species- Mus musculus

Engineering the mouse genome

David Ornitz

Time line for mouse genetic engineering

Development of chimeras between embryos with different genotypes !Transgenic mice first derived by infecting embryos with retroviruses !First DNA injection into mouse eggs !!First embryonic stem cells developed !Germline contribution of ES cells !First genetic modification of an ES cell (HPRT gene) !Improved vectors for homologous recombination

1960s !!1974, 1976 !!1980 1981 !1981 !1984 !1987 !!1987 !

Tarkowski, Mintz, Gardner !!Jaenisch and Mintz !!Gordon, Brinster, Constantini, Lacy, Wagner Martin, Evans, Kaufman !Bradley !Smithies !!!Thomas and Capecchi.

Time line for mouse genetic engineering - cont.

Phenotypic consequences of targeted genes !Conditional gene targeting-cre/lox !Conditional gene targeting-flip/FRT !Multiple conditional alleles, cre, flip !Somatic cloning of mice !Lentiviral vectors for transgenesis !RNAi in mice !Sleeping Beauty transposon mutagenesis !Conditional Mouse Knockout Project !Genomic editing

1990+ !1992/1993 !1996 !1998- !1998 !2002 !2002 !2005 !2006 - !2010 -

Marth, Rajewsky !Dymecki !Martin !Wakayama et al !Lois, Baltimore !Conklin,Rosenquist !Jenkins,Copeland !EUCOMM, KOMP

The Nobel Prize in Physiology or Medicine 2007

"for their discoveries of principles for introducing specific gene modifications in mice by the use of embryonic stem cells"

Mario R. Capecchi Sir Martin J. Evans Oliver Smithies

How do we analyze gene function in mice?

!Gene addition (transgenic approach)

Permits GOF, DN and knockdown experiments

Ectopic (spatial or temporal) expression

Allows gene regulatory elements to be tested

Allows populations of cells to be marked with a reporter gene

!Targeted mutations

Specific genes can be targeted

Unexpected phenotypes (lethal phenotype may result prior to the spatial and temporal site of interest)

Must be very careful to make a null allele

!Tissue-specific (conditional) targeted mutations

Provides some of the best features of gene targeting and transgenic approaches

May be combined with enhancer trap and gene trap experiments.

An effective method to circumvent embryonic lethality.

Breeding mice

gestation period-19 days

(range is 18-21 days depending on strain)

age at weaning-21 days

sexual maturity-females 4-5 weeks, males-6-8 weeks

birthweight-1 gm

weaning-8-12 gm

adult-30-40 gm

Preimplantation mouse development

Aggregation chimerasBefore the use of microinjection aggregation chimeras were the only way to genetically modify cells and test them during mouse

development

Morula aggregation,

used to make chimeras between two different genetic backgrounds

ES/EC cell chimera

add genetically modified cells to a mouse

Routes for Introducing Genes into Mice

1) Microinjection of DNA into zygotes

2) Injection of embryos with recombinant virus

3) Transfection of ES cells with cloned DNA

Selection,Characterization

Chimeraformation

Transgenic Mice

Transgenic Mice: Gene addition

!Random insertion of DNA into the mouse genome

!Permits GOF, DN and knockdown experiments

!Allows gene regulatory elements to be tested

!Allows populations of cells to be marked with a reporter gene

!Occasionally allows endogenous genes to be trapped

!!

Components of a Transgene

!

promoter + enhancer

gene coding sequence or cDNA

polyadenylation signal

promoter cDNA splice/poly A

Things that are good:

introns

!Things that are bad:

plasmid sequence, lack of introns

example: Elastase Promoter

!cell-type specific expression

200 bp is sufficient for expression

Pr/En hGH Pr/En splice/poly Apoly A v-ras

cDNA

Transgenic mouse issues:

Tissue specificity

ectopic expression

chromosomal integration site may affect expression

!Temporal specificity

Level of expression

Insertional mutagenesis

How to make a transgenic mouse1. Fusion Gene Construct 2. Superovulated Female

PromoterATG

Coding Sequence p(A)

Microinjection

3. Germline Integration

Fertilized Eggs

TRANSGENIC MOUSE

4. DNA Analysis

5. Breeding

from Manipulating the Mouse Embryo

a laboratory manual, CSHL press

http://mgc.wustl.edu/

http://mgc.wustl.edu

Homologous recombination using embryonic stem cells

• First completely unbiased experiment of gene function

in an entire mammalian organism.

