Stress Levels of Glucocorticoids Inhibit LH�-SubunitGene Expression in Gonadotrope Cells
Kellie M. Breen, Varykina G. Thackray, Tracy Hsu, Rachel A. Mak-McCully,Djurdjica Coss, and Pamela L. Mellon
Department of Reproductive Medicine and Center for Reproductive Science and Medicine, University ofCalifornia, San Diego, La Jolla, California 92093-0674
Increased glucocorticoid secretion is a common response to stress and has been implicated as amediator of reproductive suppression upon the pituitary gland. We utilized complementary invitro and in vivo approaches in the mouse to investigate the role of glucocorticoids as a stress-induced intermediate capable of gonadotrope suppression. Repeated daily restraint stress length-ened the ovulatory cycle of female mice and acutely reduced GnRH-induced LH secretion andsynthesis of LH �-subunit (LH�) mRNA, coincident with increased circulating glucocorticoids. Ad-ministration of a stress level of glucocorticoid, in the absence of stress, blunted LH secretion inovariectomized female mice, demonstrating direct impairment of reproductive function by glu-cocorticoids. Supporting a pituitary action, glucocorticoid receptor (GR) is expressed in mousegonadotropes and treatment with glucocorticoids reduces GnRH-induced LH� expression in im-mortalized mouse gonadotrope cells. Analyses revealed that glucocorticoid repression localizes toa region of the LH� proximal promoter, which contains early growth response factor 1 (Egr1) andsteroidogenic factor 1 sites critical for GnRH induction. GR is recruited to this promoter region inthe presence of GnRH, but not by dexamethasone alone, confirming the necessity of the GnRHresponse for GR repression. In lieu of GnRH, Egr1 induction is sufficient for glucocorticoid repres-sion of LH� expression, which occurs via GR acting in a DNA- and dimerization-independentmanner. Collectively, these results expose the gonadotrope as an important neuroendocrine siteimpaired during stress, by revealing a molecular mechanism involving Egr1 as a critical integratorof complex formation on the LH� promoter during GnRH induction and GR repression. (MolecularEndocrinology 26: 1716–1731, 2012)
NURSA Molecule Pages†: Ligands: Corticosterone.
Stress profoundly disrupts reproductive function.Whether the nature of the stressor is physical (e.g.
foot-shock, exercise), immunological (e.g. infection, ad-ministration of cytokines or endotoxins), or psychologi-cal (e.g. isolation, mental performance tasks), each hasbeen shown to decrease circulating levels of gonadotro-pins in mammals (1–5). Associated with this reproductivedisturbance is an activation of the hypothalamic-pitu-itary-adrenal axis and an elevation in circulating gluco-corticoids from the adrenal cortex, the final hormonaleffectors of the hypothalamic-pituitary-adrenal axis. Ev-
idence that the glucocorticoid receptor (GR) antagonist,RU486, attenuates the inhibitory effect of immobilizationstress on LH secretion in male rats or psychosocial stresson pituitary responsiveness to GnRH in ovariectomizedewes implies a physiological role for glucocorticoids inmediating the inhibitory effects of stress on LH secretion,although RU486 can also block the effects of progester-one (6–8).
Although there is little doubt that glucocorticoids sup-press gonadotropin secretion, the neuroendocrine mech-anism underlying this effect is not well understood. Inhi-
bition at the hypothalamic level is supported by evidencethat glucocorticoids reduce the frequency of LH pulses inovary-intact female sheep, ovariectomized female rats,and women during the follicular phase of the ovulatorycycle (9–11). Because LH pulse frequency is generallymodulated by the GnRH neurosecretory system, thesefindings suggest an action of glucocorticoids to suppressthe frequency of GnRH pulses. A recent study in follicularphase sheep provides the first definitive evidence that glu-cocorticoids inhibit GnRH pulses in pituitary portalblood (12). GR is expressed within hypothalamic neuronsimplicated in GnRH regulation (13), and such neuronsprovide a potential indirect target by which glucocortico-ids may inhibit GnRH secretion or GnRH synthesis (14);however, a direct action within the GnRH neuron itself issupported by evidence that glucocorticoids blunt GnRHsynthesis and release from immortalized GnRH neurons,GT1–7 cells (15, 16). Thus, the mechanism whereby glu-cocorticoids suppress GnRH and LH remains unclear andmay involve direct actions upon the GnRH neuron itself,indirect actions via another neuronal cell type, or actionsupon an extrahypothalamic site.
With regard to a site outside of the central nervoussystem, the most obvious possibility is that glucocortico-ids act via GR located within gonadotrope cells of theanterior pituitary gland. Evidence that glucocorticoids re-duce the amplitude of the LH response to a GnRH chal-lenge in rodents, pigs, cows, and women is consistent withthis possibility (17–20). Further, suppression of respon-siveness to GnRH in vitro has been observed in rodent,porcine, and bovine pituitary cell cultures, indicating thatglucocorticoids can act directly upon the gonadotrope cellto inhibit responsiveness to GnRH (19–21). Consistentwith an action upon the gonadotrope cell, GR has beenidentified in rat gonadotropes (22), and studies in rat andpig primary cells suggest that glucocorticoids inhibit sig-naling mechanisms downstream of the GnRH receptor,including protein kinase C and cAMP (20, 23). It is notknown, however, whether these nongenomic actions ofglucocorticoids that inhibit intracellular signaling path-ways ultimately lead to a reduction in LH release. Alter-natively, evidence suggests that glucocorticoids can actgenomically to suppress gonadotrope responsiveness byregulating transcription and translation of the GnRH re-ceptor gene (24, 25).
Another potential mechanism whereby glucocortico-ids could diminish GnRH responsiveness of the gonado-trope is via regulation of gonadotropin synthesis. At themolecular level, LH and FSH are glycoprotein hormonesthat exist as heterodimers, consisting of a common andabundantly expressed glycoprotein hormone alpha-sub-unit (�GSU) complexed with a unique �-subunit that con-
fers biological specificity (26). Synthesis of the �-subunitgene of each hormone is the rate-limiting step in the over-all production of LH and FSH (26, 27). Because expres-sion of each �-subunit is tightly controlled by endocrine,paracrine, and autocrine actions, including hypothalamicGnRH, the activin-inhibin-follistatin system, and steroidhormones of gonadal origin (27, 28), it is possible thatGR regulation of transcriptional activity underlies the in-hibitory effects of stress on the gonadotrope.
Transcriptional effects of steroid hormones within thegonadotrope have been shown for the gonadotropingenes, including Cga, Fshb, and Lhb (29, 30). With regardto Lhb, androgen repression of Lhb involves protein-pro-tein interactions between the androgen receptor and ste-roidogenic factor 1 (SF1) and is localized to a bipartiteSF1 element within the LH� proximal promoter, criticalfor mediating GnRH responsiveness (31, 32). Progester-one repression also involves indirect receptor binding butdiffers from androgen repression of LH� gene expressionin that, rather than SF1 elements, progesterone repressioninvolves two novel promoter regions located upstream ofthe SF1 sites. Similar to progestins and androgens, gluco-corticoids have been shown to inhibit LH� gene expres-sion (29, 33), although the mechanism is unclear, raisingthe possibility that stress impairs fertility by way of dis-ruption of gene expression within the gonadotrope cell.
We initiated two lines of investigation in the mouse totease apart the mechanisms whereby elevated glucocorti-coids inhibit gonadotrope responsiveness during episodesof stress. First, we tested the hypothesis that restraintstress, and/or an elevation in glucocorticoids mimickingthe level induced by restraint stress, can disrupt reproduc-tive function and inhibit gonadotrope production of LHin female mice. Second, we conducted a series of studies toexamine the molecular mechanisms underlying glucocor-ticoid regulation of the LH� promoter utilizing the im-mortalized L�T2 gonadotrope cell line.
Materials and Methods
AnimalsFemale C57Bl/6 mice (6 wk of age) were purchased from The
Jackson Laboratory (Bar Harbor, ME), and housed in a UCSDvivarium animal facility under standard conditions. All animalswere housed under a 12-h light, 12-h dark cycle (lights on at0700 h) and provided with food and water ad libitum. Micewere group housed (four females per cage) for 2 wk of acclima-tization. All experimentation was performed between 0900 and1300 h in a room within the vivarium. Care was taken to min-imize pain and discomfort for the animals. Mouse colonies weremaintained in agreement with protocols approved by the Insti-tutional Animal Care and Use Committee at the University of
Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1717
California, San Diego. All procedures were approved by theUniversity of California, San Diego IACUC.
Determination of phase of estrous cycleAt 8 wk of age, vaginal lavage was performed daily (at
0900 h) by flushing the vagina with distilled H2O. Collectedsmears were mounted on glass slides and examined microscop-ically for cell type (34). The smears were classified into one ofthree phases of estrus: diestrus, proestrus, or estrus. Female miceexhibiting two consecutive 4- to 6-d estrous cycles, includingpositive classification of diestrus, proestrus, and estrus, wereused in animal experiments. Estrous cycle length was calculatedas the length of time between two successive occurrences ofestrus. The time spent in each cycle stage was calculated as theproportion of time classified in each cycle phase during theobservation period, and values were analyzed by two-way re-peated measures ANOVA, group (no stress vs. stress) � time (d1–d 18 vs. d 19–d 36). All statistics were performed using JMP7.0 (SAS Institute, Cary, NC), and significance was establishedas P � 0.05.
Restraint stress protocolAfter vaginal lavage and estrus classification, mice were ei-
ther returned to their group home cage (no stress) or placedindividually into clear plastic restraint tubes (stress). The venti-lated tubes (Harvard Apparatus, Holliston, MA) are designed tobe small enough to restrain a mouse so that it is able to breathebut unable to move freely. The restraint devices were cleanedbetween uses with soap, water, and ethanol (70%). Mice arecontinually observed by experienced personnel during the 180-min restraint period. After the restraint period, stress mice arereturned to individual home cages or killed by decapitation, andtrunk blood or pituitary tissue was collected from individualanimals. Hormone values were analyzed by one-way ANOVAfollowed by Tukey’s post hoc test or two-way ANOVA, group(no stress vs. stress) � time (vehicle vs. GnRH).
Corticosterone response protocolFemale mice (8 wk of age) were ovariectomized and allowed
to recover for 2 wk before experimentation. To test the LHresponse to a stress level of corticosterone, animals received abolus injection of corticosterone (200 ng/kg, sc) or vehicle. After90 min, animals were killed by decapitation, and trunk bloodwas collected from individual animals. Hormone values wereanalyzed by one-way ANOVA followed by Tukey’s post hoctest.
Hormone analysisTrunk blood was collected and serum separated by centrifu-
gation and stored frozen at �20 C before analysis at the Centerfor Research in Reproduction Ligand Assay and Analysis Coreat the University of Virginia (Charlottesville, VA). Corticoste-rone concentrations were determined by RIA in single 25- to50-�l aliquots of serum. Assay sensitivity averaged 20.0 ng/ml.LH concentrations were determined by two-site sandwich im-munoassay in duplicate 50-�l aliquots of serum. Assay sensitiv-ity averaged 0.07 ng/ml.
