+ All Categories
Home > Documents > Sept. 13, 2020 24th Sunday in Ordinary Time · 9/9/2020  · 8:30 AM Lina Pavan — Anniversary...

Sept. 13, 2020 24th Sunday in Ordinary Time · 9/9/2020  · 8:30 AM Lina Pavan — Anniversary...

Date post: 11-Oct-2020
Category:
Upload: others
View: 2 times
Download: 0 times
Share this document with a friend
12
Church of St. Paul Church of St. Ann 82 Lake Road West 16 Jefferson Street Congers, NY 10920 Nyack, NY 10960 [email protected] Parish Office: 82 Lake Road West, Congers, NY 10920 Phone: (845) 268-4464/-4465 Fax: -6790 Email: [email protected] Website: spasaparish.org You Tube: Spasa Parish Rev. Vladimir Chripko, C.O. Pastor Rev. Roman Dominik Palecko, C.O. Assistant Pastor Rev. Narisetty Arogya Raju, C.O., Parochial Vicar Rev. Joseph Kumar Narisetty, Parochial Vicar Rev. Maniraguha Jean Paul Ruriho, Assistant Rev. George Torok, C.O., Weekend Assistant S ST. PAUL ST. ANN Deacons Dominic Buonocore Mark Czerwinski, Director RCIA Luke Conroy, Director RCIA Charles DeGroat Gerald Fenton, Liturgy Coordinator Parish Office Hours 9:00 am-3:00 pm Monday-Friday Cemetery/Assistant to Pastor Lissette Diaz [email protected] Religious Education Program (845-268-5442) Email: [email protected] Carmen Hernandez Lissette Diaz St. Anthony-St. Paul School Dr. Anna Adams, Principal (845-623-2311); St. Anthony, grades 2 to 8 Jessica Perez, Asst. Principal (845-268-6506) St. Paul, PreK/UPK, Kindergarten, Gr. 1 Music Ministry Vincent Green Sunday Masses Saturday 5 pm Sunday 7:30 am 10 am (at St. Paul Church) 10 am (at Marydell Faith & Life Center) 12 pm, 6 pm Saturday 5:30 pm Sunday 8:45, 11:30 am Weekday Masses MondaySaturday 6:30 & 8:30 am MondaySaturday 7:30 am Streamed Mass Daily including Sunday 8:15 am at YouTube Channel SPASA Parish Confessions Saturdays 4:00-4:45 pm Anytime by request. Saturdays 4:30-5:15 pm Anytime by request. Sacrament of Baptism To schedule a Baptism at St. Paul or St. Ann please call the rectory at 845-268-4464. Baptism instruction classes are held the last Thursday of each month at 7 pm at the St. Ann School in Nyack. Please call the rectory to register. Sacrament of Marriage Engaged couples should contact the Rectory at least six months in advance in order to arrange for their participation in the marriage preparation program. Please email [email protected]. Anointing of the Sick If someone is homebound or in the hospital, please notify the Rectory. Arrangements can be made for the sick person to receive the Sacrament of the Anointing of the Sick. Holy Communion is brought to the homebound by our Ministers of Holy Communion. Sept. 13, 2020 24th Sunday in Ordinary Time
Transcript
Page 1: Sept. 13, 2020 24th Sunday in Ordinary Time · 9/9/2020  · 8:30 AM Lina Pavan — Anniversary 8:15 AM ♦♦ Friday Sept. 18, 2020 Friday Sept. 18, 2020 6:30 AM Virginia Cufuni

Church of St. Paul Church of St. Ann 82 Lake Road West 16 Jefferson Street Congers, NY 10920 Nyack, NY 10960

[email protected] Parish Office:

82 Lake Road West, Congers, NY 10920 Phone: (845) 268-4464/-4465 Fax: -6790

Email: [email protected] Website: spasaparish.org You Tube: Spasa Parish

Rev. Vladimir Chripko, C.O. Pastor Rev. Roman Dominik Palecko, C.O. Assistant Pastor

Rev. Narisetty Arogya Raju, C.O., Parochial Vicar ● Rev. Joseph Kumar Narisetty, Parochial Vicar Rev. Maniraguha Jean Paul Ruriho, Assistant Rev. George Torok, C.O., Weekend Assistant

SST. PAUL ST. ANN Deacons Dominic Buonocore

Mark Czerwinski, Director RCIA Luke Conroy, Director RCIA Charles DeGroat Gerald Fenton, Liturgy Coordinator

Parish Office Hours 9:00 am-3:00 pm Monday-Friday

Cemetery/Assistant to Pastor Lissette Diaz [email protected]

Religious Education Program (845-268-5442) Email: [email protected] Carmen Hernandez Lissette Diaz

St. Anthony-St. Paul School Dr. Anna Adams, Principal (845-623-2311); St. Anthony, grades 2 to 8 Jessica Perez, Asst. Principal (845-268-6506) St. Paul, PreK/UPK, Kindergarten, Gr. 1

Music Ministry Vincent Green

Sunday Masses

Saturday 5 pm Sunday 7:30 am 10 am (at St. Paul Church) 10 am (at Marydell Faith & Life Center) 12 pm, 6 pm

Saturday 5:30 pm Sunday 8:45, 11:30 am

Weekday Masses Monday—Saturday 6:30 & 8:30 am Monday—Saturday 7:30 am

Streamed Mass Daily including Sunday 8:15 am at YouTube Channel SPASA Parish

Confessions Saturdays 4:00-4:45 pm Anytime by request.

Saturdays 4:30-5:15 pm Anytime by request.

Sacrament of Baptism To schedule a Baptism at St. Paul or St. Ann please call the rectory at 845-268-4464. Baptism instruction classes are held the last Thursday of each month at 7 pm at the St. Ann School in Nyack. Please call the rectory to register.

