Structural Relationships of Low Molecular Weight Viral RNAs Synthesized by RNA Polymerase III in Nuclei from Adenovirus 2-infected Cells*

(Received for publication, December 19, 1977)

Barry Harris+ and Robert G. Roeders

From the Demx-tment of Biolokcal Chemistrv. Division of Biology and Biomedical Sciences, Washington liniuersity, St. Louis, Missoki 63110 ’ .’

Previous studies have shown that endogenous class III RNA polymerase(s) in nuclei from adenovirus 2- infected cells synthesize virus-coded RNA species which are approximately 200 (V&, 156 (VI&, and 140 (VI.& nucleotides in length (Weinmann, R., Brendler, T. G., Raskas, H. J., and Roeder, R. G. (1976) Cell 7, 557-566). The VI.56 nuclear RNA is identical in sequence to the major virus-associated RNA (VA RNA, or 5.5 S RNA) synthesized in intact cells (Ohe, K., and Weiss- man, S. M. (1971) J. Biol. Chem. 246, 6991-7009). The VI40 RNA contains several components, one of which appears identical to a minor virus-associated RNA (VA RNAII) which is synthesized in infected cells (Mathews, M. B. (1975) Cell 6, 223-229). Thus transcription of the VA RNA1 and VA RNA11 genes in vitro accurately re- flects the in vivo transcription of these genes. The VzUO RNA contains all the nucleotide sequences found in VI66 RNA plus an additional 38 to 40 nucleotides on the 3’ terminus. Transcription of the gene encoding this RNA species terminates within a stretch of 6 deoxythymi- dylic acid residues which are located 38 nucleotides beyond the predicted termination site for VA RNA, and which are preceded by a GC-rich sequence of nucleo- tides. These data suggest either that the VZOO RNA is a precursor to the VA RNA, or that the RNA polymerase III occasionally reads-through the presumptive VA RNA, gene termination signal and stops at a potentially stronger downstream termination site.

Class III RNA polymerases have been shown to mediate the synthesis of a variety of low molecular weight RNA species in isolated nuclei. These RNAs include presumptive tRNA precursors (1, 2), ribosomal 5 S RNAs (l-3), and several adenovirus-2 encoded RNAs (3, 4). The genes which encode these RNAs have proved attractive for an analysis of the mechanism and regulation of specific gene transcription through the reconstruction of specific transcription events from fractionated components. Thus, recent studies have in-

* These studies were supported by National Institutes of Health grant CA 16640, American Cancer Society Grant VC 159, National Science Foundation Grant MBS 74-24657, a Camille and Henry Dreyfus Teacher-Scholar Award (to R. G. R.), and Cancer Center Support Grant 5 I’01 CA 16217 from the National Institutes of Health to Washington University. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC. Section 1754 solely to indicate this fact.

$ Recipient of a Postdoctoral Research Fellowship Award from the National Institutes of Health.

8 Recipient of Research Career Development Award GM 70661 from the National Institutes of Health.

dicated that at least some of the genes which encode these RNAs are accurately and selectively transcribed in chromatin or nuclear templates by purified class III RNA polymerases (5-8).

With respect to the analysis of transcriptional controls in cell-free systems it is important to establish the precise rela- tionships of the RNAs synthesized in vitro to those synthe- sized in uiuo. In nuclei isolated from adenovirus 2-infected cells, RNA polymerase III synthesizes viral RNA species of approximately 200 (V,,,,), 156 (V,,,; or 5.5 S RNA), and 140 (V,,,,) nucleotides (3). The VI56 RNA is the major transcript and appears similar (3, 4, 9, 10) to the major low molecular weight viral RNA (5.5 S RNA or VA RNA,) isolated from infected cells and sequenced by Ohe and Weissman (11). The presence of other minor viral RNA species in intact adenovi- rus-infected cells has also been reported. One minor viral species (designated VA RNA,,) was separated from VA RNAl (5.5 S RNA) on the basis of its hybridization to a restriction endonuclease fragment distinct from that containing the se- quences encoding VA RNA, (12). Subsequent to its isolation by hybridization, VA RNA11 was characterized by fingerprint analysis and shown to be distinct from VA RNA,. Electropho-

retie separations of the RNAs synthesized in viral-infected cells also revealed an RNA component (5.2 S RNA) which co- migrated with the smaller in vitro transcript (V,,,, RNA), and which was shown by hybridization to contain viral RNA sequences (3, 13). From a fingerprint analysis of the 5.2 S RNA band isolated from intact cells, Sijderlund et al. (13) suggested the presence of a 5.2 S viral RNA species distinct from VA RNA, and VA RNA,,.

A major objective of the work reported here was to examine in greater detail the structural relationships of the various in vitro and in uivo adenovirus 2 transcripts. These studies demonstrate that the in vitro VISfi and V141) transcripts are distinct and that they are indistinguishable, respectively, from the VA RNA, (5.5 S RNA) and VA RNA11 species observed in

vivo. In addition, the Vaoo RNA is shown to be a discrete RNA species although it is structurally similar to VA RNA, and may represent a precursor to this RNA species.

EXPERIMENTAL PROCEDIJRES

Cell Culture and Virus Infection-Suspension cultures of expo- nentially growing KB cells were infected with adenovirus 2 at a multiplicity of 40 plaque-forming units/cell as described previously (14) and diluted 20.fold to 3 X lo” cells/ml after a l-h adsorption period.

