+ All Categories
Home > Documents > Sept. 20, 2020 25th Sunday in Ordinary Time...2 ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday...

Sept. 20, 2020 25th Sunday in Ordinary Time...2 ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday...

Date post: 02-Oct-2020
Category:
Upload: others
View: 7 times
Download: 0 times
Share this document with a friend
12
Church of St. Paul Church of St. Ann 82 Lake Road West 16 Jefferson Street Congers, NY 10920 Nyack, NY 10960 [email protected] Parish Office: 82 Lake Road West, Congers, NY 10920 Phone: (845) 268-4464/-4465 Fax: -6790 Email: [email protected] Website: spasaparish.org You Tube: Spasa Parish Rev. Vladimir Chripko, C.O. Pastor Rev. Roman Dominik Palecko, C.O. Assistant Pastor Rev. Narisetty Arogya Raju, C.O., Parochial Vicar Rev. Joseph Kumar Narisetty, Parochial Vicar Rev. Maniraguha Jean Paul Ruriho, Assistant Rev. George Torok, C.O., Weekend Assistant S ST. PAUL ST. ANN Deacons Dominic Buonocore Mark Czerwinski, Director RCIA Luke Conroy, Director RCIA Charles DeGroat Gerald Fenton, Liturgy Coordinator Parish Office Hours 9:00 am-3:00 pm Monday-Friday Cemetery/Assistant to Pastor Lissette Diaz [email protected] Religious Education Program (845-268-5442) Email: [email protected] Carmen Hernandez Lissette Diaz St. Anthony-St. Paul School Dr. Anna Adams, Principal (845-623-2311); St. Anthony, grades 2 to 8 Jessica Perez, Asst. Principal (845-268-6506) St. Paul, PreK/UPK, Kindergarten, Gr. 1 Music Ministry Vincent Green Sunday Masses Saturday 5 pm Sunday 7:30 am 10 am (at St. Paul Church) 10 am (at Marydell Faith & Life Center) 12 pm, 6 pm Saturday 5:30 pm Sunday 8:45, 11:30 am Weekday Masses MondaySaturday 6:30 & 8:30 am MondaySaturday 7:30 am Streamed Mass Daily including Sunday 8:15 am at YouTube Channel SPASA Parish Confessions Saturdays 4:00-4:45 pm Anytime by request. Saturdays 4:30-5:15 pm Anytime by request. Sacrament of Baptism To schedule a Baptism at St. Paul or St. Ann please call the rectory at 845-268-4464. Baptism instruction classes are held the last Thursday of each month at 7 pm at the St. Ann School in Nyack. Please call the rectory to register. Sacrament of Marriage Engaged couples should contact the Rectory at least six months in advance in order to arrange for their participation in the marriage preparation program. Please email [email protected]. Anointing of the Sick If someone is homebound or in the hospital, please notify the Rectory. Arrangements can be made for the sick person to receive the Sacrament of the Anointing of the Sick. Holy Communion is brought to the homebound by our Ministers of Holy Communion. Sept. 20, 2020 25th Sunday in Ordinary Time
Transcript
Page 1: Sept. 20, 2020 25th Sunday in Ordinary Time...2 ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 19, 2020 Saturday Sept. 19, 2020 5:00 PM Helen Decolyse 5:30 PM Patricia & Charles

Church of St. Paul Church of St. Ann 82 Lake Road West 16 Jefferson Street Congers, NY 10920 Nyack, NY 10960

[email protected] Parish Office:

82 Lake Road West, Congers, NY 10920 Phone: (845) 268-4464/-4465 Fax: -6790

Email: [email protected] Website: spasaparish.org You Tube: Spasa Parish

Rev. Vladimir Chripko, C.O. Pastor Rev. Roman Dominik Palecko, C.O. Assistant Pastor

Rev. Narisetty Arogya Raju, C.O., Parochial Vicar ● Rev. Joseph Kumar Narisetty, Parochial Vicar Rev. Maniraguha Jean Paul Ruriho, Assistant Rev. George Torok, C.O., Weekend Assistant

SST. PAUL ST. ANN Deacons Dominic Buonocore

Mark Czerwinski, Director RCIA Luke Conroy, Director RCIA Charles DeGroat Gerald Fenton, Liturgy Coordinator

Parish Office Hours 9:00 am-3:00 pm Monday-Friday

Cemetery/Assistant to Pastor Lissette Diaz [email protected]

Religious Education Program (845-268-5442) Email: [email protected] Carmen Hernandez Lissette Diaz

St. Anthony-St. Paul School Dr. Anna Adams, Principal (845-623-2311); St. Anthony, grades 2 to 8 Jessica Perez, Asst. Principal (845-268-6506) St. Paul, PreK/UPK, Kindergarten, Gr. 1

Music Ministry Vincent Green

Sunday Masses

Saturday 5 pm Sunday 7:30 am 10 am (at St. Paul Church) 10 am (at Marydell Faith & Life Center) 12 pm, 6 pm

Saturday 5:30 pm Sunday 8:45, 11:30 am

Weekday Masses Monday—Saturday 6:30 & 8:30 am Monday—Saturday 7:30 am

Streamed Mass Daily including Sunday 8:15 am at YouTube Channel SPASA Parish

Confessions Saturdays 4:00-4:45 pm Anytime by request.