Sacrament of Marriage Engaged couples should contact the Rectory at least six months in advance in order to arrange for their participation in the marriage preparation program. Please email [email protected].

Anointing of the Sick If someone is homebound or in the hospital, please notify the Rectory. Arrangements can be made for the sick person to receive the Sacrament of the Anointing of the Sick. Holy Communion is brought to the homebound by our Ministers of Holy Communion.

Sept. 13, 2020 24th Sunday in Ordinary Time

Page 2: Sept. 13, 2020 24th Sunday in Ordinary Time · 9/9/2020  · 8:30 AM Lina Pavan — Anniversary 8:15 AM ♦♦ Friday Sept. 18, 2020 Friday Sept. 18, 2020 6:30 AM Virginia Cufuni

2

ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 12, 2020 Saturday Sept. 12, 2020

5:00 PM Carlos M. Taganas 5:30 PM Pastor’s Intention

Sunday Sept. 13, 2020 Sunday Sept. 13, 2020

7:30 AM Assunta Cecere, William Thomas & William James Sbordone 8:45 AM Christopher Bazile (L) — Birthday

10:00 AM Pastor’s Intention Marydell Faith & Life Center

10:00 AM Nicholas Cifuni St. Paul’s Church

12:00 PM Anna Mullane 6:00 PM Claramma Thomas Monday Sept. 14, 2020 Monday Sept. 14, 2020

6:30 AM Violeta V. Saulon 7:30 AM Steven R. Leardi 8:30 AM Michael McLoughlin — 46th Anniversary 8:15 AM ♦♦ Tuesday Sept. 15, 2020 Tuesday Sept. 15, 2020

6:30 AM Violeta V. Saulon 7:30 AM Maria Ramirez, Dr. Diana Ramirez & Daphne C. Ramirez

8:30 AM Martin Cullen 8:15 AM ♦♦ Eduardo Alphonso

Wednesday Sept. 16, 2020 Wednesday Sept. 16, 2020

6:30 AM Logan Porter (L) 7:30 AM Thomas & Theresa Kaps (L)

8:30 AM Robert Joseph Burns Jr. 8:15 AM ♦♦

Thursday Sept. 17, 2020 Thursday Sept. 17, 2020

6:30 AM Robert M. Sbordone (L) 7:30 AM George Bryant 8:30 AM Lina Pavan — Anniversary 8:15 AM ♦♦ Friday Sept. 18, 2020 Friday Sept. 18, 2020

6:30 AM Virginia Cufuni 7:30 AM Maria Ramirez, Dr. Diana Ramirez & Daphne C. Ramirez

8:30 AM Richard Cullen 8:15 AM ♦♦ Saturday Sept. 19, 2020 Saturday Sept. 19, 2020

6:30 AM Standford Klingler 7:30 AM Maria Ramirez, Dr. Diana Ramirez & Daphne C. Ramirez

8:30 AM Kathleen Flynn 8:15 AM ♦♦

5:00 PM Helen Decolyse 5:30 PM Patricia & Charles Westwater

Sunday Sept. 20, 2020 Sunday Sept. 20, 2020

7:30 AM Mario & Phylis Costanzo 8:45 AM Daniel Kirwan — Birthday

10:00 AM Pastor’s Intention Marydell Faith & Life Center

12:00 PM Gene Morris 6:00 PM Guiseppa Cutaia & Giuseppa Cartella

Now you can now find out which masses are available for your special intentions and schedule them online. Go to our parish website, SPASAPARISH.ORG. On the homepage, click on the Mass Intentions box for instructions and access to the “Mass Intentions Booking” page. You may also reserve the sanctuary lamp at either church or at St. Ann’s Chapel. You can make your offering by credit card. Or you can call the parish office (845-268-4464) to schedule masses the traditional way and make your offering by credit card, cash, or check.

10:00 AM Margaret & Edward Bordas St. Paul’s Church

8:15 AM ♦♦ 11:30 AM People of the Parish

8:15 AM ♦♦ 11:30 AM Richard Stokes

Second Collection for the Parish Food Cupboards

Second Collection for Parish Religious Education

♦♦ NOTE: The 8:15 am masses are not public masses. They are livestreamed from different loca ons in our parish daily. You can watch on our parish YouTube channel SPASA PARISH. All previously scheduled 12:10 mass inten ons have been transferred to the 8:15 mass.

Page 3: Sept. 13, 2020 24th Sunday in Ordinary Time · 9/9/2020  · 8:30 AM Lina Pavan — Anniversary 8:15 AM ♦♦ Friday Sept. 18, 2020 Friday Sept. 18, 2020 6:30 AM Virginia Cufuni

3

MARK YOUR CALENDAR We are happy and grateful to announce that, after a long delay, our children will finally be celebrating their First Communions and Confir-mations, our Parish Religious Education Program will resume, and other parish events have been rescheduled.

PARISH RELIGIOUS ED PROGRAM (PREP) Registration is in progress. Classes will be online until December. For more information, go to our website,

SpasaParish.org, and click on Education.

PREP CHILDREN — CONFIRMATION Saturday, Sept. 19

St. Ann’s — 11:00 am St. Paul ‘s — 2:00 pm

SPANISH COMMUNITY FIRST COMMUNION & CONFIRMATION

Sunday, Sept. 20, at St. Ann’s — 7:00 pm

25th & 50th WEDDING ANNIVERSRY MASS Sunday, Sept. 20, at St. Paul’s – 12:00 pm

ST ANN’S 150TH ANNIVERSARY CLOSING MASS

Saturday or Sunday, Oct. 17 or 18 — tentative

Congratula ons to all the children

in our parish who received their

First Holy Communion on Saturday, Sept. 12.

