1

STRUCTURAL INSIGHTS INTO THE MECHANISM OF THE ALLOSTERIC

TRANSITIONS OF THE MYCOBACTERIUM TUBERCULOSIS cAMP RECEPTOR PROTEIN

Manchi C. M. Reddy¶, Satheesh K. Palaninathan¶, John B. Bruning¶, Cory Thurman, Danielle Smith

and James C. Sacchettini*

Department of Biochemistry & Biophysics, Texas A&M University, College Station, TX 77843, USA

Running title: Regulation of the Mycobacterium tuberculosis cAMP Receptor Protein

*Address correspondence to: James C. Sacchettini, Department of Biochemistry and Biophysics, Texas A&M University, College Station, Texas 77843, Tel: 979-862-7636, Fax: 979-862-7638,

Email: sacchett@tamu.edu

The cyclic AMP receptor protein (CRP) from Mycobacterium tuberculosis is a cAMP-responsive global transcriptional regulator, responsible for the regulation of a multitude of diverse proteins. We have determined the crystal structures of the CRP-cAMP and CRP-N6-cAMP derivative bound forms of the enzyme to 2.2 and 2.3 Å resolution, respectively, in order to investigate cAMP mediated conformational and structural changes. The allosteric switch from the open, inactive conformation to the closed, active conformation begins with a number of changes in the ligand binding cavity upon cAMP binding. These subtle structural changes and numerous non-bonding interactions between cAMP, the N-domain residues and the C-domain helices demonstrate that the N-domain hairpin loop acts as a structural mediator of the allosteric switch. Based on the CRP-N6-cAMP crystal structure, binding of N6-cAMP with a bulkier methyl-phenyl-ethyl extension from the N6 atom, also stabilizes the cAMP-binding domain, N-domain hairpin and C-terminal domain in a similar manner as that of the CRP-cAMP structure, maintaining structural integrity within the subunits. However, the bulkier N6 extension of N6-cAMP (in R conformation) is accommodated only in subunit A with minor changes whereas in subunit B, N6 extension is in S conformation hindering with the hinge region of the central helix. As a

result, the entire N-domain and the C-domain of subunit B integrated by the cAMP portion of this ligand, together tilt away (~7˚ tilt) from central helix C, positioning the helix-turn-helix (HTH) motif in an unfavorable position for the DNA substrate, asymmetrically. Together these crystal structures demonstrate the mechanism of action of the cAMP molecule and its role in integrating the active CRP structure.

Mycobacterium tuberculosis (Mtb) is

thought to enter a latent phase (1) in order to survive hostile environments, including starvation and hypoxia (2). During times of duress, transcriptional regulators belonging to the CRP/FNR family respond to a broad spectrum of intracellular and exogenous signals associated with low oxygen stress and starvation, modulating the expression of various metabolic genes in many facultative or strictly anaerobic bacteria (3,4). In

Escherichia coli (E. coli), CRP controls the expression of over 100 genes in response to changes in the intracellular concentration of cAMP (5). CRP is activated by the binding of cAMP (3,5’-cyclic adenosine monophosphate) and subsequently becomes an active transcriptional regulator upon cAMP binding by means of allosteric structural changes (6-10). Several essential genes are upregulated during intracellular growth in macrophages (11), suggesting that cAMP signaling may be important to M.

tuberculosis during its interaction with the host.

http://www.jbc.org/cgi/doi/10.1074/jbc.M109.041343The latest version is at JBC Papers in Press. Published on September 9, 2009 as Manuscript M109.041343

Copyright 2009 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

2

Indeed, Rv3676 (Mtb-CRP), the CRP homolog in M.tuberculosis H37Rv, is a cAMP-responsive transcription factor (12-14). Deletion of Rv3676

results in impaired growth in laboratory medium, in bone marrow-derived macrophages, and in TB grown in a mouse model system (13). These observations suggest that Mtb-CRP plays a critical role in Mtb survival, especially in macrophages

Several models have been offered as possible explanations for how the sensory module can transmit the signal to the distant DNA binding domain. (9,15-17). Perhaps the most intriguing question about the CRP family is how ligand binding within the effector domain can influence the properties of the DNA binding domain. Answers to this question remain elusive, in part because the only CRP crystal structure available for Mtb is that of the cAMP-free form (18) The Mtb-CRP apo structure displayed asymmetry between the subunits as compared to the E. coli CRP-cAMP crystal structure, which shares only a 32% sequence identity with Mtb-CRP. Although the asymmetry observed in the apo Mtb-CRP crystal (18) has been interpreted as an important factor in its mechanism, NMR studies in solution could not find any evidence of structural asymmetry in either the E. coli apo CRP or the cAMP-CRP (19-21). In contrast, recent NMR studies (22) reported cAMP binding resulting in a coil to helix transition that extends the coil-coil dimerization and functions as a regulatory switch. Nevertheless, the allosteric mechanism by which ligand binding induces a conformational transition remains elusive from the same organism and atomic level structural comparisons are needed to fully understand the transition.

Although there is mounting evidence to suggest that the E. coli CRP undergoes allosteric conformational changes upon cAMP binding from a variety of spectroscopic and biochemical techniques (23-26), little is known about the nature of the conformational change to the allosterically activated conformation in Mtb-CRP. Wild-type CRP is activated by cAMP only, although it can bind other cyclic nucleotides with comparable affinity (27). Ligands such as cGMP and cIMP, which are structurally similar to cAMP, fail to activate transcription (28) In E. coli chemical modifications of cAMP that retain function have provided important clues concerning the allosteric mechanism of action. Experiments with cAMP

analogs have shown that the 2'OH-, 3'O-, and 5'O- groups, the overall negative charge, and the N-6 amino group cannot be modified without losing biological activity in vivo, while the N-1 and N-7 groups of adenine are not essential (29) (Ebright et al. (1985) (30) reported analogs of cAMP with bulky additions at C2 and N6 which bind CRP and induce a conformational change, but do not induce transcription. Moreover, it has also been suggested that the binding of the CRP-cAMP complex to DNA introduces distinct alterations in the CRP structure in proximity to the N6 moiety of the bound cAMP molecule. To further investigate this phenomenon, one of the N6-modified cAMP analogs (N6-(1-Methyl-2-phenylethyl)adenosine-3-5-cyclic monophosphate, here after N6-cAMP) reported by Ebright et al. (30) was employed as a non-functional analogue of cAMP to investigate the differential effects of allosteric transitions. While N6 modification of the cAMP ligand has lead to information regarding CRP activation in E.

coli, no atomic level structures of these substituted ligands are available.

We present here two crystallographic structures: that of Mtb-CRP bound to cAMP and that of Mtb-CRP bound to an N6-cAMP ligand. Determination of both the CRP-cAMP and CRP -N6-cAMP structures has enabled us to explore various allosteric models, giving more detailed insight into the allosteric behavior of this transcriptional regulator. Our structures of the cAMP and N6-cAMP bound CRP allow for the first comparison of apo CRP to cAMP and inhibitor-bound CRP within the same species. Crystallographic analysis of these structures has lead to a model in which the Mtb CRP exists as a symmetric dimer, in which both subunits exist in an open form. Furthermore, our structures implicate a model for the allosteric switch from the inactive apo form to the active cAMP-bound form. Our model implies that binding of cAMP triggers alterations in the cAMP contacting residues and shifts the N-terminal domain, consequently allowing the DNA binding domain to accept DNA. The structural basis of our CRP inhibitor is based upon abrogation of dimer interactions and a concomitant helix unwinding at the interface of one of the subunits. Ultimately, these results will aid in understanding the regulation mechanisms controlling the expression

of the corresponding CRP-regulated genes at a

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

3

level that enables guided inhibition and antibiotic design. EXPERIMENTAL PROCEDURES

The cAMP was obtained from SIGMA Chemicals and N6-cAMP (N6-(1-Methyl-2-phenylethyl)adenosine-3-5-cyclic monophosphate) from BIOLOG Life Science Institute, Germany. A Hi-Trap Ni2+ chelating column from Pharmacia was used for protein purification. Crystal screen solutions from Hampton Research and Emerald Biosciences were used for obtaining CRP crystals.

