© 2017. Published by The Company of Biologists Ltd.
Signal motifs-dependent ER export of Qc-SNARE BET12 interacts with MEMB12
and affects PR1 trafficking in Arabidopsis
Kin Pan Chunga, Yonglun Zenga, Yimin Lib, Changyang Jia, Yiji Xiab and Liwen
Jianga,c,1
a School of Life Sciences, Centre for Cell & Developmental Biology and State Key
Laboratory of Agrobiotechnology, The Chinese University of Hong Kong, Shatin, New
Territories, Hong Kong, China
b Department of Biology, Hong Kong Baptist University, Hong Kong, China
c The Chinese University of Hong Kong Shenzhen Research Institute, Shenzhen
518057, China
1To whom correspondence should be addressed.
Professor Liwen Jiang
School of Life Sciences, The Chinese University of Hong Kong, Shatin, New
Territories, Hong Kong, China
Tel: 852-3943-6388
Email: [email protected]
Keywords:
BET12; ER export; PR1; protein trafficking; SNARE
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
JCS Advance Online Article. Posted on 25 May 2017
SUMMARY STATEMENT
Efficient targeting of Qc-SNARE BET12 is dependent on two distinct signal motifs.
BET12 interacts with Qb-SNARE MEMB12 and regulates pathogenesis-related
protein1 trafficking in the early secretory pathway in Arabidopsis thaliana.
ABSTRACT
SNAREs are well-known for their role in controlling membrane fusion, the final but
crucial step for vesicular transport in eukaryotes. SNARE proteins contribute to various
biological processes including pathogen defense, channel activity regulation as well
as plant growth and development. Precise targeting of SNARE proteins to destined
compartments is a prerequisite for their proper functioning. However, the underlying
mechanism(s) for SNAREs targeting in plants remains obscure. Here we investigate
the targeting mechanism of the Qc-SNARE BET12, which is involved in protein
trafficking in the early secretory pathway. Two distinct signal motifs that are required
for efficient BET12 ER export have been identified. Pull down assays and in vivo
imaging have implicated a BET12-dependency on both the COPI and COPII pathways
for its targeting. Further studies using an ER-export defective form of BET12 revealed
the Golgi-localized Qb-SNARE MEMB12, a negative regulator of pathogenesis-related
protein1 (PR1) secretion, as its interacting partner. Ectopic expression of BET12
showed no inhibition in the general ER-Golgi anterograde transport but caused
intracellular accumulation of PR1, suggesting the regulatory role of BET12 in PR1
trafficking in Arabidopsis thaliana.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
INTRODUCTION
Compartmentalization of cells in eukaryotes presupposes the development of
mechanisms for protein trafficking between different membrane-enclosed organelles.
Vesicular transport is the predominant pathway for protein trafficking in eukaryotic cells.
Multiple molecular machineries are required for the formation, transport, tethering and
fusion of the vesicles to the target compartment (Bonifacino and Glick, 2004). SNAREs
(soluble N-ethylmaleimide-sensitive fusion protein attachment protein receptors) have
been identified as critical components involved in the final fusion step for the vesicular
transport pathways (Sollner et al., 1993). These facilitate vesicle-target membrane
fusion by forming hetero-tetrameric trans-SNARE complexes derived from a specific
set of SNARE proteins (Jahn and Scheller, 2006; McNew et al., 2000).
A large number of SNARE proteins are encoded in the plant genome (Sanderfoot,
2007; Sanderfoot et al., 2000). Numerous studies have unraveled the important role
of SNARE proteins in plants, involving various biological processes including pathogen
defense, cytokinesis, abiotic stress, cell expansion, symbiosis, gravitropism,
gametophyte and seed development (Ebine et al., 2008; El-Kasmi et al., 2011; Grefen
et al., 2010; Hachez et al., 2014; Honsbein et al., 2009; Huisman et al., 2016; Pan et
al., 2016; Reichardt et al., 2007; Uemura et al., 2012b; Yano et al., 2003). The precise
targeting of SNARE proteins to a distinct compartment is essential for mediating the
vesicle-target membrane fusions which secures an efficient and accurate protein
trafficking. Mis-targeting of SNARE proteins results in numerous cellular defects. For
instance, the cell plate formation was disrupted in the mutant with an impaired
trafficking of the syntaxin KNOLLE (Park et al., 2013; Teh et al., 2013). In addition, a
recent study has revealed the novel role of the endoplasmic reticulum (ER) associated
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
SNARE SYP73 in maintaining the ER integrity and consequently streaming since
these features were altered in syp73 mutant (Cao et al., 2016). Therefore, correct
localization of SNARE proteins seems to be a prerequisite for their proper functioning
in different cellular processes.
Most SNARE proteins are tail-anchored (TA) proteins, their membrane association
being conferred by the C-terminal transmembrane domain (TMD). TA proteins are
post-translationally inserted into the membrane through the Guided-Entry of TA
proteins (GET) pathway (Schuldiner et al., 2008; Stefanovic and Hegde, 2007). Recent
studies have demonstrated the functional GET components for TA protein targeting in
Arabidopsis (Xing et al., 2017), by which the SNARE SYP72 is inserted into the ER
membrane through the GET pathway (Srivistava et al., 2016). Once translocated into
the ER, further targeting of membrane proteins is determined by either specific signal
motifs, the length of TMD or a combination of both (Brandizzi et al., 2002; Hanton et
al., 2006; Hanton et al., 2005b; Matheson et al., 2006; Rojo and Denecke, 2008; Saint-
Jore-Dupas et al., 2006). In the early secretory pathway of plants proteins which are
exported from the ER and traffic to the Golgi are mediated by coat protein complex II
(COPII) machinery (Brandizzi and Barlowe, 2013; DaSilva et al., 2004; Hawes et al.,
2008; Moreau et al., 2007; Robinson et al., 2015; Stefano et al., 2014). According to
the model in yeast and mammals, the formation of COPII vesicles is initiated by the
recruitment of the small GTPase SAR1 to the ER membrane. Activated SAR1 then
recruits the inner coat dimeric complex SEC23-24 which captures protein cargos.
Subsequent recruitment of the outer-coat complex SEC13-31 stimulates the GTP-
hydrolysis of activated SAR1, and eventually leads to the formation of COPII carriers
containing protein cargos to be exported (Bassham et al., 2008; Chung et al., 2016;
Hwang and Robinson, 2009; Marti et al., 2010). Among the Golgi-localized SNARE
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
proteins (Uemura et al., 2004), SYP31 and MEMB11 have been reported to have a
critical role in mediating ER-Golgi anterograde transport (Bubeck et al., 2008; Chatre
et al., 2005). Although the role of SNARE proteins in the early secretory pathway have
been investigated, the mechanism for SNARE targeting to the Golgi membrane
remains elusive. Until now, only a single study has demonstrated that ER export and
Golgi targeting of SYP31 depends on the di-acidic motif in its N-terminus (Chatre et
al., 2009).
In the present study, we aim to elucidate the targeting mechanism and the functional
role of the Qc-SNARE BET12 (also termed Bs14b) in the early secretory pathway.
Previous studies suggested that BET12 is involved in plant fertility and displayed a
Golgi localization in Arabidopsis protoplasts (Bolanos-Villegas et al., 2015). BET11
(also termed Bs14a), shares a 78% amino acid similarity to BET12, and was also
suggested to localize on Golgi membranes (Uemura et al., 2004). Unlike SYP31 and
MEMB11, BET11 overexpression did not severely affect protein ER-Golgi anterograde
transport (Bubeck et al., 2008; Chatre et al., 2005). Strikingly, an in vitro study in yeast
suggested that BET11 and BET12 tend to form a distinct quaternary SNARE complex
with different yeast Golgi SNAREs, as BET11 resembled the Sft1p SNARE binding
profile while BET12 resembled that of Bet1p (Tai and Banfield, 2001). In order to
characterize the role of BET12 in ER-Golgi protein trafficking, we first determined the
subcellular localization of BET12 in transgenic plants and uncovered its signal motifs-
dependent targeting mechanism for efficient ER export. We further identified the Qb-
SNARE MEMB12 as the interacting partner of BET12 and implicated their function in
regulating the secretion of pathogenesis-related protein 1 (PR1) in Arabidopsis.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
RESULTS
Golgi and trans-Golgi network localization of BET12 in transgenic Arabidopsis
plants
To determine the subcellular localization of BET12, we generated transgenic plants
expressing N-terminally yellow fluorescent protein (YFP) tagged BET12 (YFP-BET12)
driven by the UBQ10 promoter. Confocal laser scanning microscopy (CLSM) analysis
revealed a punctate distribution pattern of YFP-BET12 in Arabidopsis root cells.
Immunofluorescence labeling using antibodies of organelle-specific markers was
performed and revealed that YFP-BET12 was partially colocalized with the Golgi
marker anti-EMP12 and the trans-Golgi network (TGN) marker anti-SYP61 but was
distinct from the ER marker anti-calreticulin (Fig. 1A-C), suggesting that YFP-BET12
localizes to both the Golgi and TGN.
Previous studies reported that the fungal toxin Brefeldin A (BFA) causes aggregation
of both Golgi and TGN, which the Golgi-derived and TGN-derived aggregates are
distinct from each other (Lam et al., 2009; Zhang et al., 2011a). To further prove the
localization of YFP-BET12, we carried out BFA treatment followed by the styryl dye
FM4-64 uptake experiment, since the dye can be used as an endocytic tracer to label
endosomal compartments including the TGN (Bolte et al., 2004), using transgenic
plants expressing ST-YFP (trans-Golgi marker), VHAa1-GFP (TGN marker) and YFP-
BET12. After BFA treatment, VHAa1-GFP was found in the dense core aggregates
termed BFA bodies together with FM4-64 while ST-YFP was distinctly found at the
periphery of the FM4-64 labeled BFA body (Fig. S1A, B). Line plots were constructed
to show the corresponding fluorescence intensity along the BFA-induced aggregates.
From these the VHAa1-GFP peak was seen to completely overlap with the FM4-64
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
peak whereas the ST-YFP peak was largely separate from the FM4-64 peak (Fig. S1A,
B). Similarly, the fluorescence pattern of YFP-BET12 changed from punctate to
aggregates upon BFA treatment (Fig. 1D). But, unlike ST-YFP and VHAa1-GFP, the
YFP-BET12 aggregate was not only found in the dense core FM4-64 aggregate but
also at its periphery (Fig. 1D). Fluorescence intensity line plots along the YFP-BET12
aggregate showed a different distribution pattern from the ST-YFP and VHAa1-GFP in
that the YFP-BET12 signal intensity remained high in both the periphery and the core
region of the FM4-64 peak (Fig. 1E), indicating that YFP-BET12 is being trapped in
both the Golgi-derived and TGN-derived aggregates.
To further confirm the localization of YFP-BET12 from the CLSM analysis, we
performed immunogold electron microscopy (EM) with GFP antibodies on ultrathin
sections prepared from high-pressure frozen/freeze substituted root cells of transgenic
Arabidopsis seedlings expressing YFP-BET12. Consistent with our confocal findings,
EM observations showed that gold particles (anti-GFP) were present on both the Golgi
stacks as well as the associated TGN (Fig. 1F). Quantification of immunogold labeling
indicated that around 37% and 52% of the gold particles are associated with the Golgi
(including both the cis- and trans-side) and TGN respectively (Fig. 1G). Taken together,
CLSM and EM studies demonstrated that YFP-BET12 localized on both the Golgi and
TGN in transgenic Arabidopsis plants.
BET12 is an integral membrane protein with an N-terminus facing the cytosol
In order to elucidate the BET12 targeting mechanism, we first needed to know its
protein topology. Most SNARE proteins are type II membrane protein, with the N-
terminus that contains the SNARE motif exposed to the cytosol and with a C-terminal
TMD. To determine if BET12 is a membrane protein, total proteins were extracted from
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Arabidopsis cell expressing YFP-BET12 and were then separated into soluble and
membrane fraction by ultracentrifugation. Immunoblot analysis using GFP antibodies
showed that YFP-BET12 was found in the membrane fraction but not the soluble
fraction (Fig. S2A, lane 1 and 2). To distinguish integral from peripheral membrane
protein, microsomes isolated were then subjected to high salt, high pH and detergent
washes, followed by immunoblotting with GFP antibodies. The reliability of the assay
was verified by using anti-VSR, as it is known to be an integral membrane protein
(Paris et al., 1997). Immunoblot analysis showed that YFP-BET12 remained
associated with microsomal membrane under high salt and high pH condition but
released to the soluble fraction upon detergent washes (Fig. S2A, lane 3 – 10). The
response of YFP-BET12 towards different conditions was similar to that of VSR,
indicating that BET12 is most likely to be an integral membrane protein.