Isolation of Nuclei from Infected Cells and Synthesis of Nucleo- side [u-.‘“PJTriphosphate-labeled RNAs-Infected cells were washed twice with isotonic Earles’ balanced salts solution (without 1.8 mM CaCls and phenol red) and washed once in 10 volumes of hypotonic buffer (10 mM Tris (7.9), 24 mM KCl, 10 mM MgCL). The cells were resuspended in 5 volumes of isotonic buffer (above) and disrupted

4120

by guest on Decem

ber 2, 2020http://w

ww

.jbc.org/D

ownloaded from

Transcription of Viral Genes by RNA Polymerase III 4121

with 10 to 20 strokes of the B pestle of a Kontes all-glass Dounce homogenizer. After the homogenate was layered over 2 volumes of a buffer containing 10 mM Tris (7.9), 5 mM MgCL, 0.1 mM EDTA, 25% glycerol, and 0.5 mM dithioerythritol, nuclei were collected as a pellet by centrifugation at 800 x g for 10 min. They were resuspended in the same glycerol containing buffer at 2 x 10H/ml.

RNA synthesis was performed at 25°C for 30 min with 5 x lo7 nuclei/ml. The incubation buffer contained 50 mM Tris (7.9), 1 mM MnC12, 4 mM NaF, 20 InM (NH,)&O,, 1 pgg/ml of oi-amanitin and an ATP regenerating system composed of 6 mM phosphoenolpyruvate and 20 ag/ml of pyruvate kinase. The labeled nucleoside triphosphate ([(Y-““PIUTP, -CTP or -GTP) was present at a concentration of 0.05 mM (specific activity, 15 to 25 Ci/mmol), whereas the remaining triphosphates were present at 0.6 mM. Reactions were terminated by treatment with electrophoretically purified DNase (50 ag/ml) for 15 min at 4°C. Following the addition of sodium dodecyl sulfate to 0.2%, an equal volume of sterile Hz0 was added, and the preparations were treated with phenol and CHCL, as described by Palmiter (15).

Purification of Low Molecular Weight RNAs-Following ethanol precipitation, the RNA was dissolved in formamide and electropho- resed on gel slabs (40 X 15 X 0.1 cm) containing 12% polyacrylamide, 0.32% N,N’-methylenebisacrylamide for 45 h at 150 V, as described previously (3). Gel regions containing specific RNA species, localized by autoradiography, were excised, and the RNA was eluted by ho- mogenization in 1 M NaCl as described by Brownlee (16). The salt concentration of the homogenate was reduced to 0.3 M by addition of water and the RNA subsequently purified and concentrated by chro- matography on a column (0.6 x 1 cm) of DEAE-cellulose. After addition of 50 to 100 pg of yeast tRNA, 2% volumes of ethanol:1 M

NaAc (pH 5.5) (9:l) was added to precipitate the RNA samples. Preparative Electrophoresis of VI40 RNA Components under De-

naturing Conditions-The pellet of the V,~O RNA-ethanol precipitate was dried in vacua, redissolved in 5 ~1 of sterile HZO, and denatured by addition of 50 ~1 of 99% formamide. After incubation at 90°C for 15 min, glycerol was added to a final concentration of 25%. The sample was layered onto a gel slab (40 x 15 x 0.1 cm) composed ‘of 12% acrylamide, 0.83% N,N’-methylenebisacrylamide, 0.075% ammo- nium persulfate, and 0.07% N,N,N’,iV-tetramethylethylenediamine in 99% formamide buffered to pH 7.4 with 0.02 M phosphate. Electro- phoresis was carried out at 350 V for 92 h with a buffer composed of 0.04 M phosphate (pH 7.4). Gel regions containing the subspecies of VI40 RNA were localized, excised, extracted, and concentrated as described above.

Fingerprint Analysis-After two successive ethanol precipitations, the RNA was dissolved in less than 10 ~1 of 10 mM Tris (7.9), 1 mM EDTA containing either 5 ag of TI RNase or 2.5 ag of pancreatic RNase. The sample was incubated at 37°C for 45 min. Oligonucleo- tides were electrophoresed first on cellulose acetate paper at pH 3.5 in 5% acetic acid, 0.5% pyridine, followed by a second dimension on DEAE-cellulose paper in 7% formic acid (pH 1.8) (16). Oligonucleo- tides were also analyzed by electrophoresis on Cellogel at pH 3.5 in 7 M urea, followed by homochromatography with homomixture B (16). Subsequent to homochromatography, individual oligonucleotide com- ponents were eluted from the DEAE-cellulose: cellulose matrix, di- gested by either T1 or pancreatic RNases, and fractionated by elec- trophoresis on DEAE-paper at pH 3.5 (11).

Preparation of Ball Restriction Fragments of Adenovirus 2 DNA-Restriction endonuclease Bali was purified from the bacteria Brevibacterium albidum according to a procedure provided by R. J. Roberts (Cold Spring Harbor Laboratory). Restriction enzyme frag- ment EcoRl A was subcleaved by incubating with Bali at 37’C for 16 h in a buffer containing 10 mM Tris-HCl (pH 7.5), 10 mM MgC12, and 0.1 mM mercaptoethanol. Digestion was terminated by addition of EDTA to 100 mM and the resultant DNA fragments were separated by electrophoresis in 1.4% cylindrical agarose gels. After staining with ethidium bromide, the bands were localized with an ultraviolet lamp and excised. Individual DNA fragments were eluted by the freeze and squeeze method (17) and immobilized on nitrocellulose filters after base denaturation.

