonso
Wednesday Sept. 16, 2020 Wednesday Sept. 16, 2020
6:30 AM Logan Porter (L) 7:30 AM Thomas & Theresa Kaps (L)
8:30 AM Robert Joseph Burns Jr. 8:15 AM ♦♦
Thursday Sept. 17, 2020 Thursday Sept. 17, 2020
6:30 AM Robert M. Sbordone (L) 7:30 AM George Bryant 8:30 AM Lina Pavan — Anniversary 8:15 AM ♦♦ Friday Sept. 18, 2020 Friday Sept. 18, 2020
6:30 AM Virginia Cufuni 7:30 AM Maria Ramirez, Dr. Diana Ramirez & Daphne C. Ramirez
8:30 AM Richard Cullen 8:15 AM ♦♦ Saturday Sept. 19, 2020 Saturday Sept. 19, 2020
6:30 AM Standford Klingler 7:30 AM Maria Ramirez, Dr. Diana Ramirez & Daphne C. Ramirez
8:30 AM Kathleen Flynn 8:15 AM ♦♦
5:00 PM Helen Decolyse 5:30 PM Patricia & Charles Westwater
Sunday Sept. 20, 2020 Sunday Sept. 20, 2020
7:30 AM Mario & Phylis Costanzo 8:45 AM Daniel Kirwan — Birthday
10:00 AM Pastor’s Intention Marydell Faith & Life Center
12:00 PM Gene Morris 6:00 PM Guiseppa Cutaia & Giuseppa Cartella
Now you can now find out which masses are available for your special intentions and schedule them online. Go to our parish website, SPASAPARISH.ORG. On the homepage, click on the Mass Intentions box for instructions and access to the “Mass Intentions Booking” page. You may also reserve the sanctuary lamp at either church or at St. Ann’s Chapel. You can make your offering by credit card. Or you can call the parish office (845-268-4464) to schedule masses the traditional way and make your offering by credit card, cash, or check.
10:00 AM Margaret & Edward Bordas St. Paul’s Church
8:15 AM ♦♦ 11:30 AM People of the Parish
8:15 AM ♦♦ 11:30 AM Richard Stokes
Second Collection for the Parish Food Cupboards
Second Collection for Parish Religious Education
♦♦ NOTE: The 8:15 am masses are not public masses. They are livestreamed from different loca ons in our parish daily. You can watch on our parish YouTube channel SPASA PARISH. All previously scheduled 12:10 mass inten ons have been transferred to the 8:15 mass.
3
MARK YOUR CALENDAR We are happy and grateful to announce that, after a long delay, our children will finally be celebrating their First Communions and Confir-mations, our Parish Religious Education Program will resume, and other parish events have been rescheduled.
PARISH RELIGIOUS ED PROGRAM (PREP) Registration is in progress. Classes will be online until December. For more information, go to our website,
SpasaParish.org, and click on Education.
PREP CHILDREN — CONFIRMATION Saturday, Sept. 19
St. Ann’s — 11:00 am St. Paul ‘s — 2:00 pm
SPANISH COMMUNITY FIRST COMMUNION & CONFIRMATION
Sunday, Sept. 20, at St. Ann’s — 7:00 pm
25th & 50th WEDDING ANNIVERSRY MASS Sunday, Sept. 20, at St. Paul’s – 12:00 pm
ST ANN’S 150TH ANNIVERSARY CLOSING MASS
Saturday or Sunday, Oct. 17 or 18 — tentative
Congratula ons to all the children
in our parish who received their
First Holy Communion on Saturday, Sept. 12.
It must have been hard to wait so long to receive
Jesus. But Jesus was wai ng for you, too —
and how happy He must be to be with you now in
HOLY COMMUNION! ♥
PARENTS — Unfortunately, it was not possible to have a professional photographer at the masses, but I’m sure you took plenty of photos. We would love to display them in the bulletin for all the parish to see. Please text them to 201-739-4413 or email to [email protected]. You can send either a photo of the individual First Communicant or a picture of the entire family. We’ll publish as many as we can and
post the rest on our website. Thank you!
Happy National
Grandparents Day
Sept. 13, 2020
“The blossom of a tree comes from what it has underground,” says a poet from my country. Your grandparents are your roots. An uprooted tree cannot blossom or bear fruit. That is why the bond or connection is so important. Today we are in need of a bridge, a dialogue between grandparents and young people, between the old and the young. — Pope Francis.