By sequence analysis, BET12 is predicted to have a typical SNARE topology using
TMHMM server 2.0 (Fig. S2B). To determine if the YFP-BET12 fusion retains the same
topology, we carried out a protease protection assay using microsomes isolated from
Arabidopsis cells expressing YFP-BET12, followed by immunoblotting with GFP
antibodies. GFP-VSR2, a membrane protein with a known topology that the N-
terminus is facing into the lumen (Cai et al., 2011), was used as a control in this assay.
No band was detected in the immunoblot analysis of YFP-BET12 in the presence of
the protease trypsin, indicating that the N-terminus together with the YFP face the
cytosol and can therefore be digested by trypsin (Fig. S2C, lane 2). By contrast, a
band was detected in the immunoblot of GFP-VSR2, showing that its lumen-facing N-
terminus was protected from trypsin digestion (Fig. S2C, lane 5). As expected, no band
could be detected for YFP-BET12 and GFP-VSR2 in the presence of both trypsin and
Triton X-100 (Fig. S2C, lane 3 and 6). The results from these biochemical assays
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
suggest that YFP-BET12 is an integral membrane protein, which maintains a typical
SNARE topology with its N-terminus facing the cytosol.
The N-terminal region and the region in-between the SNARE motif and the TMD
are important for BET12 trafficking
With the determined BET12 protein topology, we next generated various
truncation/deletion versions of YFP-BET12, followed by transient expression using
Arabidopsis protoplasts to identify the regions that are responsible for BET12
trafficking. Upon transient expression of YFP-BET12 with organelle-specific markers,
CLSM analysis showed that YFP-BET12 partially colocalized with the Golgi marker
Man1-RFP and TGN marker mRFP-SYP61 (Fig. 2A, B). As YFP-BET12 displayed a
partial Golgi and TGN localization in both the transiently expressed protoplasts and
the transgenic plants, we decided to use the transient setup to screen for targeting
defects caused by truncation/deletion of YFP-BET12. We first deleted the whole
cytosolic N-terminus of BET12 to determine its effect in trafficking. CLSM analysis
showed that YFP-BET12(107-130) colocalized with the ER marker CNX-RFP and
displayed an ER pattern (Fig. 2C), indicating that the presence of the TMD with its C-
terminus is not sufficient for its ER export, while the cytosolic N-terminal probably
contains ER export signals. Since in previous studies the SNARE motif has been
suggested to play a role in SNARE targeting (Joglekar et al., 2003), we therefore
deleted the BET12 SNARE motif to test for any targeting defect. Upon transient
expression, YFP-BET12(1-32)(98-130) showed a punctate pattern which colocalized
with Man1-RFP (Fig. 2D), suggesting that SNARE motif is not essential for BET12 ER
export. To identify the region containing the ER export signals, we further deleted the
nine amino acids (a.a.) between the SNARE motif and the TMD. Interestingly, instead
of only showing a punctate pattern, YFP-BET12(1-32)(107-130) partially colocalized
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
with CNX-RFP and displayed an ER pattern as well (Fig. 2E). This result implicates
that the very N-terminus (a.a. 1-32) contains ER export signal and aids in targeting to
the Golgi which lead to the punctate pattern (Fig. 2F). The deletion of the nine amino
acids (a.a. 98-106) inhibits ER export to some extent, thus leading to the appearance
of the ER pattern. Similarly, the presence of both the punctate and ER pattern was
also observed when expressing YFP-BET12(98-130) (Fig. 2G, H), supporting the
notion that the nine amino acids (a.a. 98-106) also contain the ER export signal and
aid in BET12 targeting, while the absence of the very N-terminus (a.a. 1-32) hampers
its ER export efficiency. Taken together, in vivo expression of truncated/deleted
versions of YFP-BET12 revealed that both the N-terminus (a.a. 1-32) and the region
between the SNARE motif and TMD (a.a. 98-106) of BET12 contain ER export signals
and are responsible for its efficient trafficking.
BET12 trafficking depends on functional COPI and COPII machineries
To elucidate the mechanism of BET12 trafficking, we made use of the region identified
containing the ER export signals to find out the potential interaction partners and the
related trafficking machinery. A synthetic peptide of the nine amino acids (a.a. 98-106
containing the ER export motif) was conjugated onto Sepharose beads as bait for pull
down experiments. Sepharose beads conjugated with/without nine amino acids were
incubated with total proteins extracted from Arabidopsis suspension cells. After
washing, proteins were eluted from the beads and subjected to SDS-PAGE followed
by silver staining (Fig. 3A). In duplicate experiments, intense bands that were
repeatedly observed in the lane with the conjugated peptide but not with the empty
Sepharose were isolated for tandem mass spectrometry (MS/MS) analysis. MS/MS
analysis showed that certain proteins pulled out by the nine amino acid peptide were
identified as components of the COPI (ε-COP and ζ-COP) and COPII (Sar1)
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
machineries (Table S1). It has been reported that COPI and COPII machinery are
important for regulating ER-to-Golgi protein trafficking (Gao et al., 2014; Hanton et al.,
2005a; Paul and Frigerio, 2007). As a Golgi-localized SNARE, BET12 likely interacts
with the COPI and COPII machinery components to maintain its proper localization.
To determine if this is indeed the case we transiently expressed YFP-BET12 together
with the GDP-fixed mutant form of ADP-ribosylation factor 1 (Arf1-GDP), which
interferes with the COPI machinery (Pimpl et al., 2003; Takeuchi et al., 2002); and with
the GTP-locked version of SAR1 (SAR1-GTP) mutant, which interferes with the COPII
machinery and inhibits protein export from the ER (Osterrieder et al., 2010; Takeuchi
et al., 2000; Zeng et al., 2015). CLSM analysis showed that YFP-BET12 relocated to
the ER and colocalized with the ER marker CNX-RFP upon co-expression with Arf1-
GDP (Fig. 3B). Similarly, YFP-BET12 displayed an ER pattern when co-expressed
with the SAR1 GTP-locked mutant form Sar1C-DN-RFP, indicating its failure in ER
export when the COPII machinery is disrupted (Fig. 3C). Pull down MS/MS analysis,
together with the evidence obtained from in vivo cell biological study, suggested that
BET12 trafficking depends on functional COPI and COPII machineries.
The LXXLE motif in the N-terminus and the dibasic motif prior to the TMD are
responsible for ER export of BET12
The intimate relationship of BET12 with COPII machinery prompted us to take a
detailed look into the N-terminus (a.a. 1-32) and the region between the SNARE motif
and TMD (a.a. 98-106) in order to identify more precisely amino acid residues
responsible for COPII-mediated ER export. By sequence alignment, we identified
motifs that bind and interact with Sar1 and Sec24 as reported previously. In yeast, it
has been shown that the COPII inner coat complex Sec23/24 binds to LXXLE and
mediates SNARE Bet1 ER export (Mossessova et al., 2003). Interestingly, the COPII-
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
binding motif LXXLE was present within the N-terminus region (a.a. 1-32) of BET12
(Fig. 4A, in blue). In addition, the dibasic motif of glycosyltransferase was found to
interact with Sar1 in mammalian cells (Giraudo and Maccioni, 2003). A similar dibasic
motif was identified in the region between the BET12 SNARE motif and the TMD (a.a.
98-106) (Fig. 4A, in blue). To prove the conserved role of these motifs in ER export,
we generated two mutated BET12 constructs with point mutagenesis in the LXXLE
and RK dibasic motif respectively, which are termed YFP-BET12(L18A,L21A,E22A)
and YFP-BET12(R102A,K103A). We then performed a transient expression
experiment using Arabidopsis protoplasts and the subcellular localization of these
mutated BET12 was determined using CLSM. Unlike the sole punctate pattern
displayed by YFP-BET12 (Fig. 4B), both the YFP-BET12(L18A,L21A,E22A) and YFP-
BET12(R102A,K103A) showed a punctate and ER pattern which partially colocalized
with CNX-RFP (Fig. S3A, B), suggesting that the separate mutations in one of the
potential COPII binding motifs causes a partial defect in BET12 ER export. To further
assess the role of these motifs, we generated a construct with five point mutations that
turned the five residues into alanine simultaneously and termed it as YFP-BET12-m
(Fig. 4A, in red). Strikingly, YFP-BET12-m displayed a dominant ER pattern and
colocalized with CNX-RFP (Fig. 4C), suggesting that the mutations severely inhibit its
ER export. Interestingly, a few punctate with faint fluorescence signals were observed
in between the ER, suggesting that a limited amount of YFP-BET12-m may still exit
the ER and reach the Golgi (Fig. 4C and Figs S4). The failure in ER export of YFP-
BET12-m was not only observed in protoplasts but also in intact Arabidopsis seedlings.
YFP-BET12 and YFP-BET12-m was expressed in 7-days-old seedlings by particle
bombardment and the corresponding transformed cells were imaged using CLSM. In
leaf pavement and trichome cells, YFP-BET12 displayed a punctate pattern
resembling the Golgi localization as observed previously (Fig. 4D). By contrast, YFP-
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
BET12-m exhibited an ER network pattern in both the leaf pavement and trichome
cells, which was obviously observed through the z-stack projection of multiple confocal
layers (Fig. 4E). Point mutagenesis of the five residues significantly changed the
localization of YFP-BET12 from punctate to an ER pattern. The fact that the presence
of two putative COPII binding motifs in different regions of the protein may explain our
previous observation that the absence of any one ER export signal leads to both the
punctate and ER localization pattern.
ER export defective YFP-BET12-m retained MEMB12 but not other Golgi-
localized SNAREs in the ER
The role of the SNARE BET12 in ER-Golgi trafficking is unclear. We speculated that
the overexpression of an ER export defective form of BET12 might interfere with
protein trafficking in the early secretory pathway. To test this hypothesis, we co-
expressed YFP-BET12-m with protein cargos known to be transported through the
conventional secretory pathway. Aleurain-mRFP and RFP-SCAMP1 were used as
soluble and membrane cargo markers respectively (Lam et al., 2007; Miao et al., 2008).
However, CLSM analysis showed that the trafficking of both the Aleurain-mRFP and
RFP-SCAMP1 was not affected by YFP-BET12-m and they were transported to the
vacuole and plasma membrane (PM) correspondingly (Fig. S4A, B). Man1-RFP still
maintained a typical punctate pattern upon co-expression with YFP-BET12-m (Fig.
S4C), suggesting the Golgi was not disrupted. We then screened a set of Golgi-
localized SNARE proteins for any trafficking defect as YFP-BET12-m may interact with
its partner SNARE proteins and are retained together in the ER. Interestingly, CLSM
analysis revealed that only mCherry-MEMB12 but not mCherry-SYP31 nor mCherry-
GOS12 was trapped in the ER together with YFP-BET12-m in protoplasts (Fig. 5A and
Fig. S4D, E). The ER trapping effect of YFP-BET12-m on mCherry-MEMB12 was also
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
observed in intact Arabidopsis leaf and trichome cells (Fig. 5B, C). Consistent with the
previous findings, mCherry-MEMB12 displayed a punctate pattern when co-expressed
with YFP-BET12 (Figs S5). The ER trapping of mCherry-MEMB12 is probably caused
by physical interaction with the ER export defective YFP-BET12-m. To confirm this,
we performed an acceptor photobleaching-fluorescence resonance energy transfer
(FRET-AB) assay to verify the potential protein-protein interaction between YFP-
BET12-m and Cerulean-MEMB12 (Xing et al., 2016), in which YFP-linker-Cerulean
and YFP-BET12-m/CNX-Cerulean was used as a positive and negative control
respectively. FRET-AB analysis suggested an in vivo interaction between YFP-BET12-
m and Cerulean-MEMB12 as their FRET efficiency was significantly high compared to
the negative control (Fig. 5D). Co-immunoprecipitation (Co-IP) assay using GFP-trap
was further performed to show the interaction between YFP-BET12-m and HA-
MEMB12, as HA-MEMB12 was immunoprecipitated by YFP-BET12-m as shown in
the immunoblot using GFP and HA antibodies (Fig. 5E). Taken together, results from
the CLSM analysis and protein-protein interaction assays strongly suggest that YFP-
BET12-m interacts with MEMB12 and its ER export defective nature causes the
trapping of both proteins in the ER.
Ectopic expression of BET12 and MEMB12 causes intracellular accumulation of
PR1-RFP in Arabidopsis
A previous study suggested that MEMB12 is involved in regulating the secretion of the
antimicrobial protein PR1 in Arabidopsis (Zhang et al., 2011b). As BET12 was shown
to interact with MEMB12, we decided to test if BET12 would also affect PR1 secretion.