RNA-DNA Hybridization Conditions-Purified viral RNAs were dissolved in 500 ~1 of 4 x SSC and incubated in the presence of the DNA-nitrocellulose filters for 16 h at 66’C. Filters containing Bali restriction endonuclease fragments B, D, M, and a blank were hy- bridized simultaneously in the same reaction mixture. After hybridi- zation, the filters were treated as described in Ref. 3.

RESULTS

Preparative Separation of Low Molecular Weight RNAs

Synthesized in Isolated Nuclei-In previous studies high resolution electrophoresis of nuclear RNAs revealed that sev- eral minor RNA components were synthesized in isolated nuclei in addition to the major 5.5 S RNA species (3). In order to analyze these minor RNA species in more detail, nuclear incubations were scaled-up IOO-fold and the various RNA species were isolated by preparative electrophoretic proce- dures (Fig. 1). All of the radioactive components detected previously were clearly resolved and designated (in order of increasing electrophoretic mobility) VZOO, Vine, V140, ViZo, 5 S rRNA, and pre-tRNA. Designation of the band identified as cellular 5 S ribosomal RNA is based upon fingerprint analysis (data not shown). The relative abundance of radioisotope incorporation into the minor viral RNA components (V,,,,, V14”, and V,,,) varied slightly depending upon the [a-“‘PI- nucleoside triphosphate utilized as the radioisotopic precur- sor.

Identification ofMajor Low Molecular Weight RNA Com- ponent-several independent observations have previously suggested that the major viral RNA component synthesized in isolated nuclei, designated here as V156, corresponds to the viral-associated 5.5 S RNA. These observations include simi- lar electrophoretic mobilities (5.5 S) (3, 4, 9, 10, 13), and similar hybridization properties with restriction enzyme frag- ments of the adenovirus genome (3, 12). In our preparative electrophoresis system Vi56 RNA exhibits microheterogeneity

FIG. 1. Polyacrylamide gel electrophoresis of RNAs synthesized in nuclei isolated from adenovirus-infected cells. Cells were harvested at 14 h after infection, and nuclei were prepared as described under “Experimental Procedures.” Nuclei were incubated for 30 min at 25°C in the nresence of 0.05 mM lo-“‘PlUTP or CTP (15 to 25 Ci/mmol). The R-NA was extracted and subjected to electrophoresis on a 12% polyacrylamide gel. Autoradiography of the gel revealed discrete RNA species which are designated and discussed in the text.

by guest on Decem

ber 2, 2020http://w

ww

.jbc.org/D

ownloaded from

digestion and fingerprint analysis, a complex pattern of oli- gonucleotides is observed (data not shown). Although the overall fingerprint pattern resembles that of 5.5 S RNA, there are several minor oligonucleotides which appear distinct from those predicted from the 5.5 S RNA sequence. The positions of the minor oligonucleotides correspond to those of the unique spots observed in the fingerprint patterns of both VA RNA11 (12) and 5.2 S RNA (13) from intact cells. These findings raised the possibility that the V140 RNA isolated from standard aqueous acrylamide gels is composed of more than one radioactive RNA component.

4122 Transcription of Viral Genes by RNA Polymerase II1

(two or three distinct bands appear within the V,sh region) as shown in Fig. 1. This may reflect the variation in initiation and termination sites of 5.5 S RNA synthesis observed in viva

by Weissman’s laboratory (l&19). A more detailed fingerprint analysis of the in vitro Vlh6 RNA is shown in Fig. 2. The resultant oligonucleotide patterns were obtained by digestion of [a-““PICTP-labeled RNA with either T1 RNase (Fig. 2A) or pancreatic RNase (Fig. 2B) followed by oligonucleotide separation using standard two-dimensional paper electropho- resis techniaues (see “Exnerimental Procedures”). These * oligonucleotide patterns are essentially indistinguishable from those published by Ohe and Weissman (11) for 5.5 S RNA, and the various oligonucleotides are numbered accordingly.

Molar ratios of the individual pancreatic RNase digestion products of Vln6 RNA labeled with [a-““P]CTP are presented in Table I (column 3). These values compare favorably with the molar ratios predicted from the known sequence of 5.5 S

RNA (column 5). These data also show that the entire Vls6 RNA molecule is labeled uniformly by [a-““PICTP, thus dem- onstrating the de nouo synthesis of this RNA species by RNA polymerase III in isolated nuclei.

Sequence Analysis of V,4O RNA Components-The VI40 RNA migrates slightly faster on polyacrylamide gels than the adenovirus specific 5.5 S RNA (Fig. 1) and is similar in this respect to the in viuo 5.2 S RNA species described by Soder- lund et al. (13) and an in vivo RNA reported by Weinmann et al. (3). When V140 RNA is subjected to extensive T1 RNase

To assess this possibility the V14fl RNA from aqueous gels was isolated and subjected to electrophoresis under denatur- ing conditions. An autoradiogram of V140 RNA electropho- resed on a 40-cm formamide gel is shown in Fig. 3. The V140 RNA (lane 3) is clearly resolved into at least three distinct radioactive components. For purposes of description only, these are designated species I, II, and III in order of increasing electrophoretic mobility.

