journa l homepage: www.e lsev ier .com/ locate / jv i romet
imultaneous assessment of CD4 and MHC-I downregulation by Nef primarysolates in the context of infection
yub Ali a,b, Susan Realegeno a,c, Otto O. Yang a,b,c, Martha J. Lewis a,b,∗
Division of Infectious Diseases, Department of Medicine, David Geffen School of Medicine at UCLA, Los Angeles, CA 90095, USAUCLA AIDS Institute, David Geffen School of Medicine at UCLA, Los Angeles, CA 90095, USADepartment of Microbiology, Immunology, and Molecular Genetics, David Geffen School of Medicine at UCLA, Los Angeles, CA 90095, USA
rticle history:eceived 3 February 2009eceived in revised form 16 July 2009ccepted 20 July 2009vailable online 28 July 2009
a b s t r a c t
The HIV-1 Nef protein plays a key role in pathogenesis, as demonstrated by strong selective pressureto maintain its open reading frame, and disease attenuation when it is deleted. Among myriad cellulareffects attributed to Nef, downregulation of cell surface CD4 and major histocompatibility complex class I(MHC-I) proteins are the best documented. However, few data regarding primary isolate Nef functions areavailable, and most studies have been performed using transient transfections to express Nef driven by a
eywords:IV-1efHC-I
D4
non-physiologic promoter. A novel assay system to measure simultaneously the downregulation of CD4and MHC-I by primary HIV-1 nef in a more physiologic viral genomic context is presented. Examinationof plasma nef mixtures allowed comprehensive profiling of these Nef functions within the quasispeciesin vivo. Subsets within the circulating nef population were observed that are either fully functional ornon-functional. These data demonstrated that this assay system allows rapid characterization of bulkand clonal Nef functional profiles that can be used in pathogenesis studies to define further its important
role in pathogenesis.
. Introduction
Unique to SIV and HIV, Nef is a small myristoylated proteinhat plays a central role in the pathogenesis of disease, based onn vivo observations of humans and primates (Kestler et al., 1991;iguet and Trono, 1999; Trono, 1995). Macaques infected with antherwise pathogenic strain of SIV with nef deleted tend to haveignificantly attenuated disease and protection from subsequenthallenge with wild-type virus (Daniel et al., 1992; Swigut et al.,004). Similarly, slower disease progression has been noted in aohort of humans infected by blood transfusions from a single HIV--infected donor whose virus contained a defect in nef (Deacon etl., 1995; Dyer et al., 1997; Kirchhoff et al., 1995; Oelrichs et al.,998).
Yet the exact mechanism of Nef’s contribution to pathogenesis
s not completely understood. Among its many reported functionsn infected cells that may contribute to viral pathogenesis, Nef is
ell documented to downregulate CD4 (Bandres et al., 1995; Garciand Miller, 1991), downregulate major histocompatibility complex
∗ Corresponding author at: Division of Infectious Diseases, 37-121 CHS, 10833eConte Ave, Los Angeles, CA 90095, USA. Tel.: +1 310 825 0205;ax: +1 310 825 3632.
class I proteins (MHC-I) (Cohen et al., 1999; Collins et al., 1998;Schwartz et al., 1996), and modulate cellular activation (Du et al.,1995; Glushakova et al., 1999; Simmons et al., 2001; Smith et al.,1996). Elimination of some or all of these functions leads to an atten-uated infection (Geffin et al., 2000). Among the best-understoodfunctions of Nef are downregulation of MHC-I and CD4 moleculesfrom the surface of infected cells. MHC-I downregulation has beenshown to render infected cells less visible to circulating CD8+ cyto-toxic T lymphocytes (CTL) and thereby confer resistance of infectedcells to CTL killing (Adnan et al., 2006; Collins et al., 1998; Fujiwaraand Takiguchi, 2007; Tomiyama et al., 2002, 2005; Ueno et al.,2008; Yang et al., 2002). Nef’s downregulation of CD4 prevents CD4binding to Env on nascent virions thereby enhancing virion release(Lama et al., 1999; Mangasarian et al., 1999; Yang et al., 2002).
Previous studies of Nef function have been limited by the useof a few homogenous strains of HIV-1 and the expression of Nefusing non-physiologic promoters (Collins et al., 1998; Noviello et al.,2007; Schindler et al., 2006). Limited data are available regardingthe function of Nef proteins from primary viruses, although somestudies have shown variation in the MHC-I downregulatory func-tion relative to HIV-1 disease status (Carl et al., 2001; Kirchhoff et al.,
1999; Lewis et al., 2008; Noviello et al., 2007). Additionally, initialobservations indicate that even within the same infected individualthere may be variations in this function of Nef (Lewis et al., 2008).Further complicating the measurement of Nef’s function is the factthat Vpu and Env also downregulate CD4 (Lama et al., 1999; Pang
t al., 2000). Therefore this function of Nef typically has been stud-ed by expressing nef in a eukaryotic expression vector rather than
hole HIV-1-infection in order to isolate Nef’s contribution to CD4ownregulation.
A new, modified whole-genome assay system to measure simul-aneously the ability of Nef to downregulate MHC-I and CD4 isresented. Use of a whole-genome vector allows for the expres-ion of Nef at physiologic levels under the control of an HIV-1TR promoter. The deletion of segments of Env and Vpu per-its the measurement of Nef’s independent contribution to CD4
ownregulation. Lastly, our approach allows the use of cloneduasispecies rather than just a single isolate to generate Nef func-ional profiles more accurately reflecting its in vivo function withinhe circulating swarm of HIV-1. This system provides a rapidssay for the measurement of multiple Nef functions that morelosely reflects its function in vivo compared to previous assayystems.