Saturdays 4:30-5:15 pm Anytime by request.

Sacrament of Baptism To schedule a Baptism at St. Paul or St. Ann please call the rectory at 845-268-4464. Baptism instruction classes are held the last Thursday of each month at 7 pm at the St. Ann School in Nyack. Please call the rectory to register.

Sacrament of Marriage Engaged couples should contact the Rectory at least six months in advance in order to arrange for their participation in the marriage preparation program. Please email [email protected].

Anointing of the Sick If someone is homebound or in the hospital, please notify the Rectory. Arrangements can be made for the sick person to receive the Sacrament of the Anointing of the Sick. Holy Communion is brought to the homebound by our Ministers of Holy Communion.

Sept. 20, 2020 25th Sunday in Ordinary Time

Page 2: Sept. 20, 2020 25th Sunday in Ordinary Time...2 ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 19, 2020 Saturday Sept. 19, 2020 5:00 PM Helen Decolyse 5:30 PM Patricia & Charles

2

ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 19, 2020 Saturday Sept. 19, 2020

5:00 PM Helen Decolyse 5:30 PM Patricia & Charles Westwater

Sunday Sept. 20, 2020 Sunday Sept. 20, 2020

7:30 AM Mario & Phylis Constanzo 8:45 AM Daniel Kirwan — Birthday

10:00 AM Pastor’s Intention Marydell Faith & Life Center

10:00 AM Margaret & Edward Bordas St. Paul’s Church

12:00 PM Gene Morris 6:00 PM Guiseppa Cutaia & Giuseppa Cartella Monday Sept. 21, 2020 Monday Sept. 21, 2020

6:30 AM Violeta V. Saulon 7:30 AM Maria Ramirez, Dr. Diana Ramirez & Daphne C. Ramirez

8:30 AM Virginia Cifuni 8:15 AM ♦♦ George Bryant Tuesday Sept. 22, 2020 Tuesday Sept. 22, 2020 6:30 AM Violeta V. Saulon 7:30 AM Natividad Contrastano (L) 8:30 AM Gene Morris 8:15 AM ♦♦ Pastor’s Intention

Wednesday Sept. 23, 2020 Wednesday Sept. 23, 2020

6:30 AM Violeta V. Saulon 7:30 AM Maria Ramirez, Dr. Diana Ramirez & Daphne C. Ramirez

8:30 AM Bridget Butler 8:15 AM ♦♦

Thursday Sept. 24, 2020 Thursday Sept. 24, 2020

6:30 AM Lelis Loria — Birthday 7:30 AM Nadine & Nathalie Auguste (L) 8:30 AM Edward & Rosemary Rigney 8:15 AM ♦♦ Pastor’s Intention Friday Sept. 25, 2020 Friday Sept. 25, 2020

6:30 AM Violeta V. Saulon 7:30 AM Marie Josee Joseph (L) — Birthday 8:30 AM Ernesto San Diego 8:15 AM ♦♦ Donovan, Carroll, Norris Families Saturday Sept. 26, 2020 Saturday Sept. 26, 2020

6:30 AM Jess Calungcagin — 5th Anniversary 7:30 AM Keith Wills (L) — Birthday

8:30 AM Jess Calungcagin — 5th Anniversary 8:15 AM ♦♦ Patricia & Charles Westwater

5:00 PM Loretta Sullivan 5:30 PM Maria Ramirez, Dr. Diana Ramirez & Daphne C. Ramirez

Sunday Sept. 27, 2020 Sunday Sept. 27, 2020

7:30 AM George & Elsie Trautwein 8:45 AM Keith Wills (L) — Birthday

10:00 AM Pastor’s Intention Marydell Faith & Life Center

12:00 PM Nicholas Cifuni — Birthday 6:00 PM Frances Nazzaro

Now you can now find out which masses are available for your special intentions and schedule them online. Go to our parish website, SPASAPARISH.ORG. On the homepage, click on the Mass Intentions box for instructions and access to the “Mass Intentions Booking” page. You may also reserve the sanctuary lamp at either church or at St. Ann’s Chapel. You can make your offering by credit card. Or you can call the parish office (845-268-4464) to schedule masses the traditional way and make your offering by credit card, cash, or check.

10:00 AM Alegre Ledesma St. Paul’s Church

8:15 AM ♦♦ 11:30 AM Richard Stokes

8:15 AM ♦♦ 11:30 AM People of the Parish

Second Collection for St. Joseph’s Seminary

Second Collection for Parish Food Cupboards

♦♦ NOTE: The 8:15 am masses are not public masses. They are livestreamed from different loca ons in our parish daily. You can watch on our parish YouTube channel SPASA PARISH. All previously scheduled 12:10 mass inten ons have been transferred to the 8:15 mass.

Page 3: Sept. 20, 2020 25th Sunday in Ordinary Time...2 ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 19, 2020 Saturday Sept. 19, 2020 5:00 PM Helen Decolyse 5:30 PM Patricia & Charles

3

TODAY The second collection will be for the St. Paul’s and St. Ann’s Food Cupboards.