A fingerprint pattern of Vno RNA species II is shown in Fig. 4. The RNA was labeled by incorporation of [a- “P]UTP and was digested with TI RNase. This pattern is strikingly differ- ent from that of a similarly labeled 5.5 S RNA (compare with Fig. 2A). In particular, unique spots appear in the region of the larger UMP-rich oligonucleotides (near the origin of the second dimension) and spot 45 (the 3’-OH-terminal oligonu- cleotide CpUpCpCpUpUou) is absent in the V140 RNA pat-

FIG. 2. Autoradiograph of two-dimensional electrophoretic frac- tionation of the oligonucleotides produced by extensive TI RNase digestion (A) and extensive pancreatic RNase digestion (B) of V,Q, RNA. The [a-‘“PICTP-labeled VIX, RNA was prepared as described in the legend for Fig. 1. Electrophoresis was from left to right on

cellulose acetate paper (pH 3.5) and from bottom to top on DEAE- cellulose paper in 7% formic acid (pH 1.8). The oligonucleotides are numbered according to the nomenclature developed by Ohe and Weissman (11).

by guest on Decem

ber 2, 2020http://w

ww

.jbc.org/D

ownloaded from

Transcription of Viral Genes by RNA Polymerase III 4123

tern. All of the fragments unique to RNA species II are observed in the published fingerprint pattern of VA RNAii (12). These include the oligonucleotides given the tentative nucleotide composition of [C3UA]Gp, [C3U2A]Gp, [U3]Gp, and [U2]Gp. Oligonucleotides which are composed of [A,C,]Gp and which are derived from the VA RNAii sequence are not labeled by incorporation of [a-““PIUTP. However, these oligonucleotides are observed in T1 RNase digest pat- terns of RNA species II labeled with [a-“‘P]CTP (data not shown), as in uniformly labeled VA RNAii from intact cells (12).

Fingerprint patterns resulting from the T1 RNase digestion of VI40 RNA species I (not shown) reveal an oligonucleotide composition identical to 5.5 S RNA except for the absence of spot 45 (see above). Possibly this major component of the original V140 RNA band (Fig. 1) is a breakdown product of 5.5 S RNA. Alternatively, it may result from premature termi- nation by RNA polymerase III in the 5.5 S RNA gene. Thus, despite its complete resolution from the major 5.5 S RNA band, the VI40 RNA band from an aqueous acrylamide gel contains several RNAs which include a 5.5 S RNA component. These observations raise the possibility that the 5.2 S RNA band isolated by Soderlund et al. (13) contains a similar mixture of radioactive RNA components. Any 5.5 S RNA component in this 5.2 S RNA band would not have been detected by their hybridization analysis since the adenovirus DNA-nitrocellulose filters used were presaturated with 5.5 S RNA. In addition, incorporation of [/3-32P]GTP into the total RNA component(s) represented by the 5.2 S RNA band may not be indicative of separate promotor sites for the major and

TABLE I

Analysis of oligonucleotides obtained by complete digestion of [a- “P]CTP-labeled VIs6 and Vz, RNAs wsth pancreatic RNase

Oligonu- cleotide (Fig. 2B)

11 11’” 12 13

Sequence

CP 9.0 11.0 9.0 UP 5.0 7.0 5.0

APCP 3.5 3.5 3.0

APUP 1.0 1.0 1.0

GPCP 9.0 14.0 9.0 GPUP 3.3 3.0 3.0

APAPCP 1.0 1.0 1.0 GPAPCP 3.0 2.0 3.0

APGPCP 1.0

GPAPUP 1.0 1.0 1.0

GPGPCP 3.0 4.5 3.0

Molar ratio”

14 GPGPUP 1.0 1.25 1.0 19 APGPAPCP 1.0 1.0 1.0 21 GPAPAPCP 4.0 4.5 3.0 27 GPGPAPCP 1.0 1.0 1.0 28 GPGPAPUP 1.0 1.0 1.0 29’ GPGPGPCP 0.14 0.10 0.25

255 GPGPGPGPGPAPGPCP 0.1 1.5 1.0

n The experimental yield of each oligonucleotide (moles per mol of 5.5 S RNA) is calculated by taking an average of 1 mol of GpApUp and GpGpApCp/mol of 5.5 S RNA. The figures are the average of four different pancreatic RNase digests of Vl,ti RNA and V7,n RNA.

* Sequence is deduced from its eikctrophoretic mobility on DEAE- cellulose paper at pH 1.8, and from DNA sequence analysis of nu- cleotides beyond 3’-OH terminus of 5.5 S RNA.

’ This oligonucleotide represents the 5’-terminal fragment pro- duced by pancreatic RNase digestion and is indicated as GpGpGpCp in Figs. 2B and 5B. Based on previous observations by Ohe and Weissman (11) this oligonucleotide should be produced by only 25% of the digested molecules. Although it appears as only a faint spot just to the right of the indicated sequence in the photographic prints of Figs. 2B and 5B, this oligonucleotide fragment is clearly observed on the original autoradiographs.

1

“200 v2 “,:, 5”s 156

FIG. 3. Electrophoretic analysis of purified low molecular weight RNAs using denaturing conditions. Low molecular weight RNAs synthesized in nuclei isolated from infected cells were separated electrophoretically as in the experiments shown in Fig. 1. The indi- vidual RNA species were recovered from the gels as described under “Experimental Procedures,” precipitated with ethanol, and dissolved in 90% formamide. After incubation at 90°C for 15 min, these samples were individually run on a 40-cm 12% polyacrylamide, 99% formamide slab gel as described under “Experimental Procedures.”

minor adenovirus-associated RNA species, as suggested by Soderlund et al. (13).

VI40 RNA species III (Fig. 3) was present in amounts too small to analyze by fingerprint analysis. This was the case, as well, for the VI30 RNA component from the preparative aqueous acrylamide gel (Fig. 1). Further analysis of these minor RNA components may reveal additional adenovirus- specific RNA species which are synthesized by a class III RNA polymerase.

