Short title: Intra-cluster and mutual regulation of AP2/ERFs · 54 NICOTINE2 (NIC2) ERF cluster....

1

Short title: Intra-cluster and mutual regulation of AP2/ERFs 1

Corresponding authors: Ling Yuan and Sitakanta Pattanaik, Department of Plant and Soil 2

Sciences and Kentucky Tobacco Research and Development Center, University of Kentucky, 3

Lexington, KY, USA. 4

Email: [email protected] and [email protected] 5

Phone: 859-257-4806; 859-257-1976 6

Fax: 859-323-1077 7 8

Title: 9

Mutually Regulated AP2/ERF Gene Clusters Modulate Biosynthesis of Specialized Metabolites in 10

Plants 11

Mutually regulated APETALA2/ETHYLENE RESPONSE FACTOR clusters modulate specialized 12

metabolite biosynthesis 13

14

Author names and affiliations: 15

aPriyanka Paul†,

aSanjay Kumar Singh†,

aBarunava Patra, *Xiaoyu Liu,

aSitakanta Pattanaik, and 16

a,bLing Yuan 17

aDepartment of Plant and Soil Sciences and the Kentucky Tobacco Research and Development 18

Center, University of Kentucky, 1401 University Drive, Lexington, KY 40546 USA 19

bKey Laboratory of South China Agricultural Plant Molecular Analysis and Genetic 20

Improvement, South China Botanical Garden, Chinese Academy of Sciences, Guangzhou, China 21

510650 22

23

*College of Life Sciences, Shanxi Agricultural University, Shanxi, China 030801 24

25

† These authors contributed equally to this work. 26

27

One-sentence summary: 28

Intra-cluster and mutual regulation of jasmonate-responsive transcription factor gene clusters is 29

evident in the biosynthesis of many plant specialized metabolites. 30

31

Plant Physiology Preview. Published on November 14, 2019, as DOI:10.1104/pp.19.00772

Copyright 2019 by the American Society of Plant Biologists

www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.

mailto:[email protected]

mailto:[email protected]

http://www.plantphysiol.org

2

Author contributions: 32

L.Y. and S.P. designed the research; P.P., S.K.S., B.P., X.L. and S.P. performed experiments; 33

P.P., S.K.S. and S.P. analyzed data; and P.P., S.K.S., S.P. and L.Y. wrote the paper. 34

35

Funding information: 36

This work is supported partially by the Harold R. Burton Endowed Professorship to L.Y. and by 37

the National Science Foundation under Cooperative Agreement no. 1355438 to L.Y. 38

39

ABSTRACT 40 41

APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) gene clusters regulate the 42

biosynthesis of diverse specialized metabolites, including steroidal glycoalkaloids in tomato 43

(Solanum lycopersicum) and potato (S. tuberosum), nicotine in tobacco (Nicotiana tabacum), and 44

pharmaceutically valuable terpenoid indole alkaloids (TIAs) in Madagascar periwinkle 45

(Catharanthus roseus). However, the regulatory relationships between individual AP2/ERF 46

genes within the cluster remain unexplored. We uncovered intra-cluster regulation of the C. 47

roseus AP2/ERF regulatory circuit, which consists of ORCA3, ORCA4, and ORCA5. ORCA3 48

and ORCA5 activate ORCA4 by directly binding to a GC-rich motif in the ORCA4 promoter. 49

ORCA5 regulates its own expression through a positive auto-regulatory loop, and indirectly 50

activates ORCA3. In determining the functional conservation of AP2/ERF clusters in other plant 51

species, we found that GC-rich motifs are present in the promoters of analogous AP2/ERF 52

clusters in tobacco, tomato, and potato. Intra-cluster regulation is evident within the tobacco 53

NICOTINE2 (NIC2) ERF cluster. Moreover, overexpression of ORCA5 in tobacco and of NIC2 54

ERF189 in C. roseus hairy roots activates nicotine and TIA pathway genes, respectively, 55

suggesting that the AP2/ERFs are functionally equivalent and are likely to be interchangeable. 56

Elucidation of the intra-cluster and mutual regulation of transcription factor gene clusters 57

advances our understanding of the underlying molecular mechanism governing regulatory gene 58

clusters in plants. 59



3

Keywords: AP2/ERF gene cluster, intra-cluster and mutual regulation of transcription factor 60

cluster, terpenoid indole alkaloids, nicotine, transcriptional regulation, Catharanthus roseus 61

(Madagascar periwinkle) 62

63

INTRODUCTION 64

Plants produce a vast array of bioactive specialized metabolites in response to various biotic and 65

abiotic stresses. Many specialized metabolites with nutritional and medicinal values are 66

beneficial to animals and humans. While significant progress has been made in discovering the 67

genes encoding key enzymes in biosynthesis of specialized metabolites, molecular regulatory 68

mechanisms controlling the metabolic pathways are insufficiently understood. Biosynthesis of 69

specialized metabolites is primarily regulated at the transcriptional level (Colinas and Goossens, 70

2018). The APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) family transcription 71

factors (TFs) have emerged as key regulators of specialized metabolite biosynthesis, including 72

nicotine in tobacco (Nicotiana tabacum) (Shoji et al., 2010; De Boer et al., 2011), terpenoid 73

indole alkaloids (TIAs) in Madagascar periwinkle (Catharanthus roseus) (van der Fits and 74

Memelink, 2000; Paul et al., 2017) and Ophiorrhiza pumila (Udomsom et al., 2016), artemisinin 75

in Artemisia annua (Yu et al., 2012; Lu et al., 2013), and steroidal glycoalkaloids (SGA) in 76

tomato (Solanum lycopersicum) and potato (S. tuberosum) (Cardenas et al., 2016; Thagun et al., 77

2016; Nakayasu et al., 2018). AP2/ERFs are subdivided into 12 phylogenetic groups (Nakano et 78

al., 2006). Several group IX AP2/ERFs form physically linked gene clusters that regulate 79

biosynthesis of specialized metabolites. TF gene clusters have been characterized in a limited 80

number of plant species, including tobacco (Shoji et al., 2010; Kajikawa et al., 2017), tomato 81

(Cardenas et al., 2016; Thagun et al., 2016; Nakayasu et al., 2018), potato (Cardenas et al., 82

2016), and C. roseus (Paul et al., 2017). The tobacco NICOTINE2 (NIC2) locus comprises at 83

least 10 AP2/ERFs that are homologous to the C. roseus ORCAs. Not all NIC2 ERFs are equally 84

effective in regulating nicotine biosynthesis; ERF189 and ERF221/ORC1 play major roles in 85

nicotine biosynthesis (Shoji et al., 2010; De Boer et al., 2011). The AP2/ERF-gene cluster in 86

tomato and potato comprise five and eight ERFs, respectively. GLYCOALKALOID 87

METABOLISM 9 (GAME9)/JASMONATE-RESPONSIVE ERF4 (JRE4), a member of the 88

AP2/ERF gene clusters in tomato and potato, is key to biosynthesis of SGAs and the upstream 89



4

isoprenoids. Knockdown, knockout, or overexpression of the GAME9 genes in tomato and potato 90

affect the SGA pathway gene expression and SGA production (Cardenas et al., 2016; Thagun et 91

al., 2016; Nakayasu et al., 2018). In C. roseus, the ORCA cluster consists of at least three 92

AP2/ERFs, ORCA3, ORCA4, and ORCA5, and of which ORCA3 and ORCA4 are known to 93

regulate the biosynthesis of the pharmaceutically valuable TIAs (Figure 1A) (van der Fits and 94

Memelink, 2000; Paul et al., 2017). 95

In addition to the group IX AP2/ERFs, TF gene clusters have been identified in the group III 96

AP2/ERFs, C-repeat Binding Factors (CBFs) (Gilmour et al., 1998; Zhang et al., 2004), Auxin 97

Response Factors (ARFs) (Hagen and Guilfoyle, 2002), R2R3 MYBs (Zhang et al., 2000; Zhang 98

et al., 2019) and basic helix-loop-helix (bHLH) factors (Sanchez-Perez et al., 2019). TF gene 99

clusters are likely originated from tandem gene duplication events (Shoji et al., 2010; Kellner et 100

al., 2015). Unlike the operon-like, non-homologous metabolic gene clusters (Boycheva et al., 101

2014; Nützmann and Osbourn, 2014; Nützmann et al., 2016), TF gene clusters encode 102

homologous TFs with overlapping or unique functions. It has been suggested that gene 103

duplication offers the opportunity for mutual regulation among the duplicated genes (Shoji et al., 104

2010); however, mutual regulatory relationships among the members of any TF cluster remained 105

unconfirmed. Furthermore, the ORCA, NIC2, and GAME9/JRE locus ERFs are phylogenetically 106

related and commonly respond to the phytohormone, jasmonic acid (JA), suggesting the 107

evolution of similar regulatory mechanism in diverse metabolic pathways (Shoji et al., 2010; 108

Thagun et al., 2016). Question thus arose as to whether AP2/ERFs from different clusters are 109

functionally equivalent and interchangeable. Elucidation of the mutual regulatory relationship 110

among the ERF gene clusters implies an evolutionarily conserved molecular mechanism that 111

controls the biosynthesis of functionally and structurally diverse specialized metabolites. 112

In this study, we discovered a regulatory relationship among the members of the ORCA cluster. 113

The direct activation of ORCA4 by ORCA3 and ORCA5, as well as self-regulation of ORCA5, 114

highlight the presence of feed-forward and auto-regulatory loops in the ORCA cluster. We also 115

demonstrated the intra-cluster regulation among the tobacco NIC2 ERFs. Moreover, ORCA5 116

overexpression in tobacco hairy roots upregulated nicotine biosynthetic genes and nicotine 117

accumulation, and reciprocal overexpression of NIC2 ERF189 in C. roseus hairy roots induced 118



5

the TIA biosynthetic genes, suggesting that the ORCAs and NIC2 ERFs are functionally 119

equivalent and are likely interchangeable. 120

RESULTS 121

Phylogenetic analysis positions ORCAs, GAME9, and NIC2 ERFs in the same clade 122

AP2/ERFs are divided into 12 groups based on domain structure and other conserved motifs. The 123

group IX AP2/ERFs are involved in phytohormone signaling and defense response (Nakano et 124

al., 2006). Phylogenetic analysis of group IX ERFs from tomato, tobacco, potato and C. roseus 125

showed that ORCAs are grouped together with NIC2 and GAME9 ERFs, which are involved in 126

nicotine and SGA biosynthesis in tobacco and tomato, respectively (Shoji et al., 2010; Cardenas 127

et al., 2016) (Supplemental Figure S1). Interestingly, this clade does not include ERFs from 128

Arabidopsis thaliana, suggesting that the ERFs in this clade are possibly evolved for the 129

biosynthesis of structurally complex specialized metabolites. 130

ORCA gene cluster is differentially induced by MeJA and ethylene 131

MeJA is a key elicitor of biosynthesis of a number of specialized metabolites, including nicotine 132

(Shoji et al., 2000), beta-thujaplicin (Zhao et al., 2004), artemisinin (Shen et al., 2016), taxol 133

(Mirjalili and Linden, 1996) and SGAs (Thagun et al., 2016; Nakayasu et al., 2018). Ethylene 134

(ET) acts synergistically with MeJA to promote biosynthesis of taxol in Taxus cuspidate 135

(Mirjalili and Linden, 1996), beta-thujaplicin in Cupressus lusitanica (Zhao et al., 2004), and 136

hydroxycinnamic acid amides (HCAAs) in Arabidopsis thaliana (Li et al., 2018), while ET 137

attenuates the effects of MeJA on nicotine and SGA biosynthetic pathway gene expression in 138

Nicotiana species (N. tabacum and N. attenuata) and tomato, respectively (Shoji et al., 2000; 139

Winz and Baldwin, 2001; Shoji et al., 2010; Nakayasu et al., 2018). In C. roseus, MeJA induces 140

expression of ORCA3, ORCA4, and ORCA5 as well as their targets (van der Fits and Memelink, 141

2000; Paul et al., 2017). To determine the effects of ET alone or in combination with MeJA on 142

ORCA gene expression, C. roseus seedlings were treated with MeJA, ACC, or both for 2h, and 143

transcript accumulation were measured by reverse-transcription quantitative PCR (RT-qPCR). 144

Expression of ORCA5 was induced 9.5-fold by MeJA but remained unaffected by ACC; 145

however, MeJA-induced expression of ORCA5 was attenuated in the presence of ACC, reduced 146

to 7.5-fold. Expression of ORCA4 and ORCA3 was induced 7 and 12 fold, respectively, by MeJA 147



6

and reduced to 0.2-0.3 fold by ACC (Figure 1B). Similar to ORCA5, MeJA-responsive 148

expression of ORCA4 and ORCA3 was reduced to 2.5 and 7-fold, respectively, in the presence of 149

ACC. Expression of STR and TDC, two key targets of ORCAs, and CrMYC2a, were induced 4, 150

12 and 5.7 fold, respectively, by MeJA treatment. The MeJA-induced expression was reduced to 151

2-4 fold in the presence of ACC (Fig 1B). In addition, we measured the TIA contents in 152

seedlings treated with MeJA and ACC either alone or in combination. MeJA induced, whereas 153

ACC repressed the accumulation of tabersonine and ajmalicine. Moreover, MeJA-induced 154

accumulation of tabersonine, but not that of ajmalicine, was attenuated by ACC. Accumulation 155

of catharanthine was reduced in MeJA or ACC-treated seedlings (Figure 1C). 156

ORCA5 is a nucleus-localized transcriptional activator 157

To determine the transactivation activity, ORCA3, ORCA4, or ORCA5, fused to the GAL4-158

DNA-binding domain (GAL4-DBD), were co-electroporated into tobacco protoplasts with a 159

luciferase reporter driven by a minimal CaMV 35S promoter with GAL4-responsive elements as 160

described previously (Paul et al., 2017). Transactivation activities of ORCA3, ORCA4, and 161

ORCA5 were 6.5, 6.6, and 12-fold, respectively, higher than the reporter-only control 162

(Supplemental Figure S2A). The significant inductions of reporter activity in plant cells suggest 163

that three ORCAs are transcriptional activators. To determine the sub-cellular localization, 164

ORCA5 coding sequence was fused in-frame to the enhanced green fluorescent protein (eGFP) 165

and expressed in tobacco protoplasts. Compared to the protoplasts expressing the eGFP-control, 166

in which GFP was detected throughout the cell, the ORCA5-eGFP fusion protein was localized 167

to the nucleus (Supplemental Figure S2B), consistent with its putative function as a TF. 168

ORCA4 and ORCA5 bind to the JRE in the STR promoter 169

We have shown that ORCA4 and ORCA5 activate the promoters of key TIA pathway genes, 170

including STR, TDC, and CPR in tobacco cells (Paul et al., 2017). A previous study has shown 171

that ORCA3 binds to the JRE in the STR promoter (Van Der Fits and Memelink, 2001). To 172

determine whether ORCA4 and ORCA5 also bind the same JRE in the STR promoter, we 173

performed electrophoretic mobility shift assay (EMSA). We purified the recombinant, 174

glutathione S-transferase (GST)-tagged ORCA3, ORCA4, ORCA5, (GST-ORCA3/4/5) and 175

CrMYC2a (GST-CrMYC2a) proteins from E. coli using GST affinity chromatography as 176



7

described previously (Paul et al., 2017; Patra et al., 2018) (Figure 2A; Supplemental Figure 3A). 177

CrMYC2a, which binds T/G-box motif, was used as a negative control. The purified ORCA3, 178

ORCA4, ORCA5 or CrMYC2a protein was incubated with a 5’ biotin-labeled probe covering the 179

JRE of the STR promoter. Similar to ORCA3, ORCA4 and ORCA5 also bind to the JRE, 180

resulting in a mobility shift (Figure 2B). The binding of GST-tagged ORCA5 to the JRE of the 181

STR promoter was further confirmed by competition using 10X, and 100X excess of the 182

unlabeled (cold) probe. The intensity of the signal decreased gradually with the increase of the 183

concentration of cold probe (Supplemental Figure 3B). As shown in Figure 2B, the unlabeled 184

probe, 1000-fold in excess, out-competed the labeled probe and abolished the signal, suggesting 185

the shifted-band was indeed the ORCA5-JRE complex. We thus used 1000X excess of the cold 186

probe for the competition experiments with ORCA3 and ORCA4, and, similar to ORCA5, the 187

cold probe completely abolished the signals on the gel, indicating the shifted-band was indeed 188

the ORCA3/ORCA4-JRE complex (Figure 2B). We did not detect any signal for CrMYC2a, 189

suggesting that CrMYC2a does not bind to JRE in the STR promoter (Supplemental Figure 3B). 190

ORCA TFs differentially activate TIA pathway genes 191

The ORCAs are known to regulate a number of genes of the indole pathway and downstream 192

branches (van der Fits and Memelink, 2000; Paul et al., 2017). In this study, we investigated 193

their roles in regulation of additional genes in the TIA pathway. Biosynthesis of secologanin in 194

C. roseus (Figure 1A) requires nine enzymes, seven of which involved in the conversion of 195

geranyl diphosphate (GPP) to loganic acid are regulated by BIS1 (Van Moerkercke et al., 2015) 196

and BIS2 (Van Moerkercke et al., 2016). Loganic acid is converted to secologanin by loganic 197

acid methyltransferase (LAMT) and secologanin synthase (SLS). We used protoplast-based 198

transactivation assay to determine whether LAMT and SLS are regulated ORCAs. The LAMT 199

(1376 bp) or SLS (980 bp) promoter, fused to a firefly-luciferase reporter gene, was co-200

electroporated into tobacco protoplasts with or without the constructs expressing ORCA3, 201

ORCA4, or ORCA5 (Figure 2C). ORCA3, ORCA4, and ORCA5 significantly activated the 202

LAMT promoter compared to the control. ORCA5, but not ORCA3 and ORCA4, significantly 203

activated the SLS promoter (approximately 2.5-fold) compared to the control (Figure 2C). 204

Derepressed CrMYC2a and ORCA5 have synergistic effects on TIA pathway genes 205



8

A recent study has shown that mutation of a conserved aspartic acid to asparagine (D126N) in 206

the JAZ-interaction domain (JID) of CrMYC2a prevents CrMYC2a from interacting with 207