THE TRIUMPH OF THE CROSS — Sept. 14 This weekend is the collection for the people and shrines of the Holy Land. This collection is usually taken up on Good Friday, but this year it was postponed because of the coro-navirus and rescheduled for this weekend, close to tomorrow’s Feast of the Triumph of the Cross, a feast associated with the Holy Land. The Triumph of the Cross, formerly known as the Exaltation of the Holy Cross, is celebrated each year on Sept. 14. It honors the cross of Christ, on which He died for us. The feast recalls three events: the discovery of the true cross by St. Helena in Jerusalem circa 327 AD, the dedication of the Church of the Holy Sepulcher on that site nine years later, and the return of the relics of the cross in 629 AD after they had been seized during the Persian conquest of Jerusalem in 614. Tradition has it that St. Helena actually discovered three crosses during the demolition of a pagan temple which had been built on Calvary — the cross on which Christ died and the two others on which the thieves had been cruci ied beside Him. The beautiful story says that not knowing which was which, Helena brought in a dying woman and had her touch the crosses one by one. As she touched the third, she was cured, her healing demonstrating that that was the true Holy Cross, sancti ied by the death of our Savior,
4
Are You “SURE” You’re a Registered Parishioner? Many times we meet people at church who attend mass, take part in events, or perhaps even have received their sacraments here. We’re so very glad you’re with us and part of our community. But that alone does not make you a parishioner. To be a member of the parish you have to REGISTER. Registering is very easy. You can register online at spasaparish.org or at the parish office. It only takes a few minutes. Everyone over the age of 18 is encouraged to register. Even if you’re an adult who received all your sacraments here as a child and still attend mass here, you need to register. Why register? First and foremost, it’s very important to register so we can serve your needs when, for example, you need a sponsor certification letter for Baptism or Confirmation. Also, to receive an acknowledgment of your donations for your income tax filing, you need to be registered so we have an official record of your giving over the year. So, please join us officially and register with the parish so we can meet all your needs now and in the future!
PARISH OF ST. PAUL & ST. ANN STAY CONNECTED with LATEST NEWS & UPDATES
OUR YOUTUBE CHANNEL SPASA PARISH Mass 7 days a week at 8:15 am Archived videos
OUR WEBSITE SPASAPARISH.ORG Photos, bulletins, mass schedules, events, and other parish information.
OUR MASS SCHEDULING APP SPASAMASS.ORG View available masses and schedule one online for a loved one or your special intention.
ONLINE GIVING TO OUR PARISH SPASAPARISH.CHURCHGIVING.COM Arrange for online giving. Support our parish and manage your giving online.
FLOCKNOTES Sign up to receive important emails or texts from the pastor and the Archdiocese.
STPAULS.FLOCKNOTE.COM/ or text STPC to 84576 from your phone
STANNNYACK.FLOCKNOTE.COM or text SACC to 84576 from your
phone
FROM THE RECTORY
GOAL PLEDGED PAID TO DATE
$1,241,500
$515,831 350 families
have pledged as of
Aug. 30, 2020
GOGOGOGOGOGOALALALALALAL
100%
PLPLPLPLPLEDEDEDEDEDGEGEGEGEGEDDDDD
102%
$1,266,370
PAPAPAPAPAPAPAIDIDIDIDIDIDID TTTTTTTOOOOOOO DATE
41.5%
INSTRUCTIONS FOR SPONSOR CERTIFICATION LETTER In order to receive a sponsor certification letter from the Parish of St. Paul & St. Ann, you must be an ACTIVE, REGISTERED PARISHIONER for 6 MONTHS. IF YOU ARE NOT OFFICIALLY REGISTERED AND DO NOT ATTEND MASS, YOU WILL NOT RECEIVE A LETTER.
The role of a sponsor is to lead a Christian life in a manner that faithfully fulfills the obligations of the Catholic faith. A sponsor must be living the Catholic faith and be able to be part of the sponsored person’s life after the Baptism, who can guide him/her spiritually. A sponsor must also: • Be at least 16 years of age • Have received the Sacraments of Baptism, Eucharist & Confirmation • If married, must be married according to the laws of the Catholic Church
75,018
5
Memorial Intentions — Week of Sept. 13 Sanctuary Lamp (St. Paul)
Sanctuary Lamp (St. Ann)
Chapel (St. Ann)
300 CLUB WINNERS Congratulations to the Lucky Winners
of our JULY DRAWING!