Mathews (12) demonstrated that the gene sequence for 5.5 S RNA (VA RNAi) resides almost exclusively within the Bali

M digest fragment of adenovirus DNA, whereas the gene sequence for VA RNAii is located within the Bali B fragment. As a further test of the relationship of the in vitro V14” RNA species II to the in uiuo VA RNA,,, the V14” species II and V156 RNAs were hybridized to Bali restriction endonuclease frag- ments of adenovirus DNA (results shown in Table II). A small percentage of the radioactivity in the RNA species II sample hybridizes to the BaGI M fragment. This most likely can be attributed to a slight contamination of RNA species II by the 5.5 S RNA component (species I, above). Greater than 90% of the radioactivity which hybridizes is complementary to the BaZI B fragment. These results, in conjunction with our fingerprint analysis, are consistent with the notion that RNA

by guest on Decem

ber 2, 2020http://w

ww

.jbc.org/D

ownloaded from

4124 Transcription of Viral Genes by RNA Polymerase III

Fm. 4. Autoradiograph of two-dimensional eiectrophoretic frac- tionation of the oligonucleotides produced by extensive TI RNase digestion of Vtdo RNA species II. The [ol-‘“P]UTP-labeled RNA was prepared as described in the legend for Fig. 3. Electrophoresis was from left to right on cellulose acetate paper (pH 3.5) and from bottom to top on DEAE-cellulose paper in 7% formic acid (pH 1.8). Assign- ment of the labeled oligonucleotides is based on a gradicule developed by Brownlee and Sanger (16).

component II of VI40 RNA synthesized in isolated nuclei is identical to VA RNAii.

Sequence Analysis of the V2, RNA Species-In a previous report (3), we demonstrated that the Vzw RNA was distinct from other adenovirus-associated RNAs on the basis of its slower electrophoretic mobility in acrylamide gels under de- naturing or nondenaturing conditions. This is also evident in Figs. 1 and 3 of this report. The DNA sequences coding for the VZOO RNA species were also shown to map between 0.18 to 0.38 fractional lengths of the viral genome (on the SmaI B fragment). When VZOO RNA is hybridized to BamHl restric- tion enzyme fragments of adenovirus DNA, it displays se- quence homology to both fragments B (0 to 29.1) and D (29.1 to 40.9) (data not shown). This suggests that the DNA se- quences coding for V200 RNA span the same site of the adenovirus genome as do those which encode 5.5 S RNA (12).

A fingerprint analysis of VZOO RNA labeled by [(u-~P]CTP and digested with T, RNase is shown in Fig. 5A. The resultant oligonucleotides were subjected to electrophoresis in the DEAE-cellulose dimension for longer time periods (up to 21 h) to increase the resolution of the larger oligonucleotide fragments. As expected, the overall fingerprint pattern is strikingly similar to 5.5 S RNA (see Fig. 2.4); however, three

differences are routinely detected. First, two distinct spots appear in the region expected for a trinucleotide composed of U, C, and G (designated 10 and 10’). Second, a smear of radioactive components remains unresolved near the origin of the second dimension. This region is indicative of larger oligonucleotide sequences which may contain three or more UMP moieties. Third, the characteristic 3’-OH fragment from a T, RNase digest of 5.5 S RNA, CpUpCpCpUpUou (spot 45), is never present in the fingerprint patterns of Vnm RNA.

Only one qualitative difference is observed when the pan- creatic RNase digest patterns of [a-“2P]CTP-labeled Vlr,6 RNA (Fig. 2B) and Vzm RNA (Fig. 5B) are compared. This is an additional spot (11’) in the V2~ RNA pattern in the region expected for a trinucleotide composed of adenosine, guano- sine, and cytidine. Molar ratios of the individual pancreatic RNase digestion products of Vztxr RNA are presented in Table I (column 4). Several oligonucleotides common to both RNA species appear in the Vzoo RNA sequence at greater concen- trations. Thus there are an additional 2 mols of Cp (No. 1) and Up (No. 2), 5 mol of GpCp (No. 5), 1 or 2 mol of GpGpCp (No. 13), and possibly 1 mol of GpApApCp (No. 21)/mol of Vzoo RNA. Both fingerprint patterns exhibit a small amount of the oligonucleotide GpGpGpCp, which is believed to rep- resent the product of hydrolysis of the expected 5’-terminal fragment of 5.5 S RNA digested by pancreatic RNase (11).

On the basis of these data, our working hypothesis for the origin of Vzoo RNA is that RNA polymerase III initiates transcription at the same DNA site as for 5.5 S RNA, but that it continues through the usual termination site for 5.5 S RNA and transcribes for an additional 30 to 40 nucleotides. Re- cently, Weissman’s laboratory has determined the DNA se- quences at and beyond the 3’-OH terminus of VA RNA1 (18). A portion of these sequences is presented in Fig. 6. A sequence of six deoxythymidylic acid moieties is present 38 nucleotides beyond the sequence encoding the 3’ end of 5.5 S RNA. The 38 nucleotides between these two sites are predominantly G- C-rich. Should Vzoo RNA span the sequence of DNA up to the second stretch of polydeoxythymidylic acid residues, then digestion of VZW RNA by T1 RNase would result in two unique uridine-rich oligonucleotides. These are the read-through of the 5.5 S RNA termination sequence, CpUpCpCpUpUp- UpUpGp, and the II-nucleotide sequence, CpUpUpCpCp- UpUpCpCpApGp, which follow immediately thereafter.