. Materials and methods
.1. Creation of an env- and vpu-defective cloning vector toccept primary nef genes
The 3′ half-genome NL4-3-based plasmid modified to containhe HSA-HA reporter gene within nef, p83-10-HAxNef, served as thetarting template for the construction of a target vector for cloningrimary nef sequences (Ali et al., 2003; Ali and Yang, 2006). Thisonstruct was chosen to allow detection of parental vector with-ut nef insertion by staining for HA. First, a deletion within envas created. The plasmid pNL4-3-EGFP-�Env containing a dele-
ion of 581 bp (7039–7620) in env (Pang et al., 2000) was digestedith NdeI and BamHI, and the resulting fragment was subcloned
nto p83-10-HAxNef replacing wild-type env. Next, the deletionithin vpu was added. The NL4-3-based vector p210–13 (Gibbs
t al., 1994) containing a deletion of 127 bp in vpu (6063–6180)
as digested with EcoRI and NdeI. The digested product was then
nserted into the p83-10-HAxNef-�env plasmid, creating a doubleeletion, �env and vpu.
In order to reconstruct a whole-genome molecular clonehe modified 3′ half-genome construct described above, p83-10-
ig. 1. Construction of a modified NL4-3-based whole-genome plasmid with deletions inL4-3-based half-genome plasmids, p83-10 and p83-2.1 with HA and HSA reporters, r
7039–7620) and vpu (6063–6180) in p83-10 and the modifications made to specific restrihe final reconstructed whole-genome plasmid created by ligating EcoRI- and NruI-digest
ethods 161 (2009) 297–304
HAxNef-�env�vpu, was combined with a modified version of the5′ half-genome construct, p83-2-HSAxVpr (Ali et al., 2003). Threemodifications were made to p83-2-HSAxVpr. First, a duplicate BspEIsite was abolished from the 5′ LTR leaving a unique site in the 3′
LTR at the 3′ end of nef. Second, a duplicate XbaI site before vprwas removed leaving a unique site at the 5′ end of nef. Third, anNruI site was created at the junction of the HIV insert and theplasmid backbone. This plasmid was designated p83-2-HSAxVpr-Nru+Bsp−Xba−. Finally, the whole-genome construct was createdby digesting both plasmids with EcoRI and NruI. The appropriatefragments were gel-purified then ligated. The resultant plasmidwas named AA1305#18 (Fig. 1). All modifications were confirmedby sequencing. The final plasmid sequence is available via GenBankaccession number GQ452298.
2.2. Construction of a panel of control nef alleles: NL4-3 Nef, deltaNef, M20A Nef, and LL > AA Nef
All control nef alleles were inserted using the restriction sitesXbaI and BspEI of AA1305#18 described above. An XbaI restric-tion site was created at the 5′ end of nef by PCR using thefollowing primer pair: Nef 8787 XbaIF 5′ GCTCTAGAATGGGTG-GCAAGTGCTCAA and Nef 9495R 5′ TTATATGCAGCATCTGAGGGC.The high fidelity enzyme Phusion (New England Biolabs) and stan-dard reaction conditions as recommended by the manufacturer fora 50 �L reaction were used for amplification. The following PCRcycle was used: 5 min at 98 ◦C, 35 cycles of 98 ◦C for 10 s, 57 ◦C for30 s, 72 ◦C for 30 s, followed by a final extension at 72 ◦C for 10 min.The resulting PCR product contained novel XbaI and native BspEIrestriction sites, which were used for cloning into the full-genomeconstruct AA1305#18. The following plasmids were used as tem-plates for control Nefs: p210-5 (�Nef) (Gibbs et al., 1994) obtainedthrough the AIDS Research and Reference Reagent Program (Cat. No.2485), p83-10 (wild-type NL4-3 Nef) (Gibbs et al., 1994) obtainedthrough the AIDS Research and Reference Reagent Program (Cat.
No. 2480), p83-10 Nef M20A (Ali et al., 2003) (a mutant specificallydefective in Nef’s function to downregulate MHC-I molecules (Akariet al., 2000)), and a plasmid containing the previously describeddi-leucine to alanine (LL → AA) Nef mutant specifically defective inits CD4 downregulation function kindly provided by John Guatelli
env and vpu, and unique cloning sites for the insertion of unique nef alleles. Parentespectively, are shown on the left. The middle panel shows the deletions in envction enzyme sites (BspEI and XbaI) in both parent plasmids. The right panel showsed half-genome plasmids.
gical M
(b
2
tsqrwtucaTNGCMupat9fwsvtscst(pa
2
sqMtlBao
2r
cp(wciaqTo
A. Ali et al. / Journal of Virolo
Craig et al., 1998; Riggs et al., 1999). All mutants were confirmedy sequencing.