Upon transient expression of PR1-RFP in Arabidopsis protoplasts, we could not detect
any intracellular fluorescence signal using confocal microscopy. We speculated that
the majority of PR1-RFP was being secreted to the culture medium. To prove this
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
hypothesis, we therefore separated the protoplasts from the culture medium by low
speed centrifugation. The collected culture medium was then concentrated and total
proteins were extracted from the protoplast pellet. Both the medium and protein
extracts were then subjected to immunoblot analysis using RFP antibodies. As
expected, a band was detected in the medium fraction but not in the proteins extracted
from pellet (Fig. 6A, lane 1, 2), suggesting that PR1-RFP is constantly secreted out of
the protoplasts. Interestingly, co-expression of PR1-RFP with YFP-BET12 or YFP-
MEMB12 resulted in intracellular accumulation of PR1-RFP, as evidenced by the band
detection in the pellet fraction (Fig. 6A, lane 4, 6), although the majority of PR1-RFP
was still secreted to the medium (Fig. 6A, lane 3, 5). The amounts of PR1-RFP
retained intracellularly and secreted extracellularly were quantified (Fig. 6B), and
showed that the ectopic expression of YFP-BET12 and YFP-MEMB12 affects PR1
trafficking. CLSM analysis using Arabidopsis seedlings expressing PR1-RFP was
performed to further confirm its secretion behavior. When PR1-RFP was expressed
alone, PR1-RFP showed a fluorescence signal in the extracellular space surrounding
the leaf pavement cell (Fig. 6C). Consistently, co-expression of PR1-RFP with YFP-
BET12 affected PR1-RFP trafficking as red fluorescence foci were found inside the
cell while portions of PR1-RFP were still secreted to the apoplast (Fig. 6D).To further
verify the relationship between BET12 overexpression and PR1 trafficking, we
repeated the secretion assay with gradual increment expression of HA-BET12 and
determined its effect in PR1 trafficking using immunoblot analysis. The greater the
abundance of HA-BET12 is, the more PR1-RFP was trapped in the pellet fraction (Fig.
6E), suggesting that the effect of HA-BET12 in PR1 intracellular accumulation is
dosage dependent. Interestingly, overexpression of HA-BET12-m also interfered with
PR1 secretion and caused its intracellular retention, although to a lesser extent than
HA-BET12 did (Fig. S6). Taken together, both the biochemical assay and in vivo
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
imaging data suggested that ectopic expression of BET12 affects PR1 trafficking and
caused its intracellular accumulation.
PR1 is known as an antimicrobial protein that plays an important role in plant immunity
(Van Loon and Van Strien, 1999). As ectopic expression of YFP-BET12 interferes PR1
trafficking, to test whether antibacterial defense was affected, we performed bacterial
growth assays using wild type and transgenic plants overexpressing YFP-BET12
infected by both virulent and avirulent (avrRpt2) strains of the bacterial pathogen
Pseudomonas syringae pv. tomato (Pst DC3000). Bacterial growth assays showed
that there was no significant difference in the growth of the virulent or avirulent Pst
strains when comparing the wild type and YFP-BET12 overexpression plants (Fig. 6F),
suggesting that YFP-BET12 transgenic plants are not more susceptible to pathogen
infection.
DISCUSSION
Multiple mechanisms for membrane protein targeting have been proposed in plants,
including distinct signal motif recognition by trafficking machineries, as well as the
various properties of the TMD (Brandizzi et al., 2002; Langhans et al., 2008; Robinson
et al., 2007; Rojo and Denecke, 2008; Schoberer et al., 2009; Wang et al., 2014).
However, the targeting mechanisms for most of the SNAREs to their destined
compartments, remain obscure in plants. It has been reported that the entire longin
domains of the VAMP7 SNAREs and the di-acidic motif of the SYP31 are essential for
the vacuolar and Golgi targeting respectively (Chatre et al., 2009; Uemura et al., 2005).
However, additional factors and the nature of the trafficking machinery involved in
SNARE targeting is not known. In this study, we demonstrated the Golgi and TGN
localization of the Qc-SNARE BET12 in Arabidopsis and revealed its COPII-
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
dependent ER export mechanism. Interestingly, subcellular localization studies of
BET12 using transgenic plants and protoplasts yielded results with minor discrepancy:
YFP-BET12 resided more at the TGN in transgenic plant root cells while YFP-BET12
showed a slightly higher colocalization rate with the Golgi than the TGN marker in
protoplasts. This variation may be due to the different methodologies (immuno-labeling
and transient expression) and plant materials (transgenic plants and protoplasts) used
for the localization studies. Previous studies indicated that the TMD length is unlikely
to be the sole determinant that dictates subcellular localization of SNARE proteins
(Chatre et al., 2009; Uemura et al., 2005). This is consistent with our findings that the
presence of the TMD of BET12 is alone insufficient for its ER export (Figs 2). It has
been reported that the mammalian orthologue rbet1 depends on its SNARE motif for
targeting (Joglekar et al., 2003). However, the absence of the BET12 SNARE motif
did not affect its ER export in Arabidopsis cells. Instead, through truncation
experiments we identified two regions that contain signal motifs which are responsible
for efficient ER export of BET12: the N-terminus (a.a. 1-32) and the region in-between
SNARE motif and the TMD (a.a. 98-106). BET12 ER export is hampered but not
completely abrogated by deleting any one of the signal motif containing regions (either
a.a. 1-32 or a.a 98-106), as evidenced by the observation of both the ER and punctate
(Golgi) localization pattern of the truncated YFP-BET12 (Figs 2). Indeed, similar
experimental approaches have been applied in elucidating the targeting mechanism
of another Golgi-localized SNARE SYP31. A novel di-acidic motif EXXD, residing in a
region between the SNARE helices, was found to facilitate the ER export of SYP31
(Chatre et al., 2009). To precisely identify the amino acid residues constituting the
signal motifs for BET12 ER export and the trafficking machinery involved, mutagenesis
and pull down experiments were performed. Synthetic peptide pull down experiments
indicated that Sar1, one of the major constituents for COPII vesicle formation, may
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
interact with the region between the SNARE motif and the TMD (a.a. 98-106) (Figs 3).
Consistently, by sequence analysis we found that the presence of a dibasic motif,
which is reported to be Sar1 binding (Giraudo and Maccioni, 2003; Srivastava et al.,
2012; Yuasa et al., 2005), in the same region. It has been shown that mutation of the
dibasic motif residues to alanine proximal to the TMD of bZIP28 interferes with its
interaction with Sar1 and inhibits its ER export under ER stress (Srivastava et al.,
2012). In addition, a conserved motif, LXXLE, in yeast Bet1 which binds to the B site
of the Sec23/24 complex (Mossessova et al., 2003), was identified in the BET12 N-
terminal region (a.a. 1-32). Although no direct interaction between the SNAREs and
Sec24 has been reported in plants, Sec24 has been shown to interact with the
potassium channel KAT1 via its di-acidic motif and facilitate its ER export (Sieben et
al., 2008). Independent mutagenesis of the putative Sec24 binding motif LXXLE (a.a.
18-22) and the Sar1 binding dibasic motif RK (a.a. 102-103) into alanine result in the
partial defective ER-export of BET12 (Figs S3). Simultaneous mutagenesis in all the
five residues severely inhibited BET12 trafficking which resulted in the ER localization
of YFP-BET12-m (Figs 4), as well as in an ER-trapping effect upon co-expression with
Sar1C-DN-RFP. These data indicate that the ER export of BET12 is signal motif
dependent which is mediated by functional COPII machinery.
In addition to COPII, the COPI machinery component Arf1 was reported to interact
with another Golgi-localized SNARE MEMB11 (Marais et al., 2015). It has been
proposed that membrin, the mammalian MEMB11, act as a recruiter for Arf1
recruitment to the Golgi membrane to initiate COPI vesicle formation (Honda et al.,
2005). EMP12 was also shown to interact with the COPI machinery to maintain its
Golgi localization (Gao et al., 2012). Interestingly, certain COPI machinery
components were identified in our pull down MS/MS data (Figs 3), suggesting that
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
BET12 may also bind to COPI and become incorporated into COPI vesicles for its
proper targeting.
Impaired trafficking and mis-targeting of SNARE proteins has been reported to be
detrimental to cells. For instance, the correct trafficking of KNOLLE is important for
plant cell cytokinesis (Park et al., 2013; Reichardt et al., 2007), while a reduced salt
tolerance may be caused by the partial mislocalization of SYP61 in tno1 mutants (Kim
and Bassham, 2011). To determine if there is any adverse cellular effect caused by
the ER export defective form of BET12, we monitored the trafficking of both the soluble
and membrane proteins known to employ the ER-Golgi secretory pathway. However,
no trafficking defect was observed as both the Aleurain-mRFP and RFP-SCAMP1
were transported to their respective destined compartments even YFP-BET12-m was
significantly trapped in the ER (Figs S4). Interestingly, it is reported that the
overexpression of the ER export defective form of SYP31 severely inhibits tobacco
plant growth (Melser et al., 2009), as the accumulation of ER-trapped SYP31 is toxic
to the secretory pathway by potentially disturbing the homeostasis of the SNARE
machinery as well as the ER-Golgi interface. Although protein trafficking was not
affected by YFP-BET12-m overexpression, the defective ER export of BET12 could
trap the interacting SNARE partner together in the ER. Among the Golgi-localized
SNAREs screened, only MEMB12 was found to be trapped in the ER upon co-
expressing with YFP-BET12-m (Figs 5). Bos1, the yeast homolog of MEMB12, does
not bear any Sec24 binding motif (Mossessova et al., 2003). Unlike other Golgi-
localized SNAREs that could bind to Sec24 for their ER export, it is plausible that Bos1
binds to its partner SNAREs to form a complex, which is then co-packaged into COPII
vesicles for ER export (Mossessova et al., 2003). Similar to its ortholog Bos1, no
putative Sec24 binding motif could be identified in MEMB12, indicating that its ER
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
export may be dependent on its partner SNARE. In this sense, the ER retention of
YFP-BET12-m, which interacts with MEMB12, may result in the defective ER export
of MEMB12 as well. Interestingly, a recent study suggested that the preassembled
ternary Golgi Q-SNAREs complex was preferred for ER export in mammalian cells,
and is supported by the sorting defect in all other Q-SNAREs caused by the mutation
of the Sec24C-Syntaxin 5 binding site (Adolf et al., 2016). In our study, the pull down
assay followed by the MS/MS analysis failed to identify the potential SNARE partners
interacting with BET12, probably due to the fact that only the defined region (a.a 98-
106) of BET12 but not its SNARE coiled-coil domain was used as a bait for the pull
down assay. Indeed, BET12 was shown to form SNARE complex with the yeast Bos1
and certain Golgi SNAREs preferentially in an in vitro study (Tai and Banfield, 2001).
Similar in vitro binding assay using purified Arabidopsis SNARE proteins may
represent a good approach to identify the SNARE partners of BET12. Characterization
of the interacting domain between BET12 and MEMB12, as well as the use of in vitro
budding assays to determine whether BET12 and MEMB12 are co-packaged into
vesicles, would certainly shed light on the ER export mechanism of SNARE proteins.
The involvement of the Golgi-localized SNARE MEMB12 in plant defense against
pathogens has been previously reported (Zhang et al., 2011b). Arabidopsis MEMB12
knockout mutants exhibit enhanced resistance to the bacterial pathogen Pst as the
absence of MEMB12 promotes the exocytosis of the antimicrobial protein PR1 (Zhang
et al., 2011b). Consistent with its role as a negative regulator for PR1 secretion, we
found in our study that the MEMB12 overexpression caused intracellular accumulation
of PR1. Interestingly, ectopic expression of BET12 affects PR1 trafficking just as
MEMB12 does. Although PR1 trafficking was affected, transgenic plants
overexpressing BET12 displayed no significant difference in resistance to the Pst
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
infection (Figs 6), probably due to the fact that the amount of secreted PR1 for defense
was not significantly reduced. SNARE proteins are known to play an important role in
plant defense (Assaad et al., 2004; Collins et al., 2003; Kwon et al., 2008; Uemura et
al., 2012a; Wang et al., 2016). Strikingly, a previous study has revealed the essential
role of the plant secretory pathway for the plant immunity, as mutants of the secretory
pathway component showed reduced PR1 secretion and were susceptible to the
bacterial pathogen (Wang et al., 2005). Another study reported that the PM-localized
SNARE SYP132 underwent phosphorylation upon elicitor treatment and the efficient
PR1 secretion was SYP132 dependent (Kalde et al., 2007).