#012 David Mellon #248 Edward Bond
#085 Marie Etie #250 Rocco Lapenta
PARISH COUNCIL Enrico Aberion, Ann Marie Blackwood, Hernan Caceres, Guy Gebbia, Vicki Gill, Marie Josee Joseph, Karin Lancellotti, Julie Lepore, Marie Lorenzini, Dennis Lynch, Bernadette Masiello, Greg Moreau, George Strayton, Keith Taylor
FINANCIAL COUNCIL William Dailey, Carlos Hernandez
GENERATIONS The three genera ons of the Holy Family — Jesus, his parents, Mary & Joseph, and his grandparents, Ann & Joachim — are the subject of this work of art commissioned for the outdoor shrine we’ve planned for St. Ann’s Church in Nyack. We’re nearly halfway toward our goal of $50,000. So far, generous donors have given $23,955 toward this project. Please join us in making this shrine a reality. Please send your dona on, marked “statue,” to St. Paul & St. Ann’s Parish, 82 Lake Rd. West, Congers, NY 10920.
SPaSA Parish SUBSCRIBE ON AND HELP OUR PARISH REACH 1,000 SUBSCRIBERS.
MASS IS AVAILABLE ON YOUTUBE 7 DAYS A WEEK AT 8:15 AM, STREAMED FROM DIFFERENT
LOCATIONS IN OUR PARISH
Prayer for the Sick We pray that the sick of our parish, our relatives, and friends will experience God’s healing love, especially:
Please call the rectory (268-4464) to be placed on the list of those who need prayers in time of illness, or call with the names of any sick family members or friends. The name will remain on the list for 3 weeks and then be removed unless we hear from you that the person still needs our prayers.
SPASAMASS.ORG
You can find available masses and schedule them online at SPASAMASS.org. For the
me being, you’ll have to make the following adjustments:
For any 8:15 am streamed mass, select that day’s St. Ann’s 12:10 pm box
For a St. Ann’s Saturday 7:30 am mass, select the St. Ann’s Saturday 9 am box
For a St. Paul’s 8:30 am mass, select St. Paul’s 9:00 am box
For a St. Paul’s Saturday 6:30 am mass, select the St. Paul’s Saturday 7:30 am box
EMAIL FOR THE PASTOR [email protected]
BULLETIN DEADLINES Friday — the week before the bulletin is distributed at church Please send submissions to bulletinspasa @yahoo.com)
THE MASS BOOK
IS OPEN
You may now schedule masses for your inten ons through March 2021
Our Beloved Dead Please remember in your prayers our deceased
fellow parishioners, family, and friends.
Robert Rose, Dan Pfeiffer, Stephen Goeller, Madeline Dorangrichia, James O’Toole
Evan Dalsass, Laura, John Barch, Laura Mazzacone, Kathryn Scarmato,
Emilia Raphael-Olivier, Carolyn Pagliuca, Michael Doria, Noah Diaz, Manuel Tucay
6
CONFESSION & VISITS FOR PRIVATE PRAYER You may visit both our churches for private prayer daily. St. Ann’s Chapel is open from 7:30 am to 9 am and from 11:30 am to 1 pm; use the door on Third Ave. St. Paul’s Church is open from 6 am to 8 pm. MASKS & SOCIAL DISTANCE of 6 feet must be observed For Confession, priest and penitent should wear masks and maintain a 6-foot distance. Confession at St. Paul’s: Saturdays, from 4 pm to 4:45 pm in the church confession room. At St. Ann’s: Saturdays, from 4:30 pm to 5:30 pm – Outside, between the sacristy and rectory side en-trance. Or anytime by request. Please call the office (845-268-4464).
s /s-
Soul Exercises – Pursuit of Contemplative Silence Are you looking for a way to increase inner tranquility, decrease stress, have more control over your own life, and deepen your relationship with God?
Find all this and more in Silence: Silence is the great Revelation, and it is transforming.
Father George Torok, C.O., will hold a seminar on the pursuit of Silence. The seminar will consist of four group exercise sessions held at Hallel in Sparkill, NY. In addition, if you cannot attend in person, the sessions will be livestreamed.
There will be two seminars:
Fall 2020: Oct. 4 & 18 and Nov. 8 & 22 from 6 to 7:30 pm
Winter 2021: Jan. 10 & 24 and Feb. 14 & 28 from 6 to 7:30 pm
This is not a lecture series, but a group exercise experience. The sessions are free, but you MUST reserve your place. Kindly email [email protected] or register online at spiritwellsprings.com.