Mtb-CRP cloning, expression and purification: A 675 bp DNA fragment containing the

CRP gene (Rv3676c) was amplified by polymerase chain reaction (PCR) from M. tuberculosis H37Rv genomic DNA as the template, using the following oligonucleotides as the forward and reverse primers,respectively:5’AGATGAAGCCATATGGACGAGATCCTGGCCAGGGCAGGA-3’ 5’- AGA GTA AGC TTA CCT CGC TCG GCG GGC CAG TCT-3’. The amplified DNA fragment was digested with NdeI and HindIII and cloned into the corresponding restriction sites in the pET28b vector (Novagen) to generate a recombinant vector containing a 5' sequence encoding a 20 amino acid N-terminal His tag and a TEV-cleavage site. The CRP-pET28b vector was transformed into E. coli BL21 (DE3) cells by heat shock transformation. The transformed cells were grown to mid log exponential phase at 37 °C in Luria Broth (LB) media containing 50 µg/ml kanamycin. Expression of CRP was induced with 1 mM isopropyl-1-thio-β-D-galactopyranoside (IPTG), and cells were harvested. 12 hours after induction ar 25 °C.

The harvested cell pellet was resuspended in Buffer C (20 mM Tris-HCl pH 8.0, 10 mM imidazole, 0.5 M NaCl and 10% glycerol) with 1 mM PMSF (phenylmethanesulphonylfluoride or phenylmethylsulphonyl fluoride) and Complete™ EDTA-free protease inhibitor cocktail (Roche). The cells were disrupted by two passages through a cooled French pressure cell. The resulting cell extract was centrifuged at 15,000 rpm at 25 °C for 1 h (the protein precipitates at 4 °C). The cleared supernatant was loaded on to a Hi-Trap Ni2+ chelating column (Pharmacia Biosciences) and washed with 300 mL Buffer A containing 20 mM

Tris-HCl pH 7.5, 75mM imidazole, 0.5 M NaCl, and 5% glycerol. His-tagged CRP was eluted with a 150 mL linear gradient of 100-500 mM imidazole in 20 mM Tris-HCl, pH 7.5 and 0.5 M NaCl.

The TEV tag was then removed by incubation with TEV protease (1:50 ratio) at room temperature while dialyzing to remove imidazole. The TEV and tag were then separated from Mtb-CRP by passing the dialyzed sample through another nickel affinity chromatography cartridge. Purified Mtb-CRP was dialyzed for the second time in the presence of 20 mM Tris-HCl (pH 7.5), 50 mM NaCl, 5% glycerol, and 1 mM dithiothreitol at room temperature. After purification to near homogeneity by size exclusion chromatography on a Superdex S-200 column (Pharmacia Biosciences), CRP was dialyzed against 20 mM Tris-HCl (pH 7.5), 50 mM NaCl, 5% glycerol, and 1 mM dithiothreitol at room temperature. Purified recombinant protein was concentrated to 20 mg/ml. The protein was more than 95% pure as observed by SDS-PAGE.

The pET28b-CRP plasmid was transformed into

E. coli B834 (DE3) (Novagen) Met auxotroph strain. Cells were grown in LB media to an optical density of 0.6. Cells were pelleted by centrifugation, washed with 20 mM Tris pH 7.5 and resuspended in M9 minimal medium lacking L-Met.SeMet (Selenomethionine) was then added to a final concentration of 0.05 µg/mL along with 50 µg/mL kanamycin. Cultures were then induced with 1mM isopropyl-beta-D-thiogalactopyranoside IPTG) followed by incubation for 8 h at 25 °C. The protein was purified using the same method described for the native protein.

Crystallization and data collection: Crystallization screening was carried out

with CRP-cAMP as well as CRP-N6-cAMP pre-incubated with 2.5 mM of each ligand for 2 h at 25 °C. Initial CRP-cAMP hits were optimized and diffraction quality crystals were obtained at 25 °C when 4 µL (2 µL protein:2 µL reservoir solution) drops were equilibrated against 500 µL of well solution containing 1 M sodium citrate, 100 mM CHES pH 9.5 using a hanging drop vapor diffusion setup. The binary CRP:N6-cAMP derivative complexes crystallized in 0.4 M

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

4

NaH2P04/1.6 M K2HPO4, 0.1 M imidazole pH 8.0 , 0.2 M NaCl2. Diffraction quality crystals were obtained after 3-4 days. The crystal data is presented in table 1. Structure determination, model building and refinement: The, experimental phases from the SeMet incorporated CRP-cAMP crystal were obtained using SAD phasing (Table 1). The SeMet crp-cAMP crystal diffracted to a resolution of 2.2 Å at APS-23ID Advanced Photon Source, Argonne National Laboratory. Twelve selenium sites were found using SHELXD (31). SOLVE/RESOLVE (32) were used to refine the sites, calculate the initial protein phases, and build the model. Further phase improvement with solvent flattening in AUTOSHARP (33) resulted in high-quality density-modified maps that showed clear electron density. A final model was obtained after several cycles of manual model building using XTALVIEW (34)Water molecules were manually added during iterative cycles of model building and refinement using an Fo-Fc map.

Diffraction data from CRP complexed with cAMP were nearly isomorphous to the SeMet CRP crystal model. Bias minimized electron density maps were obtained using the Shake & Warp (SNW) protocol (35). Clear electron density for cAMP was visible in the SNW map prior to any model building. Several cycles of manual model building and NCS restrained maximum likelihood refinement in REFMAC5 (36) were performed until R-factors converged. (Table 1) for the CRP-cAMP complex. The data set for CRP-N6-cAMP was collected at 2.3 Å resolution at APS-23ID Advanced Photon Source, Argonne National Laboratory. The structures of the CRP-N6-cAMP complex were determined by refining the CRP-cAMP model against the data for the complex. cAMP and cAMP-analog were clearly defined in an Fo–Fc electron density mapcontoured at 3 σ and manually fitted. The final refinement statistics are given in Table 1. The CRP-cAMP and N6-cAMP bound structures were geometrically validated using Molprobity (37).

Electrophoretic mobility shift assay (EMSA): A DNA gel shift assay was used to probe

CRP ligand binding. We selected the binding site upstream of Mtb SerC-Phosphoserine

aminotransferase (Rv0884), which is putatively regulated by CRP as identified previously (14). Complementary synthetic double-stranded 28-mer DNA oligonucleotide (CTTGCATGTGAGCTTGTTCACACTACGC) present upstream of Rv0884 (SerC) were end-labeled with [Y-32P) ATP using T4 polynucletide kinase. Two nanomolar of labeled oligonuleotides were incubated with 50 nM Mtb-CRP recombinant protein in 20 µl CRP binding buffer (10 mM Tris–HCl, pH 8.0, 50 mM KCl, 25 mM MgCl2, 1 mM EDTA, 55 µg/mL bovine serum albumin, 1 mM dithiothreitol, 0.05% NP-40, 1 µg nonspecific competitor DNA poly(dI-dC) (Amersham Pharmacia Biotech) containing (75 and 150) µM freshly made cAMP or N6-cAMP for 30 min at 23 °C. After incubation, 3 µl loading buffer (CRP binding buffer containing 50% glycerol and 0.1 mg/mL bromophenol blue) was added and samples were immediately loaded on 5% polyacrylamide gels and run at 6–8 V/cm at 23 °C for 90 min. Following electrophoresis, the CRP–DNA complexes were detected by autoradiography or exposure to phosphor imager storage screens.