It must have been hard to wait so long to receive

Jesus. But Jesus was wai ng for you, too —

and how happy He must be to be with you now in

HOLY COMMUNION! ♥

PARENTS — Unfortunately, it was not possible to have a professional photographer at the masses, but I’m sure you took plenty of photos. We would love to display them in the bulletin for all the parish to see. Please text them to 201-739-4413 or email to [email protected]. You can send either a photo of the individual First Communicant or a picture of the entire family. We’ll publish as many as we can and

post the rest on our website. Thank you!

Happy National

Grandparents Day

Sept. 13, 2020

“The blossom of a tree comes from what it has underground,” says a poet from my country. Your grandparents are your roots. An uprooted tree cannot blossom or bear fruit. That is why the bond or connection is so important. Today we are in need of a bridge, a dialogue between grandparents and young people, between the old and the young. — Pope Francis.

THE TRIUMPH OF THE CROSS — Sept. 14 This weekend is the collection for the people and shrines of the Holy Land. This collection is usually taken up on Good Friday, but this year it was postponed because of the coro-navirus and rescheduled for this weekend, close to tomorrow’s Feast of the Triumph of the Cross, a feast associated with the Holy Land. The Triumph of the Cross, formerly known as the Exaltation of the Holy Cross, is celebrated each year on Sept. 14. It honors the cross of Christ, on which He died for us. The feast recalls three events: the discovery of the true cross by St. Helena in Jerusalem circa 327 AD, the dedication of the Church of the Holy Sepulcher on that site nine years later, and the return of the relics of the cross in 629 AD after they had been seized during the Persian conquest of Jerusalem in 614. Tradition has it that St. Helena actually discovered three crosses during the demolition of a pagan temple which had been built on Calvary — the cross on which Christ died and the two others on which the thieves had been cruci ied beside Him. The beautiful story says that not knowing which was which, Helena brought in a dying woman and had her touch the crosses one by one. As she touched the third, she was cured, her healing demonstrating that that was the true Holy Cross, sancti ied by the death of our Savior,

Page 4: Sept. 13, 2020 24th Sunday in Ordinary Time · 9/9/2020  · 8:30 AM Lina Pavan — Anniversary 8:15 AM ♦♦ Friday Sept. 18, 2020 Friday Sept. 18, 2020 6:30 AM Virginia Cufuni

4

Are You “SURE” You’re a Registered Parishioner? Many times we meet people at church who attend mass, take part in events, or perhaps even have received their sacraments here. We’re so very glad you’re with us and part of our community. But that alone does not make you a parishioner. To be a member of the parish you have to REGISTER. Registering is very easy. You can register online at spasaparish.org or at the parish office. It only takes a few minutes. Everyone over the age of 18 is encouraged to register. Even if you’re an adult who received all your sacraments here as a child and still attend mass here, you need to register. Why register? First and foremost, it’s very important to register so we can serve your needs when, for example, you need a sponsor certification letter for Baptism or Confirmation. Also, to receive an acknowledgment of your donations for your income tax filing, you need to be registered so we have an official record of your giving over the year. So, please join us officially and register with the parish so we can meet all your needs now and in the future!

PARISH OF ST. PAUL & ST. ANN STAY CONNECTED with LATEST NEWS & UPDATES

OUR YOUTUBE CHANNEL SPASA PARISH Mass 7 days a week at 8:15 am Archived videos

OUR WEBSITE SPASAPARISH.ORG Photos, bulletins, mass schedules, events, and other parish information.

OUR MASS SCHEDULING APP SPASAMASS.ORG View available masses and schedule one online for a loved one or your special intention.

ONLINE GIVING TO OUR PARISH SPASAPARISH.CHURCHGIVING.COM Arrange for online giving. Support our parish and manage your giving online.

FLOCKNOTES Sign up to receive important emails or texts from the pastor and the Archdiocese.

STPAULS.FLOCKNOTE.COM/ or text STPC to 84576 from your phone

STANNNYACK.FLOCKNOTE.COM or text SACC to 84576 from your

phone

FROM THE RECTORY

GOAL PLEDGED PAID TO DATE

$1,241,500

$515,831 350 families

have pledged as of

Aug. 30, 2020

GOGOGOGOGOGOALALALALALAL

100%

PLPLPLPLPLEDEDEDEDEDGEGEGEGEGEDDDDD

102%

$1,266,370

PAPAPAPAPAPAPAIDIDIDIDIDIDID TTTTTTTOOOOOOO DATE

41.5%

INSTRUCTIONS FOR SPONSOR CERTIFICATION LETTER In order to receive a sponsor certification letter from the Parish of St. Paul & St. Ann, you must be an ACTIVE, REGISTERED PARISHIONER for 6 MONTHS. IF YOU ARE NOT OFFICIALLY REGISTERED AND DO NOT ATTEND MASS, YOU WILL NOT RECEIVE A LETTER.

The role of a sponsor is to lead a Christian life in a manner that faithfully fulfills the obligations of the Catholic faith. A sponsor must be living the Catholic faith and be able to be part of the sponsored person’s life after the Baptism, who can guide him/her spiritually. A sponsor must also: • Be at least 16 years of age • Have received the Sacraments of Baptism, Eucharist & Confirmation • If married, must be married according to the laws of the Catholic Church

75,018

Page 5: Sept. 13, 2020 24th Sunday in Ordinary Time · 9/9/2020  · 8:30 AM Lina Pavan — Anniversary 8:15 AM ♦♦ Friday Sept. 18, 2020 Friday Sept. 18, 2020 6:30 AM Virginia Cufuni

5

Memorial Intentions — Week of Sept. 13 Sanctuary Lamp (St. Paul)

Sanctuary Lamp (St. Ann)

Chapel (St. Ann)

300 CLUB WINNERS Congratulations to the Lucky Winners

of our JULY DRAWING!