CrJAZ3 and CrJAZ8, thus derepressing CrMYC2a from the inactive complex with the JAZ 208

proteins. In addition, coexpression of the derepressed CrMYC2a (CrMYC2aD126N

) with ORCA3 209

has synergistic effect on expression of several TIA pathway genes (Schweizer et al., 2018). To 210

determine whether the derepressed CrMYC2a acts synergistically with ORCA5, we generated 211

the CrMYC2aD126N

mutant by site-directed mutagenesis and evaluated its effect on four key TIA 212

pathway gene promoters, TDC, STR, LAMT and SLS, which are regulated by ORCA5. As shown 213

in Figure 3, CrMYC2a had no additive effect on the STR promoter activity when co-expressed 214

with ORCA5. The TDC, LAMT and SLS promoter activities were slightly higher when CrMYC2a 215

was co-expressed with ORCA5. However, coexpression of CrMYC2aD126N

with ORCA5 had 216

synergistic effect on activation of all four promoters (Figure 3). 217

ORCA5 overexpression activates TIA pathway genes and boosts TIA accumulation in C. 218

roseus hairy roots 219

To further elucidate the regulatory role of ORCA5 in TIA biosynthesis, we generated transgenic 220

C. roseus hairy roots overexpressing ORCA5 (ORCA5-OE). The transgenic status of hairy roots 221

was confirmed by PCR (Supplemental Figure 4A). Two empty vector (EV) control and two 222

overexpression lines (OE-1 and OE-2) were selected for further analysis. Compared to EV 223

control, expression of ORCA5 was 24-40 fold higher in the transgenic lines (Supplemental 224

Figure 4B). Expression of a number of TIA pathway genes, including ASα, TDC, CPR, G10H, 225

IS, SLS, STR, and SGD, were significantly higher in the ORCA5-overexpression lines compared 226

with the EV control. In addition, expression of the genes encoding C2H2 zinc finger repressors, 227

ZCT1, ZCT2, and ZCT3 were also increased. Interestingly, expression of ORCA3 and ORCA4 228

were increased significantly in ORCA5-overexpressing hairy roots, suggesting that ORCA5 229

possibly regulates other members in the ORCA cluster (Figure 4A). 230

Previous studies have shown that overexpression of ORCA3 in C. roseus hairy roots does not 231

result in increased TIA accumulation (Peebles et al., 2009; Wang et al., 2010; Zhou et al., 2010). 232

In this study, overexpression of ORCA5 significantly increased the transcripts levels of genes in 233

both indole (i.e. AS and TDC) and iridoid branches (i.e. CPR, G10H, IS, and SLS) of the TIA 234

pathway. In addition, expression of the downstream pathway genes, STR and SGD, were also 235



9

significantly increased. To determine the metabolic outcomes of ORCA5-overexpression, we 236

measured the alkaloids in the two independent hairy root lines. Accumulation of tabersonine, 237

ajmalicine, and catharanthine increased significantly in ORCA5-OE lines compared to the EV 238

lines (Figure 4B). 239

In C. roseus, tabersonine, ajmalicine, and catharanthine are detected in roots and aerial parts, 240

while vindoline is only accumulated in aerial parts (van der Heijden et al., 2004). Recent studies 241

have shown that four separate hydrolases (HL1 to HL4) are involved in the conversion of the 242

unstable intermediate derived from O-acetylstemmadenine to tabersonine by HL1, to 243

catharanthine by HL2, and to vincadifformine byHL3/4 (Qu et al., 2018; Qu et al., 2019) (Figure 244

1A). In roots, the tabersonine is converted to hörhammericine catalyzed by tabersonine 19-245

hydroxylase (T19H) (Giddings et al., 2011) and minovincinine 19-O-acetyltransferase (MAT) 246

(Laflamme et al., 2001). Recently, a BADH acetyltransferase, tabersonine derivative 19-O-247

acetyltransferase (TAT), has been characterized in C. roseus. TAT is highly expressed in roots, 248

and has been shown to acetylate 19-hydroxytabersonine derivatives from C. roseus roots at a 249

higher efficiency than MAT (Carqueijeiro et al., 2018). In addition, two conserved cytochrome 250

P450s, tabersonine 6,7-epoxidase isoforms 1 and 2 (TEX1 and TEX2), have been identified in C. 251

roseus. TEX1 is preferentially expressed in roots whereas TEX2 transcripts are present in stem, 252

leaf, and flower (Carqueijeiro et al., 2018). TEX1/2 catalyze the stereo-selective epoxidation of 253

tabersonine to lochnericine which is then converted to hörhammericine by T19H and 254

subsequently acetylated by TAT to form 19-O-acetylhörhammericine. In a parallel branch, a 255

root-specific cytochrome P450, vincadifformine 19-hydroxylase (V19H) catalyzes the 256

conversion of vincadifformine to minovincinine, which is then O-acetylated by MAT to form 257

echitovenine (Williams et al., 2019). We found that similar to other TIA pathway genes, 258

expression of HL2, HL4, T19H, TAT, MAT, and TEX2 was induced by 1.5 to 18 fold in MeJA-259

treated C. roseus seedlings (Figure 5A). However, we did not observe significant change in the 260

expression of HL1, HL3, V19H and TEX1 in response to MeJA treatment. Next, we measured the 261

expression of these genes in EV and ORCA5-OE hairy root lines and found that expression of 262

MAT and T19H was induced by 20-500 fold ORCA5-OE compared to EV (Figure 4A). 263

Expression of HL3, V19H, TEX1, TEX2, and TAT was also induced by 2-11 fold in the ORCA5-264

OE lines (Figure 5B), suggesting that these genes are likely regulated by ORCAs. In the ORCA5-265

OE lines, expression of HL1 and HL4 was slightly repressed whereas HL2 expression did not 266



10

change significantly. This is similar to a recent study where transient overexpression of ORCA3 267

and/or MYC2a in Catharanthus flower petal had no effect on HL1 and HL2 expression, indicting 268

that additional factors are involved in regulation of TIA pathway (Schweizer et al., 2018). 269

270

ORCA5 activates the ZCT3 promoter 271

ZCTs are negative regulators of TIA pathway (Pauw et al., 2004). In both ORCA4 (Paul et al., 272

2017) and ORCA5 overexpressing hairy root lines (Figure 4A), expression of ZCTs were 273

significantly increased. We analyzed the cis-elements in the ZCT promoters, and found that the 274

ZCT3 promoter contains putative AP2/ERF binding sites (GC-rich motif). The findings suggest 275

that ORCA5 regulates ZCT3 possibly by binding to its promoter, while indirectly regulating 276

ZCT1 and ZCT2. We thus tested the activation of ZCT3 by ORCAs. The ZCT3 promoter (961 bp) 277

was fused to a firefly-luciferase reporter gene and co-electroporated into tobacco protoplasts 278

with or without the constructs expressing ORCA3, ORCA4 or ORCA5 (Figure 5C). Only ORCA5 279

moderately but significantly activated the ZCT3 promoter compared to the control. To test 280

whether ORCA5 is regulated by ZCT3, ORCA5 promoter was fused to a firefly-luciferase 281

reporter gene and co-electroporated into tobacco protoplasts with or without the construct 282

expressing ZCT3. No significant repression of the ORCA5 promoter was observed (Figure 5D). 283

To demonstrate that ORCA5 activates ZCT3 likely by binding to its promoter, we performed 284

yeast one-hybrid (Y1H) assay. Plasmids expressing GAL4-AD-ORCA5 fusion, controlled by the 285

ADH promoter, and the HIS3 nutritional reporter driven by the ZCT3 promoter were co-286

transformed into yeast cells. Transformed yeast cells, harboring the ZCT3-HIS3 reporter and AD-287

ORCA5, grew on selection medium (-leu-trp-his) with 50 mM of 3-AT, indicating activation of 288

the ZCT3 promoter by ORCA5 (Figure 6A). 289

ORCA5 activates the ORCA4 promoter 290

Expression of both ORCA3 and ORCA4 were increased significantly in ORCA5-OE hairy root 291

lines (Figure 4A), indicating that ORCA5 possibly regulates the expression of ORCA3 and 292

ORCA4. To test this possibility, ORCA3 (778 bp), ORCA4 (883 bp), or ORCA5 (890 bp) 293

promoters, fused to a firefly-luciferase reporter, were co-electroporated into tobacco protoplasts 294

with or without the plasmids expressing ORCA3, ORCA4 or ORCA5. None of the ORCAs could 295

activate the ORCA3 promoter, suggesting the ORCAs are unable to bind to the promoter despite 296



11

the induction of ORCA3 in ORCA5-OE lines (Figure 6B). ORCA3 and ORCA5, but not ORCA4, 297

significantly activated the ORCA4 promoter (Figure 6C). In addition, ORCA5 activated its own 298

promoter compared to the control (Figure 6D). However, ORCA3 or ORCA4 had no effects on 299

transcriptional activity of the ORCA5 promoter (Figure 6D). The activation of ORCA4 by 300

ORCA3 and ORCA5, activation of ORCA3 and ORCA4 by ORCA5, and self-regulation of 301

ORCA5 allude to the possible presence of auto-regulatory and feed-forward loops in the ORCA 302

cluster. 303

ORCA3 and ORCA5 bind to the ORCA4 promoter 304

We identified a GC-rich motif (AGCCCGCCC) to be a putative AP2/ERF binding site in the 305

ORCA4 promoter and mutated it to AGCAAAACC by site-directed mutagenesis. The mutant 306

promoter, mORCA4-pro was fused to the luciferase reporter to generate a reporter vector. The 307

reporter vectors harboring the wild-type or mutant ORCA4 promoter were co-electroporated into 308

tobacco protoplasts with the plasmid expressing ORCA5. Mutation in the GC-rich motif reduced 309

activation of the ORCA4 promoter by ORCA5 (Figure 6C), suggesting that ORCA5 activates 310

ORCA4 likely by binding to the GC-rich motif in its promoter. 311

To further verify that ORCA3 and ORCA5 bind the GC-rich element in the ORCA4 promoter, we 312

performed Y1H assay. ORCA3 or ORCA5 fused to the GAL4-AD was co-transformed into yeast 313

cells with the HIS3 reporter driven by the ORCA4 promoter. Yeast cells, harboring the ORCA4-314

HIS3 reporter and AD-ORCA3 or AD-ORCA5, grew on selection medium (-leu-trp-his) with 50 315

mM of 3-AT, suggesting that ORCA3 and ORCA5 can activate the ORCA4 promoter (Figure 316

6A). 317

We also carried out EMSA to validate the binding of ORCA3 and ORCA5 to the GC-rich motif 318

in the ORCA4 promoter. Recombinant, GST-tagged ORCA3 or ORCA5 protein was purified and 319

incubated with 5’ biotin-labeled probes covering the GC-rich motif of the ORCA4 promoter. 320

Figure 6E shows that ORCA3 and ORCA5 proteins individually interacted with the GC-rich 321

motif, resulting in a mobility shift. The binding of ORCA3 and ORCA5 to the labeled probe was 322

confirmed by a competition experiment using unlabeled (cold) probes. The binding signals of the 323

biotin-labeled probes could be eliminated by excess concentrations (1000x) of cold probe (Figure 324

6E), suggesting that ORCA3 or ORCA5 binds to the GC-rich motif in the ORCA4 promoter. 325



12

GC-rich motifs are present in the promoters of AP2/ERF gene clusters in other plants 326

AP2/ERFs are known to bind the GC-rich motifs in target gene promoters (Fujimoto et al., 2000; 327

Shoji et al., 2013). Group IX ERFs bind differentially to three GC-rich motifs, P-box 328

(CCGCCCTCCA), CS1-box (TAGACCGCCT) and GCC-box (AGCCGCC) (Shoji et al., 2013). 329

A recent study has identified consensus sequence for GC-rich motifs 330

([A/C]GC[A/C]C[T/C][C/T]C) present in the promoters of nicotine biosynthetic genes in 331

tobacco (Kajikawa et al., 2017). In addition, ORCA3 and ORCA5 bind to a GC-rich motif 332

(AGCCCGCC; this study) in the ORCA4 promoter. The question thus arose whether GC-rich 333

elements are also present in the promoters of AP2/ERF gene clusters identified in other plant 334

species. To address this question, we manually searched for similar GC-rich motifs 335

approximately 1kb 5’ of the protein coding regions of NIC2 and GAME9 genes in tobacco, 336

tomato, and potato. Of the ten NIC2 promoters, two GC-rich sequences were found each of 337

ERF168, ERF115 and ERF179. Both tomato GAME9-like 1 (Solyc01g090300) and 2 338

(Solyc01g090310) contain a single GC-rich sequence, while potato GAME9-like 2, 3, 4, and 7 339

(Cardenas et al., 2016) contain several in their promoters (Supplemental Figure S5). 340

Intra-cluster and mutual regulation in AP2/ERF gene clusters 341

The conserved nature of the GC-rich elements in promoters of the AP2/ERF clusters alludes to 342

the possible intra-cluster regulatory mechanisms that are mutually shared among different plant 343

species. To test this possibility, the C. roseus ORCA4-promoter-luciferase reporter construct was 344

co-electroporated into tobacco protoplasts with or without the plasmids expressing tobacco 345

ERF189 or ERF221. Both tobacco ERF189 and ERF221 significantly activated the ORCA4 346

promoter compared to the control (Figure 7A). Similarly, tobacco ERF115 (1056 bp) or ERF179 347

(1070 bp) promoter-luciferase reporter construct was co-electroporated into tobacco protoplasts 348

with or without the construct expressing ERF189 or ORCA5. The activation of the ERF115 and 349

ERF179 promoters by ERF189 or ORCA5 were moderate, but statistically significant (Figure 350

7B). In addition, we found two potential ERF binding motifs (GGCACCT and GGCCAAGC) in 351

the ERF115 promoter. Mutation of either individual motif did not significantly affect the 352

activation of ERF115-LUC by ERF189; however, mutation of both motifs reduced the activity of 353

ERF115-LUC reporter by 70% compared with the wild-type promoter (Figure 7C). Collectively, 354



13

these findings suggest the presence of intra-cluster and mutual regulation in both NIC2 and 355

ORCA clusters. . 356

C. roseus ORCA ERFs and tobacco NIC2-locus ERFs are likely interchangeable 357

C. roseus ORCA3/4/5 are homologous to tobacco NIC2 locus AP2/ERFs, ERF189 and ERF221 358

(a.k.a. ORC1) (Shoji et al., 2010; De Boer et al., 2011). In addition, both ORCAs and NIC2 359

ERFs are induced by MeJA and recognize GC-rich motifs in target gene promoters in two 360

diverse metabolic pathways (Shoji et al., 2010; De Boer et al., 2011). It is thus intriguing to 361

speculate that C. roseus ORCAs and tobacco NIC2-locus ERFs are functionally equivalent and 362

interchangeable. We tested this assumption by co-electroporation of the putrescine N-363

methyltransferase (PMT; 1500 bp) or quinolinate phosphoribosyltransferase (QPT; 1579 bp) 364

promoter-luciferase reporter vector into tobacco protoplasts with or without the plasmids 365

expressing ERF221, ORCA3, ORCA4 or ORCA5. As expected, ERF221 significantly activated 366

the PMT and QPT promoters compared to the control. ORCA3 and ORCA5 also activated the 367

PMT and QPT promoters although to lower levels compared to the activation by ERF221 (Figure 368

8A). The STR promoter (587 bp) fused to the luciferase reporter was co-electroporated into 369

tobacco protoplasts with or without the construct expressing ORCA3, ERF189, or ERF221. 370

Similar to ORCA3, a known STR-activator, both ERF189 and ERF221 significantly activated the 371

STR promoter (Figure 8A), suggesting that the tobacco ERF189 and ERF221 are functional 372

equivalents of C. roseus ORCAs. To determine the activation specificity of PMT and QPT by 373

NIC2 ERFs or ORCAs, we cloned a tobacco bZIP TF which is not involved in the regulation of 374

nicotine biosynthesis (Yang et al., 2001) and used it as a negative control. As shown in 375

Supplemental Figure S6, the bZIP TF was unable to activate the PMT or QPT promoter in 376

tobacco cells. Similarly, CrMYC1, a C. roseus bHLH TF not known to regulate the TIA pathway 377

(Chatel et al., 2003), was unable to activate the STR promoter in tobacco cells. 378

To functionally verify the conserved regulatory roles of AP2/ERFs of different clusters, we 379

generated tobacco hairy roots overexpressing ORCA5. Transgenic status of the hairy roots was 380

confirmed by PCR (Supplemental Figure S7), and two hairy root lines were used for further 381

analysis. Expression of PMT and QPT were 2.5-3.0 fold higher in ORCA5-expressing hairy roots 382

compared to the empty vector control (Figure 8B). Moreover, nicotine contents in the two 383

ORCA5-overexpressing lines were 3-4 fold higher compared to the control lines (Figure 8C), a 384



14

result that is consistent with a previous study showing that overexpression of ERF189 in tobacco 385

hairy roots resulted in 2-3 fold increase in PMT and QPT expression and alkaloid accumulation 386

(Shoji et al., 2010). We also generated C. roseus hairy roots overexpressing ERF189, and two 387

transgenic lines were used for further analysis (Supplemental Figure S8). STR expression was 388

approximately 2-fold higher in ERF189-expressing hairy roots compared to the empty vector 389

control (Figure 8D). In addition, the two ERF189-overexpressing lines accumulated 2-7 fold 390

higher ajamalicine, catharanthine and tabersonine compared to the controls (Figure 8E). 391

Discussion 392

Physically linked clusters of non-homologous, structural genes have been identified in numerous 393

plant species, including Arabidopsis, rice, maize, oat, tomato, potato, and opium poppy 394

(Boycheva et al., 2014; Nützmann and Osbourn, 2014; Nützmann et al., 2016). These gene 395

clusters generally encode enzymes that are involved in the biosynthesis of specialized 396

metabolites (Boycheva et al., 2014; Nützmann and Osbourn, 2014; Nützmann et al., 2016). 397

Unlike the structural gene clusters, TF gene clusters comprise homologous genes that likely 398

arose as the results of duplication events. It is unclear whether the duplicated TF genes are 399

functionally redundant and co-regulated by the same transcriptional circuit, or if they have 400

evolved through gene divergence to possess unique functions, including differential responses to 401

hormonal signals and regulation of one another. 402

We showed that ORCAs and key TIA pathway genes exhibit two distinct expression patterns in 403

response to ET alone, or the combined treatment of ET and MeJA (Figure 1B). CrMYC2a, 404

ORCA5, and TDC were upregulated by MeJA, but not affected by ET. On the other hand, 405

expression of ORCA3, ORCA4, and STR was significantly induced by MeJA and repressed by 406

ET. Moreover, when treated simultaneously, ET antagonizes the MeJA-induced expression of 407

