Chapter 9
Mapping and characterizing whole genomes
• Structural Genomics• Functional genomics
How many genes has a human?
27,000
5,500
Interpretation of genomicinformation:
high throughputtechnologies are used to getideas about gene (orgenomic) function.
Structural and functional genomics:a hierarchical representation
Structural Genomics.The analysis of the physical structure of genomes.
Mapping Genomes
Cytogenetic and Genetic maps were very helpful forsequencing genomes.
Cytogenetic maps are established by correlating chromosomallandmarks with phenotyps. The correlation with the location ofcloned DNA can result in high resolution maps.
Chromosome painting by in situ hybridisation using different-labelled probes.
A B
a b
A B a b
a bX
A B
A = rote Blüte, B = hohe Pflanze
F1:
Genetische Karten
A B
a b
a b
a bX
Genetische Karten 1: die Phänotypen der Allele der GeneA und B werden betrachtet
A B
a ba b
a b
parental:
Die Gene A und Bsind mit 10 cMgekoppelt,Analyse durch Auswertung derPhänotypen
rekombinant:A b
a ba B
a b
90
10
A B
a b
a b
a bX
Genetische Karten 2: der Phänotyp der Allele von A undder DNA-Polymorphismus in Position B werden betrachtet
A B
a ba b
a b
parental:
rekombinant:
A b
a B
90
10
Phänotyp DNA in B
A/a
a/a
A/a
a/a
B/b b/b
b/b B/b
A B
a b
a b
a bX
Genetische Karten 3: die DNA-Polymorphismen in denPositionen A und B werden betrachtet
A B
a ba b
a b
parental:
rekombinant:
A b
a B
90
10
DNA in A DNA in B
B/b b/bA/a a/a
b/b B/bA/a a/a
High resolution genetic maps: making use of meiotic recombination
a) Restriction fragment lenght polymorphism maps (RFLP maps)
neutral DNA sequence variation is used
A probe P detects a DNA polymorphism when the genomic DNA is cut by acertain restriction enzyme (RE). The pedigree of the dominant diseasephenotype D shows linkage of the D locus to the RFLP locus; only child 8is a recombinant.
preparation of the probe
Obtaining a DNA fingerprint by using VNTR (variable numbertandem repeats) probe. VNTRs are also called minisatellite DNA.VNTRs consist of a variable number of a repeating unit which isabout 15 to 100 bp in length.
In this example, a Southern blot is used for detection. Now replaced by PCR
DNA fingerprints
are used in forensic medicine. Minute DNAamounts isolated for example from bloodare used by amplifying specific VNTRsequences with PCR.
VNTRs can be used for genetic mapping. The molecular markers can bemapped to one another or to a locus with a known phenotype.
Microsatellite Markers
Microsatellites is a class of repetitive DNA that is based on di- andtrinucleotide repeats that are highly variable between individuals. Thesesimple-sequence length polymorphisms (SSLPs) are also used for geneticmapping.(VNTRs are also classified as SSLPs).
(CA)n(GT)n
Primer 1
Primer 2
5'5'
Microsatellites as molecular markers for mapping.
Microsatellites as molecular markers for mapping.
High resolution genetic maps
b) Simple sequence length polymorphisms (SSLPs)
RFLP markers have first been used in molecular mapping projects. Theyare now replaced by markers based on the variation of short tandem
repeats.
• Tandemly repeated• Variable numbers of repeats, give different size restriction fragments
detected on Southern blots• Simple sequence length polymorphisms (SSLPs)
– e.g., TGACGTATGACGTATGACGTATGACGTA– mutations give rise to large number of alleles– higher proportion of heterozygotes– two types in genomics
• minisatellite (VNTRs)• microsatellite
• Minisatellites– based on variation of number of tandem repeats
(VNTRs) which segregate as alleles– in humans, repeat unit is 15-100 nucleotides, for total
of 1-5 kb– if number of repeats is variable, Southern blot will
show numerous bands– basis of DNA fingerprinting and can be used in
mapping• Microsatellites
– sequences dispersed throughout the genome– variable numbers of di- or trinucleotide repeats– detected by PCR
There are several more molecular mapping techniques existing
Physical Mapping of Genomes
Long chromosomal fragments (~ 150 kb) can be cloned into BAC vectorsand a genomic librqary can be established.
Individual BAC clones are alligned in order to cover wholechromosomes. These BAC contigs are one possible starting materialfor genome sequencing projects.
(An example from the yeast genome is presented in the next figure.)
heterochromatin
centromer
chromosome
Genome projects
After alignement of the BAC clones, each BAC is sequenced by shotgunsequencing: DNA fragments of 1 - 2 kb are generated, sequenced from bothends, and aligned by sequence comparisons.
An alternative is to omitt the BAC clones and to start shotgun sequencingdirectly with the genomic DNA.
A bacterial genome
Arabidopsis thaliana genome sequence
The Arabidopsis genome initiative, Nature408, 796-815 (2000)
Lin et al, Nature 402, 761-768 (1999)
Proportion of predicted genes in functional categoriesAbout 25,000 genes have been predicted
The Arabidopsis genome initiative, Nature 408, 796-815 (2000)
Segmentally duplicated regions in the Arabidopsis genome.The Arabidopsis genome initiative, Nature 408, 796-815 (2000)
Functional genomics
• Study of expression and interaction of gene products• Requires new vocabulary and techniques
– transcriptome: all DNA transcripts• may be monitored by use of DNA chips
– proteome: all encoded proteins• complicated by alternative splicing
– interactome: all interactions between all categories ofmolecules
• detected by two-hybrid system and relatedprocedures
– phenome: phenotype of each gene knockout
Functional genomics
• The study of transcriptional regulation by using DNA chips• The study of proteins by using 2D gels and mass spectroscopy• The study of metabolites by using chromatographic separation and mass
spectroscopy
The analysis of cells, tissues, and organisms can occur on differentlevels of gene expression
DNA
RNA
Protein
Metabolite
Genome
Transcriptome
Proteome
Metabolome
Transcriptome analysisba using microarrays (DNA chips)
Display of gene expression patterns detected bymicroarrays.
Each row is a different gene and each column adifferent time point. Red means active; greeninactive.
Caterpillar and butterfly of the same species
Lottspeich, Angewandte Chemie, 1999
Proteome
Arabidopsis proteins separated on a 2D PAGE; provided by Angelika GörgFirst Dimension: 3-10 IPG
isoelectric focusingSDS PAGE
++
samplegrating
UV or IR laser
TOF detector
MALDI-TOF analysis of proteins
Lipophilic phase of Arabidopsis leaves analysed by GC/MS; ~ 160 metabolitescan be distiguished.
Metabolite profiling by GC/MS. Base peak intensity GC/MS chromatogram of the polarfraction of a leaf extract from the Arabidopsis dgd1 mutant (A). Target metabolites areidentified by exact retention times and their corresponding mass spectra (B) as shownfor the co-eluting peaks of malate, -aminobutyric acid (GABA), and an unidentifiedcompound. m/z, Ratio of mass to charge.
Scheme showing how the integration of results from differenttechnological levels of functional genomics leads to construction of a
virtual plant
Functional Genomics