Amounting evidence suggests that the absence of certain SNARE proteins or
secretory components makes plants more susceptible to pathogens, our finding that
the presence of BET12 and MEMB12 play a repressive role in PR1 secretion may
therefor seem contradictory. It has been proposed that MEMB12 is involved in
retrograde protein trafficking from the Golgi back to the ER, thus PR1 may be recycled
back and prevented from being secreted (Zhang et al., 2011b). As BET12 shows
interaction with MEMB12, it may seems reasonable that the overexpression of BET12
would inhibit PR1 secretion by promoting its retrograde transport. Although we cannot
rule out this possibility, a possible alternative explanation may be the excess SNARE
proteins due to overexpression. The overabundance of SNARE proteins may result in
uncontrolled SNARE partner interaction and thus disrupt the SNARE machinery
homeostasis. It has been suggested that SNARE proteins could become non-
fusogenic when over-accumulated, termed inhibitory SNAREs (i-SNARE) (Di
Sansebastiano, 2013), as evidenced by a study using an in vitro fusion assay
(Varlamov et al., 2004). Both the yeast and mammalian orthologs of BET12, Bet1 and
rBet1, showed an inhibitory effect on SNARE fusion when in excess (Varlamov et al.,
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
2004). In plants, previous study proposed that SYP51 and SYP52 behave as the i-
SNAREs and affected vacuolar trafficking when they accumulate on the tonoplast (De
Benedictis et al., 2013). In that sense, considering our result in PR1 trafficking, it is
plausible that overexpressed BET12 could act as i-SNAREs in the early secretory
pathway, which therefore prevents the fusion of PR1-containing vesicles and thus
inhibits its secretion. Interestingly, overexpression of Golgi-localized SNAREs SYP31
and MEMB11 strongly inhibited the ER-Golgi anterograde transport, as evidenced by
the redistribution of Man1-RFP into the ER (Bubeck et al., 2008). It is noteworthy that
BET12 overexpression did not affect the distribution of Man1-RFP (Fig. 2A), indicating
the general anterograde transport pathway is not perturbed by BET12. Instead, PR1
trafficking was interfered, suggesting a potential role of BET12 in regulating
pathogenesis-related protein secretion and plant immunity. Further studies, combining
in vitro SNARE fusion assay with the in vivo monitoring of protein trafficking, will help
to characterize i-SNARE activity in plants. It will also open the possibility that, in
addition to the well-known fusogenic role of SNARE proteins, the regulation and
targeting of non-fusogenic SNAREs to compartments could fine tune protein trafficking
in response to various stress conditions.
It has been recently reported that the single homozygous bet11 or bet12 T-DNA
insertional mutants display no obvious vegetative phenotype. Reduced seed set was
observed in homozygous/heterozygous bet11/bet12 (and vice versa) double mutants,
probably caused by defective pollen tube growth (Bolanos-Villegas et al., 2015). These
findings implicated that the function of BET11 and BET12 may partially overlap, as
functional redundancy has been reported between SNARE family members (Kim and
Bassham, 2013; Shirakawa et al., 2010; Uemura et al., 2010). Further studies using
either bet12 or bet11/bet12 double mutants in pathogen response will certainly help to
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
elucidate the role of ER-Golgi SNAREs in plant immunity.
MATERIALS AND METHODS
Plasmid construction
The cDNA of BET12 was amplified and cloned into the pBI121 and pBI221 backbone
containing an UBQ10 promoter (Grefen et al., 2010), YFP/HA coding sequence and
the nopaline synthase terminator for the generation of YFP-BET12 transgenic plants
and transient expression in protoplasts respectively. All the truncation/deletion
versions and point mutagenesis mutants of BET12 were amplified from YFP-BET12
and cloned into the pBI221 vector. All the primers used in this study are listed in Table
S2.
Plant materials and growth conditions
To generate YFP-BET12 transgenic plants, pBI121 constructs containing YFP-BET12
were introduced into Agrobacterium tumefaciens and transformed into wild-type
Arabidopsis thaliana (Col-0) by the floral dip method (Clough and Bent, 1998).
Arabidopsis seeds were surface sterilized and plated on standard Murashige and
Skoog (MS) growth medium (pH5.7) supplemented with 1% sucrose and 1% agar.
Seedlings were grown on vertically oriented plates in growth chambers at 22°C under
a long-day (16 h light/8 h dark) photoperiod. Plants used for the bacteria growth assay
were grown on soil in a growth room under a short-day condition with a 10 h light/14
h dark photoperiod for an extended vegetative growth phase.
Transient expression by electroporation and particle bombardment
Maintenance of Arabidopsis suspension cells and transient expression in protoplasts
were performed by electroporation as described previously (Miao and Jiang, 2007).
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
For particle bombardment, seven-day-old Arabidopsis seedlings were transferred and
placed horizontally on a MS agar plate. Gold particles were coated with plasmid DNA
and bombarded into seedlings as described previously (Wang and Jiang, 2011).
Immunofluorescence labeling
Preparation and fixation of 5-day-old Arabidopsis roots for immunofluorescence
labeling was performed as described (Sauer et al., 2006). Fixed roots were incubated
with anti-EMP12, anti-SYP61 and anti-calreticulin at 4°C overnight, followed by
probing with Alexa 568 goat anti-rabbit IgG (Invitrogen) secondary antibody (1:1000
dilution) for confocal observation.
BFA treatment and FM4-64 uptake study
5-day-old Arabidopsis seedlings were treated with BFA at 10 μg/ml for 30 minutes,
followed by FM4-64 uptake for another 30 minutes before imaging (Lam et al., 2009).
All experiments were repeated at least three times with similar results.
Confocal microscopy analysis
CLSM analysis was performed using Leica SP8 confocal microscope with a sequential
line scanning setting using 63X water lens. For each experiment, more than twenty
confocal images were collected for quantification and colocalization analysis. Pearson
correlation coefficient was calculated by PSC plugin and line plot was performed using
ImageJ (Wayne Rasband, NIH, https://imagej.nih.gov/) as described (French et al.,
2008).
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Electron microscopy study
EM sample preparation, ultrathin sectioning and immunogold labeling using 10nm gold
particles were performed as previously described (Tse et al., 2004). GFP antibodies
were used for labeling of root cells in YFP-BET12 transgenic plants. Transmission
electron microscopy was performed using an Hitachi H-7650 transmission electron
microscope with a charge-coupled device camera (Hitachi High-Technologies)
operating at 80 kV.
Topology analysis and protease protection assay
Total proteins were extracted from protoplasts expressing YFP-BET12 without the
addition of detergent as described (Zhuang et al., 2017). To obtain proteins in soluble
and membrane fraction, total proteins were ultracentrifuged at 100,000 g for 30
minutes, and the membrane pellets were washed and solubilized in an equal volume
of extraction buffer with additional 1% Triton X-100. For integral membrane protein
determinations, membrane pellets were incubated with 1M KCl, 0.1M Na2CO3, 1%
Triton X-100 and 1% SDS for 30 min on ice, followed by ultracentrifuged at 100,000 g
for 30 minutes. Soluble and membrane fraction were subjected to SDS-PAGE and
immunoblot analysis using GFP, VSR and cFPBase antibody. For protease protection
assays, microsomes isolated from protoplasts expressing YFP-BET12 were subjected
to trypsin digestion as previously described (Gao et al., 2012), followed by immunoblot
analysis using GFP antibodies.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
In Vitro Peptide Binding Assay and MS/MS analysis
A synthetic peptide of the nine amino acids (a.a. 98-106) of BET12 was conjugated to
CnBr-activated Sepharose as described (Contreras et al., 2004). Total proteins were
extracted from Arabidopsis suspension cells and were incubated with the conjugated
peptide for 4 hours at 4°C in a rotator. After incubation, the Sepharose were washed
five times with incubation buffer and proteins were eluted by boiling in SDS sample
buffer. Proteins were separated by SDS-PAGE and stained by silver staining. Protein
bands with significantly higher intensity in the conjugated-peptide lane than the
Sepharose control lane were cut out for in-gel trypsin digestion. Peptides were then
extracted from the digested gel and further subjected to liquid chromatography-tandem
mass spectrometry analysis as described (Gao et al., 2012).
Co-IP assay and FRET-AB analysis
Co-IP assays were performed using proteins extracted from protoplasts expressing
YFP-BET12-m and HA-MEMB12. Extracted proteins were incubated with GFP-TRAP
magnetic beads following the recommended protocol (ChromoTek,
http://www.chromotek.com/). After the washing steps, proteins were eluted and boiled
in SDS sample buffer, followed by immunoblot analysis using GFP and HA antibodies.
FRET-AB analysis was performed using the Leica SP8 confocal microscope as
described (Gao et al., 2015). Target proteins were transiently expressed in
Arabidopsis protoplast. Fixation was then performed by incubating the protoplasts with
3% formaldehyde in PBS for 15 minutes at room temperature. After two rounds of
washing with PBS, fixed samples were then subjected to the FRET-AB analysis.
Defined region of interest was selected for photobleaching using high intensity laser
(514nm). Signal intensity of the donor and acceptor proteins before and after
photobleaching were measured for calculating FRET efficiency by the SP8 built-in
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
algorithm. For each testing FRET protein pair, twenty individual cells expressing the
target proteins were used for the analysis. For the positive control, an amino acid linker
peptide, SSSELSGDEVGGTSGSEF, was used to fuse the C-terminus of Cerulean and
the N-terminus of YFP to create the Cerulean-linker-YFP fusion while CNX-cerulean
and YFP-BET12-m were used as a negative control.
PR1 Secretion assay
Secretion assays were performed using protoplasts expressing PR1-RFP or co-
expressed with YFP-MEMB12 or YFP-BET12. Protoplasts and culture medium were
collected separately by centrifugation at 100 g for 5 minutes. Total proteins were
extracted from the protoplasts while collected medium was concentrated using
Amicon® Ultra-4 Centrifugal Filter Units with 3K molecular weight cut-off by
centrifugation at 4000 rpm for 30 minutes. Proteins extracted and the concentrated
medium were subjected to SDS-PAGE followed by immunoblot analysis using RFP
and GFP antibodies. Ponceau S staining was used as a loading reference for
calculating the relative abundance of PR1 proteins in each sample.
Bacterial growth assay
Bacterial growth assays were performed using 4-week-old wild type and YFP-BET12
transgenic Arabidopsis plants as described (Li et al., 2013). 1x106 cfu/ml of Pst
(DC3000) and 5x106 cfu/ml of Pst avrRpt2 were used for infection by infiltration into
Arabidopsis leaves with syringes. Eight leaf discs were collected at 0 dpi and 3 dpi for
counting bacterial number. For each growth assay, the results from three biological
replicates were used for bacterial quantification.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Antibodies
The GFP antibody (1:1000 dilution) was generated as described (Shen et al., 2014).
cFBPase antibody (1:2000 dilution) was purchased from Agrisera (cat. no. AS04043).
HA antibody (1:1000 dilution) was purchased from Abcam (catalog no. ab18181). RFP
antibody (1:1000 dilution) was purchased from chromotek (rat monoclonal 5F8). VSR,
SYP61, EMP12 and calreticulin antibody were used as described previously (Gao et
al., 2012; Sanderfoot et al., 2001; Shen et al., 2014; Tse et al., 2004)
Accession numbers
Sequence data from this article can be found in the EMBL/GenBank data libraries
under following accession numbers: AT4G14455 (BET12); AT1G10950 (EMP12);
AT1G28490 (SYP61); AT2G30290 (VSR2); AF126550 (MAN1); AT5G20990 (CNX);
AT4G02080 (SAR1C); AT5G50440 (MEMB12); AT2G14610 (PR1); AT2G28520
(VHA-a1); AT5G05760 (SYP31); AT2G45200 (GOS12); AT2G01770 (VIT1) and
OS07G0564600 (SCAMP1).
ACKNOWLEDGEMENTS
We gratefully acknowledge Mr. Kwok Wai Kwan for technical assistance. We thank
Professor Jurgen Denecke (University of Leeds, UK) for providing anti-calreticulin
antibodies.
COMPETING INTERESTS
The authors declare no competing interests.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
AUTHOR CONTRIBUTIONS
K.P.C., Y.X. and L.J. conceived and designed the experiments. K.P.C., Y.Z., Y.L. and
C.J. performed the experiments. K.P.C. and Y.L. analyzed the data. K.P.C. and L.J.
wrote the article.