RESULTS AND DISCUSSION

The x-ray crystal structure of the Mtb-CRP-cAMP binary complex was solved using the SAD method (32) with co-crystals of selenomethionylated protein in the space group P21 at 2.2 Å resolution. Data collection and refinement statistics are summarized in Table 1. The asymmetric unit (ASU) of the Mtb-CRP-cAMP complex structure contains two dimers, denoted as AB and CD, in which three N-terminal regions of the subunits take on different conformations (Figures 1a and supplementary figure 1a). Each of these subunits contained one cAMP molecule in anti conformation (Figure 1). The overall fold and dimer organization of the binary complex resembles that of the previously published apo Mtb-CRP and E. coli CRP structures. Each subunit of the dimer is composed of an N-terminal cAMP binding domain (residues 1-114), a C-terminal DNA binding domain (146-223) and a hinge region defined by a long helix (residues 117-144 form most of the intersubunit interactions) which connects the N-terminal and C-terminal domains; a hairpin

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

5

structure of the N- terminal domain (β4-β5 hairpin, residues 54-73) is also defined in Figure 1 which directly interacts with the C-domain helices (vide infra). All subunits of the binary complex structure contain three additional short helices in the N-terminal domain which are not present in E.

coli CRP, similar to the apo Mtb-CRP structure. To adopt the standard nomenclature the new helices were labeled as helix N1, N2, and N3. The two conserved N-terminal helices are called helices A and B, the long central helix is called helix C, the adjacent helix is D, the two helices in the helix turn helix (HTH) DNA binding region are E and F, and the most C-terminal helix is G (Figure 1a, 1b and supplementary figure 1a). The presence of two independent dimers in the crystallographic asymmetric unit of the Mtb-CRP-cAMP binary complex structure was not anticipated as the apo Mtb-CRP contained only one dimer per ASU (18). The majority of the CRP structures reported to date either contained one CRP subunit per ASU (the dimer is formed through crystallographic symmetry) (38) or one CRP dimer per ASU (39). However, in the present structure, the AB and CD dimers showed high structural similarity with only a few differences as shown in Figure 1a. The R.M.S.D. difference in the Cα coordinates between subunit A of the AB dimer and subunit C of the CD dimer is only 0.41 Å; for 193 Cα atoms (0.71 Å for subunit A Vs D), and between subunit B of the AB dimer and subunit D of the CD dimer is 0.61 Å; for 210 Cα atoms (0.71 Å for B vs C). As shown by the superimposition of the individual subunits in Supplementary figure 1a, the most significant differences appear at the flexible N-terminal helices N1, A and B. In fact, within this region, residues 21-26 of subunit A, 22-25 of subunit B, 1-17 of subunit C, and 13-14 of subunit D are completely disordered. Apart from the N-terminal region, the surface exposed N-domain hairpin loop shows some noticeable flexibility in subunits A, C, and D as seen by the slightly different conformations with respect to each other (Figure 1a and Supplementary figure 1a); residues 60-66 of this region in subunit B are disordered. These differences, however, do not affect the structural integrity of the rest of the subunit. Therefore, the AB and CD dimers are not discussed independently here and the CD dimer is mostly used for the discussion and comparison with the

apo Mtb-CRP structure, as the N-domain hairpin loop region of B subunit is disordered.

The cAMP binding pocket Each subunit of the Mtb-CRP-cAMP

binary complex structure contained one cAMP molecule, in an anti conformation (Figures 1c and 2). The anti conformation of the cAMP in Mtb-CRP is consistent with the previously published E.

coli CRP-cAMP crystal structures (39) The cAMP binding pocket of Mtb-CRP is located in the N-terminal domain interacting with the short helix N3 region, the N-domain hairpin loop (β4-β5) and the long helix C, (Figure 2). The conformation of the binding pocket residues and cAMP in all subunits are similar (Supplementary figure 1b); therefore only subunit D is used for distance calculations unless specified. In each subunit, the hydrophobic interactions from the residues of the N-domain region play a dominant role in binding cAMP to Mtb-CRP; residues Phe38, Phe78, Leu81, Gly79, and Ile57 pack against the ribose ring and Met72, Leu69, and Thr70 interact with the adenine ring of the cAMP (all residues lie within at least 4.0 Å from cAMP) as seen in Figure 2. In addition, Arg130 of helix C runs parallel to the plane of the adenine ring of cAMP (3.5 Å from the C2 atom of the ligand), forming additional hydrophobic interactions. This conformation of Arg130 appears to be critical in placing the side chains of Met77, Phe78, Met72, and E80 residues of the N3 helix region of the cAMP binding pocket. Both the NH1 and NH2 atoms of Arg130 form hydrogen bonds with the carbonyl oxygen atom of M77 (at 3.0 and 2.8 Å distances) and the NH1 atom of Arg130 forms hydrogen bonds with both OE1 and OE2 atoms of Glu80 (at 2.8 and 3.2 Å distances). In addition, the CZ atom of Arg130 is at 3.7 Å from the Met72 CE atom. As a result, the OE1 and OE2 atoms of E80 face towards the sugar of cAMP at hydrogen bonding distances (2.6 and 3.3 Å). The O2’ atom of cAMP also makes hydrogen bond with the back bone amide nitrogen atom of the nearby residue Gly79 at a distance of 2.9 Å while the O3’ hydrogen bonds with the back bone nitrogen of Leu81. The carbonyl oxygen atom of Gly79 hydrogen bonds with a second arginine residue (Arg89) of the cAMP binding pocket at a distance of 2.8 Å and Arg89 makes hydrogen bond with the axial phosphate oxygen atom of cAMP hydrogen

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

6

(at 3.0 Å distance). The axial phosphate oxygen atom also hydrogen bonds with Ser82 OG (2.6 Å) and the backbone nitrogen atom of Ser82 of helix N3 (3.0 Å) while the equatorial phosphate oxygen atom of cAMP hydrogen bonds with the back bone nitrogen atom of Thr90 (2.7 Å). Taken together, Arg130, the residues of the N3 helix region (Met77, Phe78, Gly79, Glu80, Leu81, Ser82), as well as the Arg89 and Thr90 residues enclose the sugar moiety of cAMP through hydrophobic and hydrogen bond interactions. Due to this packing, the N3 helix and the adjacent loop region stabilize the sugar moiety while the residues from the adjacent hairpin (the N-domain hairpin connected to the short helix N3 loop), Leu69, Thr70, Met72 of β5, and Ile57 of β4, interact with the base of cAMP.

Two threonine residues interact with cAMP: one near the N6 atom of the base of cAMP (Thr134) and the other near the equatorial phosphate oxygen atom (Thr90). The hydroxyl groups of Thr134 of helix C hydrogen bond with the N6-amino group of cAMP (at 2.9 Å). Interestingly, two side chain conformations are equally possible for T90, it can either place its OG atom close to the equatorial phosphate atom of cAMP to form a hydrogen bond or its CG atom can form hydrophobic interactions with C3’ (3.5 Å), C5’ (3.5 Å), and C8 (3.2 Å) of cAMP (Supplementary Figure 1b, superposition of cAMP binding pockets of all subunits). In the hydrogen bonding networks, the OG of Thr90 hydrogen bonds with the phosphate oxygen atom of cAMP as well as Ser91 OG (3.1 Å). As a result, Ser91 OG is forced away from O4’ of cAMP (4 Å) and the CB of Ser91 compensates through hydrophobic interactions with C5’ (3.7 Å). In the case of the hydrophobic interaction of Thr90, the CG atom is found close to the phosphate oxygen atom (3.2 Å), forming hydrophobic interactions with C3’ (3.5 Å), C5’ (3.5 Å), and C8 (3.2 Å) of cAMP; as a result, the side chain of Ser91 is oriented towards O4’ to form a new hydrogen bond at 3.1 Å. It is possible that this interplay between Thr90 and Ser91 plays a role in adopting minor conformational changes of cAMP. All other protomer residues, with the exception of Thr90 and Ser91, adopt similar conformations across all the subunits of the asymmetric unit and form similar interactions with the cAMP binding pocket.

In addition to these intrasubunit interactions, the residue Asn135’ of helix C’ of the neighboring subunit forms two direct hydrogen bonds with the N6 and N7 atom of the base of cAMP (ND2 of Asn135 is 2.9 Å from the N7 atom of cAMP and OD1 of Asn135 is 3.0 Å from the N6 atom of cAMP). The residue Leu131’ of the helix C’ of the neighboring subunit also makes hydrophobic interactions with the base of cAMP at a distance of 4.3 Å. Asymmetry/symmetry in the Mtb-CRP dimer: comparison of apo and cAMP bound structures

The apo Mtb-CRP crystal structure demonstrates a pronounced asymmetry between the subunits within the dimer (18) This suggests that one subunit of the apo protein is in an off state while the other adopts the typical on state. More importantly, based on the solution structure E. coli CRP, it has also been proposed that the allosteric switch from apo to cAMP bound follows a mechanism in which the hinge region of the long helix C in the apo structure unwinds in both the subunits (near the hinge region close to N6 atom of the adenine moiety of cAMP), giving rise to an off state conformation for the HTH helices of both the subunits. In order to evaluate the proposed on and off state mechanism of the Mtb CRP structure further, we carried out a detailed comparison between the subunits of apo Mtb-CRP and Mtb-CRP-cAMP dimers.