ORCA3, ORCA4, ORCA5, TDC, and STR (Figure 1B). Expression divergence has been observed 408

among the tobacco NIC2 ERFs (Shoji et al., 2010) and tomato JREs (Nakayasu et al., 2018) in 409

response to MeJA and ET. MeJA-induced expression of ERF189/199 is antagonized by ET, 410

whereas expression of other NIC2 ERFs are insensitive to ET treatment (Shoji et al., 2010). 411

Other duplicated regulatory genes in Arabidopsis also exhibit expression divergence (Ganko et 412

al., 2007). The plant genomes sequenced to date have shown whole-genome, tandem, and/or 413

segmental duplications that result in neo-, sub-, or pseudo-functionalization of duplicated genes 414



15

(Rensing et al., 2008; Chae et al., 2014). These findings suggest that duplicated regulatory genes, 415

including ORCA and NIC2 ERFs, experience sub-functionalization (Shoji et al., 2010). 416

We demonstrated that ORCA5 has a broader transactivation specificity than ORCA3 and 417

ORCA4 (Figure 2C). Overexpression of ORCA5 in C. roseus hairy roots significantly induced 418

expression of genes in the indole branch and downstream of the iridoid branch, such as SLS, 419

resulting in increased TIA accumulation (Figure 4A). In addition, expression of CrMYC2a was 420

also upregulated in ORCA5-overexpressing hairy roots. In tobacco, not all NIC2 ERFs are 421

equally effective in activating nicotine pathway genes. This functional divergence among the 422

ERFs may be attributed to the sequence differences in the AP2 DNA binding domain and/or the 423

region outside of the AP2 domain (Shoji et al., 2010). MYC2 is known to regulate plant 424

specialized metabolites, including nicotine, TIAs, and SGA. Previously, we have demonstrated 425

that CrMYC2a expression strongly correlates with those of TIA structural and regulatory genes. 426

Similar to MYC2 regulation of nicotine biosynthesis in tobacco (Shoji and Hashimoto, 2011), 427

CrMYC2a co-regulates TIA pathway genes with ORCA3 (Paul et al., 2017). In addition, 428

CrMYC2a expression is induced in response to JA (Figure 1B) and increased in ORCA5-429

overexpressing hairy roots (Figure 4A). A recent study has shown that transient co-430

overexpression of a derepressed CrMYC2a (CrMYC2aD126N

) with ORCA3 synergistically affects 431

several TIA pathway gene expression (Schweizer et al., 2018). Similar to the previous study, we 432

found that CrMYC2aD126N

, when coexpressed with ORCA5, has additive effects on activation of 433

TIA pathway genes. Collectively, these findings suggest that CrMYC2a and ORCAs are part of a 434

regulatory network that modulate TIA biosynthesis in C. roseus. Transient overexpression of 435

CrMYC2a or CrMYC2aD126N

alone or in combination with ORCA3 activate a limited number of 436

TIA pathway genes, suggesting that additional but unidentified TFs are likely involved in the 437

TIA gene regulatory network. 438

Positive and negative regulatory loops are the hallmarks of metabolic pathways in plants. In 439

Arabidopsis JA signaling pathway, MYC2 activates the expression of JAZ repressors, which, in 440

turn, interact with MYC2 to attenuate the intensity of JA signal (Chini et al., 2007; Kazan and 441

Manners, 2013). AtMYBL2, a repressor of anthocyanin biosynthesis in Arabidopsis, is regulated 442

by the bHLH activator, TRANSPARENT TESTA8 (TT8). AtMYBL2 competes with the R2R3 443

MYBs, PAP1 and PAP2, to form a complex with TT8 that represses anthocyanin accumulation 444



16

(Matsui et al., 2008). Recently, we demonstrated that in C. roseus, CrMYC2a and BIS1 activate 445

the expression of the bHLH TF, RMT1, which acts as a repressor of CrMYC2a targets (Patra et 446

al., 2018). Similarly, in tomato MYC2 regulates expression of a small group of JA-responsive 447

bHLH TFs, MYC2-targeted bHLH 1 (MTB1), MTB2 and MTB3. MTB proteins inhibit the 448

formation of MYC2-MED25 complex and compete with MYC2 to bind to its targets (Liu et al., 449

2019). Here, we showed that, similar to ORCA4 (Paul et al., 2017), overexpression of ORCA5 450

significantly activates ZCTs in C. roseus hairy roots (Figure 4A). Moreover, we demonstrated 451

that ORCA5 activates ZCT3 possibly by binding to the GC-rich element in the promoter (Figure 452

5C, 6A). In C. roseus cells, ZCTs repress STR and TDC, the direct targets of ORCAs, by binding 453

to their promoters (Pauw et al., 2004). The up-regulation of ZCTs by ORCA4- or ORCA5-454

overexpression suggests the existence of a negative regulatory loop that is probably involved in 455

the fine-tuning of TIA biosynthesis (Figure 6F). 456

Individual genes in the tobacco and C. roseus ERF gene clusters play overlapping and unique 457

roles in controlling the structural genes in nicotine and TIA biosynthetic pathways, respectively 458

(Shoji et al., 2010; Paul et al., 2017). However, the regulatory relationship among the members 459

within an ERF cluster, or any known plant TF clusters, has not been elucidated prior to this 460

study. Here we demonstrated that an intra-cluster regulatory mechanism exists in both C. roseus 461

ORCA cluster and tobacco NIC2 cluster. The self-regulated ORCA5 activates ORCA4 by 462

binding to its promoter and ORCA3, likely through an uncharacterized TF. ORCA3 also activates 463

ORCA4 by binding to the GC-rich motif in its promoter (Figure 6). In tobacco, ERF189 activates 464

both the ERF115 and ERF179 promoters (Figure 7B). GC-rich sequences are not found within 465

the 1kb promoter regions of ERF189 and GAME9. The fact that GC-rich motifs are present only 466

in the promoters of some ERFs indicates that certain key regulators, such as ERF189, likely play 467

important role in controlling amplification loop in the ERF cluster. The intra-cluster regulation of 468

ERF clusters implies that the individual components within a cluster are not simply redundant 469

duplication of one another. The positive amplification loops help plants to make sufficient 470

precursors required for the spatial-temporal biosynthesis of specialized metabolites. The 471

mechanism is likely conserved in other ERF clusters in plants. It is also reasonable to predict that 472

similar self-regulation mechanisms exist in other TF clusters, such as those formed by group III 473

AP2/ERFs, CBFs (Zhang et al., 2004), and ARFs (Hagen and Guilfoyle, 2002). 474



17

The conserved nature of the intra-ERF-cluster regulation prompted us to speculate that ERFs 475

from gene clusters of different plant species are functionally equivalent and interchangeable, 476

despite low sequence similarity (35-41%). In this study, we showed that C. roseus ORCA5 can 477

activate both tobacco ERF115 and ERF179, and tobacco ERF189 and ERF221 can activate the 478

C. roseus ORCA4 promoter (Figure 7A and B). Furthermore, ORCA3 and ORCA5 can activate 479

the PMT and QPT promoters (Figure 8A). Similarly, the STR promoter in the TIA pathway can 480

be activated by tobacco ERF189 and ERF221 (Figure 8A). Moreover, ORCA5 overexpression in 481

tobacco hairy roots induced expression of PMT and QPT, resulting in increased nicotine 482

accumulation (Figure 8B and C). Similarly, ERF189 overexpression in C. roseus hairy roots 483

activated the expression of STR and induced TIA accumulation (Figure 8D and E). The mutual 484

activations of two distinct metabolic pathways by the ORCA and NIC2 clusters support our 485

hypothesis that the AP2/ERFs are functionally equivalent and are likely interchangeable (Figure 486

8F). Other ERF gene clusters, such as GAME9 ERFs of tomato and potato (Supplemental Figure 487

S5) also contain the GC-rich elements in their promoters and respond to JA-induction similar to 488

the ORCA and NIC2 clusters. We thus propose that the intra-cluster and mutual regulatory 489

functions are widely conserved among the ERF gene clusters of diverse plant species, although 490

additional experimental verifications are required. 491

TF gene clusters have been identified in non-plant organisms, including nematodes, Drosophila, 492

mouse, and human. The non-plant, homeodomain HOX TF clusters, which play critical roles in 493

invertebrates and vertebrates development, have been characterized (Lappin et al., 2006; 494

Montavon and Duboule, 2013). By comparison, the plant TF clusters are poorly investigated. As 495

more and more TF clusters are being identified, the unique functions and mutual regulatory 496

relationships of the clustered TFs require in-depth examination. Central to the knowledge gaps is 497

the regulatory relationship within a cluster and among different species. Understanding of such 498

relationships will shed light on TF evolution, as well as the functional equivalence and 499

divergence of TFs involved in specialized metabolism. This study demonstrates intra-cluster and 500

mutual regulation of AP2/ERF gene clusters, suggesting that a conserved regulatory mechanism 501

modulates biosynthesis of diverse groups of plant specialized metabolites. 502

MATERIALS AND METHODS 503

Plant materials 504



18

Catharanthus roseus (L.) G. Don var. ‘Little Bright Eye’ (NE Seed, USA) was used for cloning, 505

gene expression, and generation of transgenic hairy roots. Nicotiana tabacum var. Xanthi cell 506

line was used for protoplast-based transient expression assays. N. tabacum var. SamsunNN was 507

used for generation of hairy roots. 508

RNA isolation and cDNA synthesis 509

C. roseus (L.) G. Don var. ‘Little Bright Eye’ seeds were surface-sterilized using 30% (v/v) 510

commercial bleach for 15 min, washed five times with sterile water and inoculated on half-511

strength Murashige and Skoog (MS) medium (Caisson Labs, USA). The plates were kept at 512

28°C in dark for two days and then transferred to a growth room at 28°C, with constant light 513

(Patra et al., 2018). Ten-day-old seedlings were immersed in half-strength MS medium with 100 514

M methyl jasmonate (MeJA) and/or 50 M of ethylene precursor, 1-aminocyclopropane-1-515

carboxylic acid (ACC) for 2h. Mock-treated seedlings were used as control. Total RNA isolated 516

from the seedlings were used for cDNA synthesis as described previously (Suttipanta et al., 517

2007). 518

Reverse-transcription quantitative PCR 519

Reverse-transcription quantitative PCR (RT-qPCR) was performed as described previously 520

(Suttipanta et al., 2011). The primers used in RT-qPCR are listed in Supplemental Table S1. In 521

addition to the C. roseus Elongation Factor 1∞ (EF1∞), 40S Ribosomal Protein S9 (RPS9) gene, 522

was used as a second internal control (Liscombe et al., 2010). All PCRs were performed in 523

triplicate and repeated at least twice. 524

Total RNA isolated from empty-vector control and ORCA5-overexpressing hairy roots were used 525

for cDNA synthesis and RT-qPCR as previously described (Suttipanta et al., 2011). The 526

comparative cycle threshold (Ct) method (Applied Biosystems, 527

http://www.appliedbiosystems.com) was used to measure transcript levels. In addition to tobacco 528

elongation factor-1œ (Shoji et al., 2010) (GenBank accession number D63396), œ-tubulin 529

(GenBank accession number AJ421411) was also used as a reference gene. 530

Sub-cellular localization 531



19

For sub-cellular localization, the full-length cDNA of ORCA5 was fused to the N-terminus of the 532

enhanced GFP (eGFP) driven by the CaMV3S promoter and rbcS terminator in a pBS plasmid to 533

generate pORCA5-eGFP. A pBS plasmid containing only eGFP was used as a control. The 534

plasmids containing either eGFP or ORCA5-eGFP were individually electroporated into tobacco 535

protoplasts as described previously (Pattanaik et al., 2010) and visualized after 20h incubation in 536

dark under a fluorescent microscope (Eclipse TE200, Nikon, Japan) . 537

Tobacco protoplast isolation and electroporation 538

The 5' flanking regions of LAMT (-1375 to -1; relative to the ATG), SLS (-979 to -1), STR (-586 539

to -1), ZCT3 (-960 to -1), ORCA3 (-777 to -1), ORCA4 (-882 to -1) and ORCA5 (-889 to -1) 540

promoters were PCR-amplified from C. roseus genomic DNA. The PMT (-1499 to -1), QPT (-541

1578 to -1), ERF115 (-1055 to -3) and ERF179 (-1069 to -3) promoters were amplified from 542

tobacco genomic DNA using gene specific primers. The two GC-rich motifs, TGGCACCT and 543

GGCCAAGC, in ERF115 promoter were mutated to aaaACCT and GaaaAAGC using site-544

directed mutagenesis. The reporter plasmids for transient protoplast assays were generated by 545

cloning LAMT, SLS, STR ZCT3, ORCA3/4/5, PMT, ERF115 and ERF179 promoters in a 546

modified pUC vector containing a fire-fly luciferase (LUC) and rbcS terminator. The effector 547

plasmids were constructed by cloning ORCA3/4/5, ERF189/221, and ZCT3 into a modified pBS 548

vector under the control of the CaMV35S promoter and rbcS terminator. The ß-glucuronidase 549

(GUS) driven by the CaMV35S promoter and rbcS terminator was used as an internal control in 550

protoplast assay. For transactivation assay, ORCA3, ORCA4 and ORCA5 were fused to the 551

GAL4 DNA binding domain (GAL-DBD) in a pBS plasmid containing mirabilis mosaic virus 552

(MMV) promoter and rbcS terminator. The reporter plasmid used in the assay contains firefly 553

luciferase driven by minimal CaMV 35S promoter with five tandem repeats of GAL4 Response 554

Elements (5X GALRE), and rbcS terminator fused. Protoplast isolation from tobacco cell 555

suspension cultures and electroporation with supercoiled plasmid DNA were performed using 556

previously described protocols (Pattanaik et al., 2010). The reporter, effector, and internal 557

control plasmids were electroporated into tobacco protoplasts in different combinations; 558

luciferase and GUS activities in transfected protoplasts were measured as described previously 559

(Suttipanta et al., 2007). Each experiment was repeated three times. 560

561



20

Construction of plant expression vector and generation of hairy roots 562

For plant transformation, ORCA5 and ERF189 were PCR-amplified from C. roseus and tobacco 563

seedlings cDNA, respectively and cloned in pCAMBIA2301 vector containing the CaMV35S 564

promoter and the rbcS terminator (Pattanaik et al., 2010). The pCAMBIA2301 vector alone was 565

used as an empty vector (EV) control. The plasmids were mobilized into Agrobacterium 566

rhizogenes R1000 by freeze-thaw. Transformation of C. roseus seedlings and generation of hairy 567

roots were performed using the protocol described previously (Suttipanta et al., 2011; Paul et al., 568

2017). Transgenic status of the hairy root lines was verified by PCR amplification of rolB, rolC, 569

virC, nptII and GUS genes. Primers used in this study are listed in Supplemental Table S1. Two 570

independent hairy root lines were selected for further analysis. 571

572

Alkaloid extraction and analysis 573

For extraction of alkaloids, ten day-old seedlings were immersed in half-strength MS medium 574

with 100 M MeJA and/or 50M of ACC for 24h. MeJA and/or ACC-treated seedlings, and 575

transgenic hairy roots were frozen in liquid nitrogen and ground to powder. Samples were 576

extracted in methanol (1:100 w/v) twice for 24 h on a shaker. Pooled extracts were then dried via 577

a rotary evaporator and diluted in methanol 10 μL/mg of the initial sample. The samples were 578

then analyzed using high performance liquid chromatography (HPLC), followed by electrospray-579

injection (ESI) in a tandem mass spectrometry (MS/MS), as previously described (Suttipanta et 580

al., 2011; Paul et al., 2017). The known alkaloid standards were run to identify elution times and 581

mass fragments. 582

583

Yeast one-hybrid assay 584

The ORCA4 (883 bp)/ZCT3 (961 bp) promoter was cloned in the pHIS2 vector (Clontech), 585

containing the HIS3 reporter gene to generate the reporter plasmid (pORCA4/ZCT3-HIS3). The 586

full-length ORCA3 and ORCA5 cDNAs were cloned into the yeast expression plasmid, pAD-587

GAL4-2.1 (Stratagene), to generate the effector plasmids (pORCA3/ORCA5-AD). The reporter 588

and effector plasmids were transformed into yeast strain Y187, and transformants were selected 589

on synthetic dropout (SD) medium lacking Leu and Trp (-Leu-Trp). Transformed colonies were 590

then streaked on SD medium lacking His-Leu-Trp (-Leu-Trp-His) with 50 mM 3-AT to check 591

promoter activation. 592



21

Recombinant Protein Production and EMSA 593

The ORCA3, ORCA4 and ORCA5 genes were cloned into the pGEX 4T-1 vector (GE Healthcare 594

Biosciences, Pittsburgh, PA, USA) to generate GST-fusion proteins. The constructs were 595

verified by DNA sequencing and transformed into E. coli BL21 cells containing pRIL (Agilent, 596

Santa Clara, CA, USA). Protein expression was induced by adding isopropyl ß-D-597

thiogalactopyranoside (IPTG) to a final concentration of 0.1mM to the cell cultures at A600 ~ 598

0.8 and induced for 2 h at 37°C. The cells were harvested by centrifugation and lysed using 599

CelLytic B (Sigma, USA) according to the manufacturer’s instructions. The GST fusion proteins 600

were bound to Glutathione Sepharose 4B columns (Amersham) and eluted by using 10mM 601

reduced glutathione in 50mM Tris–HCl (pH 8.0) buffer. Bacterial expression and purification of 602

recombinant CrMYC2a protein were performed as previously described (Patra et al., 2018). For 603

EMSA experiments, biotin-labeled DNA probes were synthesized by Integrated DNA 604

Technologies (IDT) and annealed to produce double-stranded probes. Complementary DNA 605

probes were designed to include the jasmonate-responsive elements (JRE) of STR promoter (-

606

100ACATCACTCTTAGACCGCCTTCTTTGAAA GTGATTTCCCTTGGACCTT

-58 relative to 607

transcription start site; TSS) (Van Der Fits and Memelink, 2001) and putative GC rich element of 608

the ORCA4 promoter (-106

CCTTCATAGCCCGCCCAATTGGTAAACGTGCACCAACCTCC-

609

66 relative to the translation start, ATG). EMSA experiment was carried out using light shift 610

chemiluminescent EMSA kit (ThermoFisher Scientific). For the binding reactions 40 fmole of 611

DS DNA was incubated with purified protein (500 ng of each protein) for 60 min at room 612

temperature. The protein-DNA binding for ORCA5 was further confirmed by performing 613

competition experiment, where 10X-, 100X- and 1000X-fold excess amount of cold probe 614