.3. Primary HIV-1 nef quasispecies cloning from plasma
Study subjects provided informed consent according to a pro-ocol approved by the UCLA Institutional Review Board. Plasmaamples from three HIV-1-infected persons whose circulating Nefuasispecies had previously been studied for ability to down-egulate MHC-I in the whole-genome HIV-1 (Lewis et al., 2008)ere utilized. Viral RNA was isolated from 1 ml of plasma using
he Ultrasens Viral Isolation Kit (Qiagen) according to the man-facturer’s protocol. Viral RNA was used as a template forDNA synthesis using Omniscript Reverse Transcriptase (Qiagen)nd the following gene-specific primers: Nef 9589R 5′ TAGT-AGCCAGAGAGCTCCCA, Nef 8670F 5′ AATGCCACAGCCATAGCAGTG,ef 8675F 5′ GCAGTAGCTGAGGGGACAGATAGG, Nef 8687F 5′
TAGCTCAAGGGACAGATAGGGTTA, Nef 8736F 5′ AGAGCTATTCGC-ACATACC. RT products were then used for nested PCR usingaster Taq Kit (Eppendorf). The first PCR used the same primers
sed for reverse transcription. The nested PCR used the followingrimers: Nef 8787 XbaIF 5′ GCTCTAGAATGGGTGGCAAGTGCTCAAnd Nef 9495R 5′ TTATATGCAGCATCTGAGGGC. Both PCR reac-ions were carried out using the following conditions: 5 min at5 ◦C, 35 cycles of 95 ◦C for 30 s, 54 ◦C for 40 s, 72 ◦C for 60 s,ollowed by a final extension at 72 ◦C for 10 min. PCR products
ere gel-purified with Quick Spin Columns (Qiagen) and sub-equently cloned in bulk by the TA method into pCR2.1-TOPOector (Invitrogen). Ligation mixtures were grown in liquid cul-ure with ampicillin (rather than individual colony selection onolid media) in order to preserve the quasispecies mixture ofloned PCR products. For subject 00037 ten individual clones wereelected for testing in parallel with the cloned quasispecies mix-ure. Plasmid DNA was isolated and digested with XbaI and BspEINew England Biolabs) and subsequently subcloned into the nefosition of the whole-genome construct AA1305#18 describedbove.
.4. Sequencing and phylogenetic analysis of nef alleles
Multiple single colonies from each cloning reaction wereequenced to confirm cloning success and the preservation of theuasispecies diversity. Sequencing was performed using M13F and13R vector primers and ABI Big Dye 3.1 Sequencing Kit according
o the manufacturer’s protocol. Sequences were editing, trans-ated into amino acid sequences and aligned with NL4-3 Nef usingioEdit. A neighbor-joining phylogenetic tree was constructed forll subject 00037 clones using the DNAdist and Neighbor programsf Phylip 3.64.
.5. Production of single-round infectious, pseudotyped HIV-1eporter virus
Single-round infectious pseudotyped virus was produced byo-transfecting the whole-genome plasmid AA1305#18 and alasmid encoding the envelope glycoprotein from VSV (VSVg)Burns et al., 1993) provided by Dr. Irvin Chen. 293T cellsere transfected with 10 �g of each plasmid using a standard
ng virus was collected on day 2 through 5 post-transfectionnd filtered through a 0.45 �M filter. Virus production wasuantified by p24 antigen ELISA (PerkinElmer, Waltham, MA).ransfections typically produced greater than 200,000 pg/mlf p24.
ethods 161 (2009) 297–304 299
2.6. Flow cytometric assessment of Nef-mediated downregulationof CD4 and MHC-I on infected cells
T1 lymphocytes (Salter et al., 1985) were infected at 37 ◦C for4 h with 1 ml of pseudotyped virus stock containing 250–500 ngp24 antigen. Parallel infections were performed with viruses car-rying either wild-type NL4-3 nef (positive control for both CD4 andMHC-I downregulation), M20A nef (positive control for CD4 down-regulation and negative control for MHC-I downregulation), LL > AAnef (negative control for CD4 downregulation and positive controlfor MHC-I downregulation), or primary nef quasispecies describedabove. On day 4 post-infection 2 × 105 cells were stained withanti-murine CD24/HSA-FITC (BD Pharmingen), anti-human CD4-APC (BD Pharmingen) and anti-human HLA A*02-PE (ProImmune),washed twice and fixed with 1% paraformaldehyde. Uninfected T1cells stained with isotype control antibodies were used to set thenegative quadrants. T1 cells stained with anti-human HLA A*02-PE and WT NL4-3 Nef infected cells stained with anti-murineCD24/HSA-FITC were used to establish appropriate compensationbetween FL1 and FL2 channels. There is no overlapping signal withPE or FITC and APC, detected in FL4, so no further compensa-tion was required. At least 5 × 104 live cells were counted usinga FACScan flow cytometer, and data were analyzed using CellQuestsoftware (Becton Dickinson). Maximum levels of HLA A*02 and CD4were determined using the delta Nef mutant. Absence of stainingwith anti-HA-FITC antibody (Roche) confirmed no contaminationfrom the parent cloning plasmid during virus production (data notshown).
3. Results
3.1. Construction of an Env- and Vpu-deleted HIV-1 vector
A modified full-genome, NL4-3-based plasmid vector was cre-ated to allow expression of Nef under the control of the HIV-1 LTR(Fig. 1) to evaluate its ability to downregulate CD4 and MHC-I fromthe surface of infected cells. Since both HIV-1 Env and Vpu alsodownregulate CD4, portions of both were deleted in order to isolateNef’s contribution to CD4 downregulation (Gibbs et al., 1994; Lamaet al., 1999; Pang et al., 2000). In addition to deletions in env and vpu,XbaI and BspEI restriction sites were modified to create a uniquecloning site for nef genes. Lastly, the vector contained the reportergene HSA in the Vpr reading frame and the reporter HSA-HA (Aliand Yang, 2006) in the Nef reading frame, allowing detection ofinfected cells (HSA-expressing) and exclusion of those with vectornot containing inserted nef (HA-expressing).