The Mtb-CRP-cAMP binary complex structure reveals that there is no obvious asymmetry within the dimer, in contrast to the apo Mtb-CRP structure. This is illustrated in Figure 1b showing the superimposition of the individual subunits. Subunit A of the present structure superimposes on subunit B with an R.M.S.D. of 0.66 Å (193 Cα atoms compared), on subunit C of the CD dimer with an R.M.S.D. of 0.44 Å and on subunit D with 0.76 Å. Similarly, subunit A of Mtb-CRP-cAMP superposes on the subunit A of apo Mtb-CRP structure with an R.M.S.D. of only 0.70 Å (same 193 Cα atoms compared). However, for the same number of Cα atoms, subunit A of cAMP bound Mtb-CRP showed a R.M.S.D. of 3.60 Å with subunit B of the apo CRP structure, indicating that all the subunits including subunit A of the apo structure belong to one conformation, with the exception of subunit B of the apo structure. We investigated three types of

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

7

superimpositions for further analysis: apo dimer on cAMP-bound dimers (Figure 3a), apo subunits on cAMP-bound subunits (Figure 3b), and individual domains of subunit B of apo on subunit A of the cAMP-bound structure (Figure 3c). The superimpositions further confirmed that all subunits belong to one structural conformation with the exception of apo subunit B. The apo CRP subunit B, which stands out among all the subunits, displays several conformational differences in the C-terminal domain of the protomer, particularly in the DNA binding region (Figures 3), assuming the off state structure of Mtb-CRP (Figure 3d). The minor conformational changes observed in the HTH region for the rest of the subunits are insignificant compared to subunit B of the apo structure. This is consistent with the previously reported cAMP-bound (39) or cAMP-DNA bound structures (40) which typically show flexibility in this region (Supplementary figure 2).

The native state conformation of E. coli apo CRP in solution may be defined by both the subunits in a symmetric, open conformation in contrast to the apo Mtb crystal structure. Is it possible that the asymmetry in the apo Mtb crystal structure is caused by a crystallization condition? It is still not clear how apo Mtb-CRP can precisely coordinate asymmetry between the subunits, or whether the asymmetry hypothesis based on the apo CRP is valid in solution. It has been argued based on the apo Mtb structure (18) that the possibility of steric hindrance in the hinge region (between the long helices C, D, and F), particularly around Arg149, leads to the asymmetry between the subunits. While the second subunit should undergo some local conformational changes with respect to the conformation of its closely interacting partner subunit, it is unlikely for the off state subunit to influence the overall fold of the neighboring subunit. Perhaps, the off state conformation of Arg149 can be accommodated either through the flexible nature of this amino acid or through some conformational changes around the hinge region. In fact, the solution structure of apo E. Coli CRP (22) suggest that C helix unwinds, forming a coil conformation near this hinge region, symmetrically accommodating two off state subunits within the dimer. However, in the apo Mtb-CRP structure, the long helix C does not undergo a helix coil transition in any of the

subunits (Figures 1 and 3). It is possible that, in the absence of cAMP, CRP can adopt two low energy states (one on state and one off state), and due to the crystal packing one subunit adopted the on state conformation while the other, due to lack of cAMP, adopted the off state. Perhaps, due to this asymmetry and additional interactions, the helix C does not undergo a conformational change to become coiled in the crystal packing environment. If this is the case, one cAMP bound on state subunit might trigger conformational changes in the neighboring subunit, even in solution. In addition, the apo CRP structure from Thermus. thermophilus (PDB ID: 2ZCW, To be published) shows higher similarity to subunit B of the apo Mtb structure (R.M.S.D. 2.40 Ǻ versus 3.70 Ǻ to subunit A) implying that it has crystallized in the closed form. As with the Mtb structure, in solution the T. thermophilus CRP may be sampling various low energy conformations, and is finally locked into a closed conformation by crystal contacts. Following this model, the CRP apo structure would be very flexible and, perhaps disordered in many regions, as it samples multiple, low energy conformations in solution, and is locked into a rigid and less flexible closed conformation upon CRP binding. Thus, like the E.

coli CRP, Mtb-CRP might also form a symmetric off state dimer. The binding of cAMP switches Mtb-CRP from off state to on state: Comparison between the apo Mtb-CRP and Mtb-CRP-cAMP structures

In order to investigate how cAMP binding to the N-terminal domain influences the DNA binding HTH motifs of the C-terminal domain, both the subunits of the apo structure were superimposed on subunit D of cAMP-bound structure using the long C helix as common point of reference (Figure 4). Helix C was selected as a common point of reference to represent the relative positioning of the subunits within the dimer and to minimize the superimposition bias towards the structural similarity of the N-terminal domains. As shown in Figures 3 and 4, subunit A of the apo structure showed only minor differences compared to the cAMP-bound structure (colored magenta and blue in Figures 3 and 4), in contrast to subunit B of the apo structure (shown in pale red). Taken together, it is very clear that the cAMP-bound structure curtails the asymmetry

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

8

observed within the dimer of the apo CRP structure and pushes the HTH regions of both the subunits in to an almost identical active state, preparing the dimer for DNA binding.

A long standing question has been whether or not cAMP binding alone can signal the switch from off to on state. Although this cannot be answered fully without the CRP-cAMP-DNA ternary complex structure from the same organism, it is clear from the previous structures of E. coli CRP-cAMP and E. coli CRP-cAMP-DNA that the subunits undergo only small adjustments upon DNA binding after cAMP is bound (see Supplementary figure 2 and 3 for the overlay). The relative position and orientation of helix F of the HTH motif within the dimer seems to be critical for DNA binding to CRP. An overlay of Mtb-CRP-cAMP on top of E. coli CRP-cAMP-DNA suggests that helix F of Mtb-CRP of both the subunits is symmetrically placed in an optimum position and orientation, at a distance of ~38 Å from each other and roughly aligned with the E.

coli CRP HTH motif, suggesting that it can fit in to the major grooves of the DNA substrate (Supplementary figure 3). Consequently, the side chains of residues Asp174, Thr176, Gln177, Glu178, Arg188, Glu189 (disordered), Asn192, Lys193 (disordered), His200, Glu207, and Lys209 of the HTH region are surface exposed, suggesting they may be involved in the CRP-DNA binding interactions and therefore may need to undergo only slight conformational adjustments. The subunits of Mtb-CRP-cAMP dimer both adopt the active conformation placing their HTH motifs symmetrically accessible to the DNA substrate. Thus, we propose that cAMP binding alone is sufficient to create an on state like conformation.

These structural comparisons also enabled us to provide a structural basis for the transition of off state to on state upon binding of cAMP. The off state subunit, subunit B of the apo Mtb structure, must undergo several conformational changes upon binding of cAMP (Figures 4a and 4b) as described in detailed below. Upon the binding of cAMP, the side chain of Arg130 residue flips away from the cAMP binding pocket (the CZ atom moves by 4.8 Å while Cα is in the same position), making room for the adenine moiety of the cAMP. Additionally, the short helix and the Glu80 residue also shift away from the cAMP binding pocket (the Cα moves by 3.2 Å),

making room for the sugar moiety of the cAMP (Figure 4b). In the cAMP-bound structure, both Arg130 and Glu80 are involved in ligand binding interactions. These rearrangements also allow Ser82 to move closer to one of the phosphate oxygen atoms of cAMP (the Cα atom moves by 1.8 Å and OG moves by 2.1 Å). In the cAMP-bound structure, the entire N-domain along with the hydrophobic pocket residues (Phe38, Tyr48, Ile57, Phe78 and Ala93) move towards the central C helix to form tight packing around cAMP; the Cα atom of Phe38 moves by 7.8 Å in the on state compared to its off state, the Cα of Phe78 moves by 6.1 Å, Thr90 moves by 5.1 Å, Ile57 moves by 7.5Å, and Arg89 moves by 5.5 Å.