Rite of Chris an Ini a on of Adults RCIA is the spiritual journey of discovery for persons seeking to come into full communion with the Catholic Church. The process includes dialogue about the life of Jesus Christ and teachings and prac ces of the Catholic faith. Candidates enter into harmony with our parish family on receiving the Sacraments of Ini a on at the Easter Vigil. Please call the rectory, 845-268-4464
This year, enjoy the Concert to benefit One to One Learning from the comfort of your home or favorite hangout. Invite a few friends to watch with you and enjoy a fun afternoon while you support a great cause. Tickets are $30 and each one gives you a chance in our raffle for gift cards to favorite local restaurants. Please send your donation to the address below with your name, address, phone number and email address — or donate online at one2one-learning.org. You will receive information about how to connect to the concert. Star-Fest XI Tickets, One to One, 640 N. Midland Ave., Nyack, NY 10960.
Two li le girls received the priceless gi of becoming a child of God as they were bap zed last Sunday, Sept. 6, at St. Ann’s Church. On the le is Mia Caroline Desimone with her mom, Kaitlyn, and dad, Michael, holding sister Ava. The godparents are Stephanie King and Nicholas Russo. On the right is Kelsey Jane Mansfield, with her dad, Allen, and mom, Jackie. To the le are godparents Anthony Uribe and Anny Mansfield. Deacon Luke Conroy performed the Bap sms.
7
SISTERS OF LIFE: HEALING AFTER ABORTION Do you know someone who is carrying the grief of a past abortion? There is always hope. The pain and sorrow of abortion does not need to endure for a lifetime. A “Day of Prayer and Healing” offers the opportunity to experience the love and mercy of God and to respond to His invitation to begin the journey of healing. For upcoming dates, loca-tions, and confidential registration, or just to talk to a Sis-ter, please call the Sisters of Life at (866)-575-0075 (toll free) or by email at [email protected].
August 28, 2020 Dear St. Anthony-St. Paul School Families, It is with great excitement that we announce an addi on to our already-strong school leadership team. Effec ve Sept. 1, 2020, Ms. Jessica Perez is joining us as Assistant Principal of the St. Paul campus. Ms. Perez has enjoyed a stellar career in Catholic educa on as a teacher and leader, most recently as Principal at St. Thomas Aquinas School in the Bronx since 2015, where she had been a teacher for the previous 11 years. Jessica Perez holds a Bachelor of Arts degree in Psychology from St. Joseph College as well as a Master of Science in Edu-ca on from Lehman College and a Master of Science in School Building Leadership from St. John’s University. As we enter into our inaugural year as St. Anthony-St. Paul School, we do so eager to serve the educa onal needs of such a diverse and varied school community. With the St. Paul cam-pus now focused on Early Childhood, we are fortunate to have a talented professional with experience such as Ms. Perez. With her on board, we will successfully expand our horizons while mee ng and overcoming the challenges presented by the mes in which we live. Ms. Perez will complement our school’s focus on Catholic iden-
ty as well as academics, while helping to nurture suppor ve rela onships with teachers and families alike. We look forward to the wealth of knowledge she will bring to our school. We know the future is bright for St. Anthony-St. Paul School and Catholic educa on in Rockland County. Blessings, Dr. Adam, Principal, St. Anthony-St. Paul School Mrs. Cathleen Cassel, Regional Superintendent of Rockland
SINCE THE RETURN TO PUBLIC WORSHIP many parishes have chosen to avoid singing hymns in an effort to reduce the amount of congregational singing. This workshop, sponsored by the Archdiocese of NY, is for parish musicians, pastors, or anyone who wants to learn more about ways to introduce new musical forms to your parish’s Sunday mass.
Visit the SJR campus, meet faculty, staff and coaches, speak with teachers and students
and learn about our academic and athletic programs, scholarships, and financial aid.
Discover what makes
St. Joseph Regional High School a unique high school experience
SUNDAY, SEPT. 27 at 11 am
Reserve your spot online, SJRNJ.ORG 240 Chestnut Ridge Road, Montvale, NJ 07645
8
Summer 2020 Round-Up
(Above) Sunflowers grace the Marydell Children’s Garden. (Above) Fr. Vladimir helps at the St. Joseph’s Workers clean-up in July.
(Above) The Garden of Faith under the summer sky; Paul Aberion, Deacon Luke, Fr. Joseph & Marty Ka gbak at Sunday mass at Marydell; a beau ful morning at St. Ann’s.
(Le ) Swans glide across the waters of Congers Lake, across from St. Paul’s Church.