3.2. Insertion of HIV-1 nef alleles into the vector
In order to assess the ability of ex vivo Nef to downregulate CD4and MHC-I, nef alleles were amplified by RT-PCR from the plasma ofthree chronically infected individuals. The forward primer for thenested PCR created an XbaI restriction site at the 5′ end of nef and thePCR product included a native BspEI restriction site at the 3′ end ofnef (Fig. 2). Rather than selecting single nef isolates, the entire bulkquasispecies mixture amplified by PCR was utilized for subsequentinsertion into the vector. Both the full-genome vector AA1305#18and the amplified nef quasispecies were digested with XbaI andBspEI. The nef locus from AA1305#18 (containing the reporterHSA-HA) was removed by gel-purification prior to ligation of the
patient-derived nef quasispecies. In addition, four control plasmidswere constructed each containing Nef with defined properties. Thepanel of control Nefs included the following: (1) NL4-3 Nef, whichdownregulates both MHC-I and CD4, (2) Nef with a deletion afterthe first 12 amino acids (�Nef, which downregulates neither), (3)
300 A. Ali et al. / Journal of Virological Methods 161 (2009) 297–304
F e vep ring wc fied w
NN2md
3
teepianp
FaAc
ig. 2. Strategy for cloning primary nef quasispecies into the modified whole-genomrimer contains an XbaI restriction site sequence. The BspEI site is naturally occurloned, digested with XbaI and BspEI and inserted into the nef position of the modi
ef with a methionine to alanine substitution at position 20 (M20Aef, selectively deficient in MHC-I downregulation (Akari et al.,000)), and (4) Nef with a substitution of alanines for a di-leucineotif at positions 164–165 (LL > AA Nef, selectively deficient in CD4
ownregulation (Riggs et al., 1999)).
.3. Production of VSVg-pseudotyped recombinant reporter virus
To rescue the replication defective recombinant reporter virus,he constructs were co-transfected with a plasmid expressing VSVnvelope glycoprotein gene, complementing the defective HIV-1nv in trans. 293T cells transfected with both plasmids therefore
ng the �env-vpu genome with patient-derived or control nef,nd the mCD24/HSA reporter gene (in the vpr locus). The super-atant typically contained over 200 ng/ml HIV-1 p24 by day 4ost-transfection (not shown).
ig. 3. A panel of Nef mutants expressed at physiologic levels in the context of the modifind MHC-I downregulation by Nef. The Nef variant is indicated in upper right corner of e*02 and CD4 expression. (B) Histogram plot of A*02 expression; the filled histogram reomparison. (C) Histogram plot of CD4 expression; the filled histogram represents the ind
ctor. Positions of the nested PCR primers are indicated by arrowheads. The forwardithin the amplified product. Nef quasispecies are amplified from plasma RNA, TA
hole-genome vector AA1305#18.
3.4. Assessment of CD4 and MHC-I downregulation by controlNefs
These viruses were used to infect T1 cells, a CD4 and MHC-I A*02-expressing HIV-1-permissive cell line (Salter et al., 1985).Four days after infection, the cells were stained with monoclonalantibodies against HSA (FITC-labeled), human A*02 (PE-labeled)and human CD4 (APC-labeled). Flow cytometry demonstrated thatNef mutants expressed at physiologic levels can clearly vary inthe downregulation of CD4 and MHC-I (Fig. 3), whose expressioncould be examined on infected cells by gating on HSA-expressingcells. Simultaneous assessment of CD4 and MHC-I expression oncells infected with virus containing different control Nef proteins
(Fig. 3A) revealed functional profiles consistent with the knowneffects of the Nef mutations. NL4-3 Nef downregulated both CD4and A*02 compared to �Nef (Fig. 3B and C), while LL > AA Nef lostthe ability to downregulate CD4 but not A*02, and M20A Nef lostthe ability to downregulate A*02 but not CD4. These results val-
ed whole-genome construct demonstrates the simultaneous measurement of CD4ach plot. Gates were set on all live, HSA-positive cells. (A) Dot plot of simultaneouspresents the indicated Nef variant, while the open histogram represents �Nef foricated Nef variant, while the open histogram represents �Nef for comparison.
A. Ali et al. / Journal of Virological Methods 161 (2009) 297–304 301
Fig. 4. Simultaneous measurement of CD4 and MHC-I downregulation by nef quasispecies isolated from chronically infected individuals. The subject number is in upper rightcorner of each plot. Gates were set on all live, HSA-positive (infected) cells. (A) Dot plot of simultaneous A*02 and CD4 expression. Percent of gated events is noted in eachq ef varo he op
iN
3p
tt(ti0dtnsTwcfiti
uadrant. (B) Histogram plot of A*02; the filled histogram represents the indicated Nf CD4 expression; the filled histogram represents the indicated Nef variant, while t
dated the ability of the assay to distinguish these functions ofef.