Your donations will go toward providing food for local families who need our help.

PLEASE BE GENEROUS!

NEW WEBCAST SYSTEM AT ST. ANN’S In the beginning, when we first started to livestream from St. Ann’s Church, it was obvious that one of the biggest challenges was the sound quality. Being able to hear the words of mass is absolutely critical, and in our large church the laptop that served as our broadcasting system was hardly up to the job. We resorted to using the smaller St. Ann’s Chapel for most of our webcasts from Nyack.

But all that is changing now, thanks to a new, professional streaming system recently purchased for the church. It’s tied into the main sound system of the church and will provide much improved audio. The system also provides for livestreaming from multiple camera angles. It’s linked to two cameras permanently positioned in the church that can be programed to highlight different areas of the sanctuary during services. For example, for mass, we can start with a wide angle shot as the celebrant enters from the side and then switch to the podi-um for the readings and homily. We could then close in on the altar for the Proper of the Mass, show a closeup of the altar for the Elevation, cut back to the full altar shot for the rest of the mass, and finally return to the wide angle view as the priest exits.

All the audio and camera settings will be adjusted from the control station set up near the front of the church, on the left, in the pew near the Third Station of the Cross. This control station will also manage the content that appears on the large monitors that have been installed on the side of the church for Sunday mass. Now that we are no longer using missalettes, the plan is to display the read-ings, responses, and hymn lyrics on these screens.

We are in the early stages of learning how to use this system and there is a lot to learn, but soon we hope to have it operat-ing smoothly to provide the best possible experience for the members of our congregation watching from home.

Unfortunately, it was not possible to have a professional photographer at the ceremonies, but I’m sure you took plenty of photos. We’d love to display them in the bulletin for all the parish to see. Please text them to 201-739-4413 or email to lobrien56 @yahoo.com. You can send either a photo of the person who received Confirmation or

First Communion this weekend or a picture of the entire family. We’ll publish as many as we can and post the rest on our website. Thank you!

C ongratula ons to all the young people in

our parish who received the S C this weekend. May you always be empowered by the S G H S

WISDOM COURAGE

UNDERSTANDING RIGHT JUDGMENT

KNOWLEDGE REVERENCE

WONDER & AWE

Frs. Roman, Joseph, Raj, and Fr. Tom Kunnel from St. John’s in Piermont test the new equipment for livestreaming mass at St. Ann’s. Photo by Marie Olivier

CONGRATULATIONS TO ALL MEMBERS

OF OUR

ST. PAUL & ST. ANN SPANISH COMMUNITY

WHO ARE RECEIVING THE SACRAMENTS OF

First Communion and Confirmation THIS WEEKEND

Page 4: Sept. 20, 2020 25th Sunday in Ordinary Time...2 ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 19, 2020 Saturday Sept. 19, 2020 5:00 PM Helen Decolyse 5:30 PM Patricia & Charles

4

Are You “SURE” You’re a Registered Parishioner? Many times we meet people at church who attend mass, take part in events, or perhaps even have received their sacraments here. We’re so very glad you’re with us and part of our community. But that alone does not make you a parishioner. To be a member of the parish you have to REGISTER. Registering is very easy. You can register online at spasaparish.org or at the parish office. It only takes a few minutes. Everyone over the age of 18 is encouraged to register. Even if you’re an adult who received all your sacraments here as a child and still attend mass here, you need to register. Why register? First and foremost, it’s very important to register so we can serve your needs when, for example, you need a sponsor certification letter for Baptism or Confirmation. Also, to receive an acknowledgment of your donations for your income tax filing, you need to be registered so we have an official record of your giving over the year. So, please join us officially and register with the parish so we can meet all your needs now and in the future!

PARISH OF ST. PAUL & ST. ANN STAY CONNECTED with LATEST NEWS & UPDATES

OUR YOUTUBE CHANNEL SPASA PARISH Mass 7 days a week at 8:15 am Archived videos

OUR WEBSITE SPASAPARISH.ORG Photos, bulletins, mass schedules, events, and other parish information.

OUR MASS SCHEDULING APP SPASAMASS.ORG View available masses and schedule one online for a loved one or your special intention.

ONLINE GIVING TO OUR PARISH SPASAPARISH.CHURCHGIVING.COM Arrange for online giving. Support our parish and manage your giving online.

FLOCKNOTES Sign up to receive important emails or texts from the pastor and the Archdiocese.

STPAULS.FLOCKNOTE.COM/ or text STPC to 84576 from your phone

STANNNYACK.FLOCKNOTE.COM or text SACC to 84576 from your

phone

FROM THE RECTORY

GOAL PLEDGED PAID TO DATE

$1,241,500

$515,831 350 families

have pledged as of

Aug. 30, 2020

GOGOGOGOGOGOALALALALALAL

100%

PLPLPLPLPLEDEDEDEDEDGEGEGEGEGEDDDDD

102%

$1,266,370

PAPAPAPAPAPAPAIDIDIDIDIDIDID TTTTTTTOOOOOOO DATE

41.5%

INSTRUCTIONS FOR SPONSOR CERTIFICATION LETTER In order to receive a sponsor certification letter from the Parish of St. Paul & St. Ann, you must be an ACTIVE, REGISTERED PARISHIONER for 6 MONTHS. IF YOU ARE NOT OFFICIALLY REGISTERED AND DO NOT ATTEND MASS, YOU WILL NOT RECEIVE A LETTER.