#012 David Mellon #248 Edward Bond

#085 Marie Etie #250 Rocco Lapenta

PARISH COUNCIL Enrico Aberion, Ann Marie Blackwood, Hernan Caceres, Guy Gebbia, Vicki Gill, Marie Josee Joseph, Karin Lancellotti, Julie Lepore, Marie Lorenzini, Dennis Lynch, Bernadette Masiello, Greg Moreau, George Strayton, Keith Taylor

FINANCIAL COUNCIL William Dailey, Carlos Hernandez

GENERATIONS The three genera ons of the Holy Family — Jesus, his parents, Mary & Joseph, and his grandparents, Ann & Joachim — are the subject of this work of art commissioned for the outdoor shrine we’ve planned for St. Ann’s Church in Nyack. We’re nearly halfway toward our goal of $50,000. So far, generous donors have given $23,955 toward this project. Please join us in making this shrine a reality. Please send your dona on, marked “statue,” to St. Paul & St. Ann’s Parish, 82 Lake Rd. West, Congers, NY 10920.

SPaSA Parish SUBSCRIBE ON AND HELP OUR PARISH REACH 1,000 SUBSCRIBERS.

MASS IS AVAILABLE ON YOUTUBE 7 DAYS A WEEK AT 8:15 AM, STREAMED FROM DIFFERENT

LOCATIONS IN OUR PARISH

Prayer for the Sick We pray that the sick of our parish, our relatives, and friends will experience God’s healing love, especially:

Please call the rectory (268-4464) to be placed on the list of those who need prayers in time of illness, or call with the names of any sick family members or friends. The name will remain on the list for 3 weeks and then be removed unless we hear from you that the person still needs our prayers.

SPASAMASS.ORG

You can find available masses and schedule them online at SPASAMASS.org. For the

me being, you’ll have to make the following adjustments:

For any 8:15 am streamed mass, select that day’s St. Ann’s 12:10 pm box

For a St. Ann’s Saturday 7:30 am mass, select the St. Ann’s Saturday 9 am box

For a St. Paul’s 8:30 am mass, select St. Paul’s 9:00 am box

For a St. Paul’s Saturday 6:30 am mass, select the St. Paul’s Saturday 7:30 am box

EMAIL FOR THE PASTOR [email protected]

BULLETIN DEADLINES Friday — the week before the bulletin is distributed at church Please send submissions to bulletinspasa @yahoo.com)

THE MASS BOOK

IS OPEN

You may now schedule masses for your inten ons through March 2021

Our Beloved Dead Please remember in your prayers our deceased

fellow parishioners, family, and friends.

Robert Rose, Dan Pfeiffer, Stephen Goeller, Madeline Dorangrichia, James O’Toole

Evan Dalsass, Laura, John Barch, Laura Mazzacone, Kathryn Scarmato,

Emilia Raphael-Olivier, Carolyn Pagliuca, Michael Doria, Noah Diaz, Manuel Tucay

Page 6: Sept. 13, 2020 24th Sunday in Ordinary Time · 9/9/2020  · 8:30 AM Lina Pavan — Anniversary 8:15 AM ♦♦ Friday Sept. 18, 2020 Friday Sept. 18, 2020 6:30 AM Virginia Cufuni

6

CONFESSION & VISITS FOR PRIVATE PRAYER You may visit both our churches for private prayer daily. St. Ann’s Chapel is open from 7:30 am to 9 am and from 11:30 am to 1 pm; use the door on Third Ave. St. Paul’s Church is open from 6 am to 8 pm. MASKS & SOCIAL DISTANCE of 6 feet must be observed For Confession, priest and penitent should wear masks and maintain a 6-foot distance. Confession at St. Paul’s: Saturdays, from 4 pm to 4:45 pm in the church confession room. At St. Ann’s: Saturdays, from 4:30 pm to 5:30 pm – Outside, between the sacristy and rectory side en-trance. Or anytime by request. Please call the office (845-268-4464).

s /s-

Soul Exercises – Pursuit of Contemplative Silence Are you looking for a way to increase inner tranquility, decrease stress, have more control over your own life, and deepen your relationship with God?

Find all this and more in Silence: Silence is the great Revelation, and it is transforming.

Father George Torok, C.O., will hold a seminar on the pursuit of Silence. The seminar will consist of four group exercise sessions held at Hallel in Sparkill, NY. In addition, if you cannot attend in person, the sessions will be livestreamed.

There will be two seminars:

Fall 2020: Oct. 4 & 18 and Nov. 8 & 22 from 6 to 7:30 pm

Winter 2021: Jan. 10 & 24 and Feb. 14 & 28 from 6 to 7:30 pm

This is not a lecture series, but a group exercise experience. The sessions are free, but you MUST reserve your place. Kindly email [email protected] or register online at spiritwellsprings.com.

Rite of Chris an Ini a on of Adults RCIA is the spiritual journey of discovery for persons seeking to come into full communion with the Catholic Church. The process includes dialogue about the life of Jesus Christ and teachings and prac ces of the Catholic faith. Candidates enter into harmony with our parish family on receiving the Sacraments of Ini a on at the Easter Vigil. Please call the rectory, 845-268-4464

This year, enjoy the Concert to benefit One to One Learning from the comfort of your home or favorite hangout. Invite a few friends to watch with you and enjoy a fun afternoon while you support a great cause. Tickets are $30 and each one gives you a chance in our raffle for gift cards to favorite local restaurants. Please send your donation to the address below with your name, address, phone number and email address — or donate online at one2one-learning.org. You will receive information about how to connect to the concert. Star-Fest XI Tickets, One to One, 640 N. Midland Ave., Nyack, NY 10960.