FUNDING
This work was supported by grants from the Research Grants Council of Hong Kong
(CUHK465112, 466613, and 14130716 and CUHK2/CRF/11G, C4011-14R, C4012-
16E and AoE/M-05/12), the National Natural Science Foundation of China (31270226
and 31470294), NSFC/RGC (N_CUHK406/12), the Chinese Academy of Sciences-
Croucher Funding Scheme for Joint Laboratories, and the Shenzhen Peacock Project
(KQTD201101) (to L.J.).
LIST OF ABBREVIATIONS
PR1, pathogenesis-related protein1; SNARE, soluble N-ethylmaleimide-sensitive
fusion protein attachment protein receptor; ER, endoplasmic reticulum; TA, tail-
anchored; TMD, transmembrane domain; GET, Guided-Entry of TA; COPII, coat
protein complex II; YFP, yellow fluorescent protein; CLSM, Confocal laser scanning
microscopy; TGN, trans-Golgi network; BFA, Brefeldin A; EM, electron microscopy;
PM, plasma membrane; FRET-AB, acceptor photobleaching-fluorescence resonance
energy transfer; Co-IP, Co-immunoprecipitation; i-SNARE, inhibitory SNARE
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
REFERENCES
Adolf, F., Rhiel, M., Reckmann, I., and Wieland, F.T. (2016). Sec24C/D-isoform-
specific sorting of the preassembled ER-Golgi Q-SNARE complex. Mol Biol Cell.
27:2697-2707.
Assaad, F.F., Qiu, J.L., Youngs, H., Ehrhardt, D., Zimmerli, L., Kalde, M., Wanner,
G., Peck, S.C., Edwards, H., Ramonell, K., et al. (2004). The PEN1 syntaxin
defines a novel cellular compartment upon fungal attack and is required for the
timely assembly of papillae. Mol Biol Cell. 15:5118-5129.
Bassham, D.C., Brandizzi, F., Otegui, M.S., and Sanderfoot, A.A. (2008). The
secretory system of Arabidopsis. Arabidopsis Book. 6:e0116.
Bolanos-Villegas, P., Guo, C.L., and Jauh, G.Y. (2015). Arabidopsis Qc-SNARE
genes BET11 and BET12 are required for fertility and pollen tube elongation.
Bot Stud. 56:21
Bolte, S., Talbot, C., Boutte, Y., Catrice, O., Read, N.D., and Satiat-Jeunemaitre,
B. (2004). FM-dyes as experimental probes for dissecting vesicle trafficking in
living plant cells. J Microsc-Oxford. 214:159-173.
Bonifacino, J.S., and Glick, B.S. (2004). The mechanisms of vesicle budding and
fusion. Cell. 116:153-166.
Brandizzi, F., and Barlowe, C. (2013). Organization of the ER-Golgi interface for
membrane traffic control. Nat Rev Mol Cell Bio. 14:382-392.
Brandizzi, F., Frangne, N., Marc-Martin, S., Hawes, C., Neuhaus, J.M., and Paris,
N. (2002). The destination for single-pass membrane proteins is influenced
markedly by the length of the hydrophobic domain. Plant Cell. 14:1077-1092.
Bubeck, J., Scheuring, D., Hummel, E., Langhans, M., Viotti, C., Foresti, O.,
Denecke, J., Banfield, D.K., and Robinson, D.G. (2008). The syntaxins
SYP31 and SYP81 control ER-Golgi trafficking in the plant secretory pathway.
Traffic. 9:1629-1652.
Cai, Y., Jia, T.R., Lam, S.K., Ding, Y., Gao, C.J., San, M.W.Y., Pimpl, P., and Jiang,
L.W. (2011). Multiple cytosolic and transmembrane determinants are required
for the trafficking of SCAMP1 via an ER-Golgi-TGN-PM pathway. Plant J.
65:882-896.
Cao, P.F., Renna, L., Stefano, G., and Brandizzi, F. (2016). SYP73 anchors the ER
to the actin cytoskeleton for maintenance of ER integrity and streaming in
Arabidopsis. Curr Biol. 26:3245-3254.
Chatre, L., Brandizzi, F., Hocquellet, A., Hawes, C., and Moreau, P. (2005). Sec22
and Memb11 are v-SNAREs of the anterograde endoplasmic reticulum-Golgi
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
pathway in tobacco leaf epidermal cells. Plant Physiol. 139:1244-1254.
Chatre, L., Wattelet-Boyer, V., Melser, S., Maneta-Peyret, L., Brandizzi, F., and
Moreau, P. (2009). A novel di-acidic motif facilitates ER export of the syntaxin
SYP31. J Exp Bot. 60:3157-3165.
Chung, K.P., Zeng, Y.L., and Jiang, L.W. (2016). COPII paralogs in plants: functional
redundancy or diversity? Trends Plant Sci. 21:758-769.
Clough, S.J., and Bent, A.F. (1998). Floral dip: a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J.
16:735-743.
Collins, N.C., Thordal-Christensen, H., Lipka, V., Bau, S., Kombrink, E., Qiu, J.L.,
Huckelhoven, R., Stein, M., Freialdenhoven, A., Somerville, S.C., et al.
(2003). SNARE-protein-mediated disease resistance at the plant cell wall.
Nature. 425:973-977.
Contreras, I., Yang, Y.D., Robinson, D.G., and Aniento, F. (2004). Sorting signals in
the cytosolic tail of plant p24 proteins involved in the interaction with the COPII
coat. Plant Cell Physiol. 45:1779-1786.
DaSilva, L.L.P., Snapp, E.L., Denecke, J., Lippincott-Schwartz, J., Hawes, C., and
Brandizzi, F. (2004). Endoplasmic reticulum export sites and golgi bodies
behave as single mobile secretory units in plant cells. Plant Cell. 16:1753-1771.
De Benedictis, M., Bleve, G., Faraco, M., Stigliano, E., Grieco, F., Piro, G.,
Dalessandro, G., and Di Sansebastiano, G.P. (2013). AtSYP51/52 functions
diverge in the post-Golgi traffic and differently affect vacuolar sorting. Mol Plant.
6:916-930
Di Sansebastiano, G.P. (2013). Defining new SNARE functions: the i-SNARE. Front
Plant Sci. 4:99.
Ebine, K., Okatani, Y., Uemura, T., Goh, T., Shoda, K., Niihama, M., Morita, M.T.,
Spitzer, C., Otegui, M.S., Nakano, A., et al. (2008). A SNARE complex unique
to seed plants is required for protein storage vacuole biogenesis and seed
development of Arabidopsis thaliana. Plant Cell. 20:3006-3021.
El-Kasmi, F., Pacher, T., Strompen, G., Stierhof, Y.D., Muller, L.M., Koncz, C.,
Mayer, U., and Jurgens, G. (2011). Arabidopsis SNARE protein SEC22 is
essential for gametophyte development and maintenance of Golgi-stack
integrity. Plant J. 66:268-279.
French, A.P., Mills, S., Swarup, R., Bennett, M.J., and Pridmore, T.P. (2008).
Colocalization of fluorescent markers in confocal microscope images of plant
cells. Nat Protoc. 3:619-628.
Gao, C., Cai, Y., Wang, Y., Kang, B.H., Aniento, F., Robinson, D.G., and Jiang, L.
(2014). Retention mechanisms for ER and Golgi membrane proteins. Trends
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Plant Sci. 19:508-515.
Gao, C.J., Yu, C.K.Y., Qu, S., San, M.W.Y., Li, K.Y., Lo, S.W., and Jiang, L.W. (2012).
The Golgi-localized Arabidopsis Endomembrane Protein12 contains both
endoplasmic reticulum export and Golgi retention signals at its C terminus.
Plant Cell. 24:2086-2104.
Gao, C.J., Zhuang, X.H., Cui, Y., Fu, X., He, Y.L., Zhao, Q., Zeng, Y.L., Shen, J.B.,
Luo, M., and Jiang, L.W. (2015). Dual roles of an Arabidopsis ESCRT
component FREE1 in regulating vacuolar protein transport and autophagic
degradation. P Natl Acad Sci USA. 112:1886-1891.
Giraudo, C.G., and Maccioni, H.J.F. (2003). Endoplasmic reticulum export of
glycosyltransferases depends on interaction of a cytoplasmic dibasic motif with
Sar1. Mol Biol Cell. 14:3753-3766.
Grefen, C., Chen, Z.H., Honsbein, A., Donald, N., Hills, A., and Blatt, M.R. (2010a).
A novel motif essential for SNARE interaction with the K+ channel KC1 and
channel gating in Arabidopsis. Plant Cell. 22:3076-3092.
Grefen, C., Donald, N., Hashimoto, K., Kudla, J., Schumacher, K., and Blatt, M.R.
(2010b). A ubiquitin-10 promoter-based vector set for fluorescent protein
tagging facilitates temporal stability and native protein distribution in transient
and stable expression studies. Plant J. 64:355-365.
Hachez, C., Laloux, T., Reinhardt, H., Cavez, D., Degand, H., Grefen, C., De Rycke,
R., Inze, D., Blatt, M. R., Russinova, E., et al. (2014). Arabidopsis SNAREs
SYP61 and SYP121 coordinate the trafficking of plasma membrane aquaporin
PIP2;7 to modulate the cell membrane water permeability. Plant Cell. 26:3132-
47.
Hanton, S.L., Bortolotti, L.E., Renna, L., Stefano, G., and Brandizzi, F. (2005a).
Crossing the divide - Transport between the endoplasmic reticulum and Golgi
apparatus in plants. Traffic. 6:267-277.
Hanton, S.L., Matheson, L.A., and Brandizzi, F. (2006). Seeking a way out: export
of proteins from the plant endoplasmic reticulum. Trends Plant Sci. 11:335-343.
Hanton, S.L., Renna, L., Bortolotti, L.E., Chatre, L., Stefano, G., and Brandizzi, F.
(2005b). Diacidic motifs influence the export of transmembrane proteins from
the endoplasmic reticulum in plant cells. Plant Cell. 17:3081-3093.
Hawes, C., Osterrieder, A., Hummel, E., and Sparkes, I. (2008). The plant ER-Golgi
interface. Traffic. 9:1571-1580.
Honda, A., Al-Awar, O.S., Hay, J.C., and Donaldson, J.G. (2005). Targeting of Arf-1
to the early Golgi by membrin, an ER-Golgi SNARE. J Cell Biol. 168:1039-1051.
Honsbein, A., Sokolovski, S., Grefen, C., Campanoni, P., Pratelli, R., Paneque, M.,
Chen, Z.H., Johansson, I., and Blatt, M.R. (2009). A tripartite SNARE-K+
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
channel complex mediates in channel-dependent K+ nutrition in Arabidopsis.
Plant Cell. 21:2859-2877.
Huisman, R., Hontelez, J., Mysore, K.S., Wen, J.Q., Bisseling, T., and Limpens, E.
(2016). A symbiosis-dedicated SYNTAXIN OF PLANTS 13II isoform controls
the formation of a stable host-microbe interface in symbiosis. New Phytol.
211:1338-1351.
Hwang, I., and Robinson, D.G. (2009). Transport vesicle formation in plant cells. Curr
Opin Plant Biol. 12:660-669.
Jahn, R., and Scheller, R.H. (2006). SNAREs - engines for membrane fusion. Nat
Rev Mol Cell Bio. 7:631-643.
Joglekar, A.P., Xu, D.L., Rigotti, D.J., Fairman, R., and Hay, J.C. (2003). The
SNARE motif contributes to rbet1 intracellular targeting and dynamics
independently of SNARE interactions. J Biol Chem. 278:14121-14133.
Kalde, M., Nuhse, T.S., Findlay, K., and Peck, S.C. (2007). The syntaxin SYP132
contributes to plant resistance against bacteria and secretion of pathogenesis-
related protein 1. P Natl Acad Sci USA. 104:11850-11855.
Kim, S.J., and Bassham, D.C. (2011). TNO1 Is involved in salt tolerance and vacuolar
trafficking in Arabidopsis. Plant Physiol. 156:514-526.
Kim, S.J., and Bassham, D.C. (2013). Functional redundancy between trans-Golgi
network SNARE family members in Arabidopsis thaliana. Bmc Biochem. 14:22
Kwon, C., Neu, C., Pajonk, S., Yun, H.S., Lipka, U., Humphry, M., Bau, S., Straus,
M., Kwaaitaal, M., Rampelt, H., et al. (2008). Co-option of a default secretory
pathway for plant immune responses. Nature. 451:835-U810.