PlasmidsThe �1800 rat LH�-luc in pGL3 was kindly provided by Dr.
Mark Lawson. The 5�-truncations of the �1800-bp LH�-lucreporter plasmid were created by inserting fragments betweenKpnI and HindIII in pGL3 have been partially described byThackray et al. (35): �400, �300, �200, �150, �87. The 5�-and 3�-mutations of either Egr1 or SF1 binding sites in the �200rat LH�-luc have been reported previously (35). The reporterplasmids with the multimerized consensus SF1 site (TGACCT-TGA) or consensus Egr1 site (CGCCCCCGC) were created byligating an oligonucleotide, containing four copies of the indi-cated site, between KpnI and NheI in pGL3, upstream of the81-bp thymidine kinase (TK) promoter. The sequences of allpromoter fragments were confirmed by dideoxynucleotidesequencing.
The mouse Ptx1 pcDNA3 expression vector has been previ-ously described (36). The rat Egr1 and mouse SF1 cDNA werekindly provided by Dr. Jacques Drouin and Dr. Bon-chu Chung,respectively. The cDNA were cloned into the pCMV expressionvector using the ClaI/XbaI restriction sites of both plasmids. Thehuman Egr1 cDNA was provided by Dr. Hermann Pavenstadtand was cut using XhoI/EcoRI and inserted into pGEX-5X ex-pression vector using the SmaI restriction site by blunt end clon-ing. Dr. Douglass Forbes provided the green fluorescent protein(GFP) expression plasmid. The wild-type rat GR pSG5 plasmidwas provided by Dr. Keith Yamamoto. Both GR mutants are inpSG5 and have been previously described; the GRdim4 mutantcontains four point mutations that prevent dimerization andDNA binding of the receptor (29), and the GR DNA-bindingdomain (DBD) mutant contains a mutation in the DNA-bindingdomain (33).
Cell culture and transient transfectionL�T2 cells, cultured as previously described (29), were
seeded into 12-well plates at 3 � 105 cells per well and incubatedovernight at 37 C. Each well was transfected with 400 ng of theluciferase-reporter plasmid or control pGL3 vector and 100 ngof a �-galactosidase reporter gene regulated by the TK promoter(TK-�gal) as a control for transfection efficiency using FuGENE6 transfection reagent (Roche Applied Science, Indianapolis,IN). In experiments utilizing Egr1, SF1, or Ptx1 to induce pro-moter activity, cells were also transfected with 100 ng Egr1(unless indicated otherwise) or empty pCMV vector, 100 ng SF1or empty pCMV vector, 50 ng Ptx1 or empty pcDNA3 vector.Eighteen hours after transfection, cells were transferred to se-rum-free DMEM (supplemented with 0.1% BSA, 5 mg/litertransferrin, and 50 nM sodium selenite) containing either thenatural glucocorticoid, corticosterone (100 nM, Sigma Aldrich,St. Louis, MO), synthetic glucocorticoid, dexamethasone (100nM, Sigma Aldrich), or vehicle (0.1% ethanol). When cells weretreated with GnRH (10 nM; Sigma Aldrich), treatment withGnRH or vehicle (0.1% BSA) began 6 h before harvest. Cellswere harvested and extracts were prepared for assay of lu-ciferase and �-galactosidase activity as previously described(33).
CV-1 cells, a monkey kidney cell line that does not expressdetectable endogenous GR (37), were seeded into 12-well platesat 1.5 � 105 cells per well as previously described (38) andtreated as indicated above with the following addition. Each
1718 Breen et al. Glucocorticoid Repression of LH� Gene Expression Mol Endocrinol, October 2012, 26(10):1716–1731
well was transfected with 50 ng of the GR expression vector(wild type or mutant) or empty pGS5 vector.
Luciferase reporter experiments were performed in triplicateand were repeated at least three times. To normalize for trans-fection efficiency, all luciferase values were divided by �-galac-tosidase, and the triplicate values were averaged. To control forinterexperimental variation, the control pGL3 reporter plasmidwas transfected with TK-�gal and any relevant expression vec-tors, and the average pGL3/�gal value was calculated. Averageluc/�gal values were divided by the corresponding pGL3/�galvalue. Individual values obtained from each independent exper-iment were averaged and analyzed by Student’s t test or one-wayANOVA followed by Tukey’s post hoc test.
Quantitative real-time PCRPreparation of cDNA from mouse pituitary or L�T2 cells
was performed as previously described (39). Briefly, RNA wasextracted with Trizol reagent (Invitrogen/GIBCO, Carlsbad,CA) according to the manufacturer’s instructions, treated toremove contaminating DNA (DNA-free; Ambion, Austin, TX),and reverse transcribed using Superscript III First-Strand Syn-thesis System (Invitrogen). Quantitative real-time PCR was per-formed in an iQ5 Real-Time PCR instrument (Bio-Rad Labora-tories, Inc., Hercules, CA) and used iQ SYBR Green Supermix(Bio-Rad Laboratories) with specific primers for glyceralde-hyde-3-phosphate dehydrogenase (GAPDH), LH�, or Egr1cDNA.
LH� forward: CTGTCAACGCAACTCTGGLH� reverse: ACAGGAGGCAAAGCAGCEgr1 forward: ATTTTTCCTGAGCCCCAAAGCEgr1 reverse: ATGGGAACCTGGAAACCACCGAPDH forward: TGCACCACCAACTGCTTAGGAPDH reverse: GGATGCAGGGATGATGGTTCThe iQ5 real-time PCR program was as follows: 95 C for 15
min, followed by 40 cycles at 95 C for 15 sec, 55 C for 30 sec,and 72 C for 30 sec. Within each experiment, the amount ofLH� or Egr1 and GAPDH mRNA was calculated by comparinga threshold cycle obtained for each sample with the standardcurve generated from serial dilutions of a plasmid containingGAPDH, ranging from 1 ng to 1 fg. All samples were assayed (intriplicate) within the same run, and the experiment was con-ducted three times. Values were analyzed by one-way ANOVAfollowed by Tukey’s post hoc test or two-way ANOVA, group(no stress vs. stress) � time (vehicle vs. GnRH).
Dual immunofluorescenceAdult mouse pituitary paraffin tissue sections (Zyagen, San
Diego, CA) were dewaxed in xylene, rehydrated through a seriesof graded ethanol baths, and washed in H20. Sections wereimmersed in 10 mM sodium citrate buffer (pH 6.0), heated in astandard microwave twice for 5 min, and allowed to stand for20 min at room temperature. After a brief wash in PBS, nonspe-cific binding was blocked with 5% goat serum/0.3% TritonX-100 for 60 min at room temperature. Dual fluorescence la-beling was tested on the same section with a guinea pig antiratLH� primary antibody (anti-r� LH-IC-2, NIDDK NHPP; 1:200dilution in 5% goat serum/0.3% Triton X-100) plus a rabbitantimouse GR primary antibody (sc-1004, Santa Cruz Biotech-nology, Inc., Santa Cruz, CA; 1:500 dilution) for 48 h at 4 C.LH�- and GR-containing cells were revealed using a goat rho-
damine antiguinea pig IgG secondary antibody (ab6905, 1:300dilution; Abcam, Cambridge, MA) plus a goat fluorescein anti-rabbit IgG secondary antibody (FI-1000; Vector Laboratories,Burlingame, CA; 1:300 dilution) for 60 min at room tempera-ture. After rinsing with PBS, sections were coverslipped withVectashield HardSet mounting medium with 4�,6-diamidino-2-phenylindole (Vector Laboratories). Exclusion of each primaryantibody was run as a negative control, and each antibody wasrun separately to confirm that each immunostaining pattern wassimilar to published reports (40, 41). Specificity of the GR an-tibody was confirmed by immunoblot analysis of L�T2 andCV-1 cell lysates, cell lines previously shown to contain and lackGR (29, 37), respectively, which detected a single band of theexpected size.
Sections were viewed using an inverted fluorescence micro-scope (Nikon Eclipse TE 2000-U; Nikon, Tokyo, Japan), anddigital images were collected using a Sony CoolSNAP EZ cooledcharge-coupled device camera (Roper Scientific, Trenton, NJ)and analyzed with Nikon Imaging System—Elements imageanalysis system (version 2.3; Nikon).
Western blot analysisNuclear extracts were prepared as previously described (36)
from L�T2 cells treated with dexamethasone (100 nM, 18 h),GnRH (10 nM, 45 min), GnRH � dexamethasone or vehicle(0.1% BSA/0.1% ethanol). Nuclear extract (20 �g) was boiledfor 5 min in 5� Western-loading buffer, fractionated on a 10%SDS-PAGE gel, and electroblotted for 90 min at 300 mA ontopolyvinylidene difluoride (Millipore Corp., Billerica, MA) in 1�Tris-glycine-sodium dodecyl sulfate/20% methanol. Blots wereblocked overnight at 4 C in 3% BSA and then probed for 1 h atroom temperature with rabbit antihuman Egr1 antibody (sc-110, Santa Cruz Biotechnology) diluted 1:750 in blocking buf-fer. Blots were then incubated with a horseradish peroxidase-linked secondary antibody (Santa Cruz Biotechnology), andbands were visualized using the SuperSignal West Pico chemi-luminescent substrate (Pierce Biotechnology, Inc., Rockford,IL). Bio-Rad Pre-stained Protein Ladder Plus serves as a sizemarker.
Chromatin immunoprecipitation (ChIP)ChIP assays were performed as previously described (29, 35).
Briefly, confluent L�T2 cells in 10-cm plates were treated withdexamethasone (100 nM, 1 h), GnRH (10 nM, 1 h), GnRH �dexamethasone (cotreatment 1 h), or vehicle (0.1% BSA/0.1%ethanol) and cross-linked with 1% formaldehyde. The nuclearfraction was obtained, and chromatin was sonicated to an av-erage length of 300–500 bp using a Branson Sonifier 250 (Bran-son Ultrasonics Corp., Danbury, CT). Protein-DNA complexeswere incubated overnight with nonspecific rabbit IgG (sc-2027,Santa Cruz Biotechnology) or rabbit antihuman GR (ab3579,Abcam) and precipitated with protein A/G beads. Immunopre-cipitated DNA and DNA from input chromatin were analyzedby quantitative PCR using primers specific for a 220-bp se-quence of the mouse LH� proximal promoter (�180 LH�/�40LH�). Primers specific to the mouse FSH� promoter (�223FSH�/�57 FSH�) and FSH� coding region were used as posi-tive and negative controls, respectively. DNA from immunopre-cipitated samples was quantified relative to a standard curverepresenting percent of input chromatin. For ChIP assays com-
Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1719
paring chromatin from hormone-treated L�T2 cells, the foldenrichment of antibody signal over IgG was calculated for eachprimer set, and data from each independent experiment werenormalized to the indicated negative control gene. ChIP andinput samples were quantified using a standard curve madefrom ChIP input DNA. ChIP samples were normalized to theirappropriate input samples and are expressed as fold enhance-ment over nonspecific IgG.