Our structural comparisons have also shown that the allosteric off state is defined by a structural relaxation of the secondary structure away from the central C helix. The relative positioning of the N-domain and helix C seems to be the key. This is illustrated by corresponding secondary structural elements including the β1-β8 strands of the N-terminal domain which are shifted away from the central C helix (Figures 3and 4). More importantly, the N-domain hairpin and the β6-helix-β7 region also shift away from the C-terminal domain, particularly from the smaller helix of the DNA binding HTH motif (helix E). As a result, all of the C-terminal domain helices, including the DNA binding region, form the off state conformation (Figures 3-4). Upon binding of cAMP, the entire N-terminal domain, including the N-domain hairpin-(N3 helix)-loop-β7 region, pack around the adenine and sugar moieties of cAMP (vide ante). As a result of these rearrangements, several new inter-domain interactions are established, particularly between the β5 strand of the N-domain hairpin region and helix E of the C-terminal HTH motif (Figure 4a and Supplementary figure 4). The backbone nitrogen atom of Leu68 of β5 strand forms a hydrogen bond interaction with the carbonyl oxygen atom of the Gln182 of helix E (at 3.1 Å); the side chain atoms of Leu68 are involved in the hydrophobic interactions with the carbon atoms of residues Glu179, Gln182 and Leu183 of helix E (at 3.9-4.1 Å distances). The side chain atoms of Ile71 of the β5 strand are involved in hydrophobic interactions with Leu183 of helix E (3.7 and 4.3 Å distances), with Leu175 at 3.8 Å distance, Leu157 of helix D at 4.5 Å distance, and with Phe161 at

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

9

4.1 Å distance. In addition, the side chain nitrogen atom of Lys56 of β4 strand salt forms a salt bridge with the OE2 atom of Glu179 (at 2.6 Å) and Lys54 hydrogen bonds with Asp174 (at 3.0 Å); Ile96 of the β7 strand of the N-terminal domain is involved in hydrophobic interactions with Leu175 of helix E (at 3.6 Å). These interactions together augment the stabilization of the C-domain in the active state close to the central helix C (Figure 4 and Supplementary figure 4).

The transition from the off to on state begins with ligand binding. Subsequently, this ligand binding pocket structural transition augments several inter-domain interactions, particularly between the N-domain hairpin region and the C-terminal DNA binding HTH motif region. At this stage, we see the critical role of the N-domain hairpin: it transmits the allosteric signal from cAMP binding to positioning the C-terminal DNA binding HTH motif region into the on state. Interestingly, the solution studies of apo E. coli

CRP (22) indicated that the on state may be augmented through the binding interaction near the N6 atom of the cAMP ligand, primarily through the helix-coil transition of the helix C of the hinge region. In contrast, for Mtb-CRP, as detailed above, the dominant network of non-bonding interactions with the cAMP atoms, N-terminal hydrophobic clustering, N-domain hairpin, and HTH helix region strongly suggest that the on state is primarily stabilized through the cAMP-N-domain hairpin-HTH interactions which, in turn, stabilizes the hinge region. This is further corroborated by the fact that the hinge region of helix C of Mtb-CRP is involved in only three hydrogen bonding interactions with the cAMP (through Thr134 and Asn135’) compared to numerous N-domain interactions. Perhaps both events happen simultaneously, affecting each other. The close proximity of the N-domain hairpin and helix C also suggest a possible connection between the hinge region and the N-domain (Figures 1 and 3). In the Mtb-CRP-cAMP bound structure, the loop region of the N-domain hairpin showed marked flexibility, adopting slightly different conformations near the C helix. In one conformation, Pro62, located at the tip of this loop, and is stacked close to Phe143’ of the C helix of the neighboring subunit (at a 3.8 Å distance). In another subunit, this loop moves

away from the C helix of the neighboring subunit placing Pro62’ at a 6.3 Å distance from Phe143; however, Arg65’ compensates through hydrophobic interaction with Phe143. These conformational changes do not seem to affect helix C or the hinge region. This is further confirmed with the loop region of the N-domain hairpin, which is disordered in subunit B with no significant changes in the nearby helix C. The stabilization of helix C, despite the ability of the nearby loop region to adopt multiple conformations, is made possible by the non-binding interactions between helix C and helix C’ at the dimer interface (Figures 1a and 1b). In particular, Leu138, Leu141, Leu138’, Leu141’ side chains interact with each other and stabilize the helix C and C’ at the hinge region. Together, these interactions provide a structural basis for the ability of ligand binding to invoke the allosteric maneuvering of sub-domains through the positioning of N-domain and in turn N-domain hairpin. Structural basis of N6-cAMP binding to Mtb-CRP

The concept of helix to coil transition (near N6 atom of cAMP) proposed as the mechanism as seen through the solution structure of apo E. Coli CRP does not seem to be the key for Mtb structure activation. Moreover, some of the key residues involved in the helix-to-coil to off state transition of E. coli are very different in Mtb: Trp85 is S92 in Mtb, Gln80 is Gly87 in Mtb, and Gln125 is Arg132 in Mtb. In spite of all these differences, even in E. coli, the involvement of numerous interactions of the N-domain upon binding of cAMP may be the key factor for the active positioning of the HTH motif, largely due to the lack of interactions near the N6 atom of cAMP, and may be the driving force of the coil-to-helix transition. It is not clear, however, why mutations in the hinge region of E. coli lead to inactivation (41) and why the syn conformation of cAMP and its steric hindrance of helix C leads to inactivation (6). In order to investigate this further, we tested the binding ability of Mtb-CRP to DNA in the presence of N6- cAMP with a bulky methyl-phenylethyl extension from its N6 position using a previously reported biochemical analysis (30). Binding of Mtb-CRP with the 28 bP putative SerC upstream sequence was demonstrated in the

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

10

absence and presence of cAMP or N6-cAMP. Migration of the DNA fragment was retarded without cAMP (Lane 3 of Figure 5) whereas the affinity (relative abundance) of the protein-DNA complex increased with 100 µM and 150 µM of cAMP. However, in the presence of 75 µM or 150 µM (Lane 4 and Lane 5) N6-cAMP, a decreased migration of complex as compared to cAMP was observed. The specificity of binding of CRP is further evident from the disappearance of the complex in lane 2 using a 100-fold excess of unlabeled probe (Lane 2). Based on the DNA gel shift assay, the binding ability of Mtb-CRP to DNA is significantly inhibited upon the binding of N6-cAMP (Figure 5). It is possible that the loss of activity observed in lane 4 and 5 might be due to the reduced binding of N6-cAMP to Mtb-CRP under experimental conditions, mimicking the apo structure. However, it has been demonstrated previously that N6-cAMP competes with cAMP and binds to E. coli CRP to induce a conformational change, but does not promote transcription (30). More importantly, the Mtb CRP:N6-cAMP crystal structure presented here provides direct evidence for the inhibitor binding (see below).

To explore the mechanism of action of this inhibition, we solved the X-ray crystal structure of Mtb-CRP complexed with N6-cAMP. The crystal parameters of Mtb-CRP-N6-cAMP binary complex structure are not isomorphous compared to the apo and cAMP-bound structure (Table 1, Supplementary figure 5). The structure was solved by molecular replacement using the cAMP-bound subunit as a search model. The asymmetric unit contained two subunits, subunit A showed a very close resemblance to the CRP bound to cAMP structure while subunit B showed significant differences in the relative positioning of the C-terminal domain with respect to the helix C within the dimer. In other words, the superposition of individual domains or subunits of both molecule A and B of N6-cAMP-bound CRP structures mostly resemble that of cAMP-bound CRP (Figure 6). There was an exception, however, as demonstrated in the superposition of subunit B, which showed either the helix C or the rest of the structure tilted about ~7˚ from the CRP-cAMP structure (Figure 6 and Supplementary figure 6). The R.M.S.D. of subunit A of N6-cAMP-bound CRP on CRP-cAMP is 0.85 Å and demonstrates

the close resemblance between the two structures. In the case of subunit B, the R.M.S.D. is 0.95 Å, for all the residues excluding the helix C indicating that this subunit is similar with the exception of the relative positioning of helix C and rest of the structure.