Lam, S.K., Cai, Y., Tse, Y.C., Wang, J., Law, A.H., Pimpl, P., Chan, H.Y., Xia, J., and
Jiang, L. (2009). BFA-induced compartments from the Golgi apparatus and
trans-Golgi network/early endosome are distinct in plant cells. Plant J. 60:865-
881.
Lam, S.K., Siu, C.L., Hillmer, S., Jang, S., An, G.H., Robinson, D.G., and Jiang,
L.W. (2007). Rice SCAMP1 defines clathrin-coated, trans-Golgi-located
tubular-vesicular structures as an early endosome in tobacco BY-2 cells. Plant
Cell. 19:296-319.
Langhans, M., Marcote, M.J., Pimpl, P., Virgili-Lopez, G., Robinson, D.G., and
Aniento, F. (2008). In vivo trafficking and localization of p24 proteins in plant
cells. Traffic. 9:770-785.
Li, G.J., Zhang, X.J., Wan, D.L., Zhang, S.Q., and Xia, Y.J. (2013). Methods for
analysis of disease resistance and the defense response in Arabidopsis.
Methods Mol Biol. 1043:55-66.
Marais, C., Wattelet-Boyer, V., Bouyssou, G., Hocquellet, A., Dupuy, J.W.,
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Batailler, B., Brocard, L., Boutte, Y., Maneta-Peyret, L., and Moreau, P.
(2015). The Qb-SNARE Memb11 interacts specifically with Arf1 in the Golgi
apparatus of Arabidopsis thaliana. J Exp Bot. 66:6665-6678.
Marti, L., Fornaciari, S., Renna, L., Stefano, G., and Brandizzi, F. (2010). COPII-
mediated traffic in plants. Trends Plant Sci. 15:522-528.
Matheson, L.A., Hanton, S.L., and Brandizzi, F. (2006). Traffic between the plant
endoplasmic reticulum and Golgi apparatus: to the Golgi and beyond. Curr Opin
Plant Biol. 9:601-609.
McNew, J.A., Parlati, F., Fukuda, R., Johnston, R.J., Paz, K., Paumet, F., Sollner,
T.H., and Rothman, J.E. (2000). Compartmental specificity of cellular
membrane fusion encoded in SNARE proteins. Nature. 407:153-159.
Melser, S., Wattelet-Boyer, V., Brandizzi, F., and Moreau, P. (2009). Blocking ER
export of the Golgi SNARE SYP31 affects plant growth. Plant Signal Behav.
4:962-964.
Miao, Y.S., and Jiang, L.W. (2007). Transient expression of fluorescent fusion
proteins in protoplasts of suspension cultured cells. Nat Protoc. 2:2348-2353.
Miao, Y.S., Li, K.Y., Li, H.Y., Yao, X.Q., and Jiang, L.W. (2008). The vacuolar
transport of aleurain-GFP and 2S albumin-GFP fusions is mediated by the
same pre-vacuolar compartments in tobacco BY-2 and Arabidopsis suspension
cultured cells. Plant J. 56:824-839.
Moreau, P., Brandizzi, F., Hanton, S., Chatre, L., Melser, S., Hawes, C., and Satiat-
Jeunemaitre, B. (2007). The plant ER-Golgi interface: a highly structured and
dynamic membrane complex. J Exp Bot. 58:49-64.
Mossessova, E., Bickford, L.C., and Goldberg, J. (2003). SNARE selectivity of the
COPII coat. Cell. 114:483-495.
Osterrieder, A., Hummel, E., Carvalho, C.M., and Hawes, C. (2010). Golgi
membrane dynamics after induction of a dominant-negative mutant Sar1
GTPase in tobacco. J Exp Bot. 61:405-422.
Pan, H.R., Oztas, O., Zhang, X.W., Wu, X.Y., Stonoha, C., Wang, E., Wang, B., and
Wang, D. (2016). A symbiotic SNARE protein generated by alternative
termination of transcription. Nat Plants. 2:15197
Paris, N., Rogers, S.W., Jiang, L.W., Kirsch, T., Beevers, L., Phillips, T.E., and
Rogers, J.C. (1997). Molecular cloning and further characterization of a
probable plant vacuolar sorting receptor. Plant Physiol. 115:29-39.
Park, M., Song, K., Reichardt, I., Kim, H., Mayer, U., Stierhof, Y.D., Hwang, I., and
Jurgens, G. (2013). Arabidopsis μ-adaptin subunit AP1M of adaptor protein
complex 1 mediates late secretory and vacuolar traffic and is required for
growth. P Natl Acad Sci USA. 110:10318-10323.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Paul, M.J., and Frigerio, L. (2007). Coated vesicles in plant cells. Semin Cell Dev
Biol. 18:471-478.
Pimpl, P., Hanton, S.L., Taylor, J.P., Pinto-daSilva, L.L., and Denecke, J. (2003).
The GTPase ARF1p controls the sequence-specific vacuolar sorting route to
the lytic vacuole. Plant Cell. 15:1242-1256.
Reichardt, L., Stierhof, Y.D., Mayer, U., Richter, S., Schwarz, H., Schumacher, K.,
and Jurgens, G. (2007). Plant cytokinesis requires de novo secretory
trafficking but not endocytosis. Curr Biol. 17:2047-2053.
Robinson, D.G., Brandizzi, F., Hawes, C., and Nakano, A. (2015). Vesicles versus
tubes: Is endoplasmic reticulum-Golgi transport in plants fundamentally
different from other eukaryotes? Plant Physiol. 168:393-406.
Robinson, D.G., Herranz, M.C., Bubeck, J., Pepperkok, R., and Ritzenthaler, C.
(2007). Membrane dynamics in the early secretory pathway. Crit Rev Plant Sci.
26:199-225.
Rojo, E., and Denecke, J. (2008). What is moving in the secretory pathway of plants?
Plant Physiol. 147:1493-1503.
Saint-Jore-Dupas, C., Nebenfuhr, A., Boulaflous, A., Follet-Gueye, M.L., Plasson,
C., Hawes, C., Driouich, A., Faye, L., and Gomord, V. (2006). Plant N-glycan
processing enzymes employ different targeting mechanisms for their spatial
arrangement along the secretory pathway. Plant Cell. 18:3182-3200.
Sanderfoot, A. (2007). Increases in the number of SNARE genes parallels the rise of
multicellularity among the green plants. Plant Physiol. 144:6-17.
Sanderfoot, A.A., Assaad, F.F., and Raikhel, N.V. (2000). The Arabidopsis genome.
An abundance of soluble N-ethylmaleimide-sensitive factor adaptor protein
receptors. Plant Physiol. 124:1558-1569.
Sanderfoot, A.A., Kovaleva, V., Bassham, D.C., and Raikhel, N.V. (2001).
Interactions between syntaxins identify at least five SNARE complexes within
the golgi/prevacuolar system of the Arabidopsis cell. Mol Biol Cell. 12:3733-
3743.
Sauer, M., Paciorek, T., Benkova, E., and Friml, J. (2006). Immunocytochemical
techniques for whole-mount in situ protein localization in plants. Nat Protoc.
1:98-103.
Schoberer, J., Vavra, U., Stadlmann, J., Hawes, C., Mach, L., Steinkellner, H., and
Strasser, R. (2009). Arginine/lysine residues in the cytoplasmic tail promote ER
export of plant glycosylation enzymes. Traffic. 10:101-115.
Schuldiner, M., Metz, J., Schmid, V., Denic, V., Rakwalska, M., Schmitt, H.D.,
Schwappach, B., and Weissman, J.S. (2008). The GET complex mediates
insertion of tail-anchored proteins into the ER membrane. Cell. 134:634-645.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Shen, J.B., Ding, Y., Gao, C.J., Rojo, E., and Jiang, L.W. (2014). N-linked
glycosylation of AtVSR1 is important for vacuolar protein sorting in Arabidopsis.
Plant J. 80:977-992.
Shirakawa, M., Ueda, H., Shimada, T., Koumoto, Y., Shimada, T.L., Kondo, M.,
Takahashi, T., Okuyama, Y., Nishimura, M., and Hara-Nishimura, I. (2010).
Arabidopsis Qa-SNARE SYP2 proteins localized to different subcellular regions
function redundantly in vacuolar protein sorting and plant development. Plant J.
64:924-935.
Sieben, C., Mikosch, M., Brandizzi, F., and Homann, U. (2008). Interaction of the
K(+)-channel KAT1 with the coat protein complex II coat component Sec24
depends on a di-acidic endoplasmic reticulum export motif. Plant J. 56:997-
1006.
Sollner, T., Whitehart, S.W., Brunner, M., Erdjumentbromage, H., Geromanos, S.,
Tempst, P., and Rothman, J.E. (1993). SNAP receptors implicated in vesicle
targeting and fusion. Nature. 362:318-324.
Srivastava, R., Chen, Y.N., Deng, Y., Brandizzi, F., and Howell, S.H. (2012).
Elements proximal to and within the transmembrane domain mediate the
organelle-to-organelle movement of bZIP28 under ER stress conditions. Plant
J. 70:1033-1042.
Srivistava, R., Zalisko, B.E., Keenan, R.J., and Howell, S.H. (2016). The GET
system inserts the tail-anchored SYP72 protein into endoplasmic reticulum
membranes. Plant Physiol. 173:1137-1145.
Stefano, G., Hawes, C., and Brandizzi, F. (2014). ER - the key to the highway. Curr
Opin Plant Biol. 22:30-38.
Stefanovic, S., and Hegde, R.S. (2007). Identification of a targeting factor for
posttranslational membrane protein insertion into the ER. Cell. 128:1147-1159.
Tai, W.C.S., and Banfield, D.K. (2001). AtBS14a and AtBS14b, two Bet1/Sft1-like
SNAREs from Arabidopsis thaliana that complement mutations in the yeast
SFT1 gene. Febs Lett. 500:177-182.
Takeuchi, M., Ueda, T., Sato, K., Abe, H., Nagata, T., and Nakano, A. (2000). A
dominant negative mutant of Sar1 GTPase inhibits protein transport from the
endoplasmic reticulum to the Golgi apparatus in tobacco and Arabidopsis
cultured cells. Plant J. 23:517-525.
Takeuchi, M., Ueda, T., Yahara, N., and Nakano, A. (2002). Arf1 GTPase plays roles
in the protein traffic between the endoplasmic reticulum and the Golgi
apparatus in tobacco and Arabidopsis cultured cells. Plant J. 31:499-515.
Teh, O.K., Shimono, Y., Shirakawa, M., Fukao, Y., Tamura, K., Shimada, T., and
Hara-Nishimura, I. (2013). The AP-1 μ adaptin is required for KNOLLE
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
localization at the cell plate to mediate cytokinesis in Arabidopsis. Plant Cell
Physiol. 54:838-847.
Tse, Y.C., Mo, B.X., Hillmer, S., Zhao, M., Lo, S.W., Robinson, D.G., and Jiang,
L.W. (2004). Identification of multivesicular bodies as prevacuolar
compartments in Nicotiana tabacum BY-2 cells. Plant Cell. 16:672-693.
Uemura, T., Kim, H., Saito, C., Ebine, K., Ueda, T., Schulze-Lefert, P., and Nakano,
A. (2012a). Qa-SNAREs localized to the trans-Golgi network regulate multiple
transport pathways and extracellular disease resistance in plants. P Natl Acad
Sci USA. 109:1784-1789.
Uemura, T., Morita, M.T., Ebine, K., Okatani, Y., Yano, D., Saito, C., Ueda, T., and
Nakano, A. (2010). Vacuolar/pre-vacuolar compartment Qa-SNAREs
VAM3/SYP22 and PEP12/SYP21 have interchangeable functions in
Arabidopsis. Plant J. 64:864-873.
Uemura, T., Sato, M.H., and Takeyasu, K. (2005). The longin domain regulates
subcellular targeting of VAMP7 in Arabidopsis thaliana. Febs Lett. 579:2842-
2846.
Uemura, T., Ueda, T., and Nakano, A. (2012b). The physiological role of SYP4 in the
salinity and osmotic stress tolerances. Plant Signal Behav. 7:1118-1120.
Uemura, T., Ueda, T., Ohniwa, R.L., Nakano, A., Takeyasu, K., and Sato, M.H.
(2004). Systematic analysis of SNARE molecules in Arabidopsis: dissection of
the post-Golgi network in plant cells. Cell Struct Funct. 29:49-65.
Van Loon, L.C., and Van Strien, E.A. (1999). The families of pathogenesis-related
proteins, their activities, and comparative analysis of PR-1 type proteins.
Physiol Mol Plant P. 55:85-97.