(without biotin-label) was added to the binding reactions. For ORCA3 and ORCA4, 1000X-fold 615

excess amount of cold probe was added to the binding reactions. Recombinant CrMYC2a protein 616

was used as a negative control on biotin-label STR probe. The DNA-protein complexes were 617

resolved by electrophoresis on 6% non-denaturing polyacrylamide gels and then transferred to 618

BiodyneB modified membrane (0.45 mm; Pierce). The band shifts were detected by a 619

chemiluminescent nucleic acid detection module (Pierce) and exposed to X-ray films. 620

621

Phylogenetic analysis of group IX AP2/ERFs 622



22

Protein sequences for tobacco, tomato, and potato were downloaded from Sol Genomics 623

Network database (Fernandez-Pozo et al., 2015), and protein sequences for C. roseus were 624

obtained from the medicinal plant genomics resource database 625

(http://medicinalplantgenomics.msu.edu/). The Arabidopsis AP2/ERFs sequences were obtained 626

from a previously published report (Nakano et al., 2006). The group IX AP2/ERFs protein 627

sequences from Arabidopsis were used as queries using Basic Local Alignment Search Tool 628

(BLAST) (Camacho et al., 2009) to identify the AP2/ERFs from tobacco, tomato, potato, and C. 629

roseus. Putative AP2/ERFs sequences were screened using the Pfam database for the AP2/ERFs 630

domain (Finn et al., 2016). The group IX AP2/ERFs protein sequences were aligned using 631

ClustalW with the default settings, and MEGA6.0 was used to construct the phylogenetic tree 632

using Neighbor Joining (NJ) method with bootstrap values set as 1000 replicates. The tree image 633

was generated with the Evolview v2 (He et al., 2016). 634

Generation of tobacco hairy roots and measurement of nicotine 635

Leaf discs of in vitro grown N. tabacum var. SamsunNN plantlets were infected with A. 636

rhizogenes strain (R1000) harboring the pCAMBIA2301-ORCA5 overexpression construct. 637

After 2 days of co-cultivation, leaf discs were transferred to MS medium supplemented with 638

400 mg/L cefotaxime and kept at 25°C in the dark. Hairy roots developed from the leaf discs 639

were transferred to MS medium with 400 mg/L cefotaxime and 100 mg/L kanamycin for 640

further proliferation. 641

Freeze-dried empty-vector control and ORCA5-overexpressing hairy roots were exhaustively 642

extracted for pyridine alkaloids by methyl tert-butyl alcohol (MTBE) and aqueous sodium 643

hydroxide. Alkaloid contents were determined using Gas Chromatograph with Flame Ionization 644

Detectors (GC-FID, PerkinElmer, USA) (Lewis et al., 2008). Nicotine content was reported as 645

percentages on a dry-tobacco-weight basis. 646

Statistical analyses 647

The data presented here were statistically analyzed by Student’s t-test or one-way analysis of 648

variance (ANOVA), and Tukey’s Honestly Significant Difference (HSD) for multiple 649

comparisons. The significance level (P value) was described in legends to each figure. 650



23

Accession numbers: ORCA3 (AJ251249), ORCA4 (KR703577), ORCA5 (KR703578), 651

ERF189 (AB827951) and ERF221 (XM_016622819) 652

. 653

Supplemental Data 654

Supplemental Figure S1. Phylogenetic analysis of group IX AP2/ERFs in tobacco, tomato, 655

potato and C. roseus. 656

Supplemental Figure S2. Sub-cellular localization of ORCA5 and transactivation assay of 657

ORCAs in tobacco cells. 658

Supplemental Figure S3. ORCA5 and CrMYC2a binding to the GC-rich motif in the STR 659

promoter. 660

Supplemental Figure S4. Molecular analysis of ORCA5-overexpressing C. roseus hairy roots. 661

Supplemental Figure S5. Positions and sequences of GC-rich motifs in the AP2/ERF promoters 662

of C. roseus, tobacco, tomato, and potato. 663

Supplemental Figure S6. Activation assays of the QPT, PMT, and STR promoters using tobacco 664

bZIP and CrMYC1. 665

Supplemental Figure S7. Molecular analysis of ORCA5-overexpressing tobacco hairy roots. 666

Supplemental Figure S8. Molecular analysis of ERF189-overexpressing C. roseus hairy roots. 667

Supplemental Table S1. Oligonucleotides used in this study. 668

Acknowledgements 669 670

This work is supported partially by the Harold R. Burton Endowed Professorship to L.Y. and by 671

the National Science Foundation under Cooperative Agreement no. 1355438, to L.Y. We thank 672

Mr. J. May (Department of Civil Engineering and Environmental Research Training 673

Laboratories, University of Kentucky) for assistance on LC-MS and Huihua Ji (KTRDC, 674

University of Kentucky) for assistance on nicotine measurement. 675

676

Figure legends 677 678

Figure 1. Expression of ORCA3, ORCA4, and ORCA5 in response to JA and ACC. (A) A 679

simplified diagram of the TIA biosynthetic pathway in Catharanthus roseus. TIA pathway genes 680

studied in this work are highlighted in blue, and genes regulated by ORCAs and CrMYC2a (this 681

study; Schweizer et al. 2018; Paul et al. 2017; van der Fits and Memelink, 2000) are indicated by 682



24

circle and green triangle, respectively. (B) Ten-day-old C. roseus seedlings were treated with 100 683

µM MeJA (JA) and/or 50 M ACC for 2h, and gene expression in whole seedling was measured 684

by RT-qPCR. Mock-treated seedlings were used as controls (CN). (C) Measurement of 685

ajmalicine, catharanthine, and tabersonine in JA-, ACC- and JA+ACC-treated C. roseus 686

seedlings. Alkaloids were extracted and analyzed using LC-MS/MS. The levels of alkaloids were 687

estimated based on peak areas compared to standards. Data represent means ± SDs of three 688

biological samples each with 15-17 seedlings. Different letters denote statistical differences as 689

assessed by one-way ANOVA and Tukey HSD test, p < 0.05. ASα, anthranilate synthase; CPR, 690

cytochrome P450 reductase; G10H, geraniol 10-hydroxylase; HL1/2/3/4, hydrolase 1/2/3/4; IS, 691

iridoid synthase; LAMT, loganic acid methyltransferase; MAT, minovincine 19-O-692

acetyltransferase; SGD, strictosidine β-glucosidase; SLS, secologanin synthase; STR, 693

strictosidine synthase T19H, tabersonine 19-hydroxylase; TAT, tabersonine derivative 19-O-694

acetyltransferase; TEX1/TEX2, tabersonine 6,7-epoxidase isoforms 1 and 2; V19H, 695

vincadifformine 19-hydroxylase. ACC, 1-aminocyclopropane-1-carboxylic acid; MeJA, methyl 696

jasmonate; TIA, terpenoid indole alkaloid. 697

Figure 2. ORCA binding to the GC-rich motif in the STR promoter and differential 698

activation of TIA pathway gene promoters. (A) ORCA3, ORCA4, and ORCA5 were expressed 699

in E. coli and the recombinant proteins were purified to homogeneity as demonstrated by SDS-700

PAGE. (B) Binding of ORCA3, ORCA4, and ORCA5 to the GC-rich motif in the STR promoter. 701

Nucleotide sequence of GC-rich motif and position of JRE (-100 to -58) relative to the 702

transcription start site (TSS) is shown on the top panel. Autoradiograph shows the DNA-protein 703

complex of biotin-labeled GC-rich motif probe with ORCA3, ORCA4, or ORCA5. The labeled 704

probe was outcompeted by 1000X unlabeled probe (+). (C) Transactivation of the LAMT and 705

SLS promoters, fused to the firefly luciferase (LUC) reporter, by ORCA3, ORCA4, and ORCA5 706

in tobacco cells. Control (CN) represents reporter plasmid alone. A plasmid containing the ß-707

glucuronidase (GUS) reporter, driven by the CaMV 35S promoter and rbcS terminator, was used 708

as an internal control. LUC and GUS activities were measured 20 h after electroporation. LUC 709

activity was normalized against GUS activity. Data presented here are the means ± SDs of three 710

biological replicates. Statistical significance was calculated using the Student’s t-test, * p <0.05, 711

** p <0.01. JRE, jasmonate responsive element. 712



25

Figure 3. Derepressed CrMYC2a and ORCA5 synergistically effect TIA pathway genes. 713

Activation of the TDC, STR, LAMT, and SLS promoters, fused to the firefly luciferase (LUC) 714

reporter, by ORCA5, CrMYC2a, and CrMYC2aD126N

in tobacco cells. A reporter plasmid 715

containing the promoter-LUC cassette was co-electroporated into tobacco protoplasts with 716

effector plasmids harboring TF genes. Control (CN) represents reporter plasmid alone. A plasmid 717

containing the ß-glucuronidase (GUS) reporter, driven by the CaMV 35S promoter and rbcS 718

terminator, was used as internal control. LUC and GUS activities were measured 20 h after 719

electroporation. The LUC activity was normalized against the GUS activity. Data presented here 720

are the means ± SDs of three biological replicates. Different letters denote statistical differences 721

as assessed by one-way ANOVA and Tukey HSD test, p < 0.05 722

Figure 4. Relative expression of key TIA pathway genes and alkaloid accumulation in 723

ORCA5-overexpressing C. roseus hairy roots. (A) Relative expression of the TIA pathway 724

genes and TF genes in two empty vector (EV) controls and two ORCA5-overexpression (OE-1 725

and OE-2) hairy root lines as measured by RT-qPCR. (B) Measurement of tabersonine, 726

ajmalicine, and catharanthine in EV controls, OE-1, and OE-2. Alkaloids were extracted and 727

analyzed using LC-MS/MS, and the levels of alkaloids were estimated based on peak areas 728

compared to standards. Data presented here are the means ± SDs of three biological replicates. 729

Statistical significance was calculated using the Student’s t-test, * p <0.05, ** p <0.01, *** p 730

<0.001 731

Figure 5. Relative expression of TIA pathway genes in response to MeJA and in ORCA5-732

overexpressing hairy roots. (A) Ten-day-old C. roseus seedlings (15-17 seedlings in each 733

replicate) were treated with 100 M MeJA (JA) for 2h, and expression of HL1 to HL4, V19H, 734

TEX1, TEX2, T19H, TAT, and MAT in seedling was measured by RT-qPCR. Mock-treated 735

seedlings were used as controls (CN). (B) Relative expression of HL1 to HL4, V19H, TAT, TEX1, 736

and TEX2 in empty vector (EV) controls and two ORCA5-overexpression hairy root lines (OE-1 737

and OE-2) were measured by RT-qPCR. (C) Activation of the ZCT3 promoter, fused to the LUC 738

reporter, by ORCA3, ORCA4, or ORCA5 in tobacco cells. (D) Transactivation of the ORCA5 739

promoter, fused to the LUC reporter, in tobacco cells. Control (CN) represents reporter plasmid 740

alone. In both C and D, a plasmid containing the GUS reporter, driven by the CaMV 35S 741

promoter and rbcS terminator, was used as an internal control. LUC and GUS activities were 742



26

measured 20 h after electroporation. The LUC activity was normalized against the GUS activity. 743

Data presented here are the means ± SDs of three biological replicates each with 4-5 samples. 744

Statistical significance was calculated using the Student’s t-test, * p <0.05, ** p <0.01 745

Figure 6. Intra-cluster regulatory relationship among the members of ORCA cluster. (A) 746

Yeast one-hybrid assay demonstrating activation of the ORCA4 promoter by ORCA3 or ORCA5, 747

and the ZCT3 promoter by ORCA5. ORCA3 or ORCA5, fused to the GAL4 activation domain 748

(pAD-ORCA3/ORCA5), was co-transformed into yeast cells with the pORCA4-HIS3 or pZCT3-749

HIS3 reporter plasmid. The transformants were grown in either the double selection medium 750

(SD-Leu-Trp) or triple selection medium (SD-Leu-Trp-His) with 50 mM 3-amino-1,2,4-triazole 751

(3-AT). Transactivation of the promoters of (B) ORCA3, (C) ORCA4 and mutant-ORCA4 (m-752

ORCA4), and (D) ORCA5 by ORCA3, ORCA4, or ORCA5 in tobacco cells. Data presented here 753

are the means ± SDs of three biological replicates each with 4-5 samples. Statistical significance 754

was calculated using the Student’s t-test, * p <0.05, ** p <0.01 (E) Binding of ORCA3 and 755

ORCA5 to the GC-rich motif in the ORCA4 promoter. Nucleotide sequence and position of the 756

GC-rich motif relative to the translation start site (TSS) is shown on the top panel. 757

Autoradiograph shows the DNA-protein complex of the biotin-labeled probe covering the GC-758

rich motif with ORCA3 or ORCA5. The binding of the labeled probe was outcompeted by 759

1000X unlabeled probe (+). (F) A model summarizing the intra-cluster regulation among the 760

ORCAs and co-regulation of ORCAs and ZCTs of the TIA pathway. The ORCA genes are 761

activated by JA but repressed by ET. ORCA3 and ORCA5 regulate ORCA4. ORCA5 regulates 762

its own expression. ORCA5 activate ZCT3 whereas ORCAs indirectly regulate ZCT1 and ZCT2. 763

Solid blue arrows indicate activation by JA; solid yellow T-bars represent repression by ET. 764

Solid black arrows represent direct activation, whereas broken arrows represent indirect or 765

undetermined activation. ORCA5 activates whereas ZCT represses several genes in the indole 766

and iridoid branches of the TIA pathway. 767

Figure 7. Mutual regulatory relationship among C. roseus ORCA and tobacco NIC2 768

AP2/ERFs. (A) Transactivation of the ORCA4 promoter by NIC2 ERF, ERF189 or ERF221, and 769

(B) the tobacco ERF115 and ERF179 promoters by ERF189 or ORCA5. Data represent means ± 770

SDs of three biological samples. Different letters denote statistical differences as assessed by 771

one-way ANOVA and Tukey HSD test, p < 0.05. (C) Transactivation of the mutant ERF115 772



27

promoter by ERF189 in tobacco protoplast-based transactivation assay. A plasmid containing the 773

GUS reporter, driven by the CaMV 35S promoter and rbcS terminator, was used as an internal 774

control. Control represents reporter plasmid alone. The LUC and GUS activities were measured 775

20 h after electroporation. The LUC activity was normalized against the GUS activity. Data 776

presented here are the means ± SDs of three biological replicates each with 4-5 samples. 777

Statistical significance was calculated using the Student’s t-test, * p <0.05. 778

779 Figure 8. C. roseus ORCAs and tobacco NIC2 ERFs are likely interchangeable (A) 780

Transactivation of C. roseus STR promoter by ORCA3, ERF189, or ERF221 and tobacco PMT 781

and QPT promoters by ERF221, ORCA3, ORCA4, or ORCA5 in the tobacco protoplast assay. A 782

plasmid containing the GUS reporter, driven by the CaMV 35S promoter and rbcS terminator, 783

was used as internal control. Control (CN) represents reporter plasmid alone. The LUC and GUS 784

activities were measured 20 h after electroporation. The LUC activity was normalized against the 785

GUS activity. Data represent mean ± SDs of three biological replicates each with 4-5 samples. 786

Different letters denote statistical differences as assessed by one-way ANOVA and Tukey HSD 787

test, p < 0.05 (B) Relative expression of PMT and QPT in two empty vector (EV1 and EV2) 788

control and two ORCA5-overexpressing (OE-1, OE-2) tobacco hairy root lines, as measured by 789

RT-qPCR. The tobacco elongation factor 1 œ (EF1œ) was used as an internal control. (C) 790

Nicotine contents in two empty vector-control (EV1 and EV2) and two ORCA5-overexpression 791

(OE-1 and OE-2) tobacco hairy root lines. Nicotine concentrations are presented as percentage 792

dry weight (%DW). (D) Relative expression of STR in EV1 and EV2 (control) and two ERF189-793

overexpressing (189OE-1, 189OE-2) Catharanthus hairy root lines, as measured by RT-qPCR. 794

The Catharanthus EF1œ was used as an internal control. (E) Measurement of ajmalicine, 795

catharanthine, and tabersonine in EV1 and EV2 controls, and OE-1, and OE-2. Alkaloids were 796

extracted and analyzed using LC-MS/MS, and the levels of alkaloids were estimated based on 797

peak areas compared to standards. Data presented here are the means ± SDs of three biological 798

replicates. Statistical significance was calculated using the Student’s t-test, * p <0.05, ** p <0.01, 799

*** p <0.001. (F) A model depicting the mutual regulatory relationship among and between the 800

ORCA and NIC2 locus AP2/ERFs. The thin solid arrows represent direct activation and broken 801

arrows represent indirect activation within a cluster. The thick arrows indicate the inter-species 802

mutual regulation of the ERFs. 803



28

804

Literature Cited 805

Boycheva S, Daviet L, Wolfender JL, Fitzpatrick TB (2014) The rise of operon-like gene 806

clusters in plants. Trends Plant Sci 19: 447-459 807

Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL 808 (2009) BLAST+: architecture and applications. BMC Bioinformatics 10: 421 809

Cardenas PD, Sonawane PD, Pollier J, Vanden Bossche R, Dewangan V, Weithorn E, Tal 810

L, Meir S, Rogachev I, Malitsky S, Giri AP, Goossens A, Burdman S, Aharoni A 811 (2016) GAME9 regulates the biosynthesis of steroidal alkaloids and upstream isoprenoids 812

in the plant mevalonate pathway. Nat Commun 7: 10654 813

Carqueijeiro I, Brown S, Chung K, Dang TT, Walia M, Besseau S, Duge de Bernonville T, 814

Oudin A, Lanoue A, Billet K, Munsch T, Koudounas K, Melin C, Godon C, 815

Razafimandimby B, de Craene JO, Glevarec G, Marc J, Giglioli-Guivarc'h N, 816 Clastre M, St-Pierre B, Papon N, Andrade RB, O'Connor SE, Courdavault V (2018) 817

Two Tabersonine 6,7-Epoxidases Initiate Lochnericine-Derived Alkaloid Biosynthesis in 818

Catharanthus roseus. Plant Physiol 177: 1473-1486 819

Carqueijeiro I, Duge de Bernonville T, Lanoue A, Dang TT, Teijaro CN, Paetz C, Billet K, 820