Each subunit of the complex contained one N6-cAMP molecule, in anti (for the cAMP)-R

(for the N6 extension) conformation for subunit A and anit-S conformation for subunit B (Figure 7 and Supplementary figure 5). The overall fold of the complex structure, the anti conformation of the N6-cAMP and majority of the binding interactions around the sugar and base region of cAMP are consistent with the cAMP-bound CRP structure (Figure 7); however with the exception of the N6 extension. In both subunits, the methyl-phenylethyl extension protrudes into helix C of subunit A and C’ of subunit B, adopting a different conformation in one subunit compared to the other; S in subunit B and R in subunit A with respect to the chiral center near N6 atom (Figure 7). In subunit A, the cAMP analog places the phenyl extension somewhat parallel to the plane of the N6 atom in a R conformation, between Leu69 of the β5 strand of the hairpin and Asn137, Leu138, and Leu141 of helix C. Thus, the N6 extension in subunit A is mainly stabilized by hydrophobic interactions; the CB atom of Asn137 is 3.3 Å from the phenyl ring, CD1 of Leu141 is 3.3 Å, CD1 of Leu138 is 4.1 Å, and CD2 of Leu69 is 3.9 Å. To accommodate the hydrophobic extension of the adenine moiety, particularly the methyl group, the nearby residue Asn135’ of helix C’ of subunit B and Thr134 of subunit A are forced away from the adenine moiety of N6-cAMP. As a result, the N6 atom loses two hydrogen bonds as compared to the cAMP-bound structure (N6 is now at 3.3 Å from OD1 of N135’ and at 3.8 Å from OG1 of Thr134) while the N7 atom of the adenine moiety retains its hydrogen bond with Asn135’ at 2.7 Å distance. Interestingly, the position of the phenyl ring of the N6 extension lies very close to the side chain of Leu138’ of helix C of the neighboring subunit (~ 1 Å based on CRP-cAMP structure), as shown in Figure 7b. Because of this steric hindrance, the Cα atom of L138’ moves away from the phenyl moiety by ~3.8 Å and its side chain atoms are disordered. As a result, helix C’ of subunit B partially unwinds. The loop region (residues 61-

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

11

65) of the N-domain hairpin of subunit A is also disordered.

In subunit B, both the N6 and N7 atoms of the adenine moiety retain their hydrogen bonds with Asn135 of subunit A as compared to the cAMP structure, which accommodates the S conformation of N6 extension. This allows the N6 extension of subunit B to be closer to helix C’ in S conformation, as compared to the N6-cAMP of subunit A in R conformation and helix C. In this position, the phenyl moiety overlaps with the original position of Asn137’ of helix C’, thus imposing further unwinding of helix C’. Therefore, to accommodate both of the N6-cAMP molecules in different isomeric conformation, one of the helices at the dimer interface (helix C’ of subunit B) has to undergo unwinding. As a consequence, the side chains of residues 137-141 of helix C’ and residues 142-144 become completely disordered. Surprisingly, the disorder and unwinding of helix C’ does not create any local conformational differences on individual secondary structural elements of the C-terminal domains. Instead, the entire structural arrangement of subunit B, including the N-terminal domain and C-terminal domain, is tilted away from its own helix C, towards the minor groove of a modeled DNA substrate (Figure 6). Therefore, most of the cAMP region of the N6-cAMP makes similar interactions as compared to the typical cAMP binding to stabilize the structural integrity and relative positioning of the N- and C-terminal domains within subunit B. However, to accommodate the extension, the entire N- and C-domains tilt away from the central helix; using the base of the helix C as a common point of reference; the tilt is estimated to be ~7˚. Thus, the base of the tilt is affected less and the DNA binding region (the HTH motif region of the C-terminal domain) is affected more. Taken together, this rearrangement affects the positioning of most of the helices and strands of the C-domain of subunit B while also shifting the HTH motif in an unfavorable position to accept the major groove of the DNA (Figure 6, based on the overlay of DNA bound E. coli CRP); the maximum shift is observed at the tip of the helix F where the Cα of Arg201 is shifted 9.3 Å as compared to the cAMP bound CRP structure (Supplementary figure 6).

While the cAMP-N6 disrupts the dimer interface and forces helix unwinding in subunit B, subunit A of the ordered helix C of the N6-cAMP structure resembles that of Mtb-CRP-cAMP.

Once again, the crystal structure is pointing towards significant asymmetry within the dimer, induced by the binding of N6-cAMP. The role of asymmetry in the inhibition of Mtb-CRP, based on the snapshot of N6-cAMP in the crystal packing environment, however, needs to be explored further using a solution structure. What is clear, though, is that a single molecule of N6-cAMP alone is not sufficient for the inactivation of CRP, single inhibitor binding can most likely be accommodated by minor changes in the hinge region. It is likely that the binding of N6-cAMP in one subunit has a distinct impact on the inhibitor binding in the second subunit and subsequent inactivation through the HTH rearrangements.

Additionally, the N6-cAMP bound CRP structure is almost identical to the cAMP bound on state, excluding the helix C. However, the off state, due to the N6 extension, is achieved through the rearrangement and relative positioning between helix C and the rest of the structure, in subunit B. This off state mechanism is strikingly different from the off state of apo CRP in which the entire N-terminal, N-domain hairpin underwent dramatic displacement leading to conformational changes in the individual helices of the C-domain. It is possible that the previously suggested steric hindrance of syn cAMP might also follow a similar mechanism as that of N6-cAMP, integrating the N- and C-domain, while still positioning the HTH in an inactive state. Perhaps, in solution this may lead to more local conformational changes. The solution structure of apo Mtb-CRP and crystal structure of Mtb-CRP-DNA complex can further expand the understanding of the precise regulation of CRP.

In absence of the N6 extension, i.e. in a physiological state, cAMP binds to the N-domain which stabilizes the C-domain HTH motifs of Mtb-CRP, most likely through non-bonding interactions between cAMP, the N-domain hairpin and C-domain helices which is subsequently followed by the stabilization of the helix C region.

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

12

REFERENCES:

1. Ulrichs, T., and Kaufmann, S. H. (2006) J Pathol 208, 261-269 2. Wayne, L. G. (1994) Eur J Clin Microbiol Infect Dis 13, 908-914 3. Korner, H., Sofia, H. J., and Zumft, W. G. (2003) FEMS Microbiol Rev 27, 559-592 4. Green, J., Scott, C., and Guest, J. R. (2001) Adv Microb Physiol 44, 1-34 5. Gosset, G., Zhang, Z., Nayyar, S., Cuevas, W. A., and Saier, M. H., Jr. (2004) J Bacteriol 186,

3516-3524 6. Tutar, Y. (2008) Cell Biochem Funct 26, 399-405 7. Lawson, C. L., Swigon, D., Murakami, K. S., Darst, S. A., Berman, H. M., and Ebright, R. H.

(2004) Curr Opin Struct Biol 14, 10-20 8. Kolb, A., Igarashi, K., Ishihama, A., Lavigne, M., Buckle, M., and Buc, H. (1993) Nucleic Acids

Res 21, 319-326 9. Harman, J. G. (2001) Biochim Biophys Acta 1547, 1-17 10. Botsford, J. L., and Harman, J. G. (1992) Microbiol Rev 56, 100-122 11. Hobson, R. J., McBride, A. J., Kempsell, K. E., and Dale, J. W. (2002) Microbiology 148, 1571-

1579 12. Spreadbury, C. L., Pallen, M. J., Overton, T., Behr, M. A., Mostowy, S., Spiro, S., Busby, S. J.,

and Cole, J. A. (2005) Microbiology 151, 547-556 13. Rickman, L., Scott, C., Hunt, D. M., Hutchinson, T., Menendez, M. C., Whalan, R., Hinds, J.,