The role of a sponsor is to lead a Christian life in a manner that faithfully fulfills the obligations of the Catholic faith. A sponsor must be living the Catholic faith and be able to be part of the sponsored person’s life after the Baptism, who can guide him/her spiritually. A sponsor must also: • Be at least 16 years of age • Have received the Sacraments of Baptism, Eucharist & Confirmation • If married, must be married according to the laws of the Catholic Church

75,018

Page 5: Sept. 20, 2020 25th Sunday in Ordinary Time...2 ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 19, 2020 Saturday Sept. 19, 2020 5:00 PM Helen Decolyse 5:30 PM Patricia & Charles

5

Memorial Intentions — Week of Sept. 20 Sanctuary Lamp (St. Paul) James McMenimon

Sanctuary Lamp (St. Ann)

Chapel (St. Ann)

300 CLUB WINNERS Congratulations to the Lucky Winners

of our AUGUST DRAWING!

#041 Imelda Katigbak #198 Joseph Hughes

#124 Santa D’Elia #272 Maureen O’Brien

PARISH COUNCIL Enrico Aberion, Ann Marie Blackwood, Hernan Caceres, Guy Gebbia, Vicki Gill, Marie Josee Joseph, Karin Lancellotti, Julie Lepore, Marie Lorenzi-ni, Dennis Lynch, Bernadette Masiello, Greg Moreau, George Strayton, Keith Taylor

FINANCIAL COUNCIL William Dailey, Carlos Hernandez

GENERATIONS The three genera ons of the Holy Family — Jesus, his parents, Mary & Joseph, and his grandparents, Ann & Joachim — are the subject of this work of art commissioned for the outdoor shrine we’ve planned for St. Ann’s Church in Nyack. We’re nearly halfway toward our goal of $50,000. So far, generous donors have given $23,955 toward this project. Please join us in making this shrine a reality. Please send your dona on, marked “statue,” to St. Paul & St. Ann’s Parish, 82 Lake Rd. West, Congers, NY 10920.

SPaSA Parish SUBSCRIBE ON AND HELP OUR PARISH REACH 1,000 SUBSCRIBERS.

MASS IS AVAILABLE ON YOUTUBE 7 DAYS A WEEK AT 8:15 AM, STREAMED FROM DIFFERENT

LOCATIONS IN OUR PARISH

Prayer for the Sick We pray that the sick of our parish, our relatives, and friends will experience God’s healing love, especially:

Please call the rectory (268-4464) to be placed on the list of those who need prayers in time of illness, or call with the names of any sick family members or friends. The name will remain on the list for 3 weeks and then be removed unless we hear from you that the person still needs our prayers.

SPASAMASS.ORG

You can find available masses and schedule them online at SPASAMASS.org. For the

me being, you’ll have to make the following adjustments:

For any 8:15 am streamed mass, select that day’s St. Ann’s 12:10 pm box

For a St. Ann’s Saturday 7:30 am mass, select the St. Ann’s Saturday 9 am box

For a St. Paul’s 8:30 am mass, select St. Paul’s 9:00 am box

For a St. Paul’s Saturday 6:30 am mass, select the St. Paul’s Saturday 7:30 am box

EMAIL FOR THE PASTOR [email protected]

BULLETIN DEADLINES Friday — the week before the bulletin is distributed at church Please send submissions to bulletinspasa @yahoo.com)

THE MASS BOOK

IS OPEN

You may now schedule masses for your inten ons through March 2021

Our Beloved Dead Please remember in your prayers our deceased

fellow parishioners, family, and friends.

Catherine Stack, Thomas Fico, Shirley Thorman, Michael Queenan, Alicia L. DeMogollon, Martin Gillan

Robert Rose, Dan Pfeiffer, Stephen Goeller, Madeline Dorangrichia, James O’Toole

Andrew Duggan, Evan Dalsass, Laura, John Barch, Laura Mazzacone, Kathryn Scarmato,

Emilia Raphael-Olivier, Carolyn Pagliuca, Michael Doria, Noah Diaz, Manuel Tucay

Page 6: Sept. 20, 2020 25th Sunday in Ordinary Time...2 ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 19, 2020 Saturday Sept. 19, 2020 5:00 PM Helen Decolyse 5:30 PM Patricia & Charles

6

SISTERS OF LIFE: HEALING AFTER ABORTION Do you know someone who is carrying the grief of a past abortion? There is always hope. The pain and sorrow of abortion does not need to endure for a lifetime. A “Day of Prayer and Healing” offers the opportunity to experience the love and mercy of God and to respond to His invitation to begin the journey of healing. For upcoming dates, loca-tions, and confidential registration, or just to talk to a Sis-ter, please call the Sisters of Life at (866)-575-0075 (toll free) or by email at [email protected].