Two li le girls received the priceless gi of becoming a child of God as they were bap zed last Sunday, Sept. 6, at St. Ann’s Church. On the le is Mia Caroline Desimone with her mom, Kaitlyn, and dad, Michael, holding sister Ava. The godparents are Stephanie King and Nicholas Russo. On the right is Kelsey Jane Mansfield, with her dad, Allen, and mom, Jackie. To the le are godparents Anthony Uribe and Anny Mansfield. Deacon Luke Conroy performed the Bap sms.

Page 7: Sept. 13, 2020 24th Sunday in Ordinary Time · 9/9/2020  · 8:30 AM Lina Pavan — Anniversary 8:15 AM ♦♦ Friday Sept. 18, 2020 Friday Sept. 18, 2020 6:30 AM Virginia Cufuni

7

SISTERS OF LIFE: HEALING AFTER ABORTION Do you know someone who is carrying the grief of a past abortion? There is always hope. The pain and sorrow of abortion does not need to endure for a lifetime. A “Day of Prayer and Healing” offers the opportunity to experience the love and mercy of God and to respond to His invitation to begin the journey of healing. For upcoming dates, loca-tions, and confidential registration, or just to talk to a Sis-ter, please call the Sisters of Life at (866)-575-0075 (toll free) or by email at [email protected].

August 28, 2020 Dear St. Anthony-St. Paul School Families, It is with great excitement that we announce an addi on to our already-strong school leadership team. Effec ve Sept. 1, 2020, Ms. Jessica Perez is joining us as Assistant Principal of the St. Paul campus. Ms. Perez has enjoyed a stellar career in Catholic educa on as a teacher and leader, most recently as Principal at St. Thomas Aquinas School in the Bronx since 2015, where she had been a teacher for the previous 11 years. Jessica Perez holds a Bachelor of Arts degree in Psychology from St. Joseph College as well as a Master of Science in Edu-ca on from Lehman College and a Master of Science in School Building Leadership from St. John’s University. As we enter into our inaugural year as St. Anthony-St. Paul School, we do so eager to serve the educa onal needs of such a diverse and varied school community. With the St. Paul cam-pus now focused on Early Childhood, we are fortunate to have a talented professional with experience such as Ms. Perez. With her on board, we will successfully expand our horizons while mee ng and overcoming the challenges presented by the mes in which we live. Ms. Perez will complement our school’s focus on Catholic iden-

ty as well as academics, while helping to nurture suppor ve rela onships with teachers and families alike. We look forward to the wealth of knowledge she will bring to our school. We know the future is bright for St. Anthony-St. Paul School and Catholic educa on in Rockland County. Blessings, Dr. Adam, Principal, St. Anthony-St. Paul School Mrs. Cathleen Cassel, Regional Superintendent of Rockland

SINCE THE RETURN TO PUBLIC WORSHIP many parishes have chosen to avoid singing hymns in an effort to reduce the amount of congregational singing. This workshop, sponsored by the Archdiocese of NY, is for parish musicians, pastors, or anyone who wants to learn more about ways to introduce new musical forms to your parish’s Sunday mass.

Visit the SJR campus, meet faculty, staff and coaches, speak with teachers and students

and learn about our academic and athletic programs, scholarships, and financial aid.

Discover what makes

St. Joseph Regional High School a unique high school experience

SUNDAY, SEPT. 27 at 11 am

Reserve your spot online, SJRNJ.ORG 240 Chestnut Ridge Road, Montvale, NJ 07645

Page 8: Sept. 13, 2020 24th Sunday in Ordinary Time · 9/9/2020  · 8:30 AM Lina Pavan — Anniversary 8:15 AM ♦♦ Friday Sept. 18, 2020 Friday Sept. 18, 2020 6:30 AM Virginia Cufuni

8

Summer 2020 Round-Up

(Above) Sunflowers grace the Marydell Children’s Garden. (Above) Fr. Vladimir helps at the St. Joseph’s Workers clean-up in July.

(Above) The Garden of Faith under the summer sky; Paul Aberion, Deacon Luke, Fr. Joseph & Marty Ka gbak at Sunday mass at Marydell; a beau ful morning at St. Ann’s.

(Le ) Swans glide across the waters of Congers Lake, across from St. Paul’s Church.

(Above) In late August, workers completed a major landscaping project at St. Ann’s that included weeding, mulching, and hedge trimming around the church grounds and pruning the rectory rose garden.

Photos courtesy of Nelson Chan, Nancy Conroy, Elissa Dailey, Vickie Gill, and Sue Hanna Toher

Page 9: Sept. 13, 2020 24th Sunday in Ordinary Time · 9/9/2020  · 8:30 AM Lina Pavan — Anniversary 8:15 AM ♦♦ Friday Sept. 18, 2020 Friday Sept. 18, 2020 6:30 AM Virginia Cufuni

9

FROM THE PASTOR’S DESK

FR. MASTROLIA APPOINTED PASTOR OF ST. CLARE’S

Fr. Arthur J. Mastrolia, former pastor of St. Paul’s, has been appointed pastor of St. Clare’s in Staten Island, effective Sept. 1. Also at St. Clare’s is another priest who served at St. Paul’s, Fr. Brendan Gormley. May God bless them both as they continue their ministry serving God’s people.

O ne the most sensual elements of the Sacred Liturgy is the use of incense, which o en is misunderstood and o en overlooked.