• Discover unanticipated early embryonic roles

!Potential problems:

!• Embryonic lethality

• Redundancy

!

Events leading to the development of

Embryonic Stem Cells

!Teratoma

!tumors composed of various tissues foreign to 
their site of origin.

!can be formed by transplanting pieces of embryos to extra uterine sites.

!Teratocarcinoma

!undifferentiated malignant stem cells, metastasize, lethal

!made by transplanting day 6-7 mouse embryos under the kidney capsule

!resulting tumors can be passaged and cultured to yield embryonal

carcinoma cells

Embryonic Stem Cells-cont.EC cell lines

variety of stages of differentiation and variable capacity to differentiate

!exponential growth and feeder cells are required to prevent differentiation

!differentiation can be induced by aggregation

!differentiation can be induced by drugs, RA or DMSO.

ES cells

!a normal pleuripotent cell line isolated from normal embryo without

passing through a tumor stage.

!when reintroduced into the embryonic environment ES cells can generate

high grade chimeras.

!essential to grow on feeder cells (STO fibroblasts or MEFs).

!LIF/DIA is required to maintain pleuripotency of ES cells.

Establishment of ES cell lines:

transfer intact blastocysts into culture

grow to stage of early post implantation embryo

dissociate embryonic from extraembryonic tissue

continue to culture ICM.

2 days after

disaggregation

of ICM

4 days after

disaggregation

First passage

Chimeric mouse

ES cells derived from 129/SV strain, agouti coat color!injected into a C57/B6 blastocyst.!!Mate chimeric mouse to ‘Black mouse’ (C57/B6J)!identify agouti offspring!

Gene Knockout

exonexonexonexon

exonexonexonexon

genetic engineering using embryonic stem cells

critical exon

X

Practical issues for basic gene targeting:

✴ length of homology

✴ probes to detect homologous recombination

✴ vector design (with or without negative selection)

Target gene

Targeting vector

Targeted allele

homologous recombinationTarget gene

Targeting vector

Targeted allele

random integration

Homolgous recombination vs. random integration

Issues in interpreting targeted mutationsMust be very careful to make a null allele

haplotype insufficient

recessive

!Prove that an allele is null

gene expression

protein expression

assay for activity of protein

!Other types of alleles

hypomorphic allele

dominant negative

linked random mutation - generate multiple ES lines

recessive

!!

Xu, X., Weinstein, M., Li, C., Naski, M., Cohen, R. I.,

Ornitz, D. M., Leder, P., and Deng, C. (1998). Fibroblast

growth factor receptor 2 (FGFR2)-mediated regulation loop

between FGF8 and FGF10 is essential for limb induction,

Development 125, 753-765.

Arman, E., Haffnerkrausz, R., Chen, Y., Heath, J. K., and

Lonai, P. (1998). Targeted disruption of fibroblast growth

factor (Fgf) receptor 2 suggests a role for fgf signaling in

pregastrulation mammalian development, Proc. Natl. Acad.

Sci., U S A 95, 5082-5087.