SINCE THE RETURN TO PUBLIC WORSHIP many parishes have chosen to avoid singing hymns in an effort to reduce the amount of congregational singing. This workshop, sponsored by the Archdiocese of NY, is for parish musicians, pastors, or anyone who wants to learn more about ways to introduce new musical forms to your parish’s Sunday mass.

Visit the SJR campus, meet faculty, staff and coaches, speak with teachers and students

and learn about our academic and athletic programs, scholarships, and financial aid.

Discover what makes

St. Joseph Regional High School a unique high school experience

SUNDAY, SEPT. 27 at 11 am

Reserve your spot online, SJRNJ.ORG 240 Chestnut Ridge Road, Montvale, NJ 07645

MUSIC DURING THE PANDEMIC: ARCHDIOCESE OF NY MUSICIAN ONLINE ROUNDTABLE On Thursday, Oct. 15, from 7 pm to 8:30pm, the Office of Liturgy will host an online webinar to discuss musicians’ experiences of providing sung liturgy during this time of returning to public worship. Topics to be explored will include the latest scientific findings on singing and the transmission of COVID-19 virus, a reflection on the expe-rience of implementing the archdiocesan guidelines on sacred music, and a sharing of “best practices.” Panelists will be members of the archdiocesan Music Commission. $15. Sign up at Eventbrite.com. Search for: Music During the Pandemic.

Bap sm is God’s most beau ful and magnificent gi . Congratula ons to newly bap zed Teagan Amber Hughes, her parents, Sandra and Pauric, and her godparents, Marissa Chomycz and Thomas Hughes. Teagan was bap zed on Sept. 13 at St. Paul’s Church by Deacon Luke Conroy. Photo by Deacon Luke Conroy

Page 7: Sept. 20, 2020 25th Sunday in Ordinary Time...2 ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 19, 2020 Saturday Sept. 19, 2020 5:00 PM Helen Decolyse 5:30 PM Patricia & Charles

7

Soul Exercises – Pursuit of Contemplative Silence Are you looking for a way to increase inner tranquility, decrease stress, have more control over your own life, and deepen your relationship with God?

Find all this and more in Silence: Silence is the great Revelation, and it is transforming.

Father George Torok, C.O., will hold a seminar on the pursuit of Silence. The seminar will consist of four group exercise sessions held at Hallel in Sparkill, NY. In addition, if you cannot attend in person, the sessions will be livestreamed.

There will be two seminars:

Fall 2020: Oct. 4 & 18 and Nov. 8 & 22 from 6 to 7:30 pm

Winter 2021: Jan. 10 & 24 and Feb. 14 & 28 from 6 to 7:30 pm

This is not a lecture series, but a group exercise experience. The sessions are free, but you MUST reserve your place. Kindly email [email protected] or register online at spiritwellsprings.com.

First Holy Communion

at St. Paul & St. Ann’s

Sept. 12, 2020

More on pages 8 & 9

This year, enjoy the Concert to benefit One to One Learning from the comfort of your home or favorite hangout. Invite a few friends to watch with you and enjoy a fun afternoon while you support a great cause. Tickets are $30 and each one gives you a chance in our raffle for gift cards to favorite local restaurants. Please send your donation to the address below with your name, address, phone number and email address — or donate online at one2one-learning.org. You will receive information about how to connect to the concert. Star-Fest XI Tickets, One to One, 640 N. Midland Ave., Nyack, NY 10960.

Page 8: Sept. 20, 2020 25th Sunday in Ordinary Time...2 ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 19, 2020 Saturday Sept. 19, 2020 5:00 PM Helen Decolyse 5:30 PM Patricia & Charles

8

MORE ARE COMING!

We have more photos of our First Communi-cants and we’ll be displaying them here next week.

Later, all photos will be posted on our website SPASAPARISH.ORG.

Page 9: Sept. 20, 2020 25th Sunday in Ordinary Time...2 ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 19, 2020 Saturday Sept. 19, 2020 5:00 PM Helen Decolyse 5:30 PM Patricia & Charles

9

FROM THE PASTOR’S DESK

T he coronavirus pandemic has dras cally changed the world we live in. Worry is taking its toll, and most people are