(Above) In late August, workers completed a major landscaping project at St. Ann’s that included weeding, mulching, and hedge trimming around the church grounds and pruning the rectory rose garden.
Photos courtesy of Nelson Chan, Nancy Conroy, Elissa Dailey, Vickie Gill, and Sue Hanna Toher
9
FROM THE PASTOR’S DESK
FR. MASTROLIA APPOINTED PASTOR OF ST. CLARE’S
Fr. Arthur J. Mastrolia, former pastor of St. Paul’s, has been appointed pastor of St. Clare’s in Staten Island, effective Sept. 1. Also at St. Clare’s is another priest who served at St. Paul’s, Fr. Brendan Gormley. May God bless them both as they continue their ministry serving God’s people.
O ne the most sensual elements of the Sacred Liturgy is the use of incense, which o en is misunderstood and o en overlooked.
Using incense in sacred worship is a prac ce the Church adopted from our Jewish ancestral herit-age. The use of incense is men oned on many occasions in the Book of Levi cus, which describes various ceremonial atonement rituals. The Levite priests used incense along with the thanksgiving offerings of fruit, oil, wine, and unbloody animal sacrifices. Aaron was instructed in the Book of Exodus by God to use “sweet smelling in-cense” (Ex. 30:7) in the morning offering on the altar. So common was the use of incense as part of Jew-ish ceremonial worship that it shows up in the religious hymnody in the Book of Psalms: “Lord, let my prayer rise before you like incense, my hands like an evening offering.” (Ps. 141:2). In the Gospel of Luke, we learn that at the me of the Lord Jesus, incense was offered by the priests in the Temple of Jerusalem, as Luke describes Zachariah’s du es the day he learns of his son John the Bap st’s concep on. In The Book of Revela ons, John’s vision of the Heavenly liturgy is described: “And another angel came and stood before the altar, having a golden censer: and there was given to him much incense, that he should offer of the prayers of all saints, upon the golden altar which is before the throne of God. And the smoke of the incense of the prayers of the saints ascended up before God from the hand of the angel.” (Rev. 8:3). John describes incense as symbolizing “the prayer of the saints” (Rev. 8:5). Amalarius of Metz (a liturgical historian of the 9th Century) describes litur-gical incense as that which is “enkindled in the heart by the fire of God's love and, exhaling the odor of Christ, rises up a pleasing offer-ing in His sight.” The use of incense has characterized the solemnity of the Sacred Liturgy from (as early as evidence suggests) around the 6th century in the Church. It is a ritual act that symbolizes not only the raising of our hearts, minds and prayer, but also the mysterious and sacred dignity of God Himself. In the Eastern Church, the smell or fragrance of the incense symbolizes the dignity of the solemnity or feast day being celebrated. In the West, incense is more a visual sign of the “cloud of mystery” and profound awe of the presence of Al-mighty God. It is a prac ce of the Church to use incense in solemn Masses which includes the Sunday Masses as well as other great feast days. The prac ce and use of incense are rooted in Sacred Scripture, but also add to the solemn nature of our Eucharis c celebra on. Incense is also used to bless, as holy water is used, or to “set aside” for sacred use people and objects. In the Mass, not only for the gi s of bread and wine, but a er the consecra on it is used to symbolize the Lord’s presence in the Eucharist. The altar, the crucifix, and during the Easter season the Paschal Candle are also incensed to signify their being set aside for worship. The priest and the people are also incensed separately, symbolizing not only the difference of their office in the liturgical assembly, but also their par cipa on in the liturgy that is the foretaste of the heavenly liturgy of St. John’s vision. As I have no ced and you all very well know, for various safety reasons or lack of altar servers the use of incense has been regulated to only special celebra ons, but I wish to emphasize that Sundays are meant to be a con nual celebra on of Easter Sunday. There-fore, I do not wish to diminish its beauty, solemnity, or importance. Allow the cloud of incense not only to serve as visual rising of your prayers to God, but also allow its mysterious aroma to raise your thoughts and hearts to the altar of God in heaven. From Your Priests
Incense
IMPROVE YOUR SINGING VOICE The archdiocesan Vocalist Training Program is designed to help parishioners receive musical training and develop the skills needed to serve as a cantor or choir member. Lessons are taught in person or online by members of the archdiocesan Music Commission and other highly qualified teachers.
More information: nyliturgy.org/vocalisttrainingprogram Contact: Archdiocese of New York Office of Liturgy: [email protected]/ or 914-968-6200, x 8177.