Mosquera A, Oudin A, Besseau S, Papon N, Glevarec G, Atehortua L, Clastre M, 821

Giglioli-Guivarc'h N, Schneider B, St-Pierre B, Andrade RB, O'Connor SE, 822 Courdavault V (2018) A BAHD acyltransferase catalyzing 19-O-acetylation of 823

tabersonine derivatives in roots of Catharanthus roseus enables combinatorial synthesis of 824

monoterpene indole alkaloids. Plant J 94: 469-484 825

Chae L, Kim T, Nilo-Poyanco R, Rhee SY (2014) Genomic signatures of specialized 826

metabolism in plants. Science 344: 510-513 827

Chatel G, Montiel G, Pre M, Memelink J, Thiersault M, Saint-Pierre B, Doireau P, Gantet 828 P (2003) CrMYC1, a Catharanthus roseus elicitor- and jasmonate-responsive bHLH 829

transcription factor that binds the G-box element of the strictosidine synthase gene 830

promoter. J Exp Bot 54: 2587-2588 831

Chini A, Fonseca S, Fernandez G, Adie B, Chico JM, Lorenzo O, Garcia-Casado G, Lopez-832 Vidriero I, Lozano FM, Ponce MR, Micol JL, Solano R (2007) The JAZ family of 833

repressors is the missing link in jasmonate signalling. Nature 448: 666-671 834

Colinas M, Goossens A (2018) Combinatorial Transcriptional Control of Plant Specialized 835

Metabolism. Trends Plant Sci 23: 324-336 836

De Boer K, Tilleman S, Pauwels L, Vanden Bossche R, De Sutter V, Vanderhaeghen R, 837 Hilson P, Hamill JD, Goossens A (2011) APETALA2/ETHYLENE RESPONSE 838

FACTOR and basic helix–loop–helix tobacco transcription factors cooperatively mediate 839

jasmonate‐elicited nicotine biosynthesis. Plant J 66: 1053-1065 840

Fernandez-Pozo N, Menda N, Edwards JD, Saha S, Tecle IY, Strickler SR, Bombarely A, 841 Fisher-York T, Pujar A, Foerster H, Yan A, Mueller LA (2015) The Sol Genomics 842

Network (SGN)--from genotype to phenotype to breeding. Nucleic Acids Res 43: D1036-843

1041 844

Finn RD, Coggill P, Eberhardt RY, Eddy SR, Mistry J, Mitchell AL, Potter SC, Punta M, 845 Qureshi M, Sangrador-Vegas A, Salazar GA, Tate J, Bateman A (2016) The Pfam 846

protein families database: towards a more sustainable future. Nucleic Acids Res 44: 847

D279-285 848



29

Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000) Arabidopsis ethylene-849

responsive element binding factors act as transcriptional activators or repressors of GCC 850

box–mediated gene expression. Plant Cell 12: 393-404 851

Ganko EW, Meyers BC, Vision TJ (2007) Divergence in Expression between Duplicated 852

Genes in Arabidopsis. Mol Biol and Evol 24: 2298-2309 853

Giddings L-A, Liscombe DK, Hamilton JP, Childs KL, DellaPenna D, Buell CR, O'Connor 854 SE (2011) A stereoselective hydroxylation step of alkaloid biosynthesis by a unique 855

cytochrome P450 in Catharanthus roseus. J Biol Chem 286: 16751-16757 856

Gilmour SJ, Zarka DG, Stockinger EJ, Salazar MP, Houghton JM, Thomashow MF (1998) 857

Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional 858

activators as an early step in cold-induced COR gene expression. Plant J 16: 433-442 859

Hagen G, Guilfoyle T (2002) Auxin-responsive gene expression: genes, promoters and 860

regulatory factors. Plant Mol Biol 49: 373-385 861

He Z, Zhang H, Gao S, Lercher MJ, Chen WH, Hu S (2016) Evolview v2: an online 862

visualization and management tool for customized and annotated phylogenetic trees. 863

Nucleic Acids Res 44: W236-241 864

Kajikawa M, Sierro N, Kawaguchi H, Bakaher N, Ivanov NV, Hashimoto T, Shoji T (2017) 865

Genomic Insights into the Evolution of the Nicotine Biosynthesis Pathway in Tobacco. 866

Plant Physiol 174: 999-1011 867

Kazan K, Manners JM (2013) MYC2: The Master in Action. Molecular Plant 6: 686-703 868

Kellner F, Kim J, Clavijo BJ, Hamilton JP, Childs KL, Vaillancourt B, Cepela J, 869 Habermann M, Steuernagel B, Clissold L, McLay K, Buell CR, O'Connor SE (2015) 870

Genome‐guided investigation of plant natural product biosynthesis. Plant J 82: 680-692 871

Laflamme P, St-Pierre B, De Luca V (2001) Molecular and biochemical analysis of a 872

Madagascar periwinkle root-specific minovincinine-19-hydroxy-O-acetyltransferase. 873

Plant Physiol 125: 189-198 874

Lappin TR, Grier DG, Thompson A, Halliday HL (2006) HOX genes: seductive science, 875

mysterious mechanisms. Ulster Med J 75: 23-31 876

Lewis RS, Jack AM, Morris JW, Robert VJ, Gavilano LB, Siminszky B, Bush LP, Hayes 877 AJ, Dewey RE (2008) RNA interference (RNAi)-induced suppression of nicotine 878

demethylase activity reduces levels of a key carcinogen in cured tobacco leaves. Plant 879

Biotechnol J 6: 346-354 880

Li J, Zhang K, Meng Y, Hu J, Ding M, Bian J, Yan M, Han J, Zhou M (2018) Jasmonic 881

acid/Ethylene signaling coordinates hydroxycinnamic acid amides biosynthesis through 882

ORA59 transcription factor. Plant J 95:444-457 883

Liscombe DK, Usera AR, O'Connor SE (2010) Homolog of tocopherol C methyltransferases 884

catalyzes N methylation in anticancer alkaloid biosynthesis. Proc Natl Acad Sci USA 885

107: 18793-18798 886

Liu Y, Du M, Deng L, Shen J, Fang M, Chen Q, Lu Y, Wang Q, Li C, Zhai Q (2019) MYC2 887

Regulates the Termination of Jasmonate Signaling via an Autoregulatory Negative 888

Feedback Loop. Plant Cell 31:106-127 889

Lu X, Zhang L, Zhang F, Jiang W, Shen Q, Zhang L, Lv Z, Wang G, Tang K (2013) 890

AaORA, a trichome-specific AP2/ERF transcription factor of Artemisia annua, is a 891

positive regulator in the artemisinin biosynthetic pathway and in disease resistance to 892

Botrytis cinerea. New Phytol 198: 1191-1202 893



30

Matsui K, Umemura Y, Ohme‐Takagi M (2008) AtMYBL2, a protein with a single MYB 894

domain, acts as a negative regulator of anthocyanin biosynthesis in Arabidopsis. Plant J 895

55: 954-967 896

Mirjalili N, Linden JC (1996) Methyl jasmonate induced production of taxol in suspension 897

cultures of Taxus cuspidata: ethylene interaction and induction models. Biotech Progress 898

12: 110-118 899

Montavon T, Duboule D (2013) Chromatin organization and global regulation of Hox gene 900

clusters. Philos Trans R Soc Lond B Biol Sci 368: 20120367 901

Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of the ERF gene 902

family in Arabidopsis and rice. Plant Physiol 140: 411-432 903

Nakayasu M, Shioya N, Shikata M, Thagun C, Abdelkareem A, Okabe Y, Ariizumi T, 904 Arimura GI, Mizutani M, Ezura H, Hashimoto T, Shoji T (2018) JRE4 is a master 905

transcriptional regulator of defense-related steroidal glycoalkaloids in tomato. Plant J 906

94:975-990 907

Nützmann H-W, Osbourn A (2014) Gene clustering in plant specialized metabolism. Curr 908

Opin Biotech 26: 91-99 909

Nützmann HW, Huang A, Osbourn A (2016) Plant metabolic clusters–from genetics to 910

genomics. New Phytol 211: 771-789 911

Patra B, Pattanaik S, Schluttenhofer C, Yuan L (2018) A network of jasmonate‐responsive 912

bHLH factors modulate monoterpenoid indole alkaloid biosynthesis in Catharanthus 913

roseus. New Phytol 217: 1566-1581 914

Pattanaik S, Kong Q, Zaitlin D, Werkman J, Xie C, Patra B, Yuan L (2010) Isolation and 915

functional characterization of a floral tissue-specific R2R3 MYB regulator from tobacco. 916

Planta 231: 1061-1076 917

Pattanaik S, Werkman JR, Kong Q, Yuan L (2010) Site-Directed Mutagenesis and Saturation 918

Mutagenesis for the Functional Study of Transcription Factors Involved in Plant 919

Secondary Metabolite Biosynthesis. In AG Fett-Neto, ed, Plant Secondary Metabolism 920

Engineering: Methods and Applications. Humana Press, Totowa, NJ, pp 47-57 921

Paul P, Singh SK, Patra B, Sui X, Pattanaik S, Yuan L (2017) A differentially regulated 922

AP2/ERF transcription factor gene cluster acts downstream of a MAP kinase cascade to 923

modulate terpenoid indole alkaloid biosynthesis in Catharanthus roseus. New Phytol 213: 924

1107-1123 925

Pauw B, Hilliou FAO, Martin VS, Chatel G, de Wolf CJF, Champion A, Pré M, van Duijn 926 B, Kijne JW, van der Fits L, Memelink J (2004) Zinc Finger Proteins Act as 927

Transcriptional Repressors of Alkaloid Biosynthesis Genes in Catharanthus roseus. J Biol 928

Chem 279: 52940-52948 929

Peebles CA, Hughes EH, Shanks JV, San KY (2009) Transcriptional response of the terpenoid 930

indole alkaloid pathway to the overexpression of ORCA3 along with jasmonic acid 931

elicitation of Catharanthus roseus hairy roots over time. Metab Eng 11: 76-86 932

Qu Y, Easson M, Simionescu R, Hajicek J, Thamm AMK, Salim V, De Luca V (2018) 933

Solution of the multistep pathway for assembly of corynanthean, strychnos, iboga, and 934

aspidosperma monoterpenoid indole alkaloids from 19E-geissoschizine. Proc Natl Acad 935

Sci U S A 115: 3180-3185 936

Qu Y, Safonova O, De Luca V (2019) Completion of the canonical pathway for assembly of 937

anticancer drugs vincristine/vinblastine in Catharanthus roseus. Plant J 97: 257-266 938



31

Rensing SA, Lang D, Zimmer AD, Terry A, Salamov A, Shapiro H, Nishiyama T, Perroud 939 P-F, Lindquist EA, Kamisugi Y (2008) The Physcomitrella genome reveals 940

evolutionary insights into the conquest of land by plants. Science 319: 64-69 941

Sanchez-Perez R, Pavan S, Mazzeo R, Moldovan C, Aiese Cigliano R, Del Cueto J, 942 Ricciardi F, Lotti C, Ricciardi L, Dicenta F, Lopez-Marques RL, Moller BL (2019) 943

Mutation of a bHLH transcription factor allowed almond domestication. Science 364: 944

1095-1098 945

Schweizer F, Colinas M, Pollier J, Van Moerkercke A, Vanden Bossche R, de Clercq R, 946 Goossens A (2018) An engineered combinatorial module of transcription factors boosts 947

production of monoterpenoid indole alkaloids in Catharanthus roseus. Metab Eng 48: 948

150-162 949

Shen Q, Lu X, Yan T, Fu X, Lv Z, Zhang F, Pan Q, Wang G, Sun X, Tang K (2016) The 950

jasmonate‐responsive AaMYC2 transcription factor positively regulates artemisinin 951

biosynthesis in Artemisia annua. New Phytol 210: 1269-1281 952

Shoji T, Hashimoto T (2011) Tobacco MYC2 regulates jasmonate-inducible nicotine 953

biosynthesis genes directly and by way of the NIC2-locus ERF genes. Plant Cell Physiol 954

52: 1117-1130 955

Shoji T, Kajikawa M, Hashimoto T (2010) Clustered transcription factor genes regulate 956

nicotine biosynthesis in tobacco. Plant Cell 22: 3390-3409 957

Shoji T, Mishima M, Hashimoto T (2013) Divergent DNA-binding specificities of a group of 958

ETHYLENE RESPONSE FACTOR transcription factors involved in plant defense. Plant 959

Physiol 162: 977-990 960

Shoji T, Nakajima K, Hashimoto T (2000) Ethylene Suppresses Jasmonate-Induced Gene 961

Expression in Nicotine Biosynthesis. Plant and Cell Physiology 41: 1072-1076 962

Suttipanta N, Pattanaik S, Gunjan S, Xie CH, Littleton J, Yuan L (2007) Promoter analysis 963

of the Catharanthus roseus geraniol 10-hydroxylase gene involved in terpenoid indole 964

alkaloid biosynthesis. Biochim Biophys Acta 1769: 139-148 965

Suttipanta N, Pattanaik S, Kulshrestha M, Patra B, Singh SK, Yuan L (2011) The 966

Transcription Factor CrWRKY1 Positively Regulates the Terpenoid Indole Alkaloid 967

Biosynthesis in Catharanthus roseus. Plant Physiol 157: 2081-2093 968

Thagun C, Imanishi S, Kudo T, Nakabayashi R, Ohyama K, Mori T, Kawamoto K, 969

Nakamura Y, Katayama M, Nonaka S, Matsukura C, Yano K, Ezura H, Saito K, 970 Hashimoto T, Shoji T (2016) Jasmonate-Responsive ERF Transcription Factors 971

Regulate Steroidal Glycoalkaloid Biosynthesis in Tomato. Plant Cell Physiol 57: 961-975 972

Udomsom N, Rai A, Suzuki H, Okuyama J, Imai R, Mori T, Nakabayashi R, Saito K, 973 Yamazaki M (2016) Function of AP2/ERF Transcription Factors Involved in the 974

Regulation of Specialized Metabolism in Ophiorrhiza pumila Revealed by 975

Transcriptomics and Metabolomics. Front Plant Sci 7: 1861 976

van der Fits L, Memelink J (2000) ORCA3, a Jasmonate-Responsive Transcriptional Regulator 977

of Plant Primary and Secondary Metabolism. Science 289: 295-297 978

Van Der Fits L, Memelink J (2001) The jasmonate‐inducible AP2/ERF‐domain transcription 979

factor ORCA3 activates gene expression via interaction with a jasmonate‐responsive 980

promoter element. Plant J 25: 43-53 981

van der Heijden R, Schripsema J, Verpoorte R (2004) The Catharanthus alkaloids: 982

pharmacognosy and biotechnology. Curr Med Chem 11: 607-628 983



32

Van Moerkercke A, Steensma P, Gariboldi I, Espoz J, Purnama PC, Schweizer F, 984 Miettinen K, Vanden Bossche R, De Clercq R, Memelink J, Goossens A (2016) The 985

basic helix-loop-helix transcription factor BIS2 is essential for monoterpenoid indole 986

alkaloid production in the medicinal plant Catharanthus roseus. Plant J 88: 3-12 987

Van Moerkercke A, Steensma P, Schweizer F, Pollier J, Gariboldi I, Payne R, Vanden 988

Bossche R, Miettinen K, Espoz J, Purnama PC, Kellner F, Seppanen-Laakso T, 989 O'Connor SE, Rischer H, Memelink J, Goossens A (2015) The bHLH transcription 990

factor BIS1 controls the iridoid branch of the monoterpenoid indole alkaloid pathway in 991

Catharanthus roseus. Proc Natl Acad Sci U S A 112: 8130-8135 992

Wang C-T, Liu H, Gao X-S, Zhang H-X (2010) Overexpression of G10H and ORCA3 in the 993

hairy roots of Catharanthus roseus improves catharanthine production. Plant Cell Rep 29: 994

887-894 995

Williams D, Qu Y, Simionescu R, De Luca V (2019) The assembly of (+)-vincadifformine- 996

and (-)-tabersonine-derived monoterpenoid indole alkaloids in Catharanthus roseus 997

involves separate branch pathways. Plant J 99: 626-636 998

Winz RA, Baldwin IT (2001) Molecular Interactions between the Specialist Herbivore 999

Manduca sexta (Lepidoptera, Sphingidae) and Its Natural Host Nicotiana attenuata. IV. 1000

Insect-Induced Ethylene Reduces Jasmonate-Induced Nicotine Accumulation by 1001

Regulating Putrescine N-Methyltransferase Transcripts. Plant Physiol 125: 2189-2202 1002

Yang SH, Berberich T, Sano H, Kusano T (2001) Specific association of transcripts of tbzF 1003

and tbz17, tobacco genes encoding basic region leucine zipper-type transcriptional 1004

activators, with guard cells of senescing leaves and/or flowers. Plant Physiol 127: 23-32 1005

Yu Z-X, Li J-X, Yang C-Q, Hu W-L, Wang L-J, Chen X-Y (2012) The jasmonate-responsive 1006

AP2/ERF transcription factors AaERF1 and AaERF2 positively regulate artemisinin 1007

biosynthesis in Artemisia annua L. Mol Plant 5: 353-365 1008

Zhang H, Koes R, Shang H, Fu Z, Wang L, Dong X, Zhang J, Passeri V, Li Y, Jiang H, 1009 Gao J, Li Y, Wang H, Quattrocchio FM (2019) Identification and functional analysis 1010

of three new anthocyanin R2R3-MYB genes in Petunia. Plant Direct 3: e00114 1011

Zhang P, Chopra S, Peterson T (2000) A segmental gene duplication generated differentially 1012

expressed myb-homologous genes in maize. Plant Cell 12: 2311-2322 1013

Zhang X, Fowler SG, Cheng H, Lou Y, Rhee SY, Stockinger EJ, Thomashow MF (2004) 1014

Freezing-sensitive tomato has a functional CBF cold response pathway, but a CBF 1015

regulon that differs from that of freezing-tolerant Arabidopsis. Plant J 39: 905-919 1016

Zhao J, Zheng SH, Fujita K, Sakai K (2004) Jasmonate and ethylene signalling and their 1017

interaction are integral parts of the elicitor signalling pathway leading to β‐thujaplicin 1018

biosynthesis in Cupressus lusitanica cell cultures. J Exp Bot 55: 1003-1012 1019

Zhou M-L, Zhu X-M, Shao J-R, Wu Y-M, Tang Y-X (2010) Transcriptional response of the 1020

catharanthine biosynthesis pathway to methyl jasmonate/nitric oxide elicitation in 1021

Catharanthus roseus hairy root culture. Appl Microbiol Biotechnol 88: 737-750 1022



















Parsed CitationsBoycheva S, Daviet L, Wolfender JL, Fitzpatrick TB (2014) The rise of operon-like gene clusters in plants. Trends Plant Sci 19: 447-459

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL (2009) BLAST+: architecture and applications. BMCBioinformatics 10: 421