worried about ge ng COVID-19. People worry about their future, their jobs, their health, their finances, their children, family, and safety. Worry is contagious — it spreads gloom everywhere, taking the joy out of today and the strength out of tomorrow. But worry is absolutely useless. It never dried a tear, li ed a burden, or solved a problem. At its worst, it can destroy us. Have you ever thought about what it would take for you to become worry-free? The answer is simple, yet deeply profound. It’s an answer given by the Lord Jesus Christ Himself: “Have faith in God.” (Mark 11:22) Three mes in the Sermon on the Mount, Lord Jesus said, “do not worry about . . . ” (Ma hew 6:25-33). Jesus illustrates God’s in mate care for His creatures: “Look at the birds of the air: they neither sow nor reap nor gather into barns, and yet your heavenly Father feeds them. Are you not of more value than they?” And why do you worry about clothes? Consider the lilies of the field. See how they grow. If God makes what grows in the field so beau ful, what do you think he will do for you? If we trust God, worry will be replaced by faith and the knowledge that God will provide for us. Remember, faith focuses us upon God, but worry and depression cause you to focus inward upon your own emo ons and needs. Worry is a warning light that there’s an area in your life that you haven’t fully given over to God. When you love something more than God, it becomes a source of stress and anxiety in your life — even good things, like your marriage, your children, and your work. Worry is a sign of an unhealthy rela onship with God. You need to see Him as a loving father who may allow you to experience life’s difficul es, but who always takes care of you. Instead of worrying, choose faith. And the only way to increase your faith is to seek God and start praying. Jesus says in John 14:1, “Let not your hearts be troubled. Believe in God; believe also in Me.” St. Peter says, “Give all your worries and cares to God, for He cares about you,” (1 Peter 5:7). God is big enough and strong enough to handle all your worries. You could say this beau ful prayer wri en by Reinhold Niebuhr in 1943. It is called the Serenity Prayer: “God grant me the serenity to accept the things I cannot change; cour-age to change the things I can; and wisdom to know the difference.” From Your Priests

Stop Worrying, Start Praying

Photos courtesy of Nancy Conroy, Carmen Hernandez & First Communicant Families

Page 10: Sept. 20, 2020 25th Sunday in Ordinary Time...2 ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 19, 2020 Saturday Sept. 19, 2020 5:00 PM Helen Decolyse 5:30 PM Patricia & Charles

438 St. Paul - St. Ann (3) X John Patrick Publishing Company 1-800-333-3166 • www.jppc.net

Breakfast & LunchCongers Colonial Plaza285 Route 303

267-2656267-2656Fax: 267-2532Fax: 267-2532

Rockland Bakery Deli94 Demarest Mill Rd., Nanuet, NY 10954

845-623-1115Boar’s Head Provisions • Catering For All Occasions

Fresh Hot Specials Made DailyMon.-Sat. 6am-8pm • Sun. 6am-5pm

BMC & SonPlumbing & Heating

10% Discount When You Mention This Ad

Parishioner of St. Paul/St. Ann

Hot Water Heaters •BoilersSump Pumps • Water Filters

Lic. # 862

845-268-0992 • www.BMCrockland.com

-KING OF PIZZA-

TURIELLO’SITALIAN PIZZERIA & RESTAURANT

PIZZA • PASTA • CHICKEN • VEAL • SEAFOOD • HOT & COLD SUBSOPEN 7 DAYS OPEN 7 DAYS (845) 358-5440 FREE DELIVERY FREE DELIVERY

76 Main Street (Corner of Broadway) • Nyack, NY 1096076 Main Street (Corner of Broadway) • Nyack, NY 10960

Nino & RosaCatering For All Occasions

Gift Certifi catesGluten Free

Pizza & PastaGelato

CelebratingOver

35 Year

Tolstoy Tolstoy FoundationFoundationRehabilitationRehabilitation&Nursing CenterNursing Center

Dorothy Corbett, Administrator / Acting CEO

100 Lake Road • Valley Cottage100 Lake Road • Valley CottageNew York, 10989New York, 10989

845-268-6813 ex 112 • [email protected]

Licensed & InsuredLicensed & InsuredCall Now for Free Estimate: 845-267-0076Call Now for Free Estimate: 845-267-0076www.superiorlawnsandlandscaping.comwww.superiorlawnsandlandscaping.com

476 Christian Herald Rd., Valley Cottage, NY 10989 www.nyackridge.com

Nestled in a quiet & tranquil country setting in the heart of Rockland County, Nyack Ridge Rehabilitation & Nursing Center is a

foremost provider of subacute rehab & long term care.

Rated 5 stars & highly

regarded in the community.

Volunteers Needed:Call Josa Andalora, CTRS

Tel. # 845-268-6861 ext. 246 | [email protected]

Admissions Director:Jessica Chardonnette, MS

Tel. #845-268-6861, ext. 205 | [email protected]

“Committed To Quality & Freshness”Fresh Louisiana Cajun Seafood • SUSHI

Now off ering “ALL YOU CAN EAT SUSHI” everyday, with pricing of $22.99 per person

on weekdays & $24.99 on weekends. Nyack Location Open Six Days (Closed Mon.) For Lunch & Dinner

Suff ern Location Open Seven Days For Lunch & Dinner Ask About Our Catering, Take-Out & Delivery Services

2 LocationsNyack • 125 Main St. • 845-643-8888

Suff ern • 8 N. Airmont Rd. • 845-547-2326

BUILD YOUR COMMUNITY!

SHOP LOCAL

Patronize the Adve isers who make this bulletin possible!

CAN IN CASH OUT845-323-1865

BOTTLE REDEMPTION CENTER

We accept ALL NYS BottlesChurch Fund Raisers Available

25 N Middletown Roadin Rockland Plaza in

rear of StarbucksNext to Westrock Pools

PROFENNA AND DEBELLISPROFENNA AND DEBELLIS CPAS PCCPAS PC

INDIVIDUAL & CORPORATETAX PREPARATION

251 WEST NYACK ROADWEST NYACK, NY

845-623-8555845-623-8555

ValentineValentineElectric Inc.