438 St. Paul - St. Ann (3) X John Patrick Publishing Company 1-800-333-3166 • www.jppc.net
Breakfast & LunchCongers Colonial Plaza285 Route 303
267-2656267-2656Fax: 267-2532Fax: 267-2532
Rockland Bakery Deli94 Demarest Mill Rd., Nanuet, NY 10954
845-623-1115Boar’s Head Provisions • Catering For All Occasions
Fresh Hot Specials Made DailyMon.-Sat. 6am-8pm • Sun. 6am-5pm
BMC & SonPlumbing & Heating
10% Discount When You Mention This Ad
Parishioner of St. Paul/St. Ann
Hot Water Heaters •BoilersSump Pumps • Water Filters
Lic. # 862
845-268-0992 • www.BMCrockland.com
-KING OF PIZZA-
TURIELLO’SITALIAN PIZZERIA & RESTAURANT
PIZZA • PASTA • CHICKEN • VEAL • SEAFOOD • HOT & COLD SUBSOPEN 7 DAYS OPEN 7 DAYS (845) 358-5440 FREE DELIVERY FREE DELIVERY
76 Main Street (Corner of Broadway) • Nyack, NY 1096076 Main Street (Corner of Broadway) • Nyack, NY 10960
Nino & RosaCatering For All Occasions
Gift Certifi catesGluten Free
Pizza & PastaGelato
CelebratingOver
35 Year
Tolstoy Tolstoy FoundationFoundationRehabilitationRehabilitation&Nursing CenterNursing Center
Dorothy Corbett, Administrator / Acting CEO
100 Lake Road • Valley Cottage100 Lake Road • Valley CottageNew York, 10989New York, 10989
845-268-6813 ex 112 • [email protected]
Licensed & InsuredLicensed & InsuredCall Now for Free Estimate: 845-267-0076Call Now for Free Estimate: 845-267-0076www.superiorlawnsandlandscaping.comwww.superiorlawnsandlandscaping.com
476 Christian Herald Rd., Valley Cottage, NY 10989 www.nyackridge.com
Nestled in a quiet & tranquil country setting in the heart of Rockland County, Nyack Ridge Rehabilitation & Nursing Center is a
foremost provider of subacute rehab & long term care.
Rated 5 stars & highly
regarded in the community.
Volunteers Needed:Call Josa Andalora, CTRS
Tel. # 845-268-6861 ext. 246 | [email protected]
Admissions Director:Jessica Chardonnette, MS
Tel. #845-268-6861, ext. 205 | [email protected]
“Committed To Quality & Freshness”Fresh Louisiana Cajun Seafood • SUSHI
Now off ering “ALL YOU CAN EAT SUSHI” everyday, with pricing of $22.99 per person
on weekdays & $24.99 on weekends. Nyack Location Open Six Days (Closed Mon.) For Lunch & Dinner
Suff ern Location Open Seven Days For Lunch & Dinner Ask About Our Catering, Take-Out & Delivery Services
2 LocationsNyack • 125 Main St. • 845-643-8888
Suff ern • 8 N. Airmont Rd. • 845-547-2326
BUILD YOUR COMMUNITY!
SHOP LOCAL
Patronize the Adve isers who make this bulletin possible!
CAN IN CASH OUT845-323-1865
BOTTLE REDEMPTION CENTER
We accept ALL NYS BottlesChurch Fund Raisers Available
25 N Middletown Roadin rockland Plaza in rear of Starbucks
Next to Westrock Pools
PROFENNA AND DEBELLISPROFENNA AND DEBELLIS CPAS PCCPAS PC
INDIVIDUAL & CORPORATETAX PREPARATION
251 WEST NYACK ROADWEST NYACK, NY
845-623-8555845-623-8555
ValentineValentineElectric Inc.
(845) 398-1339(845) 398-1339NEW YORK CITYNEW YORK CITY
ROCKLAND • NEW JERSEYROCKLAND • NEW JERSEY
WESTCHESTER,WESTCHESTER, CT, VERMONT CT, VERMONT
374 Greenbush Road.374 Greenbush Road.Blauvelt, NY 10913Blauvelt, NY 10913Licensed & InsuredLicensed & Insured
Commercial Rates are at an All Time Low.
Contact us today to get a free analysis to see
if we can help Save you money with your
monthly payments on your commercial property.