Cardenas PD, Sonawane PD, Pollier J, Vanden Bossche R, Dewangan V, Weithorn E, Tal L, Meir S, Rogachev I, Malitsky S, Giri AP,Goossens A, Burdman S, Aharoni A (2016) GAME9 regulates the biosynthesis of steroidal alkaloids and upstream isoprenoids in theplant mevalonate pathway. Nat Commun 7: 10654


Carqueijeiro I, Brown S, Chung K, Dang TT, Walia M, Besseau S, Duge de Bernonville T, Oudin A, Lanoue A, Billet K, Munsch T,Koudounas K, Melin C, Godon C, Razafimandimby B, de Craene JO, Glevarec G, Marc J, Giglioli-Guivarc'h N, Clastre M, St-Pierre B,Papon N, Andrade RB, O'Connor SE, Courdavault V (2018) Two Tabersonine 6,7-Epoxidases Initiate Lochnericine-Derived AlkaloidBiosynthesis in Catharanthus roseus. Plant Physiol 177: 1473-1486


Carqueijeiro I, Duge de Bernonville T, Lanoue A, Dang TT, Teijaro CN, Paetz C, Billet K, Mosquera A, Oudin A, Besseau S, Papon N,Glevarec G, Atehortua L, Clastre M, Giglioli-Guivarc'h N, Schneider B, St-Pierre B, Andrade RB, O'Connor SE, Courdavault V (2018) ABAHD acyltransferase catalyzing 19-O-acetylation of tabersonine derivatives in roots of Catharanthus roseus enables combinatorialsynthesis of monoterpene indole alkaloids. Plant J 94: 469-484


Chae L, Kim T, Nilo-Poyanco R, Rhee SY (2014) Genomic signatures of specialized metabolism in plants. Science 344: 510-513Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Chatel G, Montiel G, Pre M, Memelink J, Thiersault M, Saint-Pierre B, Doireau P, Gantet P (2003) CrMYC1, a Catharanthus roseuselicitor- and jasmonate-responsive bHLH transcription factor that binds the G-box element of the strictosidine synthase genepromoter. J Exp Bot 54: 2587-2588


Chini A, Fonseca S, Fernandez G, Adie B, Chico JM, Lorenzo O, Garcia-Casado G, Lopez-Vidriero I, Lozano FM, Ponce MR, Micol JL,Solano R (2007) The JAZ family of repressors is the missing link in jasmonate signalling. Nature 448: 666-671


Colinas M, Goossens A (2018) Combinatorial Transcriptional Control of Plant Specialized Metabolism. Trends Plant Sci 23: 324-336Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

De Boer K, Tilleman S, Pauwels L, Vanden Bossche R, De Sutter V, Vanderhaeghen R, Hilson P, Hamill JD, Goossens A (2011)APETALA2/ETHYLENE RESPONSE FACTOR and basic helix–loop–helix tobacco transcription factors cooperatively mediatejasmonate‐elicited nicotine biosynthesis. Plant J 66: 1053-1065


Fernandez-Pozo N, Menda N, Edwards JD, Saha S, Tecle IY, Strickler SR, Bombarely A, Fisher-York T, Pujar A, Foerster H, Yan A,Mueller LA (2015) The Sol Genomics Network (SGN)--from genotype to phenotype to breeding. Nucleic Acids Res 43: D1036-1041


Finn RD, Coggill P, Eberhardt RY, Eddy SR, Mistry J, Mitchell AL, Potter SC, Punta M, Qureshi M, Sangrador-Vegas A, Salazar GA, TateJ, Bateman A (2016) The Pfam protein families database: towards a more sustainable future. Nucleic Acids Res 44: D279-285


Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000) Arabidopsis ethylene-responsive element binding factors act astranscriptional activators or repressors of GCC box–mediated gene expression. Plant Cell 12: 393-404


Ganko EW, Meyers BC, Vision TJ (2007) Divergence in Expression between Duplicated Genes in Arabidopsis. Mol Biol and Evol 24:2298-2309


https://www.ncbi.nlm.nih.gov/pubmed?term=Boycheva S%2C Daviet L%2C Wolfender JL%2C Fitzpatrick TB %282014%29 The rise of operon%2Dlike gene clusters in plants%2E Trends Plant Sci&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Boycheva&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The rise of operon-like gene clusters in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The rise of operon-like gene clusters in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Boycheva&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Camacho C%2C Coulouris G%2C Avagyan V%2C Ma N%2C Papadopoulos J%2C Bealer K%2C Madden TL %282009%29 BLAST%2B%3A architecture and applications%2E BMC Bioinformatics&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Camacho&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=BLAST+: architecture and applications.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=BLAST+: architecture and applications.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Camacho&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Cardenas PD%2C Sonawane PD%2C Pollier J%2C Vanden Bossche R%2C Dewangan V%2C Weithorn E%2C Tal L%2C Meir S%2C Rogachev I%2C Malitsky S%2C Giri AP%2C Goossens A%2C Burdman S%2C Aharoni A %282016%29 GAME9 regulates the biosynthesis of steroidal alkaloids and upstream isoprenoids in the plant mevalonate pathway%2E Nat Commun&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cardenas&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=GAME9 regulates the biosynthesis of steroidal alkaloids and upstream isoprenoids in the plant mevalonate pathway.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=GAME9 regulates the biosynthesis of steroidal alkaloids and upstream isoprenoids in the plant mevalonate pathway.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cardenas&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Carqueijeiro I%2C Brown S%2C Chung K%2C Dang TT%2C Walia M%2C Besseau S%2C Duge de Bernonville T%2C Oudin A%2C Lanoue A%2C Billet K%2C Munsch T%2C Koudounas K%2C Melin C%2C Godon C%2C Razafimandimby B%2C de Craene JO%2C Glevarec G%2C Marc J%2C Giglioli%2DGuivarc%27h N%2C Clastre M%2C St%2DPierre B%2C Papon N%2C Andrade RB%2C O%27Connor SE%2C Courdavault V %282018%29 Two Tabersonine 6%2C7%2DEpoxidases Initiate Lochnericine%2DDerived Alkaloid Biosynthesis in Catharanthus roseus%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Carqueijeiro&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Carqueijeiro&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Carqueijeiro I%2C Duge de Bernonville T%2C Lanoue A%2C Dang TT%2C Teijaro CN%2C Paetz C%2C Billet K%2C Mosquera A%2C Oudin A%2C Besseau S%2C Papon N%2C Glevarec G%2C Atehortua L%2C Clastre M%2C Giglioli%2DGuivarc%27h N%2C Schneider B%2C St%2DPierre B%2C Andrade RB%2C O%27Connor SE%2C Courdavault V %282018%29 A BAHD acyltransferase catalyzing 19%2DO%2Dacetylation of tabersonine derivatives in roots of Catharanthus roseus enables combinatorial synthesis of monoterpene indole alkaloids%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Carqueijeiro&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=A BAHD acyltransferase catalyzing 19-O-acetylation of tabersonine derivatives in roots of Catharanthus roseus enables combinatorial synthesis of monoterpene indole alkaloids&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=A BAHD acyltransferase catalyzing 19-O-acetylation of tabersonine derivatives in roots of Catharanthus roseus enables combinatorial synthesis of monoterpene indole alkaloids&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Carqueijeiro&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Chae L%2C Kim T%2C Nilo%2DPoyanco R%2C Rhee SY %282014%29 Genomic signatures of specialized metabolism in plants%2E Science&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chae&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Genomic signatures of specialized metabolism in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Genomic signatures of specialized metabolism in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chae&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Chatel G%2C Montiel G%2C Pre M%2C Memelink J%2C Thiersault M%2C Saint%2DPierre B%2C Doireau P%2C Gantet P %282003%29 CrMYC1%2C a Catharanthus roseus elicitor%2D and jasmonate%2Dresponsive bHLH transcription factor that binds the G%2Dbox element of the strictosidine synthase gene promoter%2E J Exp Bot&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chatel&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chatel&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Chini A%2C Fonseca S%2C Fernandez G%2C Adie B%2C Chico JM%2C Lorenzo O%2C Garcia%2DCasado G%2C Lopez%2DVidriero I%2C Lozano FM%2C Ponce MR%2C Micol JL%2C Solano R %282007%29 The JAZ family of repressors is the missing link in jasmonate signalling%2E Nature&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chini&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The JAZ family of repressors is the missing link in jasmonate signalling&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The JAZ family of repressors is the missing link in jasmonate signalling&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chini&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Colinas M%2C Goossens A %282018%29 Combinatorial Transcriptional Control of Plant Specialized Metabolism%2E Trends Plant Sci&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Colinas&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Combinatorial Transcriptional Control of Plant Specialized Metabolism&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Combinatorial Transcriptional Control of Plant Specialized Metabolism&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Colinas&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=De Boer K%2C Tilleman S%2C Pauwels L%2C Vanden Bossche R%2C De Sutter V%2C Vanderhaeghen R%2C Hilson P%2C Hamill JD%2C Goossens A %282011%29 APETALA2%2FETHYLENE RESPONSE FACTOR and basic helix%26%23x2013%3Bloop%26%23x2013%3Bhelix tobacco transcription factors cooperatively mediate jasmonate�?�elicited nicotine biosynthesis%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=De&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=APETALA2/ETHYLENE RESPONSE FACTOR and basic helix?loop?helix tobacco transcription factors cooperatively mediate jasmonateâ�?�elicited nicotine biosynthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=APETALA2/ETHYLENE RESPONSE FACTOR and basic helix?loop?helix tobacco transcription factors cooperatively mediate jasmonateâ�?�elicited nicotine biosynthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=De&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Fernandez%2DPozo N%2C Menda N%2C Edwards JD%2C Saha S%2C Tecle IY%2C Strickler SR%2C Bombarely A%2C Fisher%2DYork T%2C Pujar A%2C Foerster H%2C Yan A%2C Mueller LA %282015%29 The Sol Genomics Network %28SGN%29%2D%2Dfrom genotype to phenotype to breeding%2E Nucleic Acids Res 43%3A D&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fernandez-Pozo&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The Sol Genomics Network (SGN)--from genotype to phenotype to breeding&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The Sol Genomics Network (SGN)--from genotype to phenotype to breeding&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fernandez-Pozo&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Finn RD%2C Coggill P%2C Eberhardt RY%2C Eddy SR%2C Mistry J%2C Mitchell AL%2C Potter SC%2C Punta M%2C Qureshi M%2C Sangrador%2DVegas A%2C Salazar GA%2C Tate J%2C Bateman A %282016%29 The Pfam protein families database%3A towards a more sustainable future%2E Nucleic Acids Res 44%3A D&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Finn&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The Pfam protein families database: towards a more sustainable future&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The Pfam protein families database: towards a more sustainable future&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Finn&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Fujimoto SY%2C Ohta M%2C Usui A%2C Shinshi H%2C Ohme%2DTakagi M %282000%29 Arabidopsis ethylene%2Dresponsive element binding factors act as transcriptional activators or repressors of GCC box%26%23x2013%3Bmediated gene expression%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fujimoto&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Arabidopsis ethylene-responsive element binding factors act as transcriptional activators or repressors of GCC box?mediated gene expression&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Arabidopsis ethylene-responsive element binding factors act as transcriptional activators or repressors of GCC box?mediated gene expression&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fujimoto&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1



Giddings L-A, Liscombe DK, Hamilton JP, Childs KL, DellaPenna D, Buell CR, O'Connor SE (2011) A stereoselective hydroxylation stepof alkaloid biosynthesis by a unique cytochrome P450 in Catharanthus roseus. J Biol Chem 286: 16751-16757


Gilmour SJ, Zarka DG, Stockinger EJ, Salazar MP, Houghton JM, Thomashow MF (1998) Low temperature regulation of the ArabidopsisCBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression. Plant J 16: 433-442


Hagen G, Guilfoyle T (2002) Auxin-responsive gene expression: genes, promoters and regulatory factors. Plant Mol Biol 49: 373-385Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

He Z, Zhang H, Gao S, Lercher MJ, Chen WH, Hu S (2016) Evolview v2: an online visualization and management tool for customizedand annotated phylogenetic trees. Nucleic Acids Res 44: W236-241


Kajikawa M, Sierro N, Kawaguchi H, Bakaher N, Ivanov NV, Hashimoto T, Shoji T (2017) Genomic Insights into the Evolution of theNicotine Biosynthesis Pathway in Tobacco. Plant Physiol 174: 999-1011


Kazan K, Manners JM (2013) MYC2: The Master in Action. Molecular Plant 6: 686-703Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kellner F, Kim J, Clavijo BJ, Hamilton JP, Childs KL, Vaillancourt B, Cepela J, Habermann M, Steuernagel B, Clissold L, McLay K, BuellCR, O'Connor SE (2015) Genome‐guided investigation of plant natural product biosynthesis. Plant J 82: 680-692


Laflamme P, St-Pierre B, De Luca V (2001) Molecular and biochemical analysis of a Madagascar periwinkle root-specific minovincinine-19-hydroxy-O-acetyltransferase. Plant Physiol 125: 189-198


Lappin TR, Grier DG, Thompson A, Halliday HL (2006) HOX genes: seductive science, mysterious mechanisms. Ulster Med J 75: 23-31Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lewis RS, Jack AM, Morris JW, Robert VJ, Gavilano LB, Siminszky B, Bush LP, Hayes AJ, Dewey RE (2008) RNA interference (RNAi)-induced suppression of nicotine demethylase activity reduces levels of a key carcinogen in cured tobacco leaves. Plant Biotechnol J6: 346-354


Li J, Zhang K, Meng Y, Hu J, Ding M, Bian J, Yan M, Han J, Zhou M (2018) Jasmonic acid/Ethylene signaling coordinateshydroxycinnamic acid amides biosynthesis through ORA59 transcription factor. Plant J 95:444-457


Liscombe DK, Usera AR, O'Connor SE (2010) Homolog of tocopherol C methyltransferases catalyzes N methylation in anticanceralkaloid biosynthesis. Proc Natl Acad Sci USA 107: 18793-18798


Liu Y, Du M, Deng L, Shen J, Fang M, Chen Q, Lu Y, Wang Q, Li C, Zhai Q (2019) MYC2 Regulates the Termination of JasmonateSignaling via an Autoregulatory Negative Feedback Loop. Plant Cell 31:106-127


Lu X, Zhang L, Zhang F, Jiang W, Shen Q, Zhang L, Lv Z, Wang G, Tang K (2013) AaORA, a trichome-specific AP2/ERF transcriptionfactor of Artemisia annua, is a positive regulator in the artemisinin biosynthetic pathway and in disease resistance to Botrytis cinerea.New Phytol 198: 1191-1202


Matsui K, Umemura Y, Ohme‐Takagi M (2008) AtMYBL2, a protein with a single MYB domain, acts as a negative regulator ofanthocyanin biosynthesis in Arabidopsis. Plant J 55: 954-967

Pubmed: Author and Title www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.

https://www.ncbi.nlm.nih.gov/pubmed?term=Ganko EW%2C Meyers BC%2C Vision TJ %282007%29 Divergence in Expression between Duplicated Genes in Arabidopsis%2E Mol Biol and Evol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ganko&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Divergence in Expression between Duplicated Genes in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Divergence in Expression between Duplicated Genes in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ganko&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Giddings L%2DA%2C Liscombe DK%2C Hamilton JP%2C Childs KL%2C DellaPenna D%2C Buell CR%2C O%27Connor SE %282011%29 A stereoselective hydroxylation step of alkaloid biosynthesis by a unique cytochrome P450 in Catharanthus roseus%2E J Biol Chem&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Giddings&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=A stereoselective hydroxylation step of alkaloid biosynthesis by a unique cytochrome P450 in Catharanthus roseus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=A stereoselective hydroxylation step of alkaloid biosynthesis by a unique cytochrome P450 in Catharanthus roseus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Giddings&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Gilmour SJ%2C Zarka DG%2C Stockinger EJ%2C Salazar MP%2C Houghton JM%2C Thomashow MF %281998%29 Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional activators as an early step in cold%2Dinduced COR gene expression%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Gilmour&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Gilmour&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Hagen G%2C Guilfoyle T %282002%29 Auxin%2Dresponsive gene expression%3A genes%2C promoters and regulatory factors%2E Plant Mol Biol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hagen&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Auxin-responsive gene expression: genes, promoters and regulatory factors&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Auxin-responsive gene expression: genes, promoters and regulatory factors&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hagen&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=He Z%2C Zhang H%2C Gao S%2C Lercher MJ%2C Chen WH%2C Hu S %282016%29 Evolview v2%3A an online visualization and management tool for customized and annotated phylogenetic trees%2E Nucleic Acids Res 44%3A W&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=He&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=He&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kajikawa M%2C Sierro N%2C Kawaguchi H%2C Bakaher N%2C Ivanov NV%2C Hashimoto T%2C Shoji T %282017%29 Genomic Insights into the Evolution of the Nicotine Biosynthesis Pathway in Tobacco%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kajikawa&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Genomic Insights into the Evolution of the Nicotine Biosynthesis Pathway in Tobacco&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Genomic Insights into the Evolution of the Nicotine Biosynthesis Pathway in Tobacco&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kajikawa&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kazan K%2C Manners JM %282013%29 MYC2%3A The Master in Action%2E Molecular Plant&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kazan&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kazan&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kellner F%2C Kim J%2C Clavijo BJ%2C Hamilton JP%2C Childs KL%2C Vaillancourt B%2C Cepela J%2C Habermann M%2C Steuernagel B%2C Clissold L%2C McLay K%2C Buell CR%2C O%27Connor SE %282015%29 Genome�?�guided investigation of plant natural product biosynthesis%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kellner&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Genomeâ�?�guided investigation of plant natural product biosynthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Genomeâ�?�guided investigation of plant natural product biosynthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kellner&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Laflamme P%2C St%2DPierre B%2C De Luca V %282001%29 Molecular and biochemical analysis of a Madagascar periwinkle root%2Dspecific minovincinine%2D19%2Dhydroxy%2DO%2Dacetyltransferase%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Laflamme&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Molecular and biochemical analysis of a Madagascar periwinkle root-specific minovincinine-19-hydroxy-O-acetyltransferase&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Molecular and biochemical analysis of a Madagascar periwinkle root-specific minovincinine-19-hydroxy-O-acetyltransferase&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Laflamme&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Lappin TR%2C Grier DG%2C Thompson A%2C Halliday HL %282006%29 HOX genes%3A seductive science%2C mysterious mechanisms%2E Ulster Med J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lappin&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=HOX genes: seductive science, mysterious mechanisms&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=HOX genes: seductive science, mysterious mechanisms&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lappin&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Lewis RS%2C Jack AM%2C Morris JW%2C Robert VJ%2C Gavilano LB%2C Siminszky B%2C Bush LP%2C Hayes AJ%2C Dewey RE %282008%29 RNA interference %28RNAi%29%2Dinduced suppression of nicotine demethylase activity reduces levels of a key carcinogen in cured tobacco leaves%2E Plant Biotechnol J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lewis&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=RNA interference (RNAi)-induced suppression of nicotine demethylase activity reduces levels of a key carcinogen in cured tobacco leaves&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=RNA interference (RNAi)-induced suppression of nicotine demethylase activity reduces levels of a key carcinogen in cured tobacco leaves&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lewis&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Li J%2C Zhang K%2C Meng Y%2C Hu J%2C Ding M%2C Bian J%2C Yan M%2C Han J%2C Zhou M %282018%29 Jasmonic acid%2FEthylene signaling coordinates hydroxycinnamic acid amides biosynthesis through ORA59 transcription factor%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Jasmonic acid/Ethylene signaling coordinates hydroxycinnamic acid amides biosynthesis through ORA59 transcription factor&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Jasmonic acid/Ethylene signaling coordinates hydroxycinnamic acid amides biosynthesis through ORA59 transcription factor&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Liscombe DK%2C Usera AR%2C O%27Connor SE %282010%29 Homolog of tocopherol C methyltransferases catalyzes N methylation in anticancer alkaloid biosynthesis%2E Proc Natl Acad Sci USA&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liscombe&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Homolog of tocopherol C methyltransferases catalyzes N methylation in anticancer alkaloid biosynthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Homolog of tocopherol C methyltransferases catalyzes N methylation in anticancer alkaloid biosynthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liscombe&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Liu Y%2C Du M%2C Deng L%2C Shen J%2C Fang M%2C Chen Q%2C Lu Y%2C Wang Q%2C Li C%2C Zhai Q %282019%29 MYC2 Regulates the Termination of Jasmonate Signaling via an Autoregulatory Negative Feedback Loop%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liu&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=MYC2 Regulates the Termination of Jasmonate Signaling via an Autoregulatory Negative Feedback Loop&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=MYC2 Regulates the Termination of Jasmonate Signaling via an Autoregulatory Negative Feedback Loop&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liu&as_ylo=2019&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Lu X%2C Zhang L%2C Zhang F%2C Jiang W%2C Shen Q%2C Zhang L%2C Lv Z%2C Wang G%2C Tang K %282013%29 AaORA%2C a trichome%2Dspecific AP2%2FERF transcription factor of Artemisia annua%2C is a positive regulator in the artemisinin biosynthetic pathway and in disease resistance to Botrytis cinerea%2E New Phytol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lu&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=AaORA, a trichome-specific AP2/ERF transcription factor of Artemisia annua, is a positive regulator in the artemisinin biosynthetic pathway and in disease resistance to Botrytis cinerea&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=AaORA, a trichome-specific AP2/ERF transcription factor of Artemisia annua, is a positive regulator in the artemisinin biosynthetic pathway and in disease resistance to Botrytis cinerea&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lu&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Matsui K%2C Umemura Y%2C Ohme�?�Takagi M %282008%29 AtMYBL2%2C a protein with a single MYB domain%2C acts as a negative regulator of anthocyanin biosynthesis in Arabidopsis%2E Plant J&dopt=abstract