(845) 398-1339(845) 398-1339NEW YORK CITYNEW YORK CITY

ROCKLAND • NEW JERSEYROCKLAND • NEW JERSEY

WESTCHESTER,WESTCHESTER, CT, VERMONT CT, VERMONT

374 Greenbush Road.374 Greenbush Road.Blauvelt, NY 10913Blauvelt, NY 10913Licensed & InsuredLicensed & Insured

Commercial Rates are at an All Time Low.

Contact us today to get a free analysis to see

if we can help Save you money with your

monthly payments on your commercial property.

Multi-Family, Retail, Offi ce Building, Apartment

and Condos. Can close in as little as 45 days! Four

season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600

Philadelphia, PA 19103

Page 11: Sept. 20, 2020 25th Sunday in Ordinary Time...2 ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 19, 2020 Saturday Sept. 19, 2020 5:00 PM Helen Decolyse 5:30 PM Patricia & Charles

Residential, Commercial, Real Estate Cleanings & New Constructions CleaningsGenerous Senior Citizen Discount • Cleaning For A Cause Program

Military, Firefi ghter, EMS & Police Offi cer Discounts ~ We Appreciate YouOrganic Cleaning Products Available

Weekly, Bi-Weekly, Monthly and Seasonal Service Optionswww.DutchmenCleaningUSA.com(845) 742-9592

Serving Rockland & Bergen Counties For Over 20 Years

438 St. Paul - St. Ann (I) X John Patrick Publishing Company 1-800-333-3166 • www.jppc.net

JOSEPH W. SORCE FUNERAL HOME, INC.JOSEPH W. SORCE FUNERAL HOME, INC.Family Owned & Operated for over 50 years Our Family Serving Your FamilyFamily Owned & Operated for over 50 years Our Family Serving Your Family

FUNERAL DIRECTORSFUNERAL DIRECTORS: Joseph P. Sorce, John A. DeNicola Jr., Melissa A. Sorce-DeNicola: Joseph P. Sorce, John A. DeNicola Jr., Melissa A. Sorce-DeNicola

728 West Nyack Road, West Nyack, NY • www.sorcefuneralhome.com • 845-358-4433728 West Nyack Road, West Nyack, NY • www.sorcefuneralhome.com • 845-358-4433

The place for all your landscape and hard-scape needs15 Horseshoe Dr., New City NY 10956 • 845-638-0208 • Fax 845-639-1626

Pat Maddamma • Email: [email protected] • Web Site: SuburbanGC.net Lic.#H-11750-A6-00-00

MAKIN WAVESHair & Nail Designfor Men & Women

75-B Lake Rd., Congers NY845-268-2748

www.makinwavesdesigns.com

NY Lic. #H-08515-A6

Handyman SolutionsLicensed & Insured

Interior & Exterior PaintingKitchen & Bathroom Remodeling

Sheet Rocking & Taping • Tiling & CabinetryDeck Refi nishing • Windows, Doors, Etc.

I’m the solution for the jobs you don’t have time for.

No job too small

(845) 323-1565HandymanSolutionsNY

Jean “JP” Endres, GRI

845-634-4202 - Offi ce | 914-729-4196 - Cell | [email protected] - Email www.randrealty.com

268 South Main St., New City, NY 10956

“If You’re thinking about a career in Real Estate call “If You’re thinking about a career in Real Estate call the #1 company in Rockland County.”the #1 company in Rockland County.”

• residential • commercial • industrial • We Provide Containers for

Cardboard & Paper RecyclingDaily • Weekly • Monthly

Service AvailableP.O. Box 495, Valley Cottage, NY 10989Tel: 845-268-5747 • Fax 845-268-0352

Family Restaurant & Pizzeria Specializing in Authentic Old Fashioned Italian Favorites

Gourmet Style Pizza & Calzones482 Kings Highway, Valley Cottage, NY

Catering Availablefor All Occasions 268-5291268-5291

KEVIN’S ACE REPAIR

52 Main St. Nyack

845.358.4975

845.358.011895 W. Nyack Way • W. Nyack, NY

SPECIALISTS INALL TYPES FENCING

CHAIN LINKWOOD

GUIDE RAILWHOLESALE • RETAIL

N O WH I R I N G

School Bus DriversPETER BREGA, INC.

AM and/or PM845-268-6107www.PeterBregaInc.com

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg

y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis

cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm o

echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n

acturing - Chemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens

dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans

ortation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker

CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia

ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforcforcforcforcforceement, Public Safety - O

To all those nforcement, Public Sanforcement, Public Sa

essentiallture - Energylture - EnergyWater aste TraWater aste Tra

workerscs - Public Wors - Public WorCommunicatioCommunicatio

keeping echnology Wochnology Woovernment Wovernment W

us safe,acturing Caterials Finanaterials Finan

yournicationnicationWorkerWorke

service isovernment Workovernment Workacturing Chemacturing Chem

invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar

ment, Public Safety - OSafety - Othan

k yo

u

g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tettttttttttteee Transportation & Log

cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCCoCCoCCoCooCCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicaticatcaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim

echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering

their vehicle to make sure it is the car they are supposed to enter.