.5. Assessment of CD4 and MHC-I downregulation byatient-derived Nef quasispecies
Cells infected with the viruses carrying nef quasispecies fromhe three chronically infected individuals showed variability inheir functions of downregulate CD4 and A*02 downregulationFig. 4). The Nef swarms from subjects 00021 and 00022 appearedo contain a majority of alleles fully capable of downregulat-ng both (65% and 71%, respectively), whereas Nefs from subject0037 appeared to have two functional subpopulations, one whichownregulates both (45%) and the other which downregulates nei-her (31%). Clonal sequencing of these nef mixtures showed thato more than 5% of sequences from these individuals had non-ense or frameshift mutations ((Lewis et al., 2008) and Fig. 6).hus, variation in Nef function occurred in the Nef quasispecies
ith fully intact nef reading frames. These data demonstrated the
apacity of this new assay system to examine the functional pro-le of circulating Nef quasispecies in a more physiologic context,
hus more accurately reflecting the overall functionality of Nefn vivo.
iant, while the open histogram represents �Nef for comparison. (C) Histogram ploten histogram represents �Nef for comparison.
3.6. Comparison of Nef’s function by quasispecies versusindividual clones
In order to validate the testing of nef quasispecies, 10 individ-ual nef clones from subject 00037 were tested for their ability todownregulate CD4 and MHC-I and these results compared to thoseobtained from quasispecies testing. Ten individual clones wereselected at random and sequenced. These sequences were alignedwith NL4-3 Nef and 21 other subject 00037 nef clones from thequasispecies population. Only one of the 31 sequences containeda deletion resulting in a defective protein sequence. A neighbor-joining phylogenetic tree demonstrated that the individual cloneswere distributed throughout the population (Fig. 5). Pseudotypedrecombinant reporter viruses encoding the individual nef alleleswere used to measure the simultaneous downregulation of CD4and HLA A*02 as described above. All of the individual alleles dis-played 1 of 3 distinct functional profiles (Fig. 6). Five of 10 clonesfully downregulated both CD4 and HLA A*02, 3 of 10 downregulatedneither, and 2 of 10 downregulated CD4 but not HLA A*02. These
results were in excellent agreement with the quasispecies testingwhere 45% downregulated both, 31% downregulated neither, and14% downregulated CD4 but not HLA A*02. As had been previouslyshown (Lewis et al., 2008), the downregulation function was eitherfully present or absent for each individual alleles, and the overall
302 A. Ali et al. / Journal of Virological M
Fig. 5. A neighbor-joining phylogenetic tree of nef sequences derived from subject00037 demonstrates the distribution and function of the individually tested clones.Thirty-one full-length nef alleles were sequenced and aligned with NL4-3 nef. The10 clones used for individual testing are indicated with labels. The functional profileof each clone tested is indicated after its name: (++) both CD4 and MHC-I down-regulation present, (−−) both CD4 and MHC-I downregulation absent, (“CD4”) CD4downregulation present, MHC-I downregulation absent. Whether the reading framewas intact or defective is indicated for the non-functional isolates.
Fig. 6. Simultaneous measurement of CD4 and MHC-I downregulation by individual nefsubject 00037 were used to infect T1 cells in parallel. Three days after infection CD4 and HLof each of the three types of function profiles observed are shown. (A) Dot plot of simultrepresents the indicated Nef variant, while the open histogram represents �Nef for comindicated Nef variant, while the open histogram represents �Nef for comparison.
ethods 161 (2009) 297–304
level of function of the quasispecies population was determined bythe proportion of functional alleles in the population.
4. Discussion
Nef clearly holds a central position in HIV-1 pathogenesis, likelythrough multiple functions including CD4 and MHC-I downregu-lation (reviewed in Fackler and Baur, 2002). However, the relativecontribution of each of these functions to pathogenesis is unknown.Additionally it is not known if all functions are present at all dis-ease stages and in all primary isolates. There is the suggestion thatdifferent functions of Nef are optimized at different disease stages.Initial data from primary isolates indicates that both CD4 and MHC-I downregulatory functions are intact in acute and early infection(Kirchhoff et al., 1999; Noviello et al., 2007). Yet it appears that Neffunction tends to be lost by the time an individual has progressedto end-stage AIDS (Carl et al., 2001; Kirchhoff et al., 1999; Lewiset al., 2008). Additionally, it has been shown that some chronicallyinfected individuals harbor two functionally distinct populationswith respect to MHC-I downregulation (Lewis et al., 2008). Indeedthere may be an evolution or trade off between different functionsover time and in different in vivo contexts (Altes and Jansen, 2000).For example, Nef may optimize different functions in different tis-sue compartments or in response to differing immune pressure (Ali
et al., 2005; Salemi et al., 2005). Understanding this balance in pri-mary isolates is crucial for a better understanding of Nef’s role inpathogenesis.
Previous assays of Nef function have suffered from several lim-itations including the use of exogenous promoters that therefore
alleles. Ten separate recombinant reporter viruses carrying a single nef allele fromA A*02 were measured on live, HSA reporter-positive cells. Representative examplesaneous A*02 and CD4 expression. (B) Histogram plot of A*02; the filled histogramparison. (C) Histogram plot of CD4 expression; the filled histogram represents the
gical M
elosulditiueAiir(
rfqiodlassmApcpotBNw
Ndstoolp0spowlclhc
tcttceic
A. Ali et al. / Journal of Virolo
xpress Nef at non-physiologic levels, the expression of Nef in iso-ation and not in the context of viral infection, and the testingf only single homogenous isolates, primarily standard laboratorytrains. Altered expression of Nef may alternatively overestimate ornderestimate its functions. Additionally, expression of Nef in non-
ymphocyte cell lines that may not accurately reflect the degree ofownregulation of these cell surface molecules as their levels and or
ntracellular pathways may vary from lymphocytes. Our vector sys-em expresses Nef under the control of the HIV-1 LTR as promotern a T lymphocyte cell line, more closely resembling the in vivo sit-ation. Also, the use of the modified whole-genome vector for thexpression of Nef places its function in the context of viral infection.lthough several reading frames (env, vpr, and vpu) have been mod-
fied, the physiologic expression of Nef via LTR-driven transcriptions preserved in this NL4-3-based system and the insertion of theeporter gene in vpr has been shown not to affect pathogenicityJamieson and Zack, 1998).