Resolution of large oligonucleotides, especially those which contain several UMP moieties, is best achieved by the use of homochromatographic techniques (16). Homochromatogra- phy patterns of the T1 RNase digestion products of VlB6 and Vzoo RNAs (labeled by [a-“‘PIUTP) are presented in Fig. 7, A

and B, respectively. Similar patterns are observed as well

TABLE II

Hybridization of [a-“LP]UTP-labeled V,SG, RNA and VI40 RNA species II wcth fragments of adenovirus 2 DNA obtained after

cleavage with restriction endonuclease Ball

Map positions of the adenovirus 2 DNA fragments are based on an endonuclease cleavage map of the adenovirus 2 genome reported by Klessig (20). DNA filter hybridizations were performed as described under “Experimental Procedures.”

DNA

RNA Input counts per min

Fragment Counts per

Position min hy- bridized

VlM 50,625 Ball D 21.5-28.5 49 BaZI M 28.5-29.4 878 Bali B 29.4-50.0 96

v1no-II 8,650 Bali D 21.5-28.5 0 Ball M 28.5-29.4 100 Bali B 29.4-50.0 937

by guest on Decem

ber 2, 2020http://w

ww

.jbc.org/D

ownloaded from

Transcription of Viral Genes by RNA Polymerase III 4125

FIG. 5. Autoradiograph of two-dimensional electrophoretic frac- cellulose acetate paper (pH 3.5) and from bottom to top on DEAE- tionation of the oligonucleotides produced by extensive TI RNase cellulose paper in 7% formic acid (pH 1.8). Electrophoresis in the digestion (A) and extensive pancreatic RNase digestion (B) of VZQ DEAE-cellulose dimension of the TI RNase digest of V’s00 RNA was RNA. The [a-“P]CTP-labeled VsMj RNA was prepared as described maintained for 21 h as opposed to 12 h for the other RNA species in the legend for Fig. 1. Electrophoresis was from left to right on (see Figs. 2A and 4).

3’ END OF 5,5S RNA -I +10 +20 +30 +40 5’GCTCCTTTTGGCTTCCTTCCAGGCGCGGCGGCTGCTGCGCTAGCTTTTTTGGC3’

LOT x41 ISPOT x1-J L-l 11’

FIG. 6. Sequence of nucleotides adjoining the 3’-OH-terminal sequences of 5.5 S RNA (VA RNA,) (18). The sequences are those present in the nontranscribed strand of DNA.

when the RNA species are labeled with either [w”~P]CTP or -GTP. The overall homochromatographic patterns of these two RNA species are quite similar with the exception of two unique spots designated 1 and 4 in the Vzoo RNA pattern in the region characteristic of uridylic acid-rich oligonucleotides. Sequence analysis of the T1 RNase digest products of Vzoo RNA by secondary cleavage with pancreatic RNase is pre- sented in Table III. The VZ~ RNA sequence contains all of the T1 RNase fragments derived from the internal sequences of 5.5 S RNA. In addition, the compositions of Fragments 4 and 1 are consistent with the sequences of the aforementioned uridylic acid-rich oligonucleotides (labeled in Fig. 6) derived from the 3’-OH terminus of 5.5 S RNA and the first 15 nucleotides beyond. Increased molar ratios of GpCp (Spot 5) and GpGpCp (Spot 13) in the pancreatic digests of Vzw RNA (see Table I, column 4) are most likely derived from the GC- rich region 16 to 34 nucleotides beyond the VA RNA1 terminus. The position of Spot 11’ (Fig. 5B), unique to the pancreatic RNase digest fragment pattern of Vzoo RNA, is consistent with

that expected for the trinucleotide sequence AGC which just precedes the second stretch of deoxythymidylic acid moieties in the DNA sequence. That the V2m RNA sequence continues through the six deoxythymidylic acid residues to the following guanylic acid moiety is unlikely since no corresponding T1 RNase digest product is observed in any homochromatogra- phy patterns of Vzcw, RNA.

DISCUSSION

Studies of RNA synthesis in isolated nuclei have permitted the determination of specific RNA polymerase functions (re- viewed in Ref. 21), the quantitation of rates of RNA synthesis during physiological transitions (21), and the analysis of as- pects of transcription (e.g. identification of promoter sites (22)) which may be more difficult to examine via an analysis of RNA synthesis in intact cells. In some cases the initiation and termination of RNA chains by endogenous RNA polym- erases, presumably at natural promoter and terminator sites, has been reported (3, 10, 23, 24). An understanding of tran-

by guest on Decem

ber 2, 2020http://w

ww

.jbc.org/D

ownloaded from

Transcription of Viral Genes by RNA Polymerase III

FIG. 7. Homochromatography of T1 RNase digest of Vrs6 RNA (A) and VOW RNA (B) labeled by incorporation of [(Y-‘r’P]UTP. Both RNA species were prepared as described in the legend of Fig. 1. Electrophoresis was from left to right on Cellogel (pH 3.5) and chromatography in homomixture B (16) was from bottom to top for 10 h at 66°C.

scriptional controls will ultimately depend on the ability to reconstruct similar specific transcription events in more puri- fied systems. Hence it is crucial to know the extent to which natural initiation and termination events are preserved or altered under in vitro (cell-free) transcription conditions.

A major objective of the present work was to analyze the fidelity of viral gene transcription by RNA polymerase III in nuclei isolated from adenovirus 2-infected cells. The low mo- lecular weight viral RNAs transcribed in this system have been rigorously analyzed and compared to in vivo transcripts by fingerprint analysis and by restriction endonuclease map- ping to the viral genome. In the case of the 5.5 S RNA, the major in vitro and in vivo transcripts appear to contain identical nucleotide sequences. This strongly suggests that natural initiation and termination signals on the VA RNA1 gene are recognized by the RNA polymerase III in vitro. Moreover the uniform labeling of the in vitro transcript, including the 5’- and 3’-terminal oligonucleotides, suggests that virtually all the in vitro transcripts arise from in vitro chain initiation events. Earlier studies had also demonstrated the initiation and termination of 5.5 S RNA chains in vitro, but did not clearly establish the fraction of newly initiated chains nor the precise terminal sequences (10).