In Remembrance of Samantha Josephson

#WHATSMYNAME

This Space is Available!800-333-3166 ext. 161

or visit www.jppc.net

Page 12: Sept. 20, 2020 25th Sunday in Ordinary Time...2 ST. PAUL’S CHURCH ST. ANN’S CHURCH Saturday Sept. 19, 2020 Saturday Sept. 19, 2020 5:00 PM Helen Decolyse 5:30 PM Patricia & Charles

438 St. Paul - St. Ann (B) X John Patrick Publishing Company 1-800-333-3166 • www.jppc.net

Stephen Giordano, D.D.S.General Dentistry

Orthodontics / Endodontics217 Route 303Valley Cottage, NY 268-6088

Auto, Home, Business, LifeAuto, Home, Business, Life1 Lake Road • Congers, NY 10920 • (845) 268-7000

ANTONIO F. REDAATTORNEY AT LAW

Estate Planning & Administration • Wills & Trusts

Tax • Real Estate • Corporate

[email protected]

82 Maple Avenue • New City, NY 10956

GREG’S AUTO BODYGREG’S AUTO BODYQuality Auto Body WorkQuality Auto Body Work

• FREE ESTIMATES •268-7656268-7656

160 N. Rt. 9W • CongersGreg Zurla

Kevin STOKESExcavating, Inc.•Specialty pipe contractor•Sewer, water, drainage, waterproofi ng•Sump pump diversions

845-735-4096Lic.#H-07827-10

Rockland CemeteryPre-need grave burial sites Pre-need grave burial sites and columbarium niches for and columbarium niches for cremains are availablecremains are available201 Kings Hwy. Sparkill, NY 10965 845-359-0172 A inal resting place of rustic beauty

[email protected] www.rocklandcemetery.org

Energized Electric, Inc.Energized Electric, Inc.LICENSED &

FULLY INSURED

845-268-2300845-268-2300Tom Fredeman, Jr. ~ Parish Member

Residential • Commercial

Keith R. TaylorBrian J. Knecht

Shaun M. Cassidy~ Parishioners of Saint Ann’s ~Independently Owned & Operated • 358-0573

www.hannemannfuneralhome.com

H F H , I .88 South Broadway, Nyack, New York 10960

$10 OFFCarving a New Experience®

*Valid during lunch or dinner for up to 8 guests, Sun-Thurs. Not valid with

any other offer, on holidays, or on discounted children’s pricing. Drinks, dessert, tax and gratuity not included.

West Nyack location only. Expiration 10/31/18.

Palisades Center845.727.1313

*Valid during lunch or dinner for up to

8 guests. Sun.-Thurs. Not vailid with

any other off er, on holidays, or on

discounted children’s pricing. Drinks,

dessert, tax and gratuity not included.

West Nyack location only.

Expiration 5/1/20

The Red BarnCome home to your discount furniture store

No Credit/Bad Credit/No Problem Kornerstone Financial

www.myredbarnfurniture.com845-352-2550Parishioner of St. Paul’s

TRAVIS MONUMENTSTRAVIS MONUMENTS Est. 1899Specialists in Mausoleums & Monuments

Expert Service, Cleaning & Repair5 Generations of Expertise

Quality Monuments for All Cemeteries, Nationwide.

866-6-TRAVIS866-6-TRAVIS

Joseph P. DamontiGeneral Manager

Respect. Respect. Value. Value.

Simplicity.Simplicity.

100% Service Guarantee™ • 24 Hour Compassion HelplineSM • Prearranged Service (Nationally Transferable)

MICHAEL J. HIGGINSMICHAEL J. HIGGINSFUNERAL SERVICE, INC.FUNERAL SERVICE, INC.

113 Lake Road East, Congers268-6665268-6665

321 S. Main St., New City 634-6110634-6110

Route 9 W., Stony Point786-3500786-3500

176 Main St., Nyack, NY1-800-368-3628 • (845) 358-2544

www.tappanzeefl orist.net

Delivery Anywhere

Flowers For All OccasionsA

Plots AvailableGreat Locations

Starting at $1,350Call 845-358-0012

[email protected] North Highland Ave., Nyack, NY 10960

Our Services:• Baby Nurses• Nanny• Senior Caregivers• Companions• Housekeepers• Live-in or live-out

Lydia Velez-ArlottaAdministrator

Serving Tri State Area:New York, New Jersey

and Connecticut

[email protected]

All Work Guaranteed • Computerized Paint Booth • Lease Return Specialists

191 North Rt. 9W, Congers, NY 845-268-1790

Frank [email protected]@

845/268/9752845/268/9752

73 LAKE ROAD73 LAKE ROADCONGERS, NYCONGERS, NY

Designers andManufacturers

of Fine Jewelry

www.bourgholbrosjewelers.com

See what colorcan do for you!

John Patrick Publishing

800-333-3166

to advertise in color, please call us at

Regina CarmelNYSRE Associate BrokerNJSRE Sales Associate

(845) [email protected]

www.reginacarmel.randrealty.com

“A House is not a Home until it’s Your Own!”


Recommended