The use of single, homogenous Nef isolates or testing only labo-atory isolates is not necessarily an accurate reflection of the overallunction of Nef in infected individuals. In vivo, HIV-1 exists as auasispecies, a swarm of related but not identical sequences. Test-
ng a single primary isolate may not be reflective of the functionf the entire circulating quasispecies, even if it appears to be aominant clone. The use of laboratory strains may also yield mis-
eading conclusions about Nef’s functions. Most of these strains,lthough originally isolated from chronically infected individuals,ubsequently have been adapted for growth in cell lines underelective conditions that differ from those in vivo, and hence theyay have gained or lost functions relative to primary isolates.
lthough there is the possibility of bias introduced through therocess of PCR cloning from plasma, it appears that this methodan reliably reflect the degree of diversity present in the quasis-ecies swarm in vivo (Lewis et al., 2008). Comparison of resultsbtained from testing individual clones with results obtained fromesting the quasispecies population showed excellent concordance.y testing the whole population, a profile of the overall level ofef function both within and between individuals can be generatedithout the selection bias introduced by testing individual clones.
Our new assay system allows the examination of clonal or mixedef populations for simultaneous assessment of MHC-I and CD4ownregulation. Our pilot testing of circulating plasma nef qua-ispecies in three chronically HIV-1-infected individuals confirmshat function is not uniform across the population, as previouslybserved for MHC-I downregulation alone (Lewis et al., 2008). Twof the subjects, 00022 and 00037, both had high viral loads and
ow CD4 counts. However, the functional profile of the nef quasis-ecies was not the same; the majority of nef alleles from subject0022 were functional, while only about half of the alleles fromubject 00037 were functional. Subject 00037 had suffered multi-le opportunistic infections while subject 00022 had not. The lossf Nef functions in the quasispecies of subject 00037, an individualith end-stage AIDS, is consistent with previous studies reporting
oss of Nef function with progression to end-stage disease. Furtherharacterization of nef alleles from infected individuals, as well asongitudinal study of Nef function within the same individual willelp clarify whether and which Nef functions are associated withlinical disease indicators.
Results from chronically infected subjects also demonstratedhat Nef-mediated downregulation of CD4 and MHC-I appearedoncordant; that is, for the majority of Nef isolates both func-ions were either present or absent. Further work will be required
o determine whether this trend holds true in different tissueompartments, and across more individuals spanning varying dis-ase states. Because the mechanisms and domains of Nef involvedn downregulating CD4 and MHC-I are distinct, these functionsertainly could be differentially regulated. Another interesting
ethods 161 (2009) 297–304 303
observation is that individual Nef sequences appear to be eitherfully functional or non-functional, and this is not explained by thelow frequency of defective reading frames. Again, further work willbe required to determine the generality of this observation.
In summary, this assay allows the simultaneous assessment ofCD4 and MHC-I downregulation by Nef. This assay is amenable tothe quantification of these functions in primary isolate Nef proteins,either as bulk quasispecies or clones, under controlled expressionunder a physiologic promoter in the HIV-1 genomic context. Thistool will allow examination of these Nef functions for their contri-bution to disease in pathogenesis studies.
References
Anon, 2002. Calcium phosphate transfection. In: Ausubel, F., Brent, R., Kingston, R.,Moore, D., Seidman, J., Smith, J., Struhl, K. (Eds.), Short Protocols in MolecularBiology, vol. 1. Wiley, pp. 9.6–9.7.
Adnan, S., Balamurugan, A., Trocha, A., Bennett, M.S., Ng, H.L., Ali, A., Brander, C.,Yang, O.O., 2006. Nef interference with HIV-1-specific CTL antiviral activity isepitope specific. Blood 108, 3414–3419.
Akari, H., Arold, S., Fukumori, T., Okazaki, T., Strebel, K., Adachi, A., 2000. Nef-inducedmajor histocompatibility complex class I down-regulation is functionally disso-ciated from its virion incorporation, enhancement of viral infectivity, and CD4down-regulation. J. Virol. 74, 2907–2912.
Ali, A., Jamieson, B.D., Yang, O.O., 2003. Half-genome human immunodeficiency virustype 1 constructs for rapid production of reporter viruses. J. Virol. Methods 110,137–142.
Ali, A., Ng, H.L., Dagarag, M.D., Yang, O.O., 2005. Evasion of cytotoxic T lymphocytesis a functional constraint maintaining HIV-1 Nef expression. Eur. J. Immunol. 35,3221–3228.
Ali, A., Yang, O.O., 2006. A novel small reporter gene and HIV-1 fitness assay. J. Virol.Methods 133, 41–47.
