Structure and role of P. aeruginosa
AlgL in alginate biosynthesis
Steven Wong
A thesis submitted in conformity with the requirements for the degree
Master of Science
Department of Biochemistry, Faculty of Medicine
University of Toronto
© Copyright by Wong, Steven 2016
II
Structure and role of P. aeruginosa
AlgL in alginate biosynthesis
Steven Wong
Master of Science
Department of Biochemistry, Faculty of Medicine
University of Toronto
2016
Abstract
During chronic infection, Pseudomonas aeruginosa generate alginate-containing
biofilms in the lungs of cystic fibrosis patients. Mature bacterial alginate is a
heteropolymer of α-L-guluronic acid and partially acetylated β-D-mannuronic acid. P.
aeruginosa alginate biosynthesis requires thirteen proteins, including an alginate lyase,
AlgLPa, which has been proposed to have a bi-functional role, both as a lyase and as an
integral part of the cell envelope biosynthetic complex. How AlgLPa performs these
functions is currently poorly understood. We have used an in vitro structure-function
approach to explore the substrate recognition and catalytic mechanism of AlgLPa, and in
vivo complementation to explore the role of its activity in alginate biosynthesis. The
results presented suggest that AlgLPa is an endo-acting lyase with at least six subsites,
and that the loop containing K66 is critical for substrate binding and/or catalysis. The
complementation data supports the hypothesis that AlgLPa assembles into the cell
envelope biosynthetic complex.
III
Acknowledgements
There are too many individuals to list who have guided my professional and
academic development. I would like to first thank all my previous research supervisors
including Drs. Jeremy Wulff, Steve Perlman, Frank van Veggel, and Al Boraston.
Starting out as an eager undergrad in first year, it was their belief in me that gave me the
confidence to continue my research and academic pursuits. Their continuous support led
me on this path towards the Howell Lab. Dr. P. Lynne Howell and my committee
members, Drs. Jean-Philippe Julien and Charles Deber, continued that level of support
and helped guide and challenge me to achieve my maximum potential. Although I started
graduate studies to further my academic and professional development, I truly feel I have
gained much more because of their guidance and supervision.
Of course, I would not be successful without my lab members. Thanks to all those
who helped me realize failure is never the end, but an opportunity to reflect on how to
adapt to the challenges present. These great individuals include Dr. Roland Pfoh, Dr.
Perrin Baker, Dr. Kristin Low, Dr. Laura Riley, Dr. Sarah Kennedy, Dr. Dustin Little,
Erum Razvi, Lindsey Marmont, Greg Whitfield, Andreea Gheorghita, and the countless
co-op and summer students. Finally, I would like to give a big thanks to Dr. Stephanie
Tammam. On top of teaching me most technical skills and creating a welcoming
environment as a new student, she always challenged me to reflect on my work and see
everything as a larger scope. I cannot thank these individuals enough. Science succeeds
by the efforts of a team and the leadership of mentors along the way.
IV
Table of Contents
Chapter 1: Introduction 1 1.1 Biofilms 1
1.1.1 Biofilm function 1
1.1.2 Biofilm matrix components 3
1.1.3 Pseudomonas aeruginosa 5
1.2 Exopolysaccharides 6
1.2.1 P. aeruginosa biofilm exopolysaccharides 6
1.2.2 Psl Function, biosynthesis, and export 9
1.2.3 Pel function, biosynthesis, and export 11
1.2.4 Alginate 12
1.2.5 Alginate biosynthesis and export 13
1.3 Alginate system and alginate lyases 14
1.3.1 Alginate trans-envelope complex 14
1.3.2 Function and role of AlgLPa in the trans-envelope complex 15
1.3.3 Classification of alginate lyases 18
1.3.4 Catalytic mechanism and polysaccharide lyase subsites 19
1.4 Previous Work and Project Overview 21
1.4.1 Previous work 21
1.4.2 Project goal and thesis objectives 23
Chapter 2: Structural and Functional Characterization of AlgLPa 25 2.1 Materials and methods 25
2.1.1 Chemicals, bacterial strains, plasmids, and growth media 25
2.1.2 DNA manipulations 28
2.1.3 In vitro expression and purification of AlgL 28
2.1.4 Production of AlgL antibodies 29
2.1.5 Crystallization and structure determination of AlgL K66A 30