Issues in interpreting targeted mutations - cont.Neighboring gene effect

!✴ PGK promoter - neo may influence a nearby gene

!✴ remove the selection cassette to avoid this potential problem

!Unexpected phenotype

!✴ lethal phenotype may result prior to the developmental 


stage of interest

Targeted

allele

PGK-Neo

Cell, Vol. 85, 1–4, April 5, 1996, Copyright 1996 by Cell Press!Know Your Neighbors: Three Phenotypes in Null Mutants of the Myogenic bHLH Gene MRF4!E. N. Olson,* H.-H. Arnold,† P. W. J. Rigby,‡ and B. J. Wold§ c

loxP loxP flox = flanked by lox

Removing the Neo selection cassette

exon

X

exonPGK-NEOexon

exonexonexonexon

genetic engineering using embryonic stem cells

Xexonexonexon

critical exon

germline promoter - Cre recombinase

PGK-NEO

X

Advanced gene targeting issues

!Targeting one allele versus both alleles

!Gene replacement using recombinases

!Knockin mice

Conditional tissue-specific targeted mutations

!✴ provides some of the best features of gene targeting and

transgenic approaches

!

✴ may be combined with enhancer trap and gene trap experiments

!

✴ the targeted gene can be modified using cre and flip recombinases

!

✴ may be used in conjunction with inducible promoters

exon

critical exon

loxP loxP flox = flanked by lox

exon

X

exonexonexon

Xexonexonexon

critical exon

Regulated activation/inactivation of a gene using CreER fusion proteins

tissue specific promoter -CreER

recombinase

+ tamoxifennuclear translocation

Cytosol

EUCOMM gene targeting vector

SA-βgeo-PA PGK -neo

Criticalexon

Frt LoxP

5' homology 3' homology

SA-βgeo-PA PGK -neo

Criticalexon

Frt LoxP

5' homology 3' homology

Cre

null, reporter allele

SA-βgeo-PA PGK -neo

Criticalexon

Frt LoxP

5' homology 3' homology

Flp

conditional allele

SA-βgeo-PA PGK -neo

Criticalexon

Frt LoxP

5' homology 3' homologySA-T2A-CreER-PA

Genomic Editing

Zinc finger nucleases (ZFNs)

TAL effector nucleases (TALENs)

CRISPR/Cas9

General principle is to target a non-specific nuclease (FokI) to a specific DNA sequence

!

Double stranded break will induce non-homologous end joining which can disrupt gene function

!

Single stranded breaks (nicks) can induce homology-directed repair with a double or single stranded DNA template

Genomic Editing

Modular assembly of individual zinc fingers

Left and Right target sequence with 5 nt spacer

Zinc finger nucleases (ZFNs)

Rémy, 2010

L

R

TAL Effector Nucleases (TALENs)

GATGCATGCACTGTAGTCACTGCA GCT…GTT

TALEN repeats

(DNA binding domain)

FokI nuclease

domain

FokI nuclease

domain

cleavage

within

spacer region

DNA target

TALEN repeats

(DNA binding domain)

L

R

Nonspecific FokI nuclease domain fused to a customizable DNA-binding domain to target a single genomic locus

!FokI nuclease functions as a dimer to cleave double stranded DNA

- can form unwanted dimers

- off-target mutagenesis is relatively frequent

!Obligate heterodimeric FokI nuclease domains (“KK” and “EL”)

- can reduce the formation of unwanted homodimers

- may have improved specificities

!Single stranded cuts (nickases) can be promoted by

inactivating the catalytic activity of one monomer of a ZFN or TALEN dimer

TAL Effector Nucleases (TALENs)

KK and EL are two obligatory heterodimeric FokI variants

!kk and el are catalytically inactive monomers (D450A mutations)

!L-KK/R-EL and L-EL/R-KK are active ZFN pairs

!nickases can be formed, either by pairing L-KK with R-el or L-kk with R-EL

Kim et. al., 2012

Nickase design (single strand break)

CRISPR/Cas9 SystemCRISPR (clustered regularly interspaced short palindromic repeats)

!Streptococcus pyogenes SF370 type II CRISPR locus - 4 genes:

Cas9 nuclease

two noncoding CRISPR RNAs (crRNAs)

trans-activating crRNA (tracrRNA)

precursor crRNA (pre-crRNA) array containing nuclease guide

!Facilitates RNA-guided site-specific DNA cleavage

!Cas9 nucleases can be directed by short guide RNAs (gRNA) to induce precise cleavage at endogenous genomic loci