The VI40 RNA which is synthesized in isolated nuclei (3) has been fractionated into several components, one of which appears similar, if not identical, in sequence to the VA RNAii isolated from intact cells. In isolated nuclei this component is synthesized in a low molar yield relative to that of the VIBfi RNA, in agreement with the relative rates of accumulation of the corresponding in vivo transcripts (3, 12, 13). Thus, tran- scription of the VA RNA, and VA RNArr genes in vitro appears qualitatively and quantitatively the same as observed in vivo, implying the preservation of some transcriptional controls. The disparate molar ratios of the respective gene products also suggest independent initiation and termination sites for the respective genes, although there is no conclusive information regarding separate initiation site of the VA RNAii gene (see also “Results”). Since the VA RNAn gene has been mapped some 100 or so nucleotides past the 3’ terminus of the VA RNA1 gene, it is not inconceivable that VA RNAn is derived from a continuous transcript of the VA RNA, and VA RNA11 genes. However, this seems unlikely in view of the observations discussed in this and in the following paragraphs.

The viral RNA of approximately 200 nucleotides (V,,) which is synthesized in isolated nuclei (3) by RNA polymerase III has also been characterized by fingerprint analysis and homochromatography. This RNA species represents a tran- script of the VA RNA1 gene as well as some 38 to 40 nucleo- tides adjacent to the 3’ terminus of this gene. Although the precise termination site within the known DNA sequence of this region is not clear, it apparently lies within a stretch of 6 deoxythymidylic acid residues which are located some 38 nucleotides beyond the 3’-OH terminus of 5.5 S RNA. This stretch of deoxythymidylic acid moieties is preceded by a guanylic acid/cytidylic acid-rich region, This sequence orga- nization bears a striking resemblance to several known pro- karyotic termination sites. These sites are characterized by a stretch of 6 to 7 deoxythymidylic acid residues, within which the bacterial RNA polymerase terminates, preceded by a G- C-rich region (25,26). The termination site for 5.5 S RNA also resembles this sequence but to a lesser extent since the stretch of deoxythymidylic acid residues numbers only 4, and is preceded by a relatively short G-C-rich region (11). A question of obvious importance is why two supposed termination sig-

TABLE III

Analyses ofproducts of extensive Tl RNase digestion of Vzm RNA (Fig. 7B)

Primary a- “P-la- Ti

Pancreatic

RNase ,~$$ RNase diges-

product” sor tion products Sequence deduced

lh

2

3

4’

6

8

14

16

17

18

19

20

23

25

32

UTP U,C CTP U,C GTP AG UTP AAAU,AU CTP U GTP C UTP AC,C,U,G CTP A,U GTP C UTP U,C CTP U,C GTP U,G UTP AU CTP AU,G UTP AU CTP AU,C,G GTP U UTP U CTP AC,G GTP C UTP AU CTP AU,C,U GTP C.G UTP AU CTP AU GTP AU,G UTP U,C GTP G,U UTP C CTP AG,AU,C,U GTP AG UTP C GTP U UTP G CTP C UTP G CTP C,G

CPUPUPCPCPUPUPCPCPAPGP

APUPAPAPAPUPUPCPGP

APCPUPCPUPUPCPCPGP

CPUPCPCPUPUPUPUPGP

UPAPUPCPAPUPGP

APUPCPCPAPUPGP

UPUPAPCPCPGP

APUPCPCPGP

APUPCPAPUPGP

UPCPUPGP, UPUPCPGP

APUPCPGP, CPUPAPGP

CPUPGP

CPCPGP

CPGP

CTP AAC,AC APCPAPAPCPGP

n The numbers refer to the oligonucleotides shown in Fig. 7B. * This oligonucleotide fragment is the second U-rich readthrough

product beyond the 3’-OH end of 5.5 S RNA (see Fig. 6, +5 to +15). ’ This T, digest fragment results from readthrough of the 5.5 S

RNA termination signal. The first six nucleotides comprise the normal 3’-OH TI digest product of 5.5 S RNA.

by guest on Decem

ber 2, 2020http://w

ww

.jbc.org/D

ownloaded from

Transcription of Viral Genes by RNA Polymerase III 4121

nals for RNA polymerase III would be positioned only 35 nucleotides apart in the adenovirus genome. It is possible that the V2(x) RNA results from fortuitous readthrough of the 5.5 S RNA termination signal by RNA polymerase III, which then proceeds downstream to the second termination signal. I f the lengths of the deoxythymidylic acid stretch and the preceding G-C-rich region determine the strength of the ter- mination signal, then the second site would represent a stronger terminator. Thus the juxtaposition of two termina- tion signals may well be a mechanism used to prevent aberrant transcription by RNA polymerase III of 3’-distal gene se- quences which are otherwise transcribed by RNA polymerase II (4,27,28). The extent to which such a mechanism might be used in vivo is as yet unclear since the presence of an in vivo RNA analogous to Vzca RNA is not currently established. An alternative explanation for the genesis of V2(x) RNA is that this transcript represents the primary transcript of the 5.5 S RNA gene and that its detection in vivo is precluded by a rapid turnover, i.e. conversion to 5.5 S RNA. This would demand that the responsible processing system be present and active in isolated nuclei.