Altes, H.K., Jansen, V.A., 2000. Intra-host competition between nef-defective escapemutants and wild-type human immunodeficiency virus type 1. Proc. R. Soc. Lond.B: Biol. Sci. 267, 183–189.
Bandres, J.C., Shaw, A.S., Ratner, L., 1995. HIV-1 Nef protein downregulation of CD4surface expression: relevance of the lck binding domain of CD4. Virology 207,338–341.
Burns, J.C., Friedmann, T., Driever, W., Burrascano, M., Yee, J.K., 1993. Vesicular stom-atitis virus G glycoprotein pseudotyped retroviral vectors: concentration to veryhigh titer and efficient gene transfer into mammalian and nonmammalian cells.Proc. Natl. Acad. Sci. U.S.A. 90, 8033–8037.
Carl, S., Greenough, T.C., Krumbiegel, M., Greenberg, M., Skowronski, J., Sulli-van, J.L., Kirchhoff, F., 2001. Modulation of different human immunodeficiencyvirus type 1 Nef functions during progression to AIDS. J. Virol. 75, 3657–3665.
Cohen, G.B., Gandhi, R.T., Davis, D.M., Mandelboim, O., Chen, B.K., Strominger, J.L.,Baltimore, D., 1999. The selective downregulation of class I major histocom-patibility complex proteins by HIV-1 protects HIV-infected cells from NK cells.Immunity 10, 661–671.
Collins, K.L., Chen, B.K., Kalams, S.A., Walker, B.D., Baltimore, D., 1998. HIV-1 Nef pro-tein protects infected primary cells against killing by cytotoxic T lymphocytes.Nature 391, 397–401.
Craig, H.M., Pandori, M.W., Guatelli, J.C., 1998. Interaction of HIV-1 Nef withthe cellular dileucine-based sorting pathway is required for CD4 down-regulation and optimal viral infectivity. Proc. Natl. Acad. Sci. U.S.A. 95, 11229–11234.
Daniel, M.D., Kirchhoff, F., Czajak, S.C., Sehgal, P.K., Desrosiers, R.C., 1992. Protectiveeffects of a live attenuated SIV vaccine with a deletion in the nef gene. Science258, 1938–1941.
Deacon, N.J., Tsykin, A., Solomon, A., Smith, K., Ludford-Menting, M., Hooker, D.J.,McPhee, D.A., Greenway, A.L., Ellett, A., Chatfield, C., Lawson, V.A., Crowe, S.,Maerz, A., Sonza, S., Learmont, J., Sullivan, J.S., Cunningham, A., Dwyer, D., Dow-ton, D., Mills, J., 1995. Genomic structure of an attenuated quasispecies of HIV-1from a blood transfusion donor, recipients. Science 270, 988–991.
Du, Z., Lang, S.M., Sasseville, V.G., Lackner, A.A., Ilyinskii, P.O., Daniel, M.D., Jung,J.U., Desrosiers, R.C., 1995. Identification of a nef allele that causes lymphocyteactivation and acute disease in macaque monkeys. Cell 82, 665–674.
Dyer, W.B., Geczy, A.F., Kent, S.J., McIntyre, L.B., Blasdall, S.A., Learmont, J.C., Sul-livan, J.S., 1997. Lymphoproliferative immune function in the Sydney BloodBank Cohort, infected with natural nef/long terminal repeat mutants, and inother long-term survivors of transfusion-acquired HIV-1 infection. AIDS 11,1565–1574.
Fackler, O.T., Baur, A.S., 2002. Live and let die: Nef functions beyond HIV replication.Immunity 16, 493–497.
Fujiwara, M., Takiguchi, M., 2007. HIV-1-specific CTLs effectively suppress replication
of HIV-1 in HIV-1-infected macrophages. Blood 109, 4832–4838.
Geffin, R., Wolf, D., Muller, R., Hill, M.D., Stellwag, E., Freitag, M., Sass, G., Scott, G.B.,Baur, A.S., 2000. Functional and structural defects in HIV type 1 nef genes derivedfrom pediatric long-term survivors. AIDS Res. Hum. Retroviruses 16, 1855–1868.
3 gical M
G
G
J
K
K
K
L
L
M
N
O
P
P
04 A. Ali et al. / Journal of Virolo
ibbs, J.S., Regier, D.A., Desrosiers, R.C., 1994. Construction and in vitro proper-ties of HIV-1 mutants with deletions in “nonessential” genes. AIDS Res. Hum.Retroviruses 10, 343–350.
lushakova, S., Grivel, J.C., Suryanarayana, K., Meylan, P., Lifson, J.D., Desrosiers, R.,Margolis, L., 1999. Nef enhances human immunodeficiency virus replication andresponsiveness to interleukin-2 in human lymphoid tissue ex vivo. J. Virol. 73,3968–3974.
amieson, B.D., Zack, J.A., 1998. In vivo pathogenesis of a human immunodeficiencyvirus type 1 reporter virus. J. Virol. 72, 6520–6526.
estler 3rd, H.W., Ringler, D.J., Mori, K., Panicali, D.L., Sehgal, P.K., Daniel, M.D.,Desrosiers, R.C., 1991. Importance of the nef gene for maintenance of high virusloads and for development of AIDS. Cell 65, 651–662.
irchhoff, F., Easterbrook, P.J., Douglas, N., Troop, M., Greenough, T.C., Weber, J., Carl,S., Sullivan, J.L., Daniels, R.S., 1999. Sequence variations in human immunodefi-ciency virus type 1 Nef are associated with different stages of disease. J. Virol.73, 5497–5508.