!Cas9 can also be converted into a nicking enzyme

!Multiple guide sequences can be encoded into a single CRISPR array to enable simultaneous editing of several sites within the mammalian genome

Cong et al., Science 2013; Mali et al, Nature Methods 2013

Cas9-sgRNA targeting complexes

sgRNA (short guide RNA)

Target recognition and cleavage require protospacer sequence complementary to the spacer and presence of the appropriate NGG PAM sequence at the 3′ of the protospacer

PAM - Protospacer-adjacent motif

Type II CRISPR specificity suggest that target sites must perfectly match the PAM sequence NGG and the 8- to 12-base “seed sequence” at the 3′ end of the gRNA.

!The importance of the remaining 8 to 12 bases is less well understood and may depend on the binding strength of the matching gRNAs or on the inherent tolerance of Cas9 itself.

Mali et al, Nature Methods, 2013

Cas9-sgRNA targeting complexes sgRNA (short guide RNA)

Target recognition and cleavage require protospacer sequence complementary to the spacer and presence of the appropriate NGG PAM sequence at the 3′ of the protospacer

Cas9 enables programmable localization of dsDNA, RNA and proteins. Proteins can be targeted to any dsDNA sequence by simply fusing them to Cas9nuclease-null

PAM - Protospacer-adjacent motif

Fgf14 is a non-secreted cytoplasmic

protein with no known biochemical or

biological function.

Fgf14 is expressed in the central nervous

system of embryonic and adult mice.

mligl

mligl

Fgf14 targeting

9kb

4.5kb

9kb7.5kb

ES clones

5' 3'

WT

K/O

Δ Neo

6.3kbNeo

WT

K/O

Δ Neo

6.3kbNeo

Wild type locus

Targeted locus Exon2-LacZ

1kb

In situ and northern blot anaylsis of FGF14 expression

FGF14 in situ LacZ in situ

wt

-/-

28s

18s

wt -/- -/+ wt -/- -/+northern blot

Fgf14 expression patterns in basal ganglia!hippocampus and cortex

CPu

GPSN

CC DG

Fgf14-/- WT

In vivo foot printing

WT

Fgf14-/-

Accelerating rotorod

0

50

100

150

200

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

+/+

+/-

-/-

Sensory Motor Tests

Missense mutation in the human FGF14 gene

Van Swieten, J. C., Brusse, E., De Graaf, B. M., Krieger, E., Van De Graaf, R., De

Koning, I., Maat-Kievit, A., Leegwater, P., Dooijes, D., Oostra, B. A., and Heutink, P.

(2003) A mutation in the fibroblast growth factor 14 gene is associated with autosomal dominant cerebellar ataxia, Am J Hum Genet 72, 191-199

Dalski, A., Atici, J., Kreuz, F. R., Hellenbroich, Y., Schwinger, E., and Zuhlke, C. (2005) Mutation analysis in the fibroblast growth factor 14 gene: frameshift mutation and polymorphisms in patients with inherited ataxias, Eur J Hum Genet 13, 118-120

Brusse, E., de Koning, I., Maat-Kievit, A., Oostra, B. A., Heutink, P., and van Swieten,

J. C. (2005) Spinocerebellar ataxia associated with a mutation in the fibroblast growth factor 14 gene (SCA27): A new phenotype, Mov Disord 21, 396-401.

Missense mutation in the human FGF14 gene

Large, three-generation Dutch family

!Childhood-onset postural tremor

!Slowly progressive cerebellar ataxia

Only moderate cerebellar atrophy in older patients

!Dyskinesia

!Low IQ and deficits in memory

!Autosomal dominant

!Mutation in the FGF14 gene

T1-weighted MRI

(van Swieten et al, Am. J. Hum. Genet., 72:191-199, 2003)

Qing Wang

JL Lou

Maolei Xiao

Marie Kozel

Fernanda Laezza

Benjamin Gerber

Kelvin Yamada

Jeanne Nerbonne

!

Behavioral Tests

Mark Bardgett

David Wozniak

Behavior Core

Dept. of Psychiatry