Multi-Family, Retail, Offi ce Building, Apartment
and Condos. Can close in as little as 45 days! Four
season customer service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600
Philadelphia, PA 19103
Residential, Commercial, Real Estate Cleanings & New Constructions CleaningsGenerous Senior Citizen Discount • Cleaning For A Cause Program
Military, Firefi ghter, EMS & Police Offi cer Discounts ~ We Appreciate YouOrganic Cleaning Products Available
Weekly, Bi-Weekly, Monthly and Seasonal Service Optionswww.DutchmenCleaningUSA.com(845) 742-9592
Serving Rockland & Bergen Counties For Over 20 Years
438 St. Paul - St. Ann (I) X John Patrick Publishing Company 1-800-333-3166 • www.jppc.net
JOSEPH W. SORCE FUNERAL HOME, INC.JOSEPH W. SORCE FUNERAL HOME, INC.Family Owned & Operated for over 50 years Our Family Serving Your FamilyFamily Owned & Operated for over 50 years Our Family Serving Your Family
FUNERAL DIRECTORSFUNERAL DIRECTORS: Joseph P. Sorce, John A. DeNicola Jr., Melissa A. Sorce-DeNicola: Joseph P. Sorce, John A. DeNicola Jr., Melissa A. Sorce-DeNicola
728 West Nyack Road, West Nyack, NY • www.sorcefuneralhome.com • 845-358-4433728 West Nyack Road, West Nyack, NY • www.sorcefuneralhome.com • 845-358-4433
The place for all your landscape and hard-scape needs15 Horseshoe Dr., New City NY 10956 • 845-638-0208 • Fax 845-639-1626
Pat Maddamma • Email: [email protected] • Web Site: SuburbanGC.net Lic.#H-11750-A6-00-00
MAKIN WAVESHair & Nail Designfor Men & Women
75-B Lake Rd., Congers NY845-268-2748
www.makinwavesdesigns.com
NY Lic. #H-08515-A6
Handyman SolutionsLicensed & Insured
Interior & Exterior PaintingKitchen & Bathroom Remodeling
Sheet Rocking & Taping • Tiling & CabinetryDeck Refi nishing • Windows, Doors, Etc.
I’m the solution for the jobs you don’t have time for.
No job too small
(845) 323-1565HandymanSolutionsNY
Jean “JP” Endres, GRI
845-634-4202 - Offi ce | 914-729-4196 - Cell | [email protected] - Email www.randrealty.com
268 South Main St., New City, NY 10956
“If You’re thinking about a career in Real Estate call “If You’re thinking about a career in Real Estate call the #1 company in Rockland County.”the #1 company in Rockland County.”
• residential • commercial • industrial • We Provide Containers for
Cardboard & Paper RecyclingDaily • Weekly • Monthly
Service AvailableP.O. Box 495, Valley Cottage, NY 10989Tel: 845-268-5747 • Fax 845-268-0352
Family Restaurant & Pizzeria Specializing in Authentic Old Fashioned Italian Favorites
Gourmet Style Pizza & Calzones482 Kings Highway, Valley Cottage, NY
Catering Availablefor All Occasions 268-5291268-5291
KEVIN’S ACE REPAIR
52 Main St. Nyack
845.358.4975
845.358.011895 W. Nyack Way • W. Nyack, NY
SPECIALISTS INALL TYPES FENCING
CHAIN LINKWOOD
GUIDE RAILWHOLESALE • RETAIL
N O WH I R I N G
School Bus DriversPETER BREGA, INC.
AM and/or PM845-268-6107www.PeterBregaInc.com
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg
y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis
cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm o
echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n
acturing - Chemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens
dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans
ortation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker
CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia
ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforcforcforcforcforceement, Public Safety - O
To all those nforcement, Public Sanforcement, Public Sa
essentiallture - Energylture - EnergyWater aste TraWater aste Tra
workerscs - Public Wors - Public WorCommunicatioCommunicatio
keeping echnology Wochnology Woovernment Wovernment W
us safe,acturing Caterials Finanaterials Finan
yournicationnicationWorkerWorke
service isovernment Workovernment Workacturing Chemacturing Chem
invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar
ment, Public Safety - OSafety - Othan
k yo
u
g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tettttttttttteee Transportation & Log
cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCCoCCoCCoCooCCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicaticatcaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim
echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community
What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering
their vehicle to make sure it is the car they are supposed to enter.