irchhoff, F., Greenough, T.C., Brettler, D.B., Sullivan, J.L., Desrosiers, R.C., 1995. Briefreport: absence of intact nef sequences in a long-term survivor with nonpro-gressive HIV-1 infection. N. Engl. J. Med. 332, 228–232.
ama, J., Mangasarian, A., Trono, D., 1999. Cell-surface expression of CD4 reducesHIV-1 infectivity by blocking Env incorporation in a Nef- and Vpu-inhibitablemanner. Curr. Biol. 9, 622–631.
ewis, M.J., Balamurugan, A., Ohno, A., Kilpatrick, S., Ng, H.L., Yang, O.O., 2008. Func-tional adaptation of Nef to the immune milieu of HIV-1 infection in vivo. J.Immunol. 180, 4075–4081.
angasarian, A., Piguet, V., Wang, J.K., Chen, Y.L., Trono, D., 1999. Nef-induced CD4and major histocompatibility complex class I (MHC-I) down-regulation are gov-erned by distinct determinants: N-terminal alpha helix and proline repeat of Nefselectively regulate MHC-I trafficking. J. Virol. 73, 1964–1973.
oviello, C.M., Pond, S.L., Lewis, M.J., Richman, D.D., Pillai, S.K., Yang, O.O., Little, S.J.,Smith, D.M., Guatelli, J.C., 2007. Maintenance of Nef-mediated modulation ofmajor histocompatibility complex class I and CD4 after sexual transmission ofhuman immunodeficiency virus type 1. J. Virol. 81, 4776–4786.
elrichs, R., Tsykin, A., Rhodes, D., Solomon, A., Ellett, A., McPhee, D., Deacon, N.,1998. Genomic sequence of HIV type 1 from four members of the Sydney BloodBank Cohort of long-term nonprogressors. AIDS Res. Hum. Retroviruses 14, 811–
814.
ang, S., Yu, D., An, D.S., Baldwin, G.C., Xie, Y., Poon, B., Chow, Y.H., Park, N.H., Chen,I.S., 2000. Human immunodeficiency virus Env-independent infection of humanCD4(−) cells. J. Virol. 74, 10994–11000.
iguet, V., Trono, D., 1999. The Nef protein of primate lentiviruses. Rev. Med. Virol.9, 111–120.
ethods 161 (2009) 297–304
Riggs, N.L., Craig, H.M., Pandori, M.W., Guatelli, J.C., 1999. The dileucine-based sortingmotif in HIV-1 Nef is not required for down-regulation of class I MHC. Virology258, 203–207.
Salemi, M., Lamers, S.L., Yu, S., de Oliveira, T., Fitch, W.M., McGrath, M.S., 2005. Phy-lodynamic analysis of human immunodeficiency virus type 1 in distinct braincompartments provides a model for the neuropathogenesis of AIDS. J. Virol. 79,11343–11352.
Salter, R.D., Howell, D.N., Cresswell, P., 1985. Genes regulating HLA class I antigenexpression in T-B lymphoblast hybrids. Immunogenetics 21, 235–246.
Schindler, M., Munch, J., Kutsch, O., Li, H., Santiago, M.L., Bibollet-Ruche, F., Muller-Trutwin, M.C., Novembre, F.J., Peeters, M., Courgnaud, V., Bailes, E., Roques,P., Sodora, D.L., Silvestri, G., Sharp, P.M., Hahn, B.H., Kirchhoff, F., 2006. Nef-mediated suppression of T cell activation was lost in a lentiviral lineage thatgave rise to HIV-1. Cell 125, 1055–1067.
Schwartz, O., Marechal, V., Le Gall, S., Lemonnier, F., Heard, J.M., 1996. Endocytosisof major histocompatibility complex class I molecules is induced by the HIV-1Nef protein. Nat. Med. 2, 338–342.
Simmons, A., Aluvihare, V., McMichael, A., 2001. Nef triggers a transcriptionalprogram in T cells imitating single-signal T cell activation and inducing HIVvirulence mediators. Immunity 14, 763–777.
Smith, B.L., Krushelnycky, B.W., Mochly-Rosen, D., Berg, P., 1996. The HIV nef proteinassociates with protein kinase C theta. J. Biol. Chem. 271, 16753–16757.
Swigut, T., Alexander, L., Morgan, J., Lifson, J., Mansfield, K.G., Lang, S., Johnson,R.P., Skowronski, J., Desrosiers, R., 2004. Impact of Nef-mediated downregula-tion of major histocompatibility complex class I on immune response to simianimmunodeficiency virus. J. Virol. 78, 13335–13344.
Tomiyama, H., Akari, H., Adachi, A., Takiguchi, M., 2002. Different effects of Nef-mediated HLA class I down-regulation on human immunodeficiency virus type1-specific CD8(+) T-cell cytolytic activity and cytokine production. J. Virol. 76,7535–7543.
Tomiyama, H., Fujiwara, M., Oka, S., Takiguchi, M., 2005. Cutting edge: epitope-dependent effect of Nef-mediated HLA class I down-regulation on ability ofHIV-1-specific CTLs to suppress HIV-1 replication. J. Immunol. 174, 36–40.
Trono, D., 1995. HIV accessory proteins: leading roles for the supporting cast. Cell82, 189–192.