TGTGFSH�-coding forward: GCCGTTTCTGCATAAGCFSH�-coding reverse: CAATCTTACGGTCTCGTATACCThe iQ5 real-time PCR program was as follows: 95 C for 15
min, followed by 40 cycles at 95 C for 15 sec, 55 C for 30 sec,and 72 C for 30 sec. All samples were assayed within the samerun, and the experiment was conducted three times. Individualvalues obtained from each independent experiment were aver-aged and analyzed by one-way ANOVA followed by Tukey’spost hoc test.
Glutathione-S-transferase (GST) interaction assay35S-labeled proteins were produced using the TnT Coupled
Reticulolysate System (Promega Corp., Madison, WI). Bacteriatransformed with the GST plasmids were grown to an OD of 0.6and then induced with isopropyl-�-d-thiogalactoside overnightat 30 C. The bacterial pellets were sonicated in 0.1% TritonX-100 and 5 mm EDTA in 1� PBS and centrifuged, and thesupernatant was bound to glutathione Sepharose 4B resin (Am-ersham Pharmacia Biotech, Piscataway, NJ). The beads werewashed four times in PBS and then in HEPES/Nonidet P-40/dithiothreitol (HND) buffer [10 mg/ml BSA, 20 mm HEPES (pH7.8), 50 mm NaCl, 5 mm dithiothreitol, and 0.1% NonidetP-40]. For the interaction assay, 35S-labeled in vitro-transcribedand -translated GR (20 �l), SF1 (5 �l), or GFP (5 �l) was addedto the beads with 400 �l HND buffer. The beads were incubatedfor 1 h at 4 C and then washed twice with HND buffer and twicewith 0.1% Nonidet P-40 in PBS. Thirty microliters of 2� Laem-mli load buffer were added, and the samples were boiled andthen electrophoresed on a 10% sodium dodecyl sulfate-polyac-rylamide gel. One tenth of the 35S-labeled in vitro-transcribedand -translated product was loaded onto the gel as input. The gelwas dried, and the proteins were visualized by autoradiography.
To evaluate the mechanism whereby elevated gluco-corticoids impair reproduction, we developed a model toassess whether daily restraint stress disrupts estrous cy-clicity. Vaginal cytology was examined daily by vaginallavage in a cohort of female mice during an 18-d controlperiod (d 1–d 18). After this period of observation, micewere randomly assigned to either the stress or no stress
group (n � 9/group), and estrous cyclicity was monitoredfor an additional 18 d (d 19–d 36). Figure 1A illustratesprofiles of vaginal histological classification during theprestress and stress period of three female mice exposed to180 min of daily restraint stress. In mice not subjected tostress, cycle length was not significantly different betweenthe two periods of assessment (P � 0.05; d 1–d 18 vs. d19–d 36, 5.33 � 0.31 vs. 4.81 � 0.45 d, Fig. 1B). Incontrast, stressed mice exhibited a significant increase inaverage cycle length in the stress period compared withthe prestress period (P � 0.05; d 1–d 18 vs. d 19–d 36,5.25 � 0.35 vs. 6.75 � 0.55 d). Specifically, exposure todaily restraint stress significantly increased the time spentin diestrus during the stress period, d 19–d 36, withoutaltering the time spent in estrus or proestrus as comparedwith the prestress period, d 1–d 18 (P � 0.05; Fig. 1C).
Having found that repeated exposure to stress com-promises reproductive neuroendocrine activity as evi-
1-18
DPE
DPE
DPE
Day of assessment369 18 27
daily restraint stress
Vagi
nal h
isto
logi
cal c
lass
ifica
tion
A
3
4
5
8
1-18C
ycle
leng
th (d
ays)
B
No stress
7
6
*
1
0
1
2
5
Tim
e in
cyc
le s
tage
(day
s)
C
4
3
E P D
*
prestress
19-36 1-18Stress
19-36Stress
19-36E P D
FIG. 1. Daily stress disrupts estrous cyclicity in the mouse. A,Representative profiles depicting estrous cyclicity, as measured byvaginal cytology, during the prestress period (d 1–d 18) andsubsequent daily restraint stress period (d 19–d 36) in three femalemice subjected to 180 min of daily restraint stress. E, Estrus; P,proestrus; D, diestrus. Shading indicates period of exposure to dailyrestraint stress. B, Average estrous cycle length in the no stress groupand stress group (n � 9/group) during the two periods of assessment,d 1–d 18 and d 19–d 36. C, Time spent in each stage of the cycle instress mice during the prestress period, d 1–d 18, and stress period, d19–d 36. *, Significant (P � 0.05) group (no stress vs. stress) � time (d1–d 18 vs. d 19–d 36) interaction.
1720 Breen et al. Glucocorticoid Repression of LH� Gene Expression Mol Endocrinol, October 2012, 26(10):1716–1731
denced by a disruption in estrous cyclicity in female mice,the next step was to focus on the role of the pituitarygland and test whether gonadotrope responsiveness, asassessed by GnRH-induced LH synthesis or secretion, isdiminished by acute restraint stress. Separate cohorts offemale mice, in which estrus cyclicity was confirmed anddiestrus females selected, were used to assess gonadotroperesponsiveness to GnRH in the absence or presence ofstress. In the first study, GnRH-induced LH secretion wasmonitored in groups of control mice (no stress) or miceexposed to 180 min of restraint stress (Fig. 2A). Bloodwas collected before stress, as well as 30 and 180 minafter the initiation of the control or stress period for mea-surement of corticosterone (n � 7 per time point pergroup). To assess LH release in response to GnRH, femalediestrus mice were administered GnRH (200 ng/kg, sc;n � 7 per group per treatment) or saline vehicle and killed10 min after injection. Blood was collected and processedfor measurement of LH at 180 min after the initiation ofstress. This GnRH dose was selected because it has beenshown to produce a significant, yet submaximal, LH re-sponse, that peaks 10 min after administration in a mousemodel of diestrus in which female mice are ovariecto-mized and estrogen primed (42, 43). Serum levels of cor-ticosterone remained low in no stress control animals(Fig. 2B, open circles); corticosterone levels were signifi-cantly increased in stressed mice at 30 min (P � 0.05;stress vs. no stress, 588.6 � 26.4 vs. 108.8 � 35.5 ng/ml)and remained significantly elevated 180 min after initia-tion of restraint (Fig. 2B, gray circles). Stress did not sig-nificantly induce serum levels of progesterone at either 30min or 180 min after the initiation of restraint (data notshown). Mean LH in the no stress diestrus females receiv-ing vehicle was not significantly different from values inthe vehicle-treated stress animals, indicating that stressdoes not significantly impair responsiveness to endoge-nous GnRH in this animal model (P � 0.05; stress Veh vs.no stress Veh, Fig. 2C). In the no stress group, exogenousGnRH caused a robust increase in circulating LH levels ascompared with vehicle-treated animals (P � 0.05; 1.83 �0.23 vs. 0.56 � 0.11 ng/ml, Fig. 2C). GnRH also signifi-cantly increased LH in stressed animals (P � 0.05, Fig.2C). However, the LH response to exogenous GnRH wassignificantly blunted in restraint-stressed animals com-pared with the response in no stress controls (P � 0.05;stress GnRH vs. no stress GnRH, 1.19 � 0.18 vs. 1.83 �0.23 ng/ml; Fig. 2C), suggesting that stress diminishes theability of the pituitary to respond to GnRH. Taken to-gether, these experiments reveal an interplay betweenGnRH and stress and implicate responsiveness of the pi-tuitary gonadotrope as a potential neuroendocrine site ofLH suppression.
No stress
0 180
Cor
ticos
tero
ne (n
g/m
l)
300
0.5
1.0
1.5
2.0
2.5
LH (n
g/m
l)
No stress
#
Time (min)
B C
0
5
10
15
20
Veh Veh GnRH
E
GnRH
Pituitary
0
200
400
600
800
*
*
*
LHβ/
GAP
DH
mR
NA
Stress
Veh
Stress
0 170 180
A
Time (min)
No stress
GnRH or Veh
Blood (n=7/grp/trt)
30
Blood(n=7/grp)
VehGnR
HGnR
H
Stress
0 180Time (min)
GnRHor Veh
Pit(n=7/grp/trt)
**
No stress Stress
*#
25
D
No stress Stress
Blood (n=7/grp)
FIG. 2. Acute stress disrupts pituitary responsiveness to GnRH. A,Schematic depicting events during the 180-min observation period inwhich animals were maintained in no stress conditions (white bar) orsubjected to restraint stress (gray bar) for measurement of circulatingcorticosterone and GnRH-induced LH. Time of euthanasia and bloodcollection (Blood coll’n) are indicated: 0, 30, and 180 min. At 170 min,no stress and stressed animals (group) are divided into two treatments(n � 7/group per treatment) receiving either GnRH (200 ng/kg, sc) orvehicle (Veh). B, Serum corticosterone (ng/ml) was measured in nostress (white circles) and stress animals (gray circles). *, Significant(P � 0.05) effect of stress. C, Serum LH (ng/ml) was measured in no stress(white bars) and stressed (gray bars) animals that received vehicle orGnRH, respectively, 10 min before euthanasia. *, Significant (P � 0.05)effect of GnRH; #, difference between no stress and stress. D, Schematicdepicting events during 180-min observation period in which animals aremaintained in no stress conditions (white bar) or subjected to restraintstress (gray bar) for measurement of GnRH-induced LH� mRNA. No stressand stressed animals are divided into two groups (n � 7/group) receivingeither GnRH (200 ng/kg, sc) or vehicle (Veh) at 0 min of observation. Timeof euthanasia and blood collection (Blood coll’n) occurred at 180 min. E,Quantitative RT-PCR analysis of LH� mRNA was performed on individualmouse pituitary glands, and the amount of LH� mRNA was comparedwith the amount of GAPDH mRNA and expressed as relative transcriptlevel. *, Significant (P � 0.05) effect of GnRH; #, difference between nostress and stress. grp, Group; trt, treatment.
Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1721
We further investigated the response of the gonado-trope by analyzing GnRH-induced LH� mRNA tran-script level in mice exposed to restraint stress. Initially,diestrus female mice received saline vehicle or GnRH (200ng/kg, sc; n � 7 per group per treatment) and were sub-sequently sorted into no stress or stress treatment groups(Fig. 2D). Animals were killed and the pituitary glandswere collected for mRNA analysis by quantitative RT-PCR. Stress did not alter basal LH� transcript levels com-pared with expression in no stress vehicle controls (P �0.05; stress Veh vs. no stress Veh; Fig. 2E). In the absenceof stress, exogenous GnRH resulted in a 4-fold increase inLH� mRNA compared with values in vehicle-treated an-imals (P � 0.05; Fig. 2E). In stressed mice, the LH� tran-script level in response to GnRH was significantly re-duced by approximately 45% (P � 0.05; no stress GnRHvs. stress GnRH, 16.5 � 2.3 vs. 8.9 � 1.1; Fig. 2E).Collectively, these observations raise the possibility thatstress can interfere with ovarian cyclicity by disruptingthe synthesis and secretion of LH at the level of the ante-rior pituitary gonadotrope cell.