Varlamov, O., Volchuk, A., Rahimian, V., Doege, C.A., Paumet, F., Eng, W.S.,
Arango, N., Parlati, F., Ravazzola, P., Orci, L., et al. (2004). i-SNAREs:
inhibitory SNAREs that fine-tune the specificity of membrane fusion. J Cell Biol.
164:79-88.
Wang, D., Weaver, N.D., Kesarwani, M., and Dong, X.N. (2005). Induction of protein
secretory pathway is required for systemic acquired resistance. Science.
308:1036-1040.
Wang, H., and Jiang, L.W. (2011). Transient expression and analysis of fluorescent
reporter proteins in plant pollen tubes. Nat Protoc. 6:419-426.
Wang, W.M., Liu, P.Q., Xu, Y.J., and Xiao, S.Y. (2016). Protein trafficking during plant
innate immunity. J Integr Plant Biol. 58:284-298.
Wang, X.F., Cai, Y., Wang, H., Zeng, Y.L., Zhuang, X.H., Li, B.Y., and Jiang, L.W.
(2014). Trans-Golgi network-located AP1 gamma adaptins mediate dileucine
motif-directed vacuolar targeting in Arabidopsis. Plant Cell. 26:4102-4118.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Xing, S., Mehlhorn, D.G., Wallmeroth, N., Asseck, L.Y., Kar, R., Voss, A.,
Denninger, P., Schmidt, V.A., Schwarzlander, M., Stierhof, Y.D., et al. (2017).
Loss of GET pathway orthologs in Arabidopsis thaliana causes root hair growth
defects and affects SNARE abundance. P Natl Acad Sci USA. 114:E1544-
E1553
Xing, S.P., Wallmeroth, N., Berendzen, K.W., and Grefen, C. (2016). Techniques for
the analysis of protein-protein interactions in vivo. Plant Physiol. 171:727-758.
Yano, D., Sato, M., Saito, C., Sato, M.H., Morita, M.T., and Tasaka, M. (2003). A
SNARE complex containing SGR3/AtVAM3 and ZIG/VTI11 in gravity-sensing
cells is important for Arabidopsis shoot gravitropism. P Natl Acad Sci USA.
100:8589-8594.
Yuasa, K., Toyooka, K., Fukuda, H., and Matsuoka, K. (2005). Membrane-anchored
prolyl hydroxylase with an export signal from the endoplasmic reticulum. Plant
J. 41:81-94.
Zeng, Y.L., Chung, K.P., Li, B.Y., Lai, C.M., Lam, S.K., Wang, X.F., Cui, Y., Gao,
C.J., Luo, M., Wong, K.B., et al. (2015). Unique COPII component
AtSar1a/AtSec23a pair is required for the distinct function of protein ER export
in Arabidopsis thaliana. P Natl Acad Sci USA. 112:14360-14365.
Zhang, L., Zhang, H.Y., Liu, P., Hao, H.Q., Jin, J.B., and Lin, J.X. (2011a).
Arabidopsis R-SNARE proteins VAMP721 and VAMP722 are required for cell
plate formation. Plos One. 6:e26129
Zhang, X.M., Zhao, H.W., Gao, S., Wang, W.C., Katiyar-Agarwal, S., Huang, H.D.,
Raikhel, N., and Jin, H.L. (2011b). Arabidopsis Argonaute 2 regulates innate
immunity via miRNA393*-mediated silencing of a Golgi-localized SNARE gene,
MEMB12. Mol Cell. 42:356-366.
Zhuang, X., Chung, K.P., Cui, Y., Lin, W., Gao, C., Kang, B.H., and Jiang, L. (2017).
ATG9 regulates autophagosome progression from the endoplasmic reticulum
in Arabidopsis. P Natl Acad Sci USA. 114:E426-E435.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figures
Figure 1. YFP-BET12 localizes to the Golgi and trans-Golgi network in
transgenic Arabidopsis plants.
(A-C) Confocal immunofluorescence labeling showing YFP-BET12 partially
colocalized with the Golgi marker (A) anti-EMP12 and the TGN marker (B) anti-SYP61
but was distinct from the ER marker (C) anti-calreticulin in transgenic Arabidopsis root
cells. Dashed-line box in the merged channels represents a 2X enlargement. Linear
Pearson correlation coefficient (rp) and scatterplot was obtained using ImageJ with
PSC colocalization plug-in by analysing twenty individual confocal images for each
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
study. The degree of colocalization with the rp value of +1.0 represents a complete
colocalization. Scale bar = 10μm.
(D) Confocal images showing the colocalization of the BFA-induced aggregation of
YFP-BET12 and endocytic tracer FM4-64. 5-d-old transgenic seedlings were treated
with 10 μg/ml BFA for 30 minutes, followed by FM4-64 uptake for another 30 minutes
before imaging. Dashed-line box represents a 2X enlargement showing YFP-BET12
aggregates formed in the periphery as well as the core BFA compartment labeled by
FM4-64. Confocal images were collected from ten individual seedlings. Scale bar =
10μm.
(E) Line plot generated by ImageJ showing the fluorescence intensity of YFP-BET12
(green) and FM4-64 (red) along the BFA-induced aggregates (line marked by a and b)
shown in (C).
(F) Immunogold electron microscopy labeling showing the presence of YFP-BET12 in
the Golgi and TGN. Gold particles were presence on both the Golgi (arrows) and TGN
(empty arrows). Scale bar = 100nm.
(G) The relative percentage of distribution of gold particles found in the Golgi, TGN
and organelles other than the Golgi and TGN. Twenty electron micrographs showing
the anti-GFP labeling were used for quantification. Error bars represent the SD of the
mean.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figure 2. Efficient export of BET12 from the ER depends on both its N-terminal
region and the region between the SNARE motif and the TMD.
(A, B) Confocal images showing the partial colocalization of YFP-BET12 with the Golgi
marker (A) Man1-RFP and the TGN marker (B) mRFP-SYP61 in Arabidopsis
protoplasts. Dashed-line box in the merged channels represents a 3X enlargement.
The degree of colocalization was quantified and represented by the Pearson
correlation coefficient (rp), with the rp value of +1.0 for complete colocalization. Scale
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
bar = 10μm.
(C-H) Confocal images showing distinct subcellular localizations of different YFP-
BET12 truncation/deletion fusions upon co-expression with the ER marker CNX-RFP
and the Golgi marker Man1-RFP. The (C) ER network, (D) Golgi punctate and (E-H)
the combination of ER and Golgi punctate pattern of the corresponding
truncation/deletion fusions was observed in Arabidopsis protoplasts. Dashed-line box
in the merged channels represents a 3X enlargement. The degree of colocalization
was quantified and represented by the Pearson correlation coefficient (rp), with the rp
value of +1.0 for complete colocalization. Scale bar = 10μm.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figure 3. COPI and COPII machinery components bind to the BET12 peptide and
affects BET12 targeting.
(A) Synthetic peptide of the defined region (a.a 98-106) of BET12 was conjugated on
Sepharose and incubated with proteins extracted from Arabidopsis suspension cells.
Eluted proteins were subjected to silver staining, followed by MS/MS analysis. Proteins
identified as COPI and COPII components are indicated by arrows correspondingly.
Full list of proteins identified from the MS/MS analysis is included in the supplementary
information (Table S1). M, molecular weight marker.
(B, C) Confocal images showing the effect on YFP-BET12 trafficking when co-
expressed with Arf1-GTP and Sar1C-DN-RFP. YFP-BET12 displayed an ER pattern
upon co-expression with (B) Arf1-GTP and (C) Sar1C-DN-RFP in Arabidopsis
protoplasts. Scale bar = 10μm.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figure 4. Signal motifs identified in distinct regions are important for YFP-BET12
targeting in both Arabidopsis protoplast and plants.
(A) Amino acid sequence showing the putative COPII binding motif (in blue) of BET12
and the targeted mutagenesis into alanine (in red) in BET12-m with their
corresponding subcellular localization listed on the right side.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
(B, C) Confocal images showing the (B) punctate pattern of YFP-BET12 and (C) the
colocalization of YFP-BET12-m with CNX-RFP in Arabidopsis protoplasts. Dashed-
line box in the merged channels represents a 4X enlargement. The degree of
colocalization was quantified and represented by the Pearson correlation coefficient
(rp), with the rp value of +1.0 for complete colocalization. Scale bar = 10μm.
(D, E) Confocal images showing the subcellular distribution pattern of (D) YFP-BET12
and (E) YFP-BET12-m in Arabidopsis seedlings. Mutation in putative COPII binding
motif of BET12 shifted its localization from the (D) punctate pattern (YFP-BET12) to
the (E) ER-network pattern (YFP-BET12-m) in both the leaf pavement (1st to 3rd
columns) and trichome cells (4th column). Dashed-line box represents a 4X
enlargement. Scale bar = 10μm.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figure 5. ER export defective form YFP-BET12-m interacted with MEMB12 and
caused its ER retention.
(A-C) Confocal images showing the colocalization of YFP-BET12-m and mCherry-
MEMB12 in Arabidopsis (A) protoplasts, (B) leaf pavement and (C) trichome cells.
Both YFP-BET12-m and mCherry-MEMB12 displayed an ER-network like pattern
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
when co-expressed. Dashed-line box represents a 5X enlargement in (A, B) and 4X
enlargement in (C). The degree of colocalization was quantified and represented by
the Pearson correlation coefficient (rp), with the rp value of +1.0 for complete
colocalization. Scale bar = 10μm.
(D) FRET-AB analysis showing the in vivo interaction between YFP-BET12-m and
Cerulean-MEMB12. Confocal images showing an example of FRET sample before
and after photobleaching. Dashed-line circle represents the region targeted for
photobleaching. FRET efficiency was quantified by measuring the FRET event from
twenty protoplasts expressing YFP-linker-Cerulean; CNX-Cerulean with YFP-BET12-
m and YFP-BET12-m with Cerulean-MEMB12 respectively. Error bars represent SD
of the mean.
(E) Co-immunoprecipitation (Co-IP) assay showing the interaction between YFP-
BET12-m and HA-MEMB12. Arabidopsis protoplasts expressing GFP or YFP-BET12-
m with HA-MEMB12 were subjected to protein extraction and IP via GFP-trap followed
by immunoblotting with HA- and GFP-antibodies. Asterisk represents the correct size
of YFP-BET12-m. The experiment was repeated three times showing similar result.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figure 6. Ectopic expression of BET12 and MEMB12 affects PR1-RFP trafficking
in Arabidopsis protoplasts and plants.
(A) Secretion assay showing the intracellular accumulation of PR1-RFP when co-
expressed with YFP-BET12 and YFP-MEMB12 in Arabidopsis protoplasts. Total
proteins were extracted from the protoplasts (P) and the culture medium (M) that (I)
singly expressed PR1-RFP, (II) co-expressed PR1-RFP with YFP-BET12 and (III) co-
expressed PR1-RFP with YFP-MEMB12 respectively, followed by immunoblot
analysis using RFP antibodies. GFP antibodies were used to detect the expression of
YFP-BET12 and YFP-MEMB12. Ponceau S staining was used as a loading reference
for quantifying the relative abundance (RA) of PR1 proteins among these three
samples using ImageJ. The RA of total PR1 proteins from the (I) singly expressed
PR1-RFP sample was set as 1.00.
(B) Quantification of the percentage of PR1-RFP secreted to the culture medium from
I – III in (A). Three independent experiments were performed to obtain the
quantification results. Error bars represent the SD of the mean.
(C) Confocal images showing the secretion of PR1-RFP to the extracellular space in
Arabidopsis seedlings. Dashed-line box represents a 4X enlargement. Asterisk
represents the intracellular region of the leaf pavement cell. Scale bar = 10μm.
(D) Confocal images showing the intracellular retention and extracellular secretion of
PR1-RFP in Arabidopsis seedlings upon co-expression with YFP-BET12. PR1-RFP
signals were found both inside and outside of the cell. Dashed-line box represents a
4X enlargement. Asterisk represents the intracellular region of the pavement cell.
Scale bar = 10μm.
(E) Secretion assay showing the intracellular accumulation of PR1-RFP by HA-BET12
overexpression is dosage dependent. Total proteins were extracted from the
protoplasts co-expressing PR1-RFP with increasing amount of HA-BET12 (from 1-3),
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
followed by immunoblot analysis using RFP and HA antibodies. Anti-cFBPase was
used as loading control. The experiment was repeated three times showing similar
result.