Colston, M. J., Green, J., and Buxton, R. S. (2005) Mol Microbiol 56, 1274-1286 14. Bai, G., McCue, L. A., and McDonough, K. A. (2005) J Bacteriol 187, 7795-7804 15. Chen, R., and Lee, J. C. (2003) J Biol Chem 278, 13235-13243 16. Passner, J. M., Schultz, S. C., and Steitz, T. A. (2000) J Mol Biol 304, 847-859 17. Yu, S., and Lee, J. C. (2004) Biochemistry 43, 4662-4669 18. Gallagher, D. T., Smith, N., Kim, S. K., Robinson, H., and Reddy, P. T. (2009) J Biol Chem 284,

8228-8232 19. Won, H. S., Seo, M. D., Ko, H. S., Choi, W. S., and Lee, B. J. (2008) J Biochem 143, 163-167 20. Won, H. S., Lee, T. W., Park, S. H., and Lee, B. J. (2002) J Biol Chem 277, 11450-11455 21. Lee, T. W., Won, H. S., Park, S. H., Kyogoku, Y., and Lee, B. J. (2001) J Biochem 130, 57-61 22. Popovych, N., Tzeng, S. R., Tonelli, M., Ebright, R. H., and Kalodimos, C. G. (2009) Proc Natl

Acad Sci U S A 106, 6927-6932 23. Won, H. S., Lee, Y. S., Lee, S. H., and Lee, B. J. (2009) Biochim Biophys Acta 24. Malecki, J., Polit, A., and Wasylewski, Z. (2000) J Biol Chem 275, 8480-8486 25. Gorshkova, E. V., Kaledin, V. I., Kobzev, V. F., and Merkulova, T. I. (2005) Biochemistry

(Mosc) 70, 1180-1184 26. Cheng, X., Kovac, L., and Lee, J. C. (1995) Biochemistry 34, 10816-10826 27. Garges, S., and Adhya, S. (1985) Cell 41, 745-751 28. Anderson, W. B., Perlman, R. L., and Pastan, I. (1972) J Biol Chem 247, 2717-2722 29. Weber, I. T., Takio, K., Titani, K., and Steitz, T. A. (1982) Proc Natl Acad Sci U S A 79, 7679-

7683 30. Ebright, R. H., Le Grice, S. F., Miller, J. P., and Krakow, J. S. (1985) J Mol Biol 182, 91-107 31. Schneider, T. R., and Sheldrick, G. M. (2002) Acta Crystallogr D Biol Crystallogr 58, 1772-1779 32. Wang, J. W., Chen, J. R., Gu, Y. X., Zheng, C. D., Jiang, F., Fan, H. F., Terwilliger, T. C., and

Hao, Q. (2004) Acta Crystallogr D Biol Crystallogr 60, 1244-1253 33. Vonrhein, C., Blanc, E., Roversi, P., and Bricogne, G. (2007) Methods Mol Biol 364, 215-230 34. McRee, D. E. (1999) J Struct Biol 125, 156-165 35. Reddy, S.M. Swanson, B. Segelke, K.A. Kantardjieff, J.C. Sacchettini and B. Rupp (2003) Acta

Crystallogr D Biol Crystallogr 59, 2200–2210 36. Vagin, A. A., Steiner, R. A., Lebedev, A. A., Potterton, L., McNicholas, S., Long, F., and

Murshudov, G. N. (2004) Acta Crystallogr D Biol Crystallogr 60, 2184-2195

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

13

37. Davis, I. W., Leaver-Fay, A., Chen, V. B., Block, J. N., Kapral, G. J., Wang, X., Murray, L. W., Arendall, W. B., 3rd, Snoeyink, J., Richardson, J. S., and Richardson, D. C. (2007) Nucleic Acids

Res 35, W375-383 38. Agari, Y., Kashihara, A., Yokoyama, S., Kuramitsu, S., and Shinkai, A. (2008) Mol Microbiol 70,

60-75 39. Schultz, S. C., Shields, G. C., and Steitz, T. A. (1991) Science 253, 1001-1007 40. Parkinson, G., Wilson, C., Gunasekera, A., Ebright, Y. W., Ebright, R. E., and Berman, H. M.

(1996) J Mol Biol 260, 395-408 41. Ryu, S., Kim, J., Adhya, S., and Garges, S. (1993) Proc Natl Acad Sci U S A 90, 75-79 42. Laskowski, R. A., Rullmannn, J. A., MacArthur, M. W., Kaptein, R., and Thornton, J. M. (1996)

J Biomol NMR 8, 477-486

FOOT NOTES

¶ These authors contributed equally to this work

This work was supported by the following grants: Structural Genomics of Persistence Targets from Mycobacterium tuberculosis: PO1AI068135 and R.J. Wolfe-Welch Foundation Chair in Science 8-0015. We appreciate the support of staff scientists at beamline 23-ID of the Advanced Photon Source, Argonne National Laboratory for their help in data collection. We also thank Misty D. Watson and Joshua Owen for their excellent technical assistance and Nishant Shetty, William Snee, Vijay Gawandi, Joel Freundlich, Siaska Castro and Tracey Musa for comments on the manuscript.

Author Keywords: Mycobacterium tuberculosis; cAMP Receptor Protein; allosteric mechanism; DNA binding; inhibition; crystal structure

Abbreviations: cAMP, 3’,5’-cyclic adenosine monophosphate; cIMP, inosine 3’,5’-monophosphate; cGMP,guanosine 3’,5’-monophosphate, CRP, cAMP receptor protein; N6-cAMP; N6-(1-Methyl-2-phenylethyl)adenosine-3-5-cyclic monophosphate; Mtb, Mycobacterium tuberculosis H37Rv; Mtb-CRP, M. tuberculosisH37Rv CRP dimer; HTH, helix-turn-helix; R.M.S.D., root-mean-square deviation; SAD, single-wavelength anomalous dispersion

FIGURE LEGENDS

Figure 1. The x-ray crystal structure of the Mtb-CRP-cAMP binary complex a) Structure of the Mtb-

CRP-cAMP dimer; the crystallographic asymmetric unit contained two independent dimers, the CD dimer

(blue and cyan ribbons) is superposed on AB dimer (yellow and golden yellow ribbons). The cAMP

molecules of CD dimer are shown in CPK model. The N-terminal domain of each subunit is formed by

helices N1-N3, helices A-B, and strands β1- β8; the C-terminal domain is formed by helices D-G, and

strands β9- β12; helix C forms the dimer interface connecting N and C-terminal domains. Ribbons of the

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

14

subunit B (D) of the CRP dimer are indicated by primed letters. The HTH helices E-F and E’-F’ form the

DNA binding region of CRP dimer. b) Ribbon representation of the subunit D of the CRP dimer; the

cAMP molecule is shown in CPK model. The helices are colored in green, β strands in blue, and loops in

pale green. The relative positioning of N-domain hairpin (β4-β5), cAMP and C domain is also depicted.

c) Electron density of cAMP complexed with Mtb CRP is shown with the nearby secondary structural

elements and residue R130 of helix C. The SAD experimental maps are contoured at the 1 σ level.

Figure 2. The cAMP binding pocket of Mtb-CRP a) Stereo view of the key residues of the cAMP

binding pocket of both the subunits of Mtb CRP dimer is shown (top view of CD dimer); residues of

subunit D is primed. The relative location of the cAMP binding pocket at the interface of the N domain

hairpin loop, the long helix C and the short N domin helix N3 is also depicted. The key hydrogen bonding

interactions are shown as green solid lines. One subunit is colored in cyan ribbons and the other blue. b)

Close-up view of the cAMP binding pocket of subunit C

Figure 3. Comparison of apo and cAMP bound structures of Mtb-CRP. (Top) Ribbon representation

of the superposition of the apo dimer on cAMP-bound Mtb-CRP (a), apo subunits on cAMP-bound

subunits (b), and individual domains of subunit B of apo on subunit A on the cAMP-bound structure (c).

Color code: blue and cyan, Mtb-CRP-cAMP (CD dimer), yellow and golden yellow, Mtb-CRP-cAMP

(AB dimer), red, subunit B of apo CRP, and magenta, subunit A of the apo CRP structure. (Bottom) The

side by side comparison of on-state and off-state subunits of Mtb. (Left) the closed, on-state structure of

Mtb-CRP; the blue ribbon is a representative subunit of cAMP bound CRP and magenta is subunit A of

apo CRP. (Right) the open, off-state structure of Mtb CRP; subunit B of apo Mtb- CRP crystal structure is

shown.