Glucocorticoids impair LH secretion in vivopotentially via receptors expressed in mousegonadotrope cells
Our studies thus far demonstrate that circulating glu-cocorticoids are increased within 30 min and remain sig-nificantly elevated for the 180-min stress paradigm (Fig.2). Because stress likely induces a host of inhibitory inter-mediates, any of which could alter reproductive activity,we directly assessed the role of glucocorticoids by testingthe hypothesis that a stress-like level of glucocorticoid infemale mice reduces LH secretion. Pilot studies were con-ducted to identify a dose of glucocorticoid that approxi-mated a stress level (750 ng/ml) and an animal modelthat eliminated confounding effects of ovarian steroids.Blood was collected 90 min after a bolus administrationof vehicle or corticosterone (200 ng/kg, sc; n � 6 pertreatment) to ovariectomized female mice (Fig. 3A). Cor-ticosterone remained low in mice treated with vehicle, yetvalues were markedly elevated after administration ofcorticosterone (P � 0.05; Fig. 3B). Treatment with corti-costerone significantly reduced mean LH as comparedwith the value in mice treated with vehicle (P � 0.05; Cortvs. Veh, 3.4 � 0.3 vs. 1.9 � 0.6 ng/ml, Fig. 3C), demon-strating sufficiency of glucocorticoids to disrupt repro-ductive neuroendocrine function and relevancy as an in-hibitory factor induced during stress.
Evidence that GR is expressed in gonadotrope cells inthe rat (22) supports our hypothesis of a direct action ofglucocorticoids via GR within mouse gonadotrope cells.To confirm the presence of this receptor in mouse go-
nadotrope, we used dual-label immunofluorescence ofadult mouse anterior pituitary sections for LH� and GR(rhodamine- and fluorescein isothiocyanate-conjugatedsecondary antibodies, respectively; Fig. 3, D–F). LH� im-munostaining identified gonadotropes that accounted for asmall proportion of labeled anterior pituitary cells (Fig. 3D),whereas GR immunostaining occurred in an extensive pop-ulation of pituitary cells (Fig. 3E). Of interest, numerousLH�-containing gonadotropes showed GR staining, con-firming the presence of GR in this anterior pituitary cell typein the mouse (merge, white stars, Fig. 3F).
Having confirmed the presence of GR in adult mousepituitary gland, we next tested the hypothesis that thestress-induced decrease in LH� mRNA expression couldbe recapitulated in cultured gonadotrope cells. As ex-pected, immortalized pituitary gonadotrope cells, L�T2,responded to GnRH with a 2-fold increase in endogenousLH� mRNA as measured by quantitative RT-PCR (Fig.
Veh
*
Cort
B
Cor
ticos
tero
ne (n
g/m
l)
750
250
0
1000
0Veh
*
Cort
C
LH (n
g/m
l) 3
1
2
4
500
D E F***
A
0 90Time (min)
Cortor Veh
Blood (n=6/trt)
FIG. 3. Glucocorticoids inhibit LH and GR are expressed in mousegonadotrope cells. A, Schematic depicting experimental events inwhich animals were administered corticosterone (200 ng/kg, sc; graybar) or vehicle (white bar), 90 min before euthanasia and bloodcollection (Blood coll’n). B and C, Serum corticosterone (ng/ml, panelB) or LH (ng/ml, panel C) measured in animals administered vehicle(white bars) or corticosterone (gray bars). *, Significant (P � 0.05)effect of treatment. D–F, Photomicrographs of representative mousepituitary sections subjected to two-color immunofluorescence stainingusing a fluorescein isothiocyanate-conjugated anti-GR (greenfluorescent signal), followed by rhodamine-conjugated anti-LH� (redfluorescent signal). Red (panel D), green (panel E), and merge (panel F)immunofluorescence images were taken of the same microscopic fieldusing appropriate filters. White stars, GR-positive/LH�-positive cells.Scale bar, 20 �m. Cort, Corticosterone; trt, treatment; Veh, vehicle.
1722 Breen et al. Glucocorticoid Repression of LH� Gene Expression Mol Endocrinol, October 2012, 26(10):1716–1731
4A). Treatment of L�T2 cells with a physiological, stresslevel of corticosterone decreased GnRH-induced LH�
mRNA expression (P � 0.05; GnRH vs. GnRH � Cort,2.1 � 0.3 vs. 1.6 � 0.1; Fig. 4A); however, corticosteronealone did not reduce LH� expression. These findings in-dicate that repression by glucocorticoids occurs in the pres-ence of GnRH and confirm the L�T2 gonadotrope cell is an
appropriate model for investigating the role of glucocor-ticoid-induced suppression of LH� gene expression.
We began to dissect out the mechanism whereby glu-cocorticoids reduce LH�-subunit induction in L�T2 cells,by investigating the regulation of an LH�-luciferase re-porter after incubation with either natural or syntheticglucocorticoids. For this purpose, L�T2 cells were tran-siently transfected with �1800 bp of the rat LH� regula-tory region fused upstream of a luciferase reporter gene(LH�-luc) or pGL3 control plasmid and treated with cor-ticosterone (100 nM), dexamethasone (100 nM), or vehicle(0.1% ethanol) for 24 h before harvest. Neither the nat-ural glucocorticoid, corticosterone, nor the synthetic glu-cocorticoid, dexamethasone, significantly altered basalexpression of the �1800-bp LH� promoter (P � 0.05;Veh vs. Cort or Dex; Fig. 4B). In contrast, both glucocor-ticoids significantly blunted the robust increase in pro-moter activity induced by GnRH (10 nM, final 6 h ofglucocorticoid treatment; P � 0.05; Fig. 4B). Specifically,GnRH resulted in a 4.6-fold induction of LH�-luc, whichwas reduced 35% by corticosterone, or 45% by dexa-methasone. Although both glucocorticoids are capable oftranscriptional repression of GnRH induction of the LH�
promoter, we focused on the synthetic glucocorticoid,dexamethasone, based on the intensity of its effect andevidence for its potent interaction with the endogenoussteroid receptor, GR, expressed in L�T2 cells (29) andidentified in mouse gonadotrope cells (Fig. 3).
Using a promoter truncation approach, we identifiedregions of the LH� gene that are functionally involved inglucocorticoid regulation. L�T2 cells were transientlytransfected with a series of truncated LH� reporter plas-mids, ranging in length from �1800 to �87 bp of the5�-regulatory sequence. Figure 4C illustrates the effect oftreatment with GnRH in the presence or absence of dexa-methasone on progressive 5�-LH� promoter truncations.As observed previously, GnRH induction of the LH� genedeclined incrementally as the promoter was progressivelytruncated from �1800 to �87 (Fig. 4C and Ref. 44).Dexamethasone repressed LH� promoter activity by ap-proximately 40% when the region contained at least�150 bp of the proximal promoter. Interestingly, furthertruncation of the region from �150 to �87, which re-moved the proximal GnRH responsive elements [such asearly growth response factor 1 (Egr1) and SF1], resultedin a loss of GnRH induction and elimination of dexa-methasone repression, indicating that GnRH responsive-ness of the LH� gene is required for glucocorticoid repres-sion. Collectively, these data suggest that GR exerts itsinhibitory effects upon the LH� proximal promoter,likely via interactions with GnRH-responsive factors,such as Egr1 and SF1.
Veh DexCort
B
GnRH GnRH + Dex
-1800 -400 -300 -200 -150 -87Truncation from transcription start site
0
2
3
4
5C
1
0
2345
1
GnRH GnRH +Cort
GnRH +Dex
* *
# ###
#
*##
6
LHβ-
Luc/βg
al
Fold
indu
ctio
nLH
β-Lu
c/βg
al
Fold
indu
ctio
n
0
1.0
1.5
2.5
Veh Cort
*
GnRH
A
GnRH +Cort
LHβ/
GAP
DH
mR
NA
2.0 *
#3.0
FIG. 4. Glucocorticoid repression localizes to the LH� proximalpromoter. A, Quantitative RT-PCR analysis of LH� mRNA extractedfrom L�T2 cells cultured in the presence of GnRH (10 nM, 6 h),corticosterone (Cort; 100 nM, 24 h), GnRH � corticosterone [Cort (100nM, entire 24 h); GnRH (10 nM, final 6 h)], or vehicle (Veh; 0.1% BSA/0.1% ethanol). Results are expressed as LH� mRNA levels normalizedto GAPDH mRNA levels and are the mean of three separateexperiments performed in triplicate. Results shown are average � SEM
relative to the vehicle treatment. *, Significant (P � 0.05) effect ofGnRH; #, significant repression by corticosterone. B, The �1800-bp ratLH�-luc reporter gene was transfected into L�T2 cells, and cells weresubsequently treated with corticosterone (Cort; 100 nM, 24 h),dexamethasone (Dex; 100 nM, 24 h), or vehicle alone (Veh; 0.1% BSA/0.1% ethanol) or either glucocorticoid (100 nM, entire 24 h) incombination with GnRH (10 nM, final 6 h), and harvested for luciferaseas a measure of LH� promoter activity. Results are depicted as foldinduction by hormone treatment relative to vehicle (dashed line) asindicated. *, Significant induction by GnRH vs. vehicle control; #,significant repression by glucocorticoid treatment on GnRH-inducedLH� expression. C, L�T2 cells were transfected with a series of 5�-truncated LH�-luc reporter plasmids and treated with GnRH (10 nM,final 6 h) or GnRH � dexamethasone [Dex (100 nM, entire 24 h); GnRH(10 nM, final 6 h)] to determine regions of the LH� promoter that areresponsive to glucocorticoids. Results for each truncation are depictedas LH� fold induction relative to vehicle of that truncation (dashedline). #, Significant repression by glucocorticoid treatment on GnRH-induced LH� expression.
Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1723
Proximal binding elements are important forglucocorticoid repression
The proximal 150 bp of the rat LH� promoter containmultiple binding elements that are critically important forGnRH regulation of LH� transcription (Fig. 5A), includ-ing tandem elements for both Egr1 and SF1 that are ar-ranged on either side of a homeobox element, previouslyshown to bind pituitary homeobox factor 1 (Ptx1). Ptx1 is
expressed throughout pituitary development and plays acritical role in activation of a number pituitary genes,including Lhb (45). SF1 is specifically expressed in thegonadotrope of the anterior pituitary gland, and its im-portance for reproduction is underscored by a lack ofgonads in SF1-null mice (46). Although highly importantfor LH� transcription, SF1 and Ptx1 are not regarded asfactors induced or regulated by GnRH (47). On the otherhand, Egr1 is rapidly induced by GnRH and considered acritical regulator of LH� gene expression (47), becauseEgr1 null mice lack LH� expression in the pituitary go-nadotropes (48). Therefore, we focused on the role ofEgr1 in glucocorticoid repression of LH� gene expressionand tested the hypothesis that glucocorticoids interferewith GnRH induction of LH� by blunting the GnRH-stimulated increase in Egr1 mRNA and protein. To inves-tigate hormone regulation of Egr1 mRNA, L�T2 cellswere treated with hormone, and after 45 min, RNA washarvested for Egr1 mRNA analysis by quantitative RT-PCR. Egr1 mRNA was low in vehicle-treated controlcells, and expression was unchanged by treatment withdexamethasone alone (Fig. 5B). As expected, GnRHcaused a dramatic 27.2-fold induction in Egr1 mRNA(P � 0.05 vs. Veh). This increase in GnRH-induced Egr1transcript, however, was not significantly decreased bydexamethasone (P � 0.05; GnRH vs. GnRH � Dex,27.2� 4.6 vs. 23.1 � 4.5; Fig. 5B). Because we found thattreatment with glucocorticoids does not suppress levels ofGnRH-induced Egr1 transcript, we next tested the hy-pothesis that dexamethasone regulates translation or deg-radation of Egr1 in L�T2 cells using Western blot analy-sis. Protein expression of Egr1 was undetectable innuclear extracts of L�T2 cells after treatment with vehicleor dexamethasone (Fig. 5C). After treatment with GnRH,Egr1 protein was readily detected, yet protein expressiondid not significantly change after cotreatment with GnRHand dexamethasone, indicating that GR does not interferewith GnRH induction of Egr1 protein.
We further examined how glucocorticoids might influ-ence GnRH-induced LH� expression by performing ChIPassays on the endogenous mouse LH� promoter in L�T2cells. Cells were treated with dexamethasone or GnRHalone or in combination for 60 min before cross-linking.Sonicated chromatin was immunoprecipitated using ei-ther anti-GR or nonspecific IgG. Cross-linking was re-versed and precipitates analyzed by quantitative PCR for220 bp of the LH� promoter (�180 to �40). Dexameth-asone treatment alone did not increase GR binding to theproximal promoter over vehicle treatment (P � 0.05; Vehvs. Dex; Fig. 5D). However, we can only rule out a changein GR occupancy of the LH� promoter at 60 min, andthat later (or earlier) changes in the response to glucocor-
VehEgr1
/GAP
DH
mR
NA
Dex
B
0
10
20
GnRH GnRH +Dex
30
C
Dex
GnR
H
GnR
H +
Dex
Ab: αEgr1
*
A
rat LHβ
-150 -87
Egr1SF1 Egr1SF1Ptx1
*
Veh
Veh
Fold
enh
ance
men
t
Dex
D
0
2.0
4.0
GnRH GnRH +Dex
6.0 **
ChIP: GR/IgG
n.s.
FIG. 5. GnRH-responsive factor necessary for GR recruitment. A,Schematic of the proximal 150 bp of the rat LH� 5�-regulatory regionillustrating the known promoter elements involved in expression of theLH� gene. Proteins binding each site are indicated. B, Quantitative RT-PCR analysis of Egr1 mRNA extracted from L�T2 cells cultured in thepresence of dexamethasone (Dex; 100 nM, 18 h), GnRH (10 nM, 45min), GnRH � dexamethasone [Dex (100 nM, entire 18 h); GnRH (10nM, final 45 min)], or vehicle (Veh; 0.1% BSA/0.1% ethanol). Resultsare expressed as Egr1 mRNA levels normalized to GAPDH mRNA levelsand are the mean of three separate experiments performed intriplicate. Results shown are average � SEM. *, Significant induction byGnRH vs. vehicle control. C, Western blotting analysis of nuclearextracts from L�T2 cells treated with dexamethasone (Dex; 100 nM,18 h), GnRH (10 nM, 2 h), GnRH � dexamethasone [Dex (100 nM,entire 18 h); GnRH (10 nM, final 2 h)], or vehicle (Veh; 0.1% BSA/0.1%ethanol) was performed using an antibody for Egr1. A protein bandwas detected at the expected size of 82 kDa for Egr1. The experimentwas repeated three times with similar results, and a representative gelis shown. D, ChIP was performed using cross-linked chromatin fromL�T2 cells treated with dexamethasone (Dex; 100 nM, 1 h), GnRH (10nM, 1 h), GnRH � dexamethasone [Dex (100 nM, 1 h); GnRH (10 nM,1 h)], or vehicle (Veh; 0.1% BSA/0.1% ethanol) and antibodiesdirected against GR or nonspecific IgG as a negative control. ChIP andinput DNA were analyzed by quantitative PCR using primersencompassing the proximal promoter of Lhb to determine the amountof immunoprecipitated DNA. ChIP samples were normalized to therespective input samples and then expressed as fold enrichmentrelative to the nonspecific IgG ChIP samples.
1724 Breen et al. Glucocorticoid Repression of LH� Gene Expression Mol Endocrinol, October 2012, 26(10):1716–1731
ticoids are still possible. In contrast, GnRH treatmentincreased GR binding 3.8-fold compared with vehicle(P � 0.05; Veh vs. GnRH), indicating that recruitment ofGR to the LH� promoter is not dependent on dexameth-asone binding, but rather is dependent on a GnRH-re-sponsive factor. No difference in GR binding was ob-served when the cells were concomitantly stimulated withdexamethasone and GnRH as compared with GnRHalone, suggesting that a change in GR conformation orrecruitment due to ligand does not underlie the mecha-nism of glucocorticoid repression of LH� transcription.
Glucocorticoids interfere with Egr1 actions at thelevel of the promoter
Having determined that GR recruitment is dependenton GnRH (i.e. a responsive factor such as Egr1), yet theinhibitory effect of glucocorticoids is downstream ofGnRH-induced Egr1 mRNA or protein, we investigatedthe role of Egr1 at the level of the LH� promoter. Webegan by testing the hypothesis that glucocorticoids re-duce activity of the LH� promoter when induced by Egr1itself, in the absence of GnRH. Egr1 is a potent activatorof LH� transcription, and transfection of an Egr1 expres-sion plasmid in L�T2 cells treated with vehicle caused arobust 35-fold increase in LH� activity (P � 0.05; Veh:Empty Vec vs. Egr1; Fig. 6A). Treatment with dexametha-sone significantly blunted the increase in LH� activity in-duced by Egr1 compared with the response in cells treatedwith vehicle (P � 0.05; Egr1 (black bars): Dex vs. Veh; Fig.6A), indicating that glucocorticoids can interfere with acti-vation by Egr1 at the level of the LH� promoter in gonado-trope cells and that GR suppression does not require factorsinvolved in GnRH signaling upstream of Egr1.
We next attempted to rescue the glucocorticoid repres-sion of GnRH-induced LH� activity in L�T2 cells. Wehypothesized that if Egr1 were the sole factor affected byglucocorticoids, then titrating increasing amounts of Egr1into L�T2 cells would restore full induction and preventdiminishment by glucocorticoids. LH�-luc/�gal valuesare represented as fold induction of GnRH or GnRH �Dex relative to the vehicle control condition containingthe same amount of Egr1. In the absence of exogenousEgr1, dexamethasone significantly blunted GnRH-in-duced LH� activity (P � 0.05; empty vector: GnRH vs.GnRH � Dex; Fig. 6B). In the presence of increasingamounts of overexpressed Egr1 (50–200 ng), the percentrepression significantly decreased (P � 0.05; empty vec-tor vs. 100 or 200 ng Egr1; Fig. 6C), indicating that re-pression occurs, in part, via interfering with Egr1 functionon the promoter.
We focused our attention on the action of glucocorti-coids at the level of the LH� promoter and analyzed the
EV
#
GnRHGnRH+Dex
Empty VecEgr1
Veh Dex0
20
30
40
50
A
10
*
0
10
15
20
25
LHβ-
Luc/βg
al
Fold
indu
ctio
n
B
5
#
#
*
60
GnRH
WT 5'SF10
1.0
1.52.02.5
D
0.5
GnRH+Dex
5'Egr1 3'SF1 3'Egr1
3.0
#n.s.
** *
#*
# * #
Egr1
#
#
LHβ-
Luc/βg
al-2
00 L
Hβ-
Luc/βg
al
Fold
indu
ctio
n
Mutations
***
*
Rel
ief o
f rep
ress
ion
(%)C
100
75
50
25
0 **
EV Egr1
FIG. 6. Glucocorticoids interfere with Egr1 actions at the level of theproximal promoter. A, To test whether glucocorticoids can interferewith Egr1-induced LH� expression, Egr1 (black bars) or empty vector(Empty Vec, open bars) was transfected with the �1800-bp LH�-lucreporter plasmid into L�T2 cells and subsequently treated withdexamethasone (Dex; 100 nM, 24 h) or vehicle (Veh; 0.1% BSA/0.1%ethanol). Data are shown relative to vehicle-treated in the absence ofEgr1. *, Significant induction by Egr1 vs. vector control; #, significantrepression by glucocorticoid treatment on Egr1-induced LH�expression. B, To determine whether titrating in increasing levels ofEgr1 can rescue glucocorticoid repression of �1800-bp LH�-lucactivity, L�T2 cells were transfected with empty vector (EV, 200 ng) orincreasing amounts of Egr1 [50 ng (plus 150 ng empty vector), 100 ng(plus 100 ng empty vector), 200 ng] and treated with GnRH (whitehatched bars, 10 nM, final 6 h) or GnRH � dexamethasone [grayhatched bars, Dex (100 nM, entire 24 h); GnRH (10 nM, final 6 h)].Results are depicted as LH�-fold induction relative to the vehicle-treated condition in the presence of the same amount of Egr1 (dashedline) as indicated. *, Significant induction by GnRH; #, significantrepression by glucocorticoid treatment on GnRH-induced LH�expression. C, The effect of increasing Egr1 on the ratio of LH�-foldinduction in cells treated with GnRH alone vs. GnRH withdexamethasone was calculated and expressed as percent repression. *,Significant difference in the ratio as compared with EV determined byStudent’s t test. D, L�T2 cells were transfected with either the �200-bp LH�-luc reporter plasmid (WT) or reporter plasmids containing the�200-bp LH� region with mutations in SF1 or Egr1 binding elementsas indicated and cultured in the presence of GnRH (white hatchedbars) or GnRH � Dex (gray hatched bars). Data are shown for eachmutant promoter, relative to its own vehicle treatment. See Fig. 6Blegend for more details. n.s., Not significant P � 0.08; WT, wild type.
Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1725
necessity of known GnRH-responsive elements within theproximal 150 bp of the LH� gene for glucocorticoid re-pression by creating cis mutations in the 5�-SF1, 3�-SF1,5�-Egr1, and 3�-Egr1 binding elements in the context of aminimal �200 bp LH� promoter (WT). We used thisminimal LH� promoter because it is sufficient for respon-siveness to GnRH and glucocorticoids. cis mutation ofeither the 5�- or 3�-SF1 or the 5�-Egr1 site preserved sig-nificant GnRH induction and was sufficient for glucocor-ticoid repression, suggesting that these elements are notrequired for either GnRH induction or GR repression(P � 0.05; *, significant induction by GnRH; #, signifi-cant repression of GnRH induction; Fig. 6D). In contrast,the 3�-Egr1 cis mutation was the only mutation to abro-gate glucocorticoid repression (Fig. 6D, 3�-Egr1 muta-tion). Of interest to our study, this Egr1 binding site hasbeen shown to be critical for GnRH induction as well(49), and cis mutation of this element eliminated signifi-cant induction by GnRH in our hands, implying thatGnRH responsiveness is necessary for repression byglucocorticoids.
Interaction and involvement of Lhb promoterproximal binding factors
Egr1 conveys GnRH induction of the LH� promoterby interaction with other regulators of gene expression inthe gonadotrope (47, 49–51). To assess the complex andcooperative roles of Egr1, SF1, and Ptx1, we used heter-ologous CV-1 cells. Unlike gonadotrope cells, CV-1 cellslack GnRH receptors, an Egr1 response to GnRH, and aredevoid of endogenous SF1, Ptx1, and GR, which allowedus to reconstitute these factors and determine the neces-sity and sufficiency of proteins involved in suppression bydexamethasone. In addition to GR, CV-1 cells werecotransfected with 1800-bp LH�-luc reporter plasmid orpGL3 control plasmid and Egr1, SF1, or Ptx1 alone, or incombination, and tested for activation of LH� transcrip-tion in the presence of dexamethasone or vehicle. Asshown in Fig. 7A (white bars), overexpression of Egr1,SF1, or Ptx1 alone induced small increases in LH� tran-scription, with induction by Egr1 reaching significance.Dexamethasone significantly diminished induction byEgr1 (P � 0.05; Egr1: Dex vs. Veh). Interestingly, dexa-methasone also significantly repressed LH� inductionwhen Egr1 was cotransfected with SF1 alone or SF1 plusPtx1 (P � 0.05; Egr1: Dex vs. Veh, Egr1/SF1: Dex vs.Veh; Fig. 7A).
To address whether the Egr1-binding site is sufficientfor glucocorticoid repression of LH� transcription, re-porter constructs containing four copies of the Egr1 con-sensus site ligated into pGL3 upstream of a minimal TKpromoter were created (Egr1 multimer, Fig. 7B). CV-1
cells were cotransfected with the Egr1 multimer or con-trol TKluc pGL3 plasmid, GR, and either Egr1 alone, orEgr1 in combination with SF1 and Ptx1, to test for suffi-ciency to activate transcription in the presence or absenceof dexamethasone. Egr1 was sufficient to induce tran-scriptional activation of the Egr1 multimer, and this effectwas blunted by glucocorticoids (P � 0.05; #, significantrepression by Dex; Fig. 7B). Of interest, this site wassufficient to allow for enhanced activation by the combi-nation of Egr1, SF1, and Ptx1, an affect that was alsodiminished by glucocorticoids. In contrast to the suffi-ciency of the Egr1 site, a consensus SF1-binding site mul-timer does not convey responsiveness to dexamethasonewhen induced by SF1 alone, but activation of the SF1 siteby the combination of Egr1, SF1, and Ptx1 is disrupted bydexamethasone. Taken together, these findings indicatethat the Egr1 site activated by Egr1 alone is sufficient formediating repression. In contrast, the SF1 site activated
B
*
VehDex
Egr1 SF10
10
15
20
25A
5
Ptx1 Egr1SF1
Egr1Ptx1
Egr1SF1 Ptx1
*
CV-1 cells
**
*
*#
#
#
*LHβ-
Luc/βg
al
Fold
indu
ctio
n
VehDex
Egr10
2
3
4
5
1
Egr1SF1 Ptx1
SF1 SF1 Egr1Ptx1
* #
Egr1
mul
timer
Lu
c/βg
al fo
ld in
duct
ion
0
2
3
4
5
1SF1
mul
timer
Luc/βg
al fo
ld in
duct
ion
C*#* * #
FIG. 7. Interruption of LH� transcriptional complex formation byglucocorticoids. A, To investigate glucocorticoid-mediated interferenceof Egr1, SF1, and/or Ptx1 induction of LH� promoter activity, CV-1 cellswere transfected with a GR expression vector and the �1800-bp LH�-luc reporter plasmid, along with Egr1, SF1, or Ptx1 alone or incombination, as indicated, and treated with dexamethasone (gray bars,Dex; 100 nM, 24 h) or vehicle (white bars, Veh; 0.1% BSA/0.1%ethanol). *, Significant induction of LH� promoter activity vs. vectorcontrol (dashed line); #, significant repression by glucocorticoidtreatment. B and C, Induction of the Egr1 multimer (B) or SF1 multimer(C) by the indicated Egr1 or SF1 alone, respectively, or in combinationwith Ptx1, was assessed after treatment with dexamethasone (graybars, Dex; 100 nM, 24 h) or vehicle (white bars, Veh; 0.1% BSA/0.1%ethanol) and depicted as fold induction relative to induction of thecontrol luciferase reporter driven by the TK promoter. *, Significantinduction of multimer activity vs. vector control (dashed line); #,significant repression by glucocorticoid treatment.
1726 Breen et al. Glucocorticoid Repression of LH� Gene Expression Mol Endocrinol, October 2012, 26(10):1716–1731
by SF1 alone is not sufficient although a complex withSF1, Egr1, and Ptx1 on the SF1 site can be repressed.
Role of the GR at the level of the Lhb promoterBecause CV-1 cells lack GR, this cell model allowed us
to determine the necessity of DNA binding or dimeriza-tion by GR for repression in gonadotrope cells. In theabsence of transfected GR in CV-1 cells, dexamethasonedoes not inhibit LH� promoter activity (P � 0.05; no GR:Veh vs. Dex; Fig. 8A), confirming that GR is necessary forrepression of LH� by glucocorticoids. To determinewhether direct DNA binding by GR plays a critical role inthe repression of LH� by glucocorticoids, we transfectedCV-1 cells with two different GR mutants that are inca-pable of binding DNA. The first mutant, GR Dim mut,contains four point mutations in the dimerization domainof GR. These mutations prevent homodimerization ofGR, but do not prevent indirect DNA binding through
interactions with other transcription factors (52, 53). Thesecond GR mutant, GR DBD mut, prevents direct DNAbinding by the mutant. Dexamethasone elicited suppres-sion in the presence of either transfected GR mutant, in-dicating that GR dimerization and DNA binding are notnecessary for repression of GnRH-induced LH� pro-moter activity (P � 0.05; Dim mut or DBD mut: Veh vs.Dex; Fig. 8A).
After demonstrating that GR does not require DNAbinding to elicit repression upon the LH� promoter, weinvestigated the ability of GR to be tethered to DNA by aGnRH-induced factor, by testing the hypothesis that GRis capable of binding Egr1. We asked whether in vitro-transcribed and -translated GR could bind bacterially ex-pressed GST-Egr1 in pull-down experiments. Figure 8Bdemonstrates precipitation of 35S-labeled GR with GST-Egr1, as compared with GST alone, illustrating a physicalinteraction between GR and Egr1. As a positive control,we show that 35S-labeled SF1 binds GST-Egr1, a stronginteraction that has been previously reported (54). In con-trast, the interaction between 35S-labeled GFP with eitherGST construct was undetectable. Together with the ChIPresults in Fig. 5D, these findings indicate that GR does notdirectly bind the LH� promoter; rather it physically in-teracts with Egr1 and thus is recruited to the LH� pro-moter as a complex with Egr1, identifying Egr1 as a crit-ical factor mediating GnRH induction and GR repressionof LH� gene expression.
Discussion
Utilizing a restraint stress paradigm that robustly stimu-lates corticosterone to investigate stress-induced suppres-sion of gonadotrope function in female mice, we demon-strate that chronic exposure to stress impairs estrouscyclicity and reduces GnRH-induced LH synthesis andsecretion in diestrus female mice. Whether the increase inglucocorticoids is induced by stress or exogenously ad-ministered, both conditions lead to repression of gonado-trope function, confirming the inhibitory role of gluco-corticoids within the reproductive axis anddemonstrating the capacity for suppression during stress.Although we acknowledge that stress likely increases avariety of mediators, including other hormones of theadrenal stress axis that have been shown to alter repro-ductive function during stress (2, 55, 56), we conclude,based on our current investigation, that glucocorticoidsare sufficient to disrupt reproductive neuroendocrinefunction.
Seminal work by Dr. Neena Schwartz and colleagues(57) clearly identified inhibitory effects of glucocorticoids
0
10
15
20
25A
5
CV-1 cells
LHβ-
Luc/βg
al
Fold
indu
ctio
n by
Egr1
/SF1
/Ptx
1
No GR WTGR
Dimmut
DBD mut
##
#
GR
B
SF1
GFP
10% Input GST GST-Egr1
FIG. 8. GR does not require dimerization or DNA binding, but iscapable of physically interacting with Egr1. A, The necessity ofdimerization or DNA binding by GR, or by GR itself, was assessed inCV-1 cells. The �1800-bp LH�-luc reporter plasmid was maximallyinduced with a combination of Egr1, SF1, and Ptx1 in CV-1 cellscotransfected with empty vector (No GR), wild-type GR (WT GR), GRdimerization mutant (Dim mut), or GR DBD mutant (DBD mut) andsubsequently treated with dexamethasone (gray bars, Dex; 100 nM,24 h) or vehicle (open bars, Veh; 0.1% BSA/0.1% ethanol). Data arepresented relative to the �1800-bp LH�-luc reporter cotransfectedwith the empty vectors for Egr1, SF1, and Ptx1 for each GR expressionvector. #, Significant repression by glucocorticoid treatment. B, GSTinteraction assays were performed using bacterially expressed Egr1-GST fusion protein and 35S-labeled in vitro translated GR, SF1, or GFPas a control. One tenth of the protein input (10% Input) and the GSTtag-alone (GST, negative control) are shown (note that the SF1complex with GST-Egr1 has spilled over into the intermediate emptylane between the GST and the GST-Egr1 lanes).
Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1727
within the reproductive neuroendocrine axis and postu-lated that glucocorticoids may alter hypothalamic andpituitary function. Indeed, in vivo analyses demonstratedthat glucocorticoids could prevent the postcastration risein LH in rats but also blunt the response to GnRH inanterior pituitary fragments in culture (20, 57). Our pres-ent investigation expands upon these early studies bydemonstrating that glucocorticoids can act directly uponthe anterior pituitary gonadotrope cell to suppress GnRHinduction of LH� gene expression. Intriguingly, we ob-serve a similar suppression in LH� gene expression afterstress, but it remains to be determined whether this is adirect effect of glucocorticoids within the pituitary gland.With regard to direct actions within the gonadotrope, wedemonstrate a novel mechanism whereby GR is recruitedto the 5�-region of the mouse LH� gene in live L�T2 cellsand blunts GnRH induction of LH� by interferingwith the genomic effects of Egr1 on the proximal LH�
promoter.Glucocorticoid repression via GR maps to a highly
active region of the LH� promoter, which contains ele-ments critical for GnRH induction. Promoter analysesrevealed that glucocorticoid-mediated repression is lostupon 5�-truncation of the bipartite SF1 and Egr1 elementsin the LH� proximal promoter. Truncation of this region,however, also eliminated GnRH induction of the pro-moter (Fig. 4C, �87 LH�-luc), suggesting that the abilityof glucocorticoids to repress is closely tied to the highlycoordinated and complex mechanism of GnRH action onLhb. Not surprisingly, the only cis mutation that relievedsuppression by glucocorticoids (Fig. 6D, the 3�-Egr site)also prevented significant induction of the LH� promoterby GnRH, supporting the conclusion that glucocorticoid-induced repression is dependent on the response to GnRHand highlights the importance of Egr1 for repression byglucocorticoids.
Glucocorticoids have the potential to interfere withGnRH induction of LH� via interference of GnRH recep-tor signaling upstream and downstream of Egr1 induc-tion. For example, studies performed using rat and pigpituitary cell cultures suggest that chronic exposure toglucocorticoids can disrupt GnRH receptor-signalingmechanisms involved in gonadotropin release, includingactivation of protein kinase C and cAMP (20, 23). Fur-ther, GR has been shown to interact rapidly with c-JunN-terminal kinase, a kinase implicated in mediating ef-fects of GnRH in gonadotrope cells (58). In contrast tothese actions of glucocorticoids on GnRH signaling, ourfindings support an action of glucocorticoids down-stream of Egr1 induction by GnRH via GR acting withinthe LH� chromatin. Glucocorticoids do not alter GnRH-induced Egr1 mRNA or protein in L�T2 cells, demon-
strating that the pathway between GnRH binding its re-ceptor and induction of the immediate early gene, Egr1, isintact. Furthermore, glucocorticoids blunt the ability ofoverexpressed Egr1 to induce LH� activity, providing ev-idence that GR inhibition does not require elements up-stream of Egr1 and focus our attention on a mechanisminvolving Egr1 at the promoter level. We show that titrat-ing in increasing amounts of Egr1 partially overcomesglucocorticoid repression of Lh� in L�T2 cells, solidify-ing a mediatory role of Egr1.
With regard to the mechanism of repression, similar toother steroid hormone receptors, GR mediates transcrip-tional regulation of target genes via a host of direct andindirect mechanisms. For example, within the gonado-trope cell, induction of either the murine FSH� or human�GSU gene occurs via direct GR binding to DNA at con-served glucocorticoid response elements (29, 30). In con-trast, using cell models either devoid of or expressing GR(CV-1 vs. L�T2 cells, respectively), we find that neither anintact DBD nor dimerization domain is necessary for GRrepression of the rat LH� gene, implicating a genomicaction that occurs via indirect GR binding. In addition,GR is recruited to the LH� promoter chromatin by GnRHinduction in the presence or absence of glucocorticoids.Coupled with our findings that GR physically interactswith Egr1 in GST-pulldown experiments, this providesevidence in support of our hypothesis that GR is tetheredto the LH� promoter via a GnRH-induced factor, and inparticular by Egr1.
The requirement for a GnRH-induced factor may alsocontribute to the differential effect of glucocorticoids ontranscription within the gonadotrope cell. On the onehand, genes encoding FSH�, �GSU, and GnRH receptorare each induced by glucocorticoids alone (30, 33, 59).On the other hand, our data reveal that GR repressionrequires GnRH, likely due to the deficiency of GR recruit-ment to the proximal promoter in the absence of GnRH.On the GnRH receptor gene in gonadotrope cells, GnRH-induced GR recruitment has been shown to be involved inglucocorticoid induction of transcription (59). In thatcase, however, the recruitment of GR to the GnRH recep-tor promoter is dependent on rapid phosphorylation ofGR by GnRH-signaling pathways, which differs from ourfinding that GR repression of LH� transcription does notrequire GnRH signaling upstream of Egr1 activation.Rather, we conclude that GR is recruited by a factor in-duced by GnRH and hypothesize that Egr1 itself mediatesthe balance between GnRH induction and GR repressionof the LH� promoter.
In summary, the present study shows that restraintstress potently activates the adrenal stress axis in mice andinterferes with gonadotropin synthesis and secretion. We
1728 Breen et al. Glucocorticoid Repression of LH� Gene Expression Mol Endocrinol, October 2012, 26(10):1716–1731
expand upon this finding by demonstrating that admin-istration of a stress level of glucocorticoids inhibits LHsecretion in female mice and detailing a mechanismwhereby glucocorticoids repress activity of the anteriorpituitary gland via regulation of LH� gene expression ingonadotrope cells. We identify GR in native gonadotropecells in the mouse and demonstrate that the recruitment ofGR to the mouse LH� promoter via Egr1 interferes withthe tripartite transcriptional complex necessary for medi-ating responsiveness of this gonadotropin gene to GnRH.Utilizing dual in vivo and in vitro approaches, collec-tively, this work reveals new insights regarding the inter-action between the adrenal stress and reproductive neu-roendocrine axes by identifying a mechanism wherebyLH� expression is dampened after a stress elevation inglucocorticoid.
Acknowledgments
We thank Dr. Alexander (Sasha) Kauffman (University of Cal-ifornia, San Diego, La Jolla, CA) and Dr. Catherine Rivier (SalkInstitute, La Jolla, CA) for insightful discussions regarding the invivo experiments. We are grateful to Dr. Jacques Drouin (Uni-versity of Montreal, Quebec, Canada) for generously providingthe mouse Ptx1 and rat Egr1 cDNAs; to Dr. Hermann Paven-stadt (University of Munster, Munster, Germany) for providingthe human Egr1 cDNA; and to Dr. Douglass Forbes (Universityof California, San Diego, La Jolla, CA) for providing the GFPexpression plasmid. The mouse SF1 pCMV expression plasmidwas a kind gift of Dr. Bon-chu Chung (Academia Sinica, Taipei,Taiwan), and the rat LH�-luciferase plasmid was kindly pro-vided by Dr. Mark Lawson (University of California, San Diego,La Jolla, CA). We thank Dr. Keith Yamamoto (University ofCalifornia, San Francisco, San Francisco, CA) for providing therat GR plasmid and Dr. Al Parlow of the National Hormone andPeptide Program for providing the NIDDK-anti-r� LH-IC-2 an-tibody. We also thank Jason Meadows, Emily Witham, Chuq-ing (Carol) Yao, Courtney Benson, and Dr. Suzanne Rosenberg(University of California, San Diego, La Jolla, CA) for technicalassistance and helpful discussions throughout this work.
Address all correspondence and requests for reprints to: Pa-mela L. Mellon Ph.D., Department of Reproductive Medicine/Neuroscience, University of California, San Diego, 9500 Gil-man Drive, La Jolla, California 92093-0674. E-mail:[email protected].
This work was supported by National Institutes of Health(NIH) grants R01 HD020377, R01 HD072754, and R01DK044838 (to P.L.M.) and by the Eunice Kennedy Shriver Na-tional Institute of Child Health and Human Development/NIHthrough cooperative agreement (U54 HD012303) as part of theSpecialized Cooperative Centers Program in Reproduction andInfertility Research (to P.L.M.). P.L.M. was also partially sup-ported by P30 CA023100, P30 DK063491, and P42 ES010337.K.M.B. was partially supported by NIH Grant K99 HD060947.
V.G.T. was partially supported by NIH Grants K01 DK080467,and R01 HD067448. D.C. was partially supported by NIHGrants R01 HD057549, R21 HD058752, and R03 HD054595.The LH� antibody was provided by Dr. A. F. Parlow from theNational Hormone and Pituitary Program, Harbor-UCLAMedical Center. DNA sequencing was performed by the DNA-sequencing shared resource, University of California, San Diego,Cancer Center, which is funded in part by National CancerInstitute Cancer Support Grant P30 CA023100. Serum hor-mone assays were performed by The University of Virginia Li-gand Assay Core Laboratory, which is supported through Na-tional Institute of Child Health and Human Development GrantU54 HD028934.
Disclosure Summary: The authors have nothing to disclose.