Low molecular weight RNAs with extended 3’ termini have also been reported in other systems. Thus extended 5 S RNA molecules have been isolated from cultured Drosophila cells after heat shock (29) and from cultured Xenopus Zaevis oo- cytes (30). As with the viral RNA transcripts, it is not clear whether these observed products reflect primary transcripts (precursors to 5 S RNA) or whether they reflect readthrough of normal termination sites as a result of adverse physiological conditions.

While the physiological significance of the V2m RNA is admittedly unclear, the demonstration of a potential precursor to the 5.5 S RNA suggests the possibility of a novel function(s) for this transcript. For example, the VZtX1 RNA may be local- ized strictly within the nucleus and the turnover (i.e. process- ing) of this RNA could be coupled with some nuclear function. If such were the case, the appearance of 5.5 S RNA (in the cytoplasm) might simply be fortuitous. Since no functions have yet been defined for either of the VA RNA species, no possibilities can be discounted.

Achnowledgments-We thank Dr. Sherman Weissman for com- municating to us, at a critical stage of our experiments, his results concerning the DNA sequences beyond the 3’-OH termination site of 5.5 S RNA. We are also grateful to Dr. Weissman and members of his technical staff for instructing us in RNA sequencing techniques.

REFERENCKS

1. Weinmann, R., and Roeder, R. G. (1974) Proc. Natl. Acad. Sci. lJ. S. A. 71, 1790-1794

2. Weil, I’. A., and Blatti, S. I’. (1976) Biochemistry 15, 1500-1509 3. Weinmann, R., Brendler, 7’. G., Raskas, H. J., and Roeder,.R. G.

(1976) Cell 7, 557-566 4. Weinmann, R., Raskas, H., and Roeder, R. G. (1974) Proc. Natl.

Acad. Sci. U. S. A. 71, 3426-3430 5. Parker, C. S., and Roeder, K. G. (1977) Proc. Natl. Acad. Sri. 1J.

S. A. 74,44-48 6. Sklar, V. E. F., and Roeder, R. G. (1977) Cell 10,405-414 7. Jaehning, J. A., and Roeder, R. G. (1977) J. Biol. Chem. 252,

8762-8771 8. Parker, C. S., Jaehning, J. A., and Roeder, R. G. (1978) Cold

Spring Harbor Symposium Quant. Biol., in press 9. Ohe, K., Weissman, S. M., and Cooke, N. K. (1969) J. Biol. Chem.

244,5320-5332 10. Price, R., and Penman, S. (1972) J. Virol. 9, 621-626 11. Ohe, K., and Weissman, S. M. (1971) J. Biol. Chem. 246,

6991-7009 12. Mathews, M. B. (1975) Cell 6, 223-229 13. Soderlund, H., Pettersson, IJ., Vennstrom, B., I’hilipson, L., and

Mathews, M. B. (1976) Cell 7, 585-593 14. Craig, K. A., and Raskas, H. J. (1974) J. Virol. 14, 26-32 15. Palmiter, R. I). (1974) Biochemistry 13, 3606-3615 16. Brownlee, G. G. (1972) in Laboratory Techniques in Biochemis-

try and Molecular Biology (Work, T. S., and Work, E., eds) Vol. 3, Part I, North-Holland/American Klsevier, Amsterdam

17. McGrogan, M., and Raskas, H. J. (1977) J. Virol. 23, 240-249 18. Celma, M. L., Pan, J., and Weissman, S. M. (1977) J. Biol. Chem.

252,9032-9042 19. Celma, M. L., Pan, J., and Weissman, S. M. (1977) J. Biol. Chem.

252,9043-9046 20. Klessig, D. F. (1977) Cell 12, 9-21 21. Roeder, R. G. (1976) in RNA Polymerases (Losick, R., and

Chamberlin, M., eds) pp. 285-329, Cold Spring Harbor Labo- ratory, Cold Spring Harbor

22. Evans, R., Fraser, N., Tiff, E., Weber, ,J., Wilson, M., and Darnell, J. E. (1977) Cell 12, 733-739

23. McReynolds, L., and Penman, S. (1974) Cell 3, 185-188 24. Marzluff, W. F., Murphy, E. C., ,Jr., and Huang, R. C. C. (1974)

Biochemistry 13, 3689-3696 25. Lebowitz, I’., Weissman, S. M., and Radding, C. (1971) J. Biol.

Chem. 246, 5120-5139 26. Sklar, J., Yot, I’., and Weissman, S. M. (1975) Proc. Natl. Acad.

Sci. Ii. S. A. 72, 1817-1821 27. Weber, J., Jelinek, W., and Darnell, J. I%, Jr. (1977) Cell 10,

611-616 28. Goldberg, S., Weber, J., and Darnell, J. E., <Jr. (1977) Cell 10,

617-621 29. Rubin, G. M., and Hogness, 1). S. (1975) Cell 6, 207-213 30. Denis, H., and Wegnez, M. (1973) Biochimie 55, 1137-1151

by guest on Decem

ber 2, 2020http://w

ww

.jbc.org/D

ownloaded from

B Harris and R G RoederRNA polymerase III in nuclei from adenovirus 2-infected cells.

Structural relationships of low molecular weight viral RNAs synthesized by

1978, 253:4120-4127.J. Biol. Chem. 

  http://www.jbc.org/content/253/12/4120Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/253/12/4120.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on Decem

ber 2, 2020http://w

ww

.jbc.org/D

ownloaded from