Figure 4. The binding of cAMP switches Mtb-CRP from off state to on state The superposition of

subunit A (magenta ribbon) and subunit B (pale red ribbon) of apo Mtb-CRP structure on a representative

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

15

subunit of cAMP-bound structure using the long C helix as common point of reference. In the off-state

(pale red ribbon and the residues labeled with red color), the secondary structural elements of the N-

terminal along with the N-domain hairpin domain are shifted away from the central C helix and indicated

by a black arrow. Upon binding of cAMP, the entire N-terminal domain moves towards the helix C to

pack around the cAMP to augment the closed structure of CRP. The key residues involved in this

transition are shown in stick model along with cAMP (see figure 5b for close up). The closed positioning

of N-domain region in the cAMP bound structure allosterically augments the active conformation of the

he C domain helices, particularly the HTH motifs, indicated by inward arrows. The close proximity of the

N-domain hairpin and HTH motif helices is indicated by a dotted arrow.

Figure 5. EMSA showing binding of Mtb-CRP to SerC DNA template. Gel mobility-shift experiment

performed with a 28-bp (P32 end labeled) double stranded DNA olgonucleotide containing CRP binding

site of the upstream region of Mtb-SerC. The radiolabeled fragments (2 nM) were mixed with Mtb-CRP

(50 nM) , and then resolved on a 5% polyacrylamide gel. Lane:1:DNA probe only, Lane 2: 100 fold

excess of homologous unlabeled DNA probe, Lane:3: CRP without cAMP, Lane:4: 75 µM N6-cAMP,

Lane:5: 150 µM N6-cAMP, Lane 6: 75µM cAMP, and Lane7: 150 µM cAMP.

Figure 6. a) The superposition of the N6-cAMP bound Mtb-CRP dimer (red ribbon) on top of the

cAMP-bound Mtb-CRP dimer (cyan and blue ribbons); The N6-cAMP molecules are shown in CPK

model. The DNA template (green ribbon) is modeled by superposing the E. coli CRP-cAMP-DNA

ternary complex structure (PDB ID: 1ZRF) on top of the cAMP bound Mtb-CRP structure; the CRP part

of the E coli structure is not shown here for clarity. The DNA binding region of the subunit B of the Mtb-

CRP- N6-cAMP structure showed significant differences compare to the rest of the structure and is

highlighted. b) Close-up view of the HTH motif, near the major groove of the modeled DNA template;

the N6-cAMP is shown as a stick model and its N6 extension is colored in yellow.

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

16

Figure 7. a) ) Stereo view of the key residues of the N6-cAMP binding pocket of both the subunits of

Mtb-CRP dimer is shown (view of the DNA substrate). The cAMP part of the ligand is colored black and

the extension from its N6 atom is yellow. The relative location of the N6-cAMP binding pocket at the

interface of the N domain hairpin loop, the long helix C and the short N domin helix N3 is also depicted.

The key hydrogen bonding interactions are shown as green solid lines and the distances are shown in

broken green lines. One subunit is colored in red ribbon and the other orange red. b) Close-up view of the

relative position and conformation of the N6-cAMP binding pockets, within the Mtb-CRP dimer. The

long C helices of the cAMP bound Mtb-CRP structure are also shown here as reference, cyan and blue

ribbons.

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

17

Table 1. X-ray Crystallographic Data for Mtb-CRP-cAMP and Mtb-CRP-N6-CAMP structures cAMP bound Mtb-CRP

(PDB IDd: 3I54) N6-cAMP bound Mtb-CRP

(PDB ID: 3I59) Data Collection Wave length (Ǻ) 0.9793 0.9653 Space group P21 C2 Number of molecules in ASU (Z) 4 2 Resoltuion (Ǻ) 50-2.2 20-2.3 Unit Cell a,b,c (Ǻ) 68.25, 96.33, 79.26 113.73, 75.72, 63.64 Unique angle (o) 113.46 110.91 Redundancy 3.8 (3.3) 3.6 (3.1) Observations 47,764 22,400 Observations Test Set 2366 1149 Completeness (%) 96.7 (79.1) 97.9 (89.0) Rsym b (%) 4.6 (36.9) 5.8 (41.9) I/Iσ

a 37.76 (3.01) 20.4 (2.60) Refinement Rwork

C 21.1 23.41 Rfree 26.46 28.37 Number of atoms Protein 6565 3096 Ligand 88 62 Ramachandran analysis Most favorable (%) 95.82 95.29 Most favorable + allowed (%) 99.1 99.0 Root mean square deviation Bond lengths (Ǻ) 0.016 0.006 Bond angles (o) 1.822 0.802 Values in parentheses are for high resolution shells. a I/Iσ = the mean I/sigma for the unique reflections in the output file b Rsym = ΣhΣi | Ihi - <Ih> | / ΣhΣi Ihi, where Ihi is the ith observation of the reflection h, whereas <Ih> is the

means intensity of reflection h. c Rwork= Σ|Fo| - |Fc| / |Fo|. Rfree was calculated with a fraction (5%) of randomly selected reflections

excluded from refinement. d

Protein Data Bank (www.rcsb.org)

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from

F F’

C C’

A’B’B

D

E

GD’

E’

Subunit A (C) Subunit B (D)

DNA binding region

AN-term

G’

N1N1’

N3N2

β1

β2

β3

β4

β5

β8

β6

β7

β11

N-term

F

C

cAMP

N-termA B

D E

G

N1

N3

N-domain

hairpin loop

β4

β5

β9

β10

β12

β11

C-terminal domain

β1

β2

β3

β6

β7

β8

Figure 1a,1b and 1c (clockwise)

Subunit C Subunit D

Subunit A (C) Subunit B (D)

Page 18

N-terminal domain

by guest on September 1, 2017 http://www.jbc.org/ Downloaded from

R130

E80

L81

L131’

N135’

T134

L69

S82R89

T90

S91

M72

I57

R89F38

F78

S82

R130

R130’

T134’ T134

N135’

N135

R89’

F78’

R89F38 F78

S82

R130

R130’

T134’ T134

N135’

N135

R89’

F78’

S82’ S82’

β4β5

β5Helix C Helix C’

Helix N3

β5

β4 β4

L131’ L131’ T70

L131 L131

I57 I57

L69 L69

Figure 2a and 2b

E80F38’

F78’F38’

F78’

Page 19

by guest on September 1, 2017 http://www.jbc.org/ Downloaded from

F F’

C C’

N-term

N-term

C

HTH

N-domain

FF

C

Figure 3a,b,c (top) and 3d (bottom)

F

No

cAMP

F’

On-State Off-State

Page 20

by guest on September 1, 2017 http://www.jbc.org/ Downloaded from

N-domain

hairpin

R130

E80

I57

F38

I57

R130

E80F38

F78F78

HTH

R89 R89

FF

HTH

R130

HTH

Figure 4a and 4b Page 21

by guest on September 1, 2017 http://www.jbc.org/ Downloaded from

CRP-DNA Complex

1 2 3 4 5 6 7

Figure5 Page 22

Free DNA

by guest on September 1, 2017 http://www.jbc.org/ Downloaded from

Figure 6a and 6bPage 23

by guest on September 1, 2017 http://www.jbc.org/ Downloaded from

L138 L138’

N135’

N135

N137’

Subunit B

N135’ N135’N137 N137

L69’ L69

N137’N137’

T134’ T134’

Phe143Phe143

L69 L69

L138 L138

Figure 7a and 7b

Subunit APro62’ Pro62

Page 24

by guest on September 1, 2017 http://www.jbc.org/ Downloaded from

Smith and James C. SacchettiniManchi C. M. Reddy, Satheesh K. Palaninathan, John B. Bruning, Cory Thurman, Danielle

cAMP receptor proteinmycobacterium tuberculosisStructural insights into the mechanism of the allosteric transitions of the

published online September 9, 2009J. Biol. Chem. 

  10.1074/jbc.M109.041343Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

  http://www.jbc.org/content/suppl/2009/09/08/M109.041343.DC1

  http://www.jbc.org/content/early/2009/09/08/jbc.M109.041343.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on September 1, 2017

http://ww

w.jbc.org/

Dow

nloaded from