In Remembrance of Samantha Josephson
#WHATSMYNAME
This Space is Available!800-333-3166 ext. 161
or visit www.jppc.net
438 St. Paul - St. Ann (B) X John Patrick Publishing Company 1-800-333-3166 • www.jppc.net
Stephen Giordano, D.D.S.General Dentistry
Orthodontics / Endodontics217 Route 303Valley Cottage, NY 268-6088
Auto, Home, Business, LifeAuto, Home, Business, Life1 Lake Road • Congers, NY 10920 • (845) 268-7000
ANTONIO F. REDAATTORNEY AT LAW
Estate Planning & Administration • Wills & Trusts
Tax • Real Estate • Corporate
82 Maple Avenue • New City, NY 10956
GREG’S AUTO BODYGREG’S AUTO BODYQuality Auto Body WorkQuality Auto Body Work
• FREE ESTIMATES •268-7656268-7656
160 N. Rt. 9W • CongersGreg Zurla
Kevin STOKESExcavating, Inc.•Specialty pipe contractor•Sewer, water, drainage, waterproofi ng•Sump pump diversions
845-735-4096Lic.#H-07827-10
Rockland CemeteryPre-need grave burial sites Pre-need grave burial sites and columbarium niches for and columbarium niches for cremains are availablecremains are available201 Kings Hwy. Sparkill, NY 10965 845-359-0172 A inal resting place of rustic beauty
[email protected] www.rocklandcemetery.org
Energized Electric, Inc.Energized Electric, Inc.LICENSED &
FULLY INSURED
845-268-2300845-268-2300Tom Fredeman, Jr. ~ Parish Member
Residential • Commercial
Keith R. TaylorBrian J. Knecht
Shaun M. Cassidy~ Parishioners of Saint Ann’s ~Independently Owned & Operated • 358-0573
www.hannemannfuneralhome.com
H F H , I .88 South Broadway, Nyack, New York 10960
$10 OFFCarving a New Experience®
*Valid during lunch or dinner for up to 8 guests, Sun-Thurs. Not valid with
any other offer, on holidays, or on discounted children’s pricing. Drinks, dessert, tax and gratuity not included.
West Nyack location only. Expiration 10/31/18.
Palisades Center845.727.1313
*Valid during lunch or dinner for up to
8 guests. Sun.-Thurs. Not vailid with
any other off er, on holidays, or on
discounted children’s pricing. Drinks,
dessert, tax and gratuity not included.
West Nyack location only.
Expiration 5/1/20
The Red BarnCome home to your discount furniture store
No Credit/Bad Credit/No Problem Kornerstone Financial
www.myredbarnfurniture.com845-352-2550Parishioner of St. Paul’s
TRAVIS MONUMENTSTRAVIS MONUMENTS Est. 1899Specialists in Mausoleums & Monuments
Expert Service, Cleaning & Repair5 Generations of Expertise
Quality Monuments for All Cemeteries, Nationwide.
866-6-TRAVIS866-6-TRAVIS
Joseph P. DamontiGeneral Manager
Respect. Respect. Value. Value.
Simplicity.Simplicity.
100% Service Guarantee™ • 24 Hour Compassion HelplineSM • Prearranged Service (Nationally Transferable)
MICHAEL J. HIGGINSMICHAEL J. HIGGINSFUNERAL SERVICE, INC.FUNERAL SERVICE, INC.
113 Lake Road East, Congers268-6665268-6665
321 S. Main St., New City 634-6110634-6110
Route 9 W., Stony Point786-3500786-3500
176 Main St., Nyack, NY1-800-368-3628 • (845) 358-2544
www.tappanzeefl orist.net
Delivery Anywhere
Flowers For All OccasionsA
Plots AvailableGreat Locations
Starting at $1,350Call 845-358-0012
[email protected] North Highland Ave., Nyack, NY 10960
Our Services:• Baby Nurses• Nanny• Senior Caregivers• Companions• Housekeepers• Live-in or live-out
Lydia Velez-ArlottaAdministrator
Serving Tri State Area:New York, New Jersey
and Connecticut
All Work Guaranteed • Computerized Paint Booth • Lease Return Specialists
191 North Rt. 9W, Congers, NY 845-268-1790
Frank [email protected]@
845/268/9752845/268/9752
73 LAKE ROAD73 LAKE ROADCONGERS, NYCONGERS, NY
Designers andManufacturers
of Fine Jewelry
www.bourgholbrosjewelers.com
See what colorcan do for you!
John Patrick Publishing
800-333-3166
to advertise in color, please call us at
Regina CarmelNYSRE Associate BrokerNJSRE Sales Associate
(845) [email protected]
www.reginacarmel.randrealty.com
“A House is not a Home until it’s Your Own!”