Using incense in sacred worship is a prac ce the Church adopted from our Jewish ancestral herit-age. The use of incense is men oned on many occasions in the Book of Levi cus, which describes various ceremonial atonement rituals. The Levite priests used incense along with the thanksgiving offerings of fruit, oil, wine, and unbloody animal sacrifices. Aaron was instructed in the Book of Exodus by God to use “sweet smelling in-cense” (Ex. 30:7) in the morning offering on the altar. So common was the use of incense as part of Jew-ish ceremonial worship that it shows up in the religious hymnody in the Book of Psalms: “Lord, let my prayer rise before you like incense, my hands like an evening offering.” (Ps. 141:2). In the Gospel of Luke, we learn that at the me of the Lord Jesus, incense was offered by the priests in the Temple of Jerusalem, as Luke describes Zachariah’s du es the day he learns of his son John the Bap st’s concep on. In The Book of Revela ons, John’s vision of the Heavenly liturgy is described: “And another angel came and stood before the altar, having a golden censer: and there was given to him much incense, that he should offer of the prayers of all saints, upon the golden altar which is before the throne of God. And the smoke of the incense of the prayers of the saints ascended up before God from the hand of the angel.” (Rev. 8:3). John describes incense as symbolizing “the prayer of the saints” (Rev. 8:5). Amalarius of Metz (a liturgical historian of the 9th Century) describes litur-gical incense as that which is “enkindled in the heart by the fire of God's love and, exhaling the odor of Christ, rises up a pleasing offer-ing in His sight.” The use of incense has characterized the solemnity of the Sacred Liturgy from (as early as evidence suggests) around the 6th century in the Church. It is a ritual act that symbolizes not only the raising of our hearts, minds and prayer, but also the mysterious and sacred dignity of God Himself. In the Eastern Church, the smell or fragrance of the incense symbolizes the dignity of the solemnity or feast day being celebrated. In the West, incense is more a visual sign of the “cloud of mystery” and profound awe of the presence of Al-mighty God. It is a prac ce of the Church to use incense in solemn Masses which includes the Sunday Masses as well as other great feast days. The prac ce and use of incense are rooted in Sacred Scripture, but also add to the solemn nature of our Eucharis c celebra on. Incense is also used to bless, as holy water is used, or to “set aside” for sacred use people and objects. In the Mass, not only for the gi s of bread and wine, but a er the consecra on it is used to symbolize the Lord’s presence in the Eucharist. The altar, the crucifix, and during the Easter season the Paschal Candle are also incensed to signify their being set aside for worship. The priest and the people are also incensed separately, symbolizing not only the difference of their office in the liturgical assembly, but also their par cipa on in the liturgy that is the foretaste of the heavenly liturgy of St. John’s vision. As I have no ced and you all very well know, for various safety reasons or lack of altar servers the use of incense has been regulated to only special celebra ons, but I wish to emphasize that Sundays are meant to be a con nual celebra on of Easter Sunday. There-fore, I do not wish to diminish its beauty, solemnity, or importance. Allow the cloud of incense not only to serve as visual rising of your prayers to God, but also allow its mysterious aroma to raise your thoughts and hearts to the altar of God in heaven. From Your Priests

Incense

IMPROVE YOUR SINGING VOICE The archdiocesan Vocalist Training Program is designed to help parishioners receive musical training and develop the skills needed to serve as a cantor or choir member. Lessons are taught in person or online by members of the archdiocesan Music Commission and other highly qualified teachers.

More information: nyliturgy.org/vocalisttrainingprogram Contact: Archdiocese of New York Office of Liturgy: [email protected]/ or 914-968-6200, x 8177.

Page 10: Sept. 13, 2020 24th Sunday in Ordinary Time · 9/9/2020  · 8:30 AM Lina Pavan — Anniversary 8:15 AM ♦♦ Friday Sept. 18, 2020 Friday Sept. 18, 2020 6:30 AM Virginia Cufuni

438 St. Paul - St. Ann (3) X John Patrick Publishing Company 1-800-333-3166 • www.jppc.net

Breakfast & LunchCongers Colonial Plaza285 Route 303

267-2656267-2656Fax: 267-2532Fax: 267-2532

Rockland Bakery Deli94 Demarest Mill Rd., Nanuet, NY 10954

845-623-1115Boar’s Head Provisions • Catering For All Occasions

Fresh Hot Specials Made DailyMon.-Sat. 6am-8pm • Sun. 6am-5pm

BMC & SonPlumbing & Heating

10% Discount When You Mention This Ad

Parishioner of St. Paul/St. Ann

Hot Water Heaters •BoilersSump Pumps • Water Filters

Lic. # 862

845-268-0992 • www.BMCrockland.com

-KING OF PIZZA-

TURIELLO’SITALIAN PIZZERIA & RESTAURANT

PIZZA • PASTA • CHICKEN • VEAL • SEAFOOD • HOT & COLD SUBSOPEN 7 DAYS OPEN 7 DAYS (845) 358-5440 FREE DELIVERY FREE DELIVERY

76 Main Street (Corner of Broadway) • Nyack, NY 1096076 Main Street (Corner of Broadway) • Nyack, NY 10960

Nino & RosaCatering For All Occasions

Gift Certifi catesGluten Free

Pizza & PastaGelato

CelebratingOver

35 Year

Tolstoy Tolstoy FoundationFoundationRehabilitationRehabilitation&Nursing CenterNursing Center

Dorothy Corbett, Administrator / Acting CEO

100 Lake Road • Valley Cottage100 Lake Road • Valley CottageNew York, 10989New York, 10989

845-268-6813 ex 112 • [email protected]

Licensed & InsuredLicensed & InsuredCall Now for Free Estimate: 845-267-0076Call Now for Free Estimate: 845-267-0076www.superiorlawnsandlandscaping.comwww.superiorlawnsandlandscaping.com

476 Christian Herald Rd., Valley Cottage, NY 10989 www.nyackridge.com

Nestled in a quiet & tranquil country setting in the heart of Rockland County, Nyack Ridge Rehabilitation & Nursing Center is a

foremost provider of subacute rehab & long term care.

Rated 5 stars & highly

regarded in the community.