2.1.6 Structural analysis and sequence analysis of AlgL and A1-III 31
2.1.7 Protein-substrate computational modeling 31
2.1.8 Mass spectrometry product analysis 32
2.1.9 In vivo growth curve 32
2.1.10 Western blot analysis 33
2.1.11 Purification of alginate 33
2.1.12 Quantification of uronic acid 34
2.2 Results 35
2.2.1 Expression, purification and crystallization of AlgL constructs 35
2.2.2 K66A structure and function of the AlgL lid loop 39
2.2.3 AlgL contains at least six subsites 43
2.2.4 AlgL is an endo-lyase 46
2.2.5 Growth of P. aeruginosa is unaffected by an altered AlgL catalytic activity
during alginate production 48
2.3 Discussion 51
2.3.1 Molecular mechanism of AlgL catalysis 51
2.3.2 AlgL is a component of the trans-envelope complex 53
2.3.3 Model of AlgL in alginate biosynthesis and export 55
V
Chapter 3: Conclusions and Future Directions 58 3.1 Conclusions 58
3.2 Future Directions 58
3.2.1 Structural determination of AlgLPa-substrate complex 59
3.2.2 Further characterization of in vivo variants 59
3.2.3 Uncover trans-envelope complex protein-protein interactions 60
References 61
Appendix 76
VI
List of Tables
Table 1: Enzyme kinetic data for AlgLPa
Table 2: PolyManA substrates used for mass spectrometry and crystallization
trials
Table 3: Primers used for generation of in vivo variants
Table 4: Summary of data collection and preliminary refinement statistics for
AlgL K66A.
Table 5: O-propyl product molecular weights and corresponding signal in mass
spectrometry
Table 6: Quantification of uronic acids produced by PAO1 WPA complemented
strains
20
26
27
38
48
55
VII
List of Figures
Figure 1: Biofilm-driven bacterial defense mechanisms used against antibiotics
Figure 2: Chemical composition of alginate, Pel and Psl polysaccharides.
Figure 3: Schematic models of the P. aeruginosa alginate, Pel, and Psl
biosynthetic complexes and psl, pel, and algD operon.
Figure 4: Contrasting phenotypes of P. aeruginosa ΔalgL.
Figure 5: Convention for subsite labeling of polysaccharide lyases and proposed
alginate lyase catalytic mechanism
Figure 6: Structure of P. aeruginosa AlgLPa WT with emphasis on active site
residues and their putative function.
Figure 7: In vitro specific activity of AlgLPa variants.
Figure 8: SDS-PAGE analysis of the AlgL purification protocol
Figure 9: AlgL K66A crystals produced from crystallization screen and condition
optimization
Figure 10: Surface representation and cartoon model of AlgL K66A.
Figure 11: Structural comparison of lid loop in P. aeruginosa AlgL and
Sphingomonas species A1-III
Figure 12: AutoDock Vina free energy binding scores of AlgL-ManA model
Figure 13: Subsite identification by AutoDock Vina
Figure 14: Potential AlgL- ManA4-O-propyl products based on specific subsite binding
Figure 15: PAO1 WPA growth curve and AlgL and Δ Western blot analysis
Figure 16: Revised model for the role of AlgL in the trans-envelope complex
Figure A1: Electrospray mass spectrum obtained in the negative mode for an
aqueous ammonium acetate solution of ManA4-O-propyl
Figure A2: Mass spectrometry spectrum obtained in the negative mode for the AlgL
WT digestion of ManA4-O-propyl
2
6
8
16
19
21
22
37
38
42
43
45
46
48
50
57
60
60
VIII
List of Abbreviations
AP Alkaline phosphatase
AUC Analytical ultracentrifugation
BLI Biolayer interferometry
dp Degree of polymerization
CF Cystic fibrosis
c-di-GMP bis-(3’,5’)-cyclic-dimeric-guanosine monophosphate
CAZy Carbohydrate-active enzymes
DMSO Dimethyl sulfoxide
DNA Deoxyribonucleic acid
dNTP Deoxyribonucleotide
dTDP-rhamnose Thymidine diphosphate rhamnose
ECM Extracellular matrix
eDNA Extracellular DNA
EPS Extracellular polymeric substance
ESI Electrospray ionization
GDP-Man Guanosine diphosphate mannose
GDP-ManA Guanosine diphosphate mannuronic acid
GmR Gentamicin resistance
GulA α-L-guluronic acid
GT Glycosyltransferases
HEPES N-(2-hydroxyethyl)piperazine-N’-(2-ethansulfonic acid)
His6 Hexahistidine
IM Inner membrane
ITC Isothermal titration calorimetry
LB Lysogeny broth
LIC Ligation-independent cloning
ManA β-D-mannuronic acid
MATE Multidrug and toxic compound extrusion transporter family
MR Molecular replacement
MS Mass spectrometry
IX
MW Molecular weight
Ni2+
NTA Nickel nitrile-triacetate