(F) Bacterial growth assay showing YFP-BET12 transgenic plants were not
susceptible nor resistant to pathogen infection. Four-week-old wild type and YFP-
BET12 transgenic plants were infiltrated with Pst (DC3000) (1x106 cfu/ml) and Pst
(avrRpt2) (5x106 cfu/ml). Growth of both Pst strains was measured at 0 and 3 days
postinoculation (dpi). Error bars represent the standard deviation of the result obtained
from eight leaf discs. Similar results were obtained in three biological replicates.
Jour
nal o
f Cel
l Sci
ence
• A
dvan
ce a
rtic
le
Figure S1. BFA-induced Golgi-derived and TGN-derived aggregates are distinct from each
other.
(A, B) Confocal images showing the colocalization of the BFA-induced aggregation of (A) VHAa1-
GFP and (B) ST-YFP and endocytic tracer FM4-64. 5-d-old transgenic seedlings were treated with
10 μg/ml BFA for 30 minutes, followed by FM4-64 uptake for another 30 minutes before imaging. (A)
VHAa1-GFP aggregates fully colocalized with the core BFA compartment labeled by FM4-64 as
shown in the merged channel. Fluorescence intensity line plot was generated by ImageJ. (B) ST-
YFP aggregates formed in the periphery of the FM4-64 labeled core BFA compartment. ST-YFP and
FM4-64 aggregates were distinct from each other as suggested by the fluorescence intensity line
plot generated by ImageJ. Confocal images were collected from ten seedlings. Scale bar = 10μm.
J. Cell Sci. 130: doi:10.1242/jcs.202838: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
Figure S2. BET12 is an integral membrane protein with an N-terminus facing the cytosol.
(A) Immunoblot analysis using GFP antibodies showing the presence of YFP-BET12 in the pellet (P)
fraction but not in supernatant (S) after ultracentrifugation at 100 000g for 1 hour (lane 1, 2).
Extraction profile of YFP-BET12 is similar to the integral membrane protein VSR under various
extraction conditions: 1M KCl, 0.1M Na2CO3, 1% Triton X-100 and 1% SDS (lane 3-10). Anti-
cFBPase was used as a marker for soluble fraction. Ponceau S staining was used as a loading
control.
(B) Predicted protein topology of YFP-BET12 using TMHMM server 2.0
(http://www.cbs.dtu.dk/services/TMHMM/).
(C) Protease protection assay showing the N-terminus of YFP-BET12 is facing the cytosol.
J. Cell Sci. 130: doi:10.1242/jcs.202838: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
Microsomes were isolated from the protoplasts expressing YFP-BET12 or GFP-VSR2 for trypsin
digestion with/without 1% Triton X-100, followed by protein extraction and immunoblot analysis using
GFP antibodies. Experiments were repeated three times with similar results. Ponceau S staining
was used as a loading control.
J. Cell Sci. 130: doi:10.1242/jcs.202838: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
Figure S3. YFP-BET12(L18A,L21A,E22A) and YFP-BET12(R102A,K103A) display a punctate
and ER pattern in Arabidopsis.
(A, B) Confocal images showing the punctate and ER distribution pattern of (A) YFP-
BET12(L18A,L21A,E22A) and (B) YFP-BET12(R102A,K103A) in Arabidopsis protoplasts. Both
mutated version of BET12 showed a partial colocalization with the ER marker CNX-RFP. The degree
of colocalization was quantified and represented by the Pearson correlation coefficient (rp), with the
rp value of +1.0 for complete colocalization. Dashed-line box represents a 3X enlargement. Scale
bar = 10μm.
J. Cell Sci. 130: doi:10.1242/jcs.202838: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
Figure S4. ER export defective YFP-BET12-m does not affect the trafficking of soluble and
membrane proteins as well as certain Golgi-localized SNAREs.
(A-E) Confocal images showing the distribution pattern and trafficking of (A) soluble protein cargo
Aleurain-mRFP, (B) membrane protein cargo RFP-SCAMP1, (C) Golgi marker Man1-RFP, (D) Golgi-
localized Qa-SNARE mRFP-SYP31 and (E) Golgi-localized Qc-SNARE mRFP-GOS12 was not
affected upon co-expression with YFP-BET12-m. YFP-BET12-m labeled ring-like structures
J. Cell Sci. 130: doi:10.1242/jcs.202838: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
observed in (B-D) may represent the organized smooth endoplasmic reticulum (OSER), which the
formation of OSER could be induced by the overexpression and accumulation of membrane proteins
in the ER. The degree of colocalization was quantified and represented by the Pearson correlation
coefficient (rp), with the rp value of +1.0 for complete colocalization. Dashed-line box represents a
3X enlargement. Scale bar = 10μm.
J. Cell Sci. 130: doi:10.1242/jcs.202838: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
Figure S5. YFP-BET12 and mCherry-MEMB12 displays a punctate pattern in Arabidopsis.
(A, B) Confocal images showing the punctate distribution pattern and the partial colocalization of
YFP-BET12 and mCherry-MEMB12 in both the Arabidopsis (A) protoplast and (B) leaf pavement
cell. The degree of colocalization was quantified and represented by the Pearson correlation
coefficient (rp), with the rp value of +1.0 for complete colocalization. Dashed-line box represents a
5X enlargement. Scale bar = 10μm.
J. Cell Sci. 130: doi:10.1242/jcs.202838: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
Figure S6. Ectopic expression of HA-BET12-m causes intracellular accumulation of PR1-RFP
in Arabidopsis protoplasts.
Secretion assay showing the intracellular accumulation of PR1-RFP when co-expressed with HA-
HA-BET12 and HA-BET12-m in Arabidopsis protoplasts. Total proteins were extracted from the
protoplasts that (1) singly expressed PR1-RFP, (2) co-expressed PR1-RFP with HA-BET12 and (3)
co-expressed PR1-RFP with HA-BET12-m respectively, followed by immunoblot analysis using RFP
antibodies. HA antibodies were used to detect the expression of HA-BET12 and HA-BET12-m. Anti-
cFBPase was used as a loading control.
J. Cell Sci. 130: doi:10.1242/jcs.202838: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
Table S1. List of proteins identified by the in vitro peptide pull down assay and MS/MS
analysis
# Accession
Number
Description MW (Da) Peptide
counts
Num. of
sequence
matches
Mascot
Score
Detected
in both
replicates
1 gi|6681338 putative coatomer zeta subunit 19715 7 3 134
2 gi|8953720 unnamed protein product 19752 3 1 56
3 gi|15241061 60S ribosomal protein L18-3 20954 28 9 558 Yes
4 gi|18398753 60S ribosomal protein L9-1 22004 25 9 516
5 gi|15235226 GTP-binding protein SAR1C 22016 9 2 85 Yes
6 gi|6006850 putative GAR1 protein 22811 6 2 75
7 gi|15228111 40S ribosomal protein S5-1 22976 11 3 170 Yes
8 gi|15229064 60S ribosomal protein L13-1 23752 33 10 602
9 gi|23197656 calmodulin-like protein 26756 4 1 43
10 gi|8885586 unnamed protein product 26916 3 2 56
11 gi|15223049 L-ascorbate peroxidase 1 27544 5 3 41
12 gi|27311547 Ribosomal protein L7 27899 22 9 532
13 gi|18421762 14-3-3-like protein GF14 psi 28588 12 7 318
14 gi|15233440 cold shock protein 1 30068 3 1 51
15 gi|14532442 At1g35160/T32G9_30 30160 12 5 237
16 gi|9663025 DIP2 protein 30403 3 2 48 Yes
17 gi|15221463 coatomer subunit epsilon-1 32581 8 3 156 Yes
18 gi|15240972 Pyridoxal biosynthesis protein PDX1.3 33195 10 4 155
19 gi|15232603 60S acidic ribosomal protein P0-2 34112 21 5 523
20 gi|2289095 WD-40 repeat protein 35757 5 2 39
21 gi|15229589 receptor for activated C kinase 1C 35805 3 2 46
22 gi|598067 calmodulin-related protein 36853 4 2 79
23 gi|18400998 VIRE2-interacting protein 1 37768 3 2 59
24 gi|21595481 unknown protein 41475 4 1 46
25 gi|15242516 actin 7 41709 31 9 564
26 gi|9758270 unnamed protein product 42625 9 3 151
27 gi|15229033 S-adenosylmethionine synthase 4 42769 21 7 524 Yes
28 gi|15221444 GTP-binding protein 44443 21 9 332 Yes
29 gi|15232723 60S ribosomal protein L4-1 44674 47 14 1479
30 gi|4584520 enoyl-CoA hydratase-like protein 46033 2 1 43
31 gi|15241168 tubulin alpha-3 49622 20 7 243
32 gi|15237059 RAB GTPase homolog E1b 51598 2 1 66 Yes
J. Cell Sci. 130: doi:10.1242/jcs.202838: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
Table S2. List of primer sequences used for generating constructs used in this study.
Underlined nucleotide sequences represent restriction enzyme sites.
Primer Name Nucleotide sequence (5’ to 3’)
YFP-BET12 Forward-SpeI GGG ACTAGT ATGAACTTTCGAAGGGAGAATCGT
YFP-BET12 Reverse-XhoI GGG CTCGAG TTACCCTTTGATGTAGTTTAATAGCCT
YFP-BET12(107-130) Forward-SpeI GGG ACTAGT ATGCTCATAGCTTATTTTGTGC
YFP-BET12(1-32)(98-130)
Forward-fusion
AGAGCTTCTTCTTCGTATTTTGAGAAGAAGTCTAAT
YFP-BET12(1-32)(98-130)
Reverse-fusion
ATTAGACTTCTTCTCAAAATACGAAGAAGAAGCTCT
YFP-BET12(1-32)(107-130)
Forward-fusion
AGAGCTTCTTCTTCGTATCTCATAGCTTATTTTGTG
YFP-BET12(1-32)(107-130)
Reverse-fusion
CACAAAATAAGCTATGAGATACGAAGAAGAAGCTCT
YFP-BET12(98-130) Forward-SpeI GGG ACTAGT ATGAAGAAGTCTAATCGAAAAAGTTG
YFP-BET12-m/YFP-BET12
(L18A,L21A,E22A)-Forward-SpeI
GGG ACTAGT ATGAACTTTCGAAGGGAGAATCGTGCTTCG
AGAACGTCTCTCTTTGATGGCGCTGATGGAGCTGCAGAAG
YFP-BET12-m/YFP-BET12
(R102A,K103A)-Reverse-XhoI
GGG CTCGAG TTACCCTTTGATGTAGTTTAATAGCCTAATAAGGTAATA
CATGATCAAGAACAGGAGCACAAAATAAGCTATGAGTTTGCAACTTGC
TGCATTAGACTTC
mCherry-MEMB12 Forward-SpeI GGG ACTAGT ATGGCGTCTGGGACAGTGGGAGGGT
mCherry-MEMB12 Reverse-XhoI GGG CTCGAG CTAGCGTGTCCATCTTATGAAGAGAT
PR1-RFP Forward-BamHI GGG GGATCC ATGAATTTTACTGGCTATTCTCGATTTTTAATCGTC
PR1-RFP Reverse-KpnI GGG GGTACC GTATGGCTTCTCGTTCACATAATTCCC
mRFP-SYP31 Forward-SpeI GGG ACTAGT ATGGGCTCGACGTTCAGAGATCGGA
mRFP-SYP31 Reverse-XhoI GGG CTCGAG TTAAGCCACAAAGAAGAGGAAAACA
mRFP-GOS12 Forward-SpeI GGG ACTAGT ATGACAGAATCGAGTCTGGATCT
mRFP-GOS12 Reverse-XhoI GGG CTCGAG TTATTTTGAGAGCCAGTAGATGATT
J. Cell Sci. 130: doi:10.1242/jcs.202838: Supplementary information
Jour
nal o
f Cel
l Sci
ence
• S
uppl
emen
tary
info
rmat
ion
![yiji]Dt©©3 Verd© Soil Program Study Area... · yiji]Dt©©3 Verd© Soil Program PO Box 730 Clarkdale, AZ 86324 Telephone; 928=649-3614 E-mail: UVSP@ghd.com March 2, 2017 Mr. John](https://static.documents.pub/doc/80x56/5fd98003eaa191634b37080e/yijidt3-verd-soil-program-study-area-yijidt3-verd-soil-program.jpg)
![Probabilistic Streaming Tensor Decompositionzhe/pdf/POST.pdf · Probabilistic Streaming Tensor Decomposition Yishuai Du y, Yimin Zheng , Kuang-chih Lee], Shandian Zhey University](https://static.documents.pub/doc/80x56/5eb6be1e3d209031916fd245/probabilistic-streaming-tensor-decomposition-zhepdfpostpdf-probabilistic-streaming.jpg)