Volunteers Needed:Call Josa Andalora, CTRS

Tel. # 845-268-6861 ext. 246 | [email protected]

Admissions Director:Jessica Chardonnette, MS

Tel. #845-268-6861, ext. 205 | [email protected]

“Committed To Quality & Freshness”Fresh Louisiana Cajun Seafood • SUSHI

Now off ering “ALL YOU CAN EAT SUSHI” everyday, with pricing of $22.99 per person

on weekdays & $24.99 on weekends. Nyack Location Open Six Days (Closed Mon.) For Lunch & Dinner

Suff ern Location Open Seven Days For Lunch & Dinner Ask About Our Catering, Take-Out & Delivery Services

2 LocationsNyack • 125 Main St. • 845-643-8888

Suff ern • 8 N. Airmont Rd. • 845-547-2326

BUILD YOUR COMMUNITY!

SHOP LOCAL

Patronize the Adve isers who make this bulletin possible!

CAN IN CASH OUT845-323-1865

BOTTLE REDEMPTION CENTER

We accept ALL NYS BottlesChurch Fund Raisers Available

25 N Middletown Roadin rockland Plaza in rear of Starbucks

Next to Westrock Pools

PROFENNA AND DEBELLISPROFENNA AND DEBELLIS CPAS PCCPAS PC

INDIVIDUAL & CORPORATETAX PREPARATION

251 WEST NYACK ROADWEST NYACK, NY

845-623-8555845-623-8555

ValentineValentineElectric Inc.

(845) 398-1339(845) 398-1339NEW YORK CITYNEW YORK CITY

ROCKLAND • NEW JERSEYROCKLAND • NEW JERSEY

WESTCHESTER,WESTCHESTER, CT, VERMONT CT, VERMONT

374 Greenbush Road.374 Greenbush Road.Blauvelt, NY 10913Blauvelt, NY 10913Licensed & InsuredLicensed & Insured

Commercial Rates are at an All Time Low.

Contact us today to get a free analysis to see

if we can help Save you money with your

monthly payments on your commercial property.

Multi-Family, Retail, Offi ce Building, Apartment

and Condos. Can close in as little as 45 days! Four

season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600

Philadelphia, PA 19103

Page 11: Sept. 13, 2020 24th Sunday in Ordinary Time · 9/9/2020  · 8:30 AM Lina Pavan — Anniversary 8:15 AM ♦♦ Friday Sept. 18, 2020 Friday Sept. 18, 2020 6:30 AM Virginia Cufuni

Residential, Commercial, Real Estate Cleanings & New Constructions CleaningsGenerous Senior Citizen Discount • Cleaning For A Cause Program

Military, Firefi ghter, EMS & Police Offi cer Discounts ~ We Appreciate YouOrganic Cleaning Products Available

Weekly, Bi-Weekly, Monthly and Seasonal Service Optionswww.DutchmenCleaningUSA.com(845) 742-9592

Serving Rockland & Bergen Counties For Over 20 Years

438 St. Paul - St. Ann (I) X John Patrick Publishing Company 1-800-333-3166 • www.jppc.net

JOSEPH W. SORCE FUNERAL HOME, INC.JOSEPH W. SORCE FUNERAL HOME, INC.Family Owned & Operated for over 50 years Our Family Serving Your FamilyFamily Owned & Operated for over 50 years Our Family Serving Your Family

FUNERAL DIRECTORSFUNERAL DIRECTORS: Joseph P. Sorce, John A. DeNicola Jr., Melissa A. Sorce-DeNicola: Joseph P. Sorce, John A. DeNicola Jr., Melissa A. Sorce-DeNicola

728 West Nyack Road, West Nyack, NY • www.sorcefuneralhome.com • 845-358-4433728 West Nyack Road, West Nyack, NY • www.sorcefuneralhome.com • 845-358-4433

The place for all your landscape and hard-scape needs15 Horseshoe Dr., New City NY 10956 • 845-638-0208 • Fax 845-639-1626

Pat Maddamma • Email: [email protected] • Web Site: SuburbanGC.net Lic.#H-11750-A6-00-00

MAKIN WAVESHair & Nail Designfor Men & Women

75-B Lake Rd., Congers NY845-268-2748

www.makinwavesdesigns.com

NY Lic. #H-08515-A6

Handyman SolutionsLicensed & Insured

Interior & Exterior PaintingKitchen & Bathroom Remodeling

Sheet Rocking & Taping • Tiling & CabinetryDeck Refi nishing • Windows, Doors, Etc.

I’m the solution for the jobs you don’t have time for.

No job too small

(845) 323-1565HandymanSolutionsNY

Jean “JP” Endres, GRI

845-634-4202 - Offi ce | 914-729-4196 - Cell | [email protected] - Email www.randrealty.com

268 South Main St., New City, NY 10956

“If You’re thinking about a career in Real Estate call “If You’re thinking about a career in Real Estate call the #1 company in Rockland County.”the #1 company in Rockland County.”

• residential • commercial • industrial • We Provide Containers for

Cardboard & Paper RecyclingDaily • Weekly • Monthly

Service AvailableP.O. Box 495, Valley Cottage, NY 10989Tel: 845-268-5747 • Fax 845-268-0352

Family Restaurant & Pizzeria Specializing in Authentic Old Fashioned Italian Favorites

Gourmet Style Pizza & Calzones482 Kings Highway, Valley Cottage, NY

Catering Availablefor All Occasions 268-5291268-5291

KEVIN’S ACE REPAIR

52 Main St. Nyack

845.358.4975

845.358.011895 W. Nyack Way • W. Nyack, NY

SPECIALISTS INALL TYPES FENCING

CHAIN LINKWOOD

GUIDE RAILWHOLESALE • RETAIL

N O WH I R I N G

School Bus DriversPETER BREGA, INC.