OM Outer membrane
PAGE Polyacrylamide gel electrophoresis
PCR Polymerase chain reaction
PEG Polyethylene glycol
PG Peptidoglycan
PL Polysaccharide lyase
PNAG poly-β-1,6-N-acetyl-D-glucosamine
polyGulA Poly-guluronic acid
polyManA Poly-mannuronic acid
polyManAGulA Poly-mannuronic and -guluronic acid
rmsd Root mean square deviation
SAXS Small-angle x-ray scattering
SDS Sodium dodecyl sulfate
Tris Tris(hydroxymethyl)aminomethane
TPR Tetratricopeptide repeat
UDP-glucose Uridine diphosphate-glucose
WT Wild-type
1
Chapter 1: Introduction
1.1 Biofilms
1.1.1 Biofilm function
Bacteria facing fluctuating environmental stresses and stimuli frequently undergo
physiological changes. These stimuli can trigger bacteria to switch between two different
life forms: the free-swimming single-celled planktonic state or the heterogeneous multi-
cellular community embedded within a self-produced matrix or biofilm state [1-3]. The
biofilm matrix is composed of various extracellular polymeric substances [4] that serve
individual and/or synergistic functions. Bacterial growth within a biofilm promotes cell-
to-cell communication, population heterogeneity, and protective properties that result in
increased tolerance to antibiotics, the host immune response and detergents [5-12]. The
advantages conferred by growth within biofilms has led to the discovery of bacterial
biofilms in a range of different environments including oil storage and transfer containers
[13] and the International Space Station [14]. These biofilms can lead to industrial
biocorrosion: accelerated corrosion of metallic materials caused by the metabolic activity
of microorganisms [13]. Pathogenic bacteria can also develop biofilms within animal
hosts [15]. While the planktonic bacterial lifestyle is typically associated with acute
infections, biofilms are frequently involved in chronic conditions due to the advantages
conferred by this lifestyle. Biofilm-related infections place a heavy burden on the
healthcare system through its involvement in chronic infection and biofilm formation on
medical devices [16]. Biofilm-related infections are estimated to be present in up to 80%
of human bacterial infections [15].
The tolerance of bacteria within a biofilm to antibiotic treatment occurs through a
number of mechanisms: limited nutrient penetration, decreased effective concentration of
antibiotics, the presence of persister cells, and the secretion of antibiotic-active enzymes
[3, 17-27]. The dense biofilm matrix limits the diffusive properties of all compounds.
2
This creates a gradient, such that at the center of the biofilm, there is a low pH
environment with low O2 and high CO2 partial pressures. Compared to the biofilm
periphery, the biofilm interior is starved of nutrients and as a result, bacterial growth and
metabolism is significantly reduced. Many antibiotics target active bacterial cellular
processes and therefore their susceptibility to antibiotics is reduced (Figure 1A) [17].
Limited diffusion within the matrix also decreases the concentration of exogenously
added antibiotics at the biofilm core. Since threshold concentrations of antibiotics are
required to inhibit bacterial growth, the exposure of cells within the interior of the biofilm
to sub-minimal inhibitory concentrations of antibiotics promotes the growth and enriches
for antibiotic resistance of these cells (Figure 1B) [18].
Figure 1: Biofilm-driven bacterial defense mechanisms used against antibiotics. A:
Nutrients deprivation. B: Limited antibiotic diffusion. C: Presence of persister cells. D:
Secretion of antibiotic inhibiting enzymes. These mechanisms or biofilm characteristics
minimize the effectiveness of antibiotics against biofilms. Adapted from an image from
http://www.biofilm.montana.edu/.
Nutrient depletion creates an altered microenvironment
with decreased cellular activity
Slow diffusion
limits the amount of antibiotics
penetrating the interior of the
biofilm
Subpopulations secrete enzymes to render antibiotics ineffective to the
biofilm community
Heterogeneity increases the
number of persister cells with inherent antibiotic
resistance
A D
B C
3
The metabolic variation among bacteria within biofilms also aids growth during
infection. Persister cells are