References
1. Ferin M 1999 Clinical review 105: Stress and the reproductive cycle.J Clin Endocrinol Metab 84:1768–1774
2. Rivier C, Rivest S 1991 Effect of stress on the activity of the hypo-thalamic-pituitary-gonadal axis: peripheral and central mecha-nisms. Biol Reprod 45:523–532
3. Tilbrook AJ, Turner AI, Clarke IJ 2002 Stress and reproduction:central mechanisms and sex differences in non-rodent species. Stress5:83–100
4. Tilbrook AJ, Turner AI, Clarke IJ 2000 Effects of stress on repro-duction in non-rodent mammals: the role of glucocorticoids and sexdifferences. Rev Reprod 5:105–113
5. Dobson H, Smith RF 2000 What is stress, and how does it affectreproduction? Anim Reprod Sci 60–61:743–752
6. Briski KP, Vogel KL, McIntyre AR 1995 The antiglucocorticoid,RU486, attenuates stress-induced decreases in plasma-luteinizinghormone concentrations in male rats. Neuroendocrinology 61:638–645
7. Dong Q, Salva A, Sottas CM, Niu E, Holmes M, Hardy MP 2004Rapid glucocorticoid mediation of suppressed testosterone biosyn-thesis in male mice subjected to immobilization stress. J Androl25:973–981
8. Breen KM, Oakley AE, Pytiak AV, Tilbrook AJ, Wagenmaker ER,Karsch FJ 2007 Does cortisol acting via the type II glucocorticoidreceptor mediate suppression of pulsatile luteinizing hormone se-cretion in response to psychosocial stress? Endocrinology 148:1882–1890
9. Saketos M, Sharma N, Santoro NF 1993 Suppression of the hypo-thalamic-pituitary-ovarian axis in normal women by glucocortico-ids. Biol Reprod 49:1270–1276
10. Breen KM, Billings HJ, Wagenmaker ER, Wessinger EW, Karsch FJ2005 Endocrine basis for disruptive effects of cortisol on preovula-tory events. Endocrinology 146:2107–2115
11. Li XF, Edward J, Mitchell JC, Shao B, Bowes JE, Coen CW, Light-man SL, O’Byrne KT 2004 Differential effects of repeated restraintstress on pulsatile lutenizing hormone secretion in female Fischer,Lewis and Wistar rats. J Neuroendocrinol 16:620–627
12. Oakley AE, Breen KM, Clarke IJ, Karsch FJ, Wagenmaker ER,Tilbrook AJ 2009 Cortisol reduces gonadotropin-releasing hor-mone pulse frequency in follicular phase ewes: influence of ovariansteroids. Endocrinology 150:341–349
13. Dufourny L, Skinner DC 2002 Progesterone receptor, estrogen re-ceptor �, and the type II glucocorticoid receptor are coexpressed inthe same neurons of the ovine preoptic area and arcuate nucleus: atriple immunolabeling study. Biol Reprod 67:1605–1612
14. Gore AC, Attardi B, DeFranco DB 2006 Glucocorticoid repressionof the reproductive axis: effects on GnRH and gonadotropin sub-unit mRNA levels. Mol Cell Endocrinol 256:40–48
Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1729
15. Attardi B, Tsujii T, Friedman R, Zeng Z, Roberts JL, Dellovade T,Pfaff DW, Chandran UR, Sullivan MW, DeFranco DB 1997 Glu-cocorticoid repression of gonadotropin-releasing hormone gene ex-pression and secretion in morphologically distinct subpopulationsof GT1–7 cells. Mol Cell Endocrinol 131:241–255
16. DeFranco DB, Attardi B, Chandran UR 1994 Glucocorticoid re-ceptor-mediated repression of GnRH gene expression in a hypotha-lamic GnRH-secreting neuronal cell line. Ann NY Acad Sci 746:473–475
17. Melis GB, Mais V, Gambacciani M, Paoletti AM, Antinori D,Fioretti P 1987 Dexamethasone reduces the postcastration gonad-otropin rise in women. J Clin Endocrinol Metab 65:237–241
18. Pearce GP, Paterson AM, Hughes PE 1988 Effect of short-termelevations in plasma cortisol concentration on LH secretion in pre-pubertal gilts. J Reprod Fertil 83:413–418
19. Li PS, Wagner WC 1983 In vivo and in vitro studies on the effect ofadrenocorticotropic hormone or cortisol on the pituitary responseto gonadotropin releasing hormone. Biol Reprod 29:25–37
20. Suter DE, Schwartz NB, Ringstrom SJ 1988 Dual role of glucocor-ticoids in regulation of pituitary content and secretion of gonado-tropins. Am J Physiol 254:E595–E600
21. Suter DE, Orosz G 1989 Effect of treatment with cortisol in vivo onsecretion of gonadotropins in vitro. Biol Reprod 41:1091–1096
22. Kononen J, Honkaniemi J, Gustafsson JA, Pelto-Huikko M 1993Glucocorticoid receptor colocalization with pituitary hormones inthe rat pituitary gland. Mol Cell Endocrinol 93:97–103
23. Li PS 1994 Modulation by cortisol of luteinizing hormone secretionfrom cultured porcine anterior pituitary cells: effects on secretioninduced by phospholipase C, phorbol ester and cAMP. NaunynSchmiedebergs Arch Pharmacol 349:107–112
24. Maya-Nunez G, Conn PM 2003 Transcriptional regulation of theGnRH receptor gene by glucocorticoids. Mol Cell Endocrinol 200:89–98
25. Adams TE, Sakurai H, Adams BM 1999 Effect of stress-like con-centrations of cortisol on estradiol-dependent expression of gonad-otropin-releasing hormone receptor in orchidectomized sheep. BiolReprod 60:164–168
27. Kaiser UB, Conn PM, Chin WW 1997 Studies of gonadotropin-releasing hormone (GnRH) action using GnRH receptor-express-ing pituitary cell lines. Endocr Rev 18:46–70
28. Vale W, Rivier C, Brown M 1977 Regulatory peptides of the hy-pothalamus. Annu Rev Physiol 39:473–527
29. Thackray VG, McGillivray SM, Mellon PL 2006 Androgens, pro-gestins and glucocorticoids induce follicle-stimulating hormone�-subunit gene expression at the level of the gonadotrope. MolEndocrinol 20:2062–2079
31. Curtin D, Jenkins S, Farmer N, Anderson AC, Haisenleder DJ,Rissman E, Wilson EM, Shupnik MA 2001 Androgen suppressionof GnRH-stimulated rat LH� gene transcription occurs throughSp1 sites in the distal GnRH-responsive promoter region. Mol En-docrinol 15:1906–1917
32. Jorgensen JS, Nilson JH 2001 AR suppresses transcription of theLH� subunit by interacting with steroidogenic factor-1. Mol Endo-crinol 15:1505–1516
34. Becker KL 1995 Principles and practice of endocrinology and me-tabolism. 2nd ed. Philadelphia: Lippincott
35. Thackray VG, Hunnicutt JL, Memon AK, Ghochani Y, Mellon PL2009 Progesterone inhibits basal and GnRH induction of luteiniz-
ing hormone �-subunit gene expression. Endocrinology 150:2395–2403
36. Rosenberg SB, Mellon PL 2002 An Otx-related homeodomain pro-tein binds an LH� promoter element important for activation dur-ing gonadotrope maturation. Mol Endocrinol 16:1280–1298
37. Hollenberg SM, Evans RM 1988 Multiple and cooperative trans-activation domains of the human glucocorticoid receptor. Cell 55:899–906
38. Corpuz PS, Lindaman LL, Mellon PL, Coss D 2010 FoxL2 is re-quired for activin induction of the mouse and human follicle-stim-ulating hormone �-subunit genes. Mol Endocrinol 24:1037–1051
39. Coss D, Hand CM, Yaphockun KK, Ely HA, Mellon PL 2007 p38mitogen-activated kinase is critical for synergistic induction of theFSH � gene by gonadotropin-releasing hormone and activinthrough augmentation of c-Fos induction and Smad phosphoryla-tion. Mol Endocrinol 21:3071–3086
40. Larder R, Clark DD, Miller NL, Mellon PL 2011 Hypothalamicdysregulation and infertility in mice lacking the homeodomain pro-tein Six6. J Neurosci 31:426–438
41. Miyamoto J, Matsumoto T, Shiina H, Inoue K, Takada I, Ito S, ItohJ, Minematsu T, Sato T, Yanase T, Nawata H, Osamura YR, KatoS 2007 The pituitary function of androgen receptor constitutes aglucocorticoid production circuit. Mol Cell Biol 27:4807–4814
42. Chappell PE, Schneider JS, Kim P, Xu M, Lydon JP, O’Malley BW,Levine JE 1999 Absence of gonadotropin surges and gonadotropin-releasing hormone self-priming in ovariectomized (OVX), estrogen(E2)-treated, progesterone receptor knockout (PRKO) mice. Endo-crinology 140:3653–3658
43. Bronson FH, Vom Saal FS 1979 Control of the preovulatory releaseof luteinizing hormone by steroids in the mouse. Endocrinology104:1247–1255
44. Coss D, Thackray VG, Deng CX, Mellon PL 2005 Activin regulatesluteinizing hormone �-subunit gene expression through Smad-binding and homeobox elements. Mol Endocrinol 19:2610–2623
45. Tremblay JJ, Lanctôt C, Drouin J 1998 The pan-pituitary activatorof transcription, Ptx1 (pituitary homeobox 1), acts in synergy withSF-1 and Pit1 and is an upstream regulator of the Lim-homeodo-main gene Lim3/Lhx3. Mol Endocrinol 12:428–441
47. Tremblay JJ, Drouin J 1999 Egr-1 is a downstream effector ofGnRH and synergizes by direct interaction with Ptx1 and SF-1 toenhance luteinizing hormone � gene transcription. Mol Cell Biol19:2567–2576
48. Topilko P, Schneider-Maunoury S, Levi G, Trembleau A, GourdjiD, Driancourt MA, Rao CV, Charnay P 1998 Multiple pituitaryand ovarian defects in Krox-24 (NGFI-A, Egr-1)-targeted mice.Mol Endocrinol 12:107–122
49. Weck J, Anderson AC, Jenkins S, Fallest PC, Shupnik MA 2000Divergent and composite gonadotropin-releasing hormone-respon-sive elements in the rat luteinizing hormone subunit genes. MolEndocrinol 14:472–485
50. Dorn C, Ou Q, Svaren J, Crawford PA, Sadovsky Y 1999 Activa-tion of luteinizing hormone � gene by gonadotropin-releasing hor-mone requires the synergy of early growth response-1 and steroid-ogenic factor-1. J Biol Chem 274:13870–13876
51. Kaiser UB, Halvorson LM, Chen MT 2000 Sp1, steroidogenic fac-tor 1 (SF-1), and early growth response protein 1 (egr-1) bindingsites form a tripartite gonadotropin-releasing hormone responseelement in the rat luteinizing hormone-� gene promoter: an integralrole for SF-1. Mol Endocrinol 14:1235–1245
52. Rogers SL, Nabozny G, McFarland M, Pantages-Torok L, Archer J,Kalkbrenner F, Zuvela-Jelaska L, Haynes N, Jiang H, Four muta-tions in the GR dimerization domain result in perinatal lethal mice.In: Nuclear Receptors: Steroid Sisters, Keystone, CO 2004, p 194(Abstract 316)
1730 Breen et al. Glucocorticoid Repression of LH� Gene Expression Mol Endocrinol, October 2012, 26(10):1716–1731
53. Heck S, Kullmann M, Gast A, Ponta H, Rahmsdorf HJ, Herrlich P,Cato AC 1994 A distinct modulating domain in glucocorticoidreceptor monomers in the repression of activity of the transcriptionfactor AP-1. EMBO J 13:4087–4095
54. Halvorson LM, Ito M, Jameson JL, Chin WW 1998 Steroidogenicfactor-1 and early growth response protein 1 act through two com-posite DNA binding sites to regulate luteinizing hormone �-subunitgene expression. J Biol Chem 273:14712–14720
55. Cates PS, Li XF, O’Byrne KT 2004 The influence of 17beta-oestra-diol on corticotrophin-releasing hormone induced suppression ofluteinising hormone pulses and the role of CRH in hypoglycaemicstress-induced suppression of pulsatile LH secretion in the femalerat. Stress 7:113–118
56. Rivier C, Rivier J, Vale W 1986 Stress-induced inhibition of repro-
ductive functions: role of endogenous corticotropin-releasing fac-tor. Science 231:607–609
57. D’Agostino J, Valadka RJ, Schwartz NB 1990 Differential effects ofin vitro glucocorticoids on luteinizing hormone and follicle-stimu-lating hormone secretion: dependence on sex of pituitary donor.Endocrinology 127:891–899
58. Yokoi T, Ohmichi M, Tasaka K, Kimura A, Kanda Y, Hayakawa J,Tahara M, Hisamoto K, Kurachi H, Murata Y 2000 Activation ofthe luteinizing hormone � promoter by gonadotropin-releasinghormone requires c-Jun NH2-terminal protein kinase. J Biol Chem275:21639–21647
59. Kotitschke A, Sadie-Van Gijsen H, Avenant C, Fernandes S, Hap-good JP 2009 Genomic and nongenomic cross talk between thegonadotropin-releasing hormone receptor and glucocorticoid re-ceptor signaling pathways. Mol Endocrinol 23:1726–1745
Mol Endocrinol, October 2012, 26(10):1716–1731 mend.endojournals.org 1731