Google Scholar: Author Only Title Only Author and Title

Mirjalili N, Linden JC (1996) Methyl jasmonate induced production of taxol in suspension cultures of Taxus cuspidata: ethyleneinteraction and induction models. Biotech Progress 12: 110-118


Montavon T, Duboule D (2013) Chromatin organization and global regulation of Hox gene clusters. Philos Trans R Soc Lond B Biol Sci368: 20120367


Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol140: 411-432


Nakayasu M, Shioya N, Shikata M, Thagun C, Abdelkareem A, Okabe Y, Ariizumi T, Arimura GI, Mizutani M, Ezura H, Hashimoto T, ShojiT (2018) JRE4 is a master transcriptional regulator of defense-related steroidal glycoalkaloids in tomato. Plant J 94:975-990


Nützmann H-W, Osbourn A (2014) Gene clustering in plant specialized metabolism. Curr Opin Biotech 26: 91-99Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Nützmann HW, Huang A, Osbourn A (2016) Plant metabolic clusters–from genetics to genomics. New Phytol 211: 771-789Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Patra B, Pattanaik S, Schluttenhofer C, Yuan L (2018) A network of jasmonate‐responsive bHLH factors modulate monoterpenoidindole alkaloid biosynthesis in Catharanthus roseus. New Phytol 217: 1566-1581


Pattanaik S, Kong Q, Zaitlin D, Werkman J, Xie C, Patra B, Yuan L (2010) Isolation and functional characterization of a floral tissue-specific R2R3 MYB regulator from tobacco. Planta 231: 1061-1076


Pattanaik S, Werkman JR, Kong Q, Yuan L (2010) Site-Directed Mutagenesis and Saturation Mutagenesis for the Functional Study ofTranscription Factors Involved in Plant Secondary Metabolite Biosynthesis. In AG Fett-Neto, ed, Plant Secondary MetabolismEngineering: Methods and Applications. Humana Press, Totowa, NJ, pp 47-57


Paul P, Singh SK, Patra B, Sui X, Pattanaik S, Yuan L (2017) A differentially regulated AP2/ERF transcription factor gene cluster actsdownstream of a MAP kinase cascade to modulate terpenoid indole alkaloid biosynthesis in Catharanthus roseus. New Phytol 213:1107-1123


Pauw B, Hilliou FAO, Martin VS, Chatel G, de Wolf CJF, Champion A, Pré M, van Duijn B, Kijne JW, van der Fits L, Memelink J (2004)Zinc Finger Proteins Act as Transcriptional Repressors of Alkaloid Biosynthesis Genes in Catharanthus roseus. J Biol Chem 279:52940-52948


Peebles CA, Hughes EH, Shanks JV, San KY (2009) Transcriptional response of the terpenoid indole alkaloid pathway to theoverexpression of ORCA3 along with jasmonic acid elicitation of Catharanthus roseus hairy roots over time. Metab Eng 11: 76-86


Qu Y, Easson M, Simionescu R, Hajicek J, Thamm AMK, Salim V, De Luca V (2018) Solution of the multistep pathway for assembly ofcorynanthean, strychnos, iboga, and aspidosperma monoterpenoid indole alkaloids from 19E-geissoschizine. Proc Natl Acad Sci U S A115: 3180-3185


Qu Y, Safonova O, De Luca V (2019) Completion of the canonical pathway for assembly of anticancer drugs vincristine/vinblastine inCatharanthus roseus. Plant J 97: 257-266


Rensing SA, Lang D, Zimmer AD, Terry A, Salamov A, Shapiro H, Nishiyama T, Perroud P-F, Lindquist EA, Kamisugi Y (2008) The www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Matsui&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Matsui&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Mirjalili N%2C Linden JC %281996%29 Methyl jasmonate induced production of taxol in suspension cultures of Taxus cuspidata%3A ethylene interaction and induction models%2E Biotech Progress&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mirjalili&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Methyl jasmonate induced production of taxol in suspension cultures of Taxus cuspidata: ethylene interaction and induction models&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Methyl jasmonate induced production of taxol in suspension cultures of Taxus cuspidata: ethylene interaction and induction models&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mirjalili&as_ylo=1996&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Montavon T%2C Duboule D %282013%29 Chromatin organization and global regulation of Hox gene clusters%2E Philos Trans R Soc Lond B Biol Sci&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Montavon&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Chromatin organization and global regulation of Hox gene clusters.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Chromatin organization and global regulation of Hox gene clusters.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Montavon&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Nakano T%2C Suzuki K%2C Fujimura T%2C Shinshi H %282006%29 Genome%2Dwide analysis of the ERF gene family in Arabidopsis and rice%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nakano&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Genome-wide analysis of the ERF gene family in Arabidopsis and rice&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Genome-wide analysis of the ERF gene family in Arabidopsis and rice&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nakano&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Nakayasu M%2C Shioya N%2C Shikata M%2C Thagun C%2C Abdelkareem A%2C Okabe Y%2C Ariizumi T%2C Arimura GI%2C Mizutani M%2C Ezura H%2C Hashimoto T%2C Shoji T %282018%29 JRE4 is a master transcriptional regulator of defense%2Drelated steroidal glycoalkaloids in tomato%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nakayasu&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=JRE4 is a master transcriptional regulator of defense-related steroidal glycoalkaloids in tomato&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=JRE4 is a master transcriptional regulator of defense-related steroidal glycoalkaloids in tomato&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nakayasu&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=N�tzmann H%2DW%2C Osbourn A %282014%29 Gene clustering in plant specialized metabolism%2E Curr Opin Biotech&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nützmann&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Gene clustering in plant specialized metabolism&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Gene clustering in plant specialized metabolism&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nützmann&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=N�tzmann HW%2C Huang A%2C Osbourn A %282016%29 Plant metabolic clusters%26%23x2013%3Bfrom genetics to genomics%2E New Phytol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nützmann&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Plant metabolic clusters?from genetics to genomics&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Plant metabolic clusters?from genetics to genomics&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nützmann&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Patra B%2C Pattanaik S%2C Schluttenhofer C%2C Yuan L %282018%29 A network of jasmonate�?�responsive bHLH factors modulate monoterpenoid indole alkaloid biosynthesis in Catharanthus roseus%2E New Phytol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Patra&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=A network of jasmonateâ�?�responsive bHLH factors modulate monoterpenoid indole alkaloid biosynthesis in Catharanthus roseus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=A network of jasmonateâ�?�responsive bHLH factors modulate monoterpenoid indole alkaloid biosynthesis in Catharanthus roseus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Patra&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Pattanaik S%2C Kong Q%2C Zaitlin D%2C Werkman J%2C Xie C%2C Patra B%2C Yuan L %282010%29 Isolation and functional characterization of a floral tissue%2Dspecific R2R3 MYB regulator from tobacco%2E Planta&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pattanaik&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Isolation and functional characterization of a floral tissue-specific R2R3 MYB regulator from tobacco&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Isolation and functional characterization of a floral tissue-specific R2R3 MYB regulator from tobacco&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pattanaik&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Pattanaik S%2C Werkman JR%2C Kong Q%2C Yuan L %282010%29 Site%2DDirected Mutagenesis and Saturation Mutagenesis for the Functional Study of Transcription Factors Involved in Plant Secondary Metabolite Biosynthesis%2E In AG Fett%2DNeto%2C ed%2C Plant Secondary Metabolism Engineering%3A Methods and Applications%2E Humana Press%2C Totowa%2C NJ%2C pp&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pattanaik&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Site-Directed Mutagenesis and Saturation Mutagenesis for the Functional Study of Transcription Factors Involved in Plant Secondary Metabolite Biosynthesis.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Site-Directed Mutagenesis and Saturation Mutagenesis for the Functional Study of Transcription Factors Involved in Plant Secondary Metabolite Biosynthesis.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pattanaik&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Paul P%2C Singh SK%2C Patra B%2C Sui X%2C Pattanaik S%2C Yuan L %282017%29 A differentially regulated AP2%2FERF transcription factor gene cluster acts downstream of a MAP kinase cascade to modulate terpenoid indole alkaloid biosynthesis in Catharanthus roseus%2E New Phytol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Paul&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=A differentially regulated AP2/ERF transcription factor gene cluster acts downstream of a MAP kinase cascade to modulate terpenoid indole alkaloid biosynthesis in Catharanthus roseus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=A differentially regulated AP2/ERF transcription factor gene cluster acts downstream of a MAP kinase cascade to modulate terpenoid indole alkaloid biosynthesis in Catharanthus roseus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Paul&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Pauw B%2C Hilliou FAO%2C Martin VS%2C Chatel G%2C de Wolf CJF%2C Champion A%2C Pr� M%2C van Duijn B%2C Kijne JW%2C van der Fits L%2C Memelink J %282004%29 Zinc Finger Proteins Act as Transcriptional Repressors of Alkaloid Biosynthesis Genes in Catharanthus roseus%2E J Biol Chem&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pauw&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Zinc Finger Proteins Act as Transcriptional Repressors of Alkaloid Biosynthesis Genes in Catharanthus roseus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Zinc Finger Proteins Act as Transcriptional Repressors of Alkaloid Biosynthesis Genes in Catharanthus roseus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pauw&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Peebles CA%2C Hughes EH%2C Shanks JV%2C San KY %282009%29 Transcriptional response of the terpenoid indole alkaloid pathway to the overexpression of ORCA3 along with jasmonic acid elicitation of Catharanthus roseus hairy roots over time%2E Metab Eng&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Peebles&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Transcriptional response of the terpenoid indole alkaloid pathway to the overexpression of ORCA3 along with jasmonic acid elicitation of Catharanthus roseus hairy roots over time&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Transcriptional response of the terpenoid indole alkaloid pathway to the overexpression of ORCA3 along with jasmonic acid elicitation of Catharanthus roseus hairy roots over time&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Peebles&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Qu Y%2C Easson M%2C Simionescu R%2C Hajicek J%2C Thamm AMK%2C Salim V%2C De Luca V %282018%29 Solution of the multistep pathway for assembly of corynanthean%2C strychnos%2C iboga%2C and aspidosperma monoterpenoid indole alkaloids from 19E%2Dgeissoschizine%2E Proc Natl Acad Sci U S A&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Qu&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Solution of the multistep pathway for assembly of corynanthean, strychnos, iboga, and aspidosperma monoterpenoid indole alkaloids from 19E-geissoschizine&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Solution of the multistep pathway for assembly of corynanthean, strychnos, iboga, and aspidosperma monoterpenoid indole alkaloids from 19E-geissoschizine&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Qu&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Qu Y%2C Safonova O%2C De Luca V %282019%29 Completion of the canonical pathway for assembly of anticancer drugs vincristine%2Fvinblastine in Catharanthus roseus%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Qu&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Completion of the canonical pathway for assembly of anticancer drugs vincristine/vinblastine in Catharanthus roseus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Completion of the canonical pathway for assembly of anticancer drugs vincristine/vinblastine in Catharanthus roseus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Qu&as_ylo=2019&as_allsubj=all&hl=en&c2coff=1


Physcomitrella genome reveals evolutionary insights into the conquest of land by plants. Science 319: 64-69Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Sanchez-Perez R, Pavan S, Mazzeo R, Moldovan C, Aiese Cigliano R, Del Cueto J, Ricciardi F, Lotti C, Ricciardi L, Dicenta F, Lopez-Marques RL, Moller BL (2019) Mutation of a bHLH transcription factor allowed almond domestication. Science 364: 1095-1098


Schweizer F, Colinas M, Pollier J, Van Moerkercke A, Vanden Bossche R, de Clercq R, Goossens A (2018) An engineered combinatorialmodule of transcription factors boosts production of monoterpenoid indole alkaloids in Catharanthus roseus. Metab Eng 48: 150-162


Shen Q, Lu X, Yan T, Fu X, Lv Z, Zhang F, Pan Q, Wang G, Sun X, Tang K (2016) The jasmonate‐responsive AaMYC2 transcriptionfactor positively regulates artemisinin biosynthesis in Artemisia annua. New Phytol 210: 1269-1281


Shoji T, Hashimoto T (2011) Tobacco MYC2 regulates jasmonate-inducible nicotine biosynthesis genes directly and by way of the NIC2-locus ERF genes. Plant Cell Physiol 52: 1117-1130


Shoji T, Kajikawa M, Hashimoto T (2010) Clustered transcription factor genes regulate nicotine biosynthesis in tobacco. Plant Cell 22:3390-3409


Shoji T, Mishima M, Hashimoto T (2013) Divergent DNA-binding specificities of a group of ETHYLENE RESPONSE FACTORtranscription factors involved in plant defense. Plant Physiol 162: 977-990


Shoji T, Nakajima K, Hashimoto T (2000) Ethylene Suppresses Jasmonate-Induced Gene Expression in Nicotine Biosynthesis. Plantand Cell Physiology 41: 1072-1076


Suttipanta N, Pattanaik S, Gunjan S, Xie CH, Littleton J, Yuan L (2007) Promoter analysis of the Catharanthus roseus geraniol 10-hydroxylase gene involved in terpenoid indole alkaloid biosynthesis. Biochim Biophys Acta 1769: 139-148


Suttipanta N, Pattanaik S, Kulshrestha M, Patra B, Singh SK, Yuan L (2011) The Transcription Factor CrWRKY1 Positively Regulatesthe Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus. Plant Physiol 157: 2081-2093


Thagun C, Imanishi S, Kudo T, Nakabayashi R, Ohyama K, Mori T, Kawamoto K, Nakamura Y, Katayama M, Nonaka S, Matsukura C,Yano K, Ezura H, Saito K, Hashimoto T, Shoji T (2016) Jasmonate-Responsive ERF Transcription Factors Regulate SteroidalGlycoalkaloid Biosynthesis in Tomato. Plant Cell Physiol 57: 961-975


Udomsom N, Rai A, Suzuki H, Okuyama J, Imai R, Mori T, Nakabayashi R, Saito K, Yamazaki M (2016) Function of AP2/ERF TranscriptionFactors Involved in the Regulation of Specialized Metabolism in Ophiorrhiza pumila Revealed by Transcriptomics and Metabolomics.Front Plant Sci 7: 1861


van der Fits L, Memelink J (2000) ORCA3, a Jasmonate-Responsive Transcriptional Regulator of Plant Primary and SecondaryMetabolism. Science 289: 295-297


Van Der Fits L, Memelink J (2001) The jasmonate‐inducible AP2/ERF‐domain transcription factor ORCA3 activates gene expression viainteraction with a jasmonate‐responsive promoter element. Plant J 25: 43-53


van der Heijden R, Schripsema J, Verpoorte R (2004) The Catharanthus alkaloids: pharmacognosy and biotechnology. Curr Med Chem11: 607-628

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from

Copyright © 2019 American Society of Plant Biologists. All rights reserved.