AM and/or PM845-268-6107www.PeterBregaInc.com

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg

y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis

cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm o

echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n

acturing - Chemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens

dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans

ortation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker

CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia

ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforcforcforcforcforceement, Public Safety - O

To all those nforcement, Public Sanforcement, Public Sa

essentiallture - Energylture - EnergyWater aste TraWater aste Tra

workerscs - Public Wors - Public WorCommunicatioCommunicatio

keeping echnology Wochnology Woovernment Wovernment W

us safe,acturing Caterials Finanaterials Finan

yournicationnicationWorkerWorke

service isovernment Workovernment Workacturing Chemacturing Chem

invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar

ment, Public Safety - OSafety - Othan

k yo

u

g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tettttttttttteee Transportation & Log

cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCCoCCoCCoCooCCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicaticatcaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim

echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering

their vehicle to make sure it is the car they are supposed to enter.

In Remembrance of Samantha Josephson

#WHATSMYNAME

This Space is Available!800-333-3166 ext. 161

or visit www.jppc.net

Page 12: Sept. 13, 2020 24th Sunday in Ordinary Time · 9/9/2020  · 8:30 AM Lina Pavan — Anniversary 8:15 AM ♦♦ Friday Sept. 18, 2020 Friday Sept. 18, 2020 6:30 AM Virginia Cufuni

438 St. Paul - St. Ann (B) X John Patrick Publishing Company 1-800-333-3166 • www.jppc.net

Stephen Giordano, D.D.S.General Dentistry

Orthodontics / Endodontics217 Route 303Valley Cottage, NY 268-6088

Auto, Home, Business, LifeAuto, Home, Business, Life1 Lake Road • Congers, NY 10920 • (845) 268-7000

ANTONIO F. REDAATTORNEY AT LAW

Estate Planning & Administration • Wills & Trusts

Tax • Real Estate • Corporate

[email protected]

82 Maple Avenue • New City, NY 10956

GREG’S AUTO BODYGREG’S AUTO BODYQuality Auto Body WorkQuality Auto Body Work

• FREE ESTIMATES •268-7656268-7656

160 N. Rt. 9W • CongersGreg Zurla

Kevin STOKESExcavating, Inc.•Specialty pipe contractor•Sewer, water, drainage, waterproofi ng•Sump pump diversions

845-735-4096Lic.#H-07827-10

Rockland CemeteryPre-need grave burial sites Pre-need grave burial sites and columbarium niches for and columbarium niches for cremains are availablecremains are available201 Kings Hwy. Sparkill, NY 10965 845-359-0172 A inal resting place of rustic beauty

[email protected] www.rocklandcemetery.org

Energized Electric, Inc.Energized Electric, Inc.LICENSED &

FULLY INSURED

845-268-2300845-268-2300Tom Fredeman, Jr. ~ Parish Member

Residential • Commercial

Keith R. TaylorBrian J. Knecht

Shaun M. Cassidy~ Parishioners of Saint Ann’s ~Independently Owned & Operated • 358-0573

www.hannemannfuneralhome.com

H F H , I .88 South Broadway, Nyack, New York 10960

$10 OFFCarving a New Experience®

*Valid during lunch or dinner for up to 8 guests, Sun-Thurs. Not valid with

any other offer, on holidays, or on discounted children’s pricing. Drinks, dessert, tax and gratuity not included.

West Nyack location only. Expiration 10/31/18.

Palisades Center845.727.1313

*Valid during lunch or dinner for up to

8 guests. Sun.-Thurs. Not vailid with

any other off er, on holidays, or on

discounted children’s pricing. Drinks,

dessert, tax and gratuity not included.

West Nyack location only.

Expiration 5/1/20

The Red BarnCome home to your discount furniture store

No Credit/Bad Credit/No Problem Kornerstone Financial

www.myredbarnfurniture.com845-352-2550Parishioner of St. Paul’s

TRAVIS MONUMENTSTRAVIS MONUMENTS Est. 1899Specialists in Mausoleums & Monuments

Expert Service, Cleaning & Repair5 Generations of Expertise

Quality Monuments for All Cemeteries, Nationwide.

866-6-TRAVIS866-6-TRAVIS

Joseph P. DamontiGeneral Manager

Respect. Respect. Value. Value.

Simplicity.Simplicity.

100% Service Guarantee™ • 24 Hour Compassion HelplineSM • Prearranged Service (Nationally Transferable)

MICHAEL J. HIGGINSMICHAEL J. HIGGINSFUNERAL SERVICE, INC.FUNERAL SERVICE, INC.

113 Lake Road East, Congers268-6665268-6665

321 S. Main St., New City 634-6110634-6110

Route 9 W., Stony Point786-3500786-3500

176 Main St., Nyack, NY1-800-368-3628 • (845) 358-2544

www.tappanzeefl orist.net

Delivery Anywhere

Flowers For All OccasionsA

Plots AvailableGreat Locations

Starting at $1,350Call 845-358-0012

[email protected] North Highland Ave., Nyack, NY 10960

Our Services:• Baby Nurses• Nanny• Senior Caregivers• Companions• Housekeepers• Live-in or live-out

Lydia Velez-ArlottaAdministrator

Serving Tri State Area:New York, New Jersey

and Connecticut

[email protected]

All Work Guaranteed • Computerized Paint Booth • Lease Return Specialists

191 North Rt. 9W, Congers, NY 845-268-1790

Frank [email protected]@

845/268/9752845/268/9752

73 LAKE ROAD73 LAKE ROADCONGERS, NYCONGERS, NY

Designers andManufacturers

of Fine Jewelry

www.bourgholbrosjewelers.com

See what colorcan do for you!

John Patrick Publishing

800-333-3166

to advertise in color, please call us at

Regina CarmelNYSRE Associate BrokerNJSRE Sales Associate

(845) [email protected]

www.reginacarmel.randrealty.com

“A House is not a Home until it’s Your Own!”


Recommended