https://www.ncbi.nlm.nih.gov/pubmed?term=Rensing SA%2C Lang D%2C Zimmer AD%2C Terry A%2C Salamov A%2C Shapiro H%2C Nishiyama T%2C Perroud P%2DF%2C Lindquist EA%2C Kamisugi Y %282008%29 The Physcomitrella genome reveals evolutionary insights into the conquest of land by plants%2E Science&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rensing&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The Physcomitrella genome reveals evolutionary insights into the conquest of land by plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The Physcomitrella genome reveals evolutionary insights into the conquest of land by plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rensing&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Sanchez%2DPerez R%2C Pavan S%2C Mazzeo R%2C Moldovan C%2C Aiese Cigliano R%2C Del Cueto J%2C Ricciardi F%2C Lotti C%2C Ricciardi L%2C Dicenta F%2C Lopez%2DMarques RL%2C Moller BL %282019%29 Mutation of a bHLH transcription factor allowed almond domestication%2E Science&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sanchez-Perez&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Mutation of a bHLH transcription factor allowed almond domestication&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Mutation of a bHLH transcription factor allowed almond domestication&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sanchez-Perez&as_ylo=2019&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Schweizer F%2C Colinas M%2C Pollier J%2C Van Moerkercke A%2C Vanden Bossche R%2C de Clercq R%2C Goossens A %282018%29 An engineered combinatorial module of transcription factors boosts production of monoterpenoid indole alkaloids in Catharanthus roseus%2E Metab Eng&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schweizer&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=An engineered combinatorial module of transcription factors boosts production of monoterpenoid indole alkaloids in Catharanthus roseus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=An engineered combinatorial module of transcription factors boosts production of monoterpenoid indole alkaloids in Catharanthus roseus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schweizer&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Shen Q%2C Lu X%2C Yan T%2C Fu X%2C Lv Z%2C Zhang F%2C Pan Q%2C Wang G%2C Sun X%2C Tang K %282016%29 The jasmonate�?�responsive AaMYC2 transcription factor positively regulates artemisinin biosynthesis in Artemisia annua%2E New Phytol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shen&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The jasmonateâ�?�responsive AaMYC2 transcription factor positively regulates artemisinin biosynthesis in Artemisia annua&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The jasmonateâ�?�responsive AaMYC2 transcription factor positively regulates artemisinin biosynthesis in Artemisia annua&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shen&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Shoji T%2C Hashimoto T %282011%29 Tobacco MYC2 regulates jasmonate%2Dinducible nicotine biosynthesis genes directly and by way of the NIC2%2Dlocus ERF genes%2E Plant Cell Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Shoji&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Tobacco MYC2 regulates jasmonate-inducible nicotine biosynthesis genes directly and by way of the NIC2-locus ERF genes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Tobacco MYC2 regulates jasmonate-inducible nicotine biosynthesis genes directly and by way of the NIC2-locus ERF genes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shoji&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Shoji T%2C Kajikawa M%2C Hashimoto T %282010%29 Clustered transcription factor genes regulate nicotine biosynthesis in tobacco%2E Plant Cell&dopt=abstract


https://scholar.google.com/scholar?as_q=Clustered transcription factor genes regulate nicotine biosynthesis in tobacco&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Clustered transcription factor genes regulate nicotine biosynthesis in tobacco&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shoji&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Shoji T%2C Mishima M%2C Hashimoto T %282013%29 Divergent DNA%2Dbinding specificities of a group of ETHYLENE RESPONSE FACTOR transcription factors involved in plant defense%2E Plant Physiol&dopt=abstract


https://scholar.google.com/scholar?as_q=Divergent DNA-binding specificities of a group of ETHYLENE RESPONSE FACTOR transcription factors involved in plant defense&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Divergent DNA-binding specificities of a group of ETHYLENE RESPONSE FACTOR transcription factors involved in plant defense&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shoji&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Shoji T%2C Nakajima K%2C Hashimoto T %282000%29 Ethylene Suppresses Jasmonate%2DInduced Gene Expression in Nicotine Biosynthesis%2E Plant and Cell Physiology&dopt=abstract


https://scholar.google.com/scholar?as_q=Ethylene Suppresses Jasmonate-Induced Gene Expression in Nicotine Biosynthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Ethylene Suppresses Jasmonate-Induced Gene Expression in Nicotine Biosynthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Shoji&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Suttipanta N%2C Pattanaik S%2C Gunjan S%2C Xie CH%2C Littleton J%2C Yuan L %282007%29 Promoter analysis of the Catharanthus roseus geraniol 10%2Dhydroxylase gene involved in terpenoid indole alkaloid biosynthesis%2E Biochim Biophys Acta&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Suttipanta&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Promoter analysis of the Catharanthus roseus geraniol 10-hydroxylase gene involved in terpenoid indole alkaloid biosynthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Promoter analysis of the Catharanthus roseus geraniol 10-hydroxylase gene involved in terpenoid indole alkaloid biosynthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Suttipanta&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Suttipanta N%2C Pattanaik S%2C Kulshrestha M%2C Patra B%2C Singh SK%2C Yuan L %282011%29 The Transcription Factor CrWRKY1 Positively Regulates the Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Suttipanta&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The Transcription Factor CrWRKY1 Positively Regulates the Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The Transcription Factor CrWRKY1 Positively Regulates the Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Suttipanta&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Thagun C%2C Imanishi S%2C Kudo T%2C Nakabayashi R%2C Ohyama K%2C Mori T%2C Kawamoto K%2C Nakamura Y%2C Katayama M%2C Nonaka S%2C Matsukura C%2C Yano K%2C Ezura H%2C Saito K%2C Hashimoto T%2C Shoji T %282016%29 Jasmonate%2DResponsive ERF Transcription Factors Regulate Steroidal Glycoalkaloid Biosynthesis in Tomato%2E Plant Cell Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Thagun&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Jasmonate-Responsive ERF Transcription Factors Regulate Steroidal Glycoalkaloid Biosynthesis in Tomato&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Jasmonate-Responsive ERF Transcription Factors Regulate Steroidal Glycoalkaloid Biosynthesis in Tomato&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Thagun&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Udomsom N%2C Rai A%2C Suzuki H%2C Okuyama J%2C Imai R%2C Mori T%2C Nakabayashi R%2C Saito K%2C Yamazaki M %282016%29 Function of AP2%2FERF Transcription Factors Involved in the Regulation of Specialized Metabolism in Ophiorrhiza pumila Revealed by Transcriptomics and Metabolomics%2E Front Plant Sci&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Udomsom&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Function of AP2/ERF Transcription Factors Involved in the Regulation of Specialized Metabolism in Ophiorrhiza pumila Revealed by Transcriptomics and Metabolomics.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Function of AP2/ERF Transcription Factors Involved in the Regulation of Specialized Metabolism in Ophiorrhiza pumila Revealed by Transcriptomics and Metabolomics.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Udomsom&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=van der Fits L%2C Memelink J %282000%29 ORCA3%2C a Jasmonate%2DResponsive Transcriptional Regulator of Plant Primary and Secondary Metabolism%2E Science&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=van&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=van&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Van Der Fits L%2C Memelink J %282001%29 The jasmonate�?�inducible AP2%2FERF�?�domain transcription factor ORCA3 activates gene expression via interaction with a jasmonate�?�responsive promoter element%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Van&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The jasmonateâ�?�inducible AP2/ERFâ�?�domain transcription factor ORCA3 activates gene expression via interaction with a jasmonateâ�?�responsive promoter element&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The jasmonateâ�?�inducible AP2/ERFâ�?�domain transcription factor ORCA3 activates gene expression via interaction with a jasmonateâ�?�responsive promoter element&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Van&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=van der Heijden R%2C Schripsema J%2C Verpoorte R %282004%29 The Catharanthus alkaloids%3A pharmacognosy and biotechnology%2E Curr Med Chem&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=van&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The Catharanthus alkaloids: pharmacognosy and biotechnology&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The Catharanthus alkaloids: pharmacognosy and biotechnology&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=van&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1


Google Scholar: Author Only Title Only Author and Title

Van Moerkercke A, Steensma P, Gariboldi I, Espoz J, Purnama PC, Schweizer F, Miettinen K, Vanden Bossche R, De Clercq R,Memelink J, Goossens A (2016) The basic helix-loop-helix transcription factor BIS2 is essential for monoterpenoid indole alkaloidproduction in the medicinal plant Catharanthus roseus. Plant J 88: 3-12


Van Moerkercke A, Steensma P, Schweizer F, Pollier J, Gariboldi I, Payne R, Vanden Bossche R, Miettinen K, Espoz J, Purnama PC,Kellner F, Seppanen-Laakso T, O'Connor SE, Rischer H, Memelink J, Goossens A (2015) The bHLH transcription factor BIS1 controlsthe iridoid branch of the monoterpenoid indole alkaloid pathway in Catharanthus roseus. Proc Natl Acad Sci U S A 112: 8130-8135


Wang C-T, Liu H, Gao X-S, Zhang H-X (2010) Overexpression of G10H and ORCA3 in the hairy roots of Catharanthus roseus improvescatharanthine production. Plant Cell Rep 29: 887-894


Williams D, Qu Y, Simionescu R, De Luca V (2019) The assembly of (+)-vincadifformine- and (-)-tabersonine-derived monoterpenoidindole alkaloids in Catharanthus roseus involves separate branch pathways. Plant J 99: 626-636


Winz RA, Baldwin IT (2001) Molecular Interactions between the Specialist Herbivore Manduca sexta (Lepidoptera, Sphingidae) and ItsNatural Host Nicotiana attenuata. IV. Insect-Induced Ethylene Reduces Jasmonate-Induced Nicotine Accumulation by RegulatingPutrescine N-Methyltransferase Transcripts. Plant Physiol 125: 2189-2202


Yang SH, Berberich T, Sano H, Kusano T (2001) Specific association of transcripts of tbzF and tbz17, tobacco genes encoding basicregion leucine zipper-type transcriptional activators, with guard cells of senescing leaves and/or flowers. Plant Physiol 127: 23-32


Yu Z-X, Li J-X, Yang C-Q, Hu W-L, Wang L-J, Chen X-Y (2012) The jasmonate-responsive AP2/ERF transcription factors AaERF1 andAaERF2 positively regulate artemisinin biosynthesis in Artemisia annua L. Mol Plant 5: 353-365


Zhang H, Koes R, Shang H, Fu Z, Wang L, Dong X, Zhang J, Passeri V, Li Y, Jiang H, Gao J, Li Y, Wang H, Quattrocchio FM (2019)Identification and functional analysis of three new anthocyanin R2R3-MYB genes in Petunia. Plant Direct 3: e00114


Zhang P, Chopra S, Peterson T (2000) A segmental gene duplication generated differentially expressed myb-homologous genes inmaize. Plant Cell 12: 2311-2322


Zhang X, Fowler SG, Cheng H, Lou Y, Rhee SY, Stockinger EJ, Thomashow MF (2004) Freezing-sensitive tomato has a functional CBFcold response pathway, but a CBF regulon that differs from that of freezing-tolerant Arabidopsis. Plant J 39: 905-919


Zhao J, Zheng SH, Fujita K, Sakai K (2004) Jasmonate and ethylene signalling and their interaction are integral parts of the elicitorsignalling pathway leading to β‐thujaplicin biosynthesis in Cupressus lusitanica cell cultures. J Exp Bot 55: 1003-1012


Zhou M-L, Zhu X-M, Shao J-R, Wu Y-M, Tang Y-X (2010) Transcriptional response of the catharanthine biosynthesis pathway to methyljasmonate/nitric oxide elicitation in Catharanthus roseus hairy root culture. Appl Microbiol Biotechnol 88: 737-750



https://www.ncbi.nlm.nih.gov/pubmed?term=Van Moerkercke A%2C Steensma P%2C Gariboldi I%2C Espoz J%2C Purnama PC%2C Schweizer F%2C Miettinen K%2C Vanden Bossche R%2C De Clercq R%2C Memelink J%2C Goossens A %282016%29 The basic helix%2Dloop%2Dhelix transcription factor BIS2 is essential for monoterpenoid indole alkaloid production in the medicinal plant Catharanthus roseus%2E Plant J&dopt=abstract


https://scholar.google.com/scholar?as_q=The basic helix-loop-helix transcription factor BIS2 is essential for monoterpenoid indole alkaloid production in the medicinal plant Catharanthus roseus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The basic helix-loop-helix transcription factor BIS2 is essential for monoterpenoid indole alkaloid production in the medicinal plant Catharanthus roseus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Van&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Van Moerkercke A%2C Steensma P%2C Schweizer F%2C Pollier J%2C Gariboldi I%2C Payne R%2C Vanden Bossche R%2C Miettinen K%2C Espoz J%2C Purnama PC%2C Kellner F%2C Seppanen%2DLaakso T%2C O%27Connor SE%2C Rischer H%2C Memelink J%2C Goossens A %282015%29 The bHLH transcription factor BIS1 controls the iridoid branch of the monoterpenoid indole alkaloid pathway in Catharanthus roseus%2E Proc Natl Acad Sci U S A&dopt=abstract


https://scholar.google.com/scholar?as_q=The bHLH transcription factor BIS1 controls the iridoid branch of the monoterpenoid indole alkaloid pathway in Catharanthus roseus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The bHLH transcription factor BIS1 controls the iridoid branch of the monoterpenoid indole alkaloid pathway in Catharanthus roseus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Van&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Wang C%2DT%2C Liu H%2C Gao X%2DS%2C Zhang H%2DX %282010%29 Overexpression of G10H and ORCA3 in the hairy roots of Catharanthus roseus improves catharanthine production%2E Plant Cell Rep&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wang&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Overexpression of G10H and ORCA3 in the hairy roots of Catharanthus roseus improves catharanthine production&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Overexpression of G10H and ORCA3 in the hairy roots of Catharanthus roseus improves catharanthine production&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Williams D%2C Qu Y%2C Simionescu R%2C De Luca V %282019%29 The assembly of %28%2B%29%2Dvincadifformine%2D and %28%2D%29%2Dtabersonine%2Dderived monoterpenoid indole alkaloids in Catharanthus roseus involves separate branch pathways%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Williams&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The assembly of (+)-vincadifformine- and (-)-tabersonine-derived monoterpenoid indole alkaloids in Catharanthus roseus involves separate branch pathways&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The assembly of (+)-vincadifformine- and (-)-tabersonine-derived monoterpenoid indole alkaloids in Catharanthus roseus involves separate branch pathways&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Williams&as_ylo=2019&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Winz RA%2C Baldwin IT %282001%29 Molecular Interactions between the Specialist Herbivore Manduca sexta %28Lepidoptera%2C Sphingidae%29 and Its Natural Host Nicotiana attenuata%2E IV%2E Insect%2DInduced Ethylene Reduces Jasmonate%2DInduced Nicotine Accumulation by Regulating Putrescine N%2DMethyltransferase Transcripts%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Winz&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Molecular Interactions between the Specialist Herbivore Manduca sexta (Lepidoptera, Sphingidae) and Its Natural Host Nicotiana attenuata&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Molecular Interactions between the Specialist Herbivore Manduca sexta (Lepidoptera, Sphingidae) and Its Natural Host Nicotiana attenuata&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Winz&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Yang SH%2C Berberich T%2C Sano H%2C Kusano T %282001%29 Specific association of transcripts of tbzF and tbz17%2C tobacco genes encoding basic region leucine zipper%2Dtype transcriptional activators%2C with guard cells of senescing leaves and%2For flowers%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yang&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yang&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Yu Z%2DX%2C Li J%2DX%2C Yang C%2DQ%2C Hu W%2DL%2C Wang L%2DJ%2C Chen X%2DY %282012%29 The jasmonate%2Dresponsive AP2%2FERF transcription factors AaERF1 and AaERF2 positively regulate artemisinin biosynthesis in Artemisia annua L%2E Mol Plant&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yu&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The jasmonate-responsive AP2/ERF transcription factors AaERF1 and AaERF2 positively regulate artemisinin biosynthesis in Artemisia annua L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The jasmonate-responsive AP2/ERF transcription factors AaERF1 and AaERF2 positively regulate artemisinin biosynthesis in Artemisia annua L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yu&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Zhang H%2C Koes R%2C Shang H%2C Fu Z%2C Wang L%2C Dong X%2C Zhang J%2C Passeri V%2C Li Y%2C Jiang H%2C Gao J%2C Li Y%2C Wang H%2C Quattrocchio FM %282019%29 Identification and functional analysis of three new anthocyanin R2R3%2DMYB genes in Petunia%2E Plant Direct 3%3A e&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Identification and functional analysis of three new anthocyanin R2R3-MYB genes in Petunia.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Identification and functional analysis of three new anthocyanin R2R3-MYB genes in Petunia.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2019&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Zhang P%2C Chopra S%2C Peterson T %282000%29 A segmental gene duplication generated differentially expressed myb%2Dhomologous genes in maize%2E Plant Cell&dopt=abstract


https://scholar.google.com/scholar?as_q=A segmental gene duplication generated differentially expressed myb-homologous genes in maize&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=A segmental gene duplication generated differentially expressed myb-homologous genes in maize&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Zhang X%2C Fowler SG%2C Cheng H%2C Lou Y%2C Rhee SY%2C Stockinger EJ%2C Thomashow MF %282004%29 Freezing%2Dsensitive tomato has a functional CBF cold response pathway%2C but a CBF regulon that differs from that of freezing%2Dtolerant Arabidopsis%2E Plant J&dopt=abstract


https://scholar.google.com/scholar?as_q=Freezing-sensitive tomato has a functional CBF cold response pathway, but a CBF regulon that differs from that of freezing-tolerant Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Freezing-sensitive tomato has a functional CBF cold response pathway, but a CBF regulon that differs from that of freezing-tolerant Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Zhao J%2C Zheng SH%2C Fujita K%2C Sakai K %282004%29 Jasmonate and ethylene signalling and their interaction are integral parts of the elicitor signalling pathway leading to β�?�thujaplicin biosynthesis in Cupressus lusitanica cell cultures%2E J Exp Bot&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhao&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Jasmonate and ethylene signalling and their interaction are integral parts of the elicitor signalling pathway leading to �?²â�?�thujaplicin biosynthesis in Cupressus lusitanica cell cultures&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Jasmonate and ethylene signalling and their interaction are integral parts of the elicitor signalling pathway leading to �?²â�?�thujaplicin biosynthesis in Cupressus lusitanica cell cultures&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhao&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Zhou M%2DL%2C Zhu X%2DM%2C Shao J%2DR%2C Wu Y%2DM%2C Tang Y%2DX %282010%29 Transcriptional response of the catharanthine biosynthesis pathway to methyl jasmonate%2Fnitric oxide elicitation in Catharanthus roseus hairy root culture%2E Appl Microbiol Biotechnol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhou&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Transcriptional response of the catharanthine biosynthesis pathway to methyl jasmonate/nitric oxide elicitation in Catharanthus roseus hairy root culture&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Transcriptional response of the catharanthine biosynthesis pathway to methyl jasmonate/nitric oxide elicitation in Catharanthus roseus hairy root culture&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhou&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1


Date post:	19-Jan-2020
Category:	Documents
Upload:	others
View:	6 times
Download:	0 times

Short title: Intra-cluster and mutual regulation of AP2/ERFs · 54 NICOTINE2 (NIC2) ERF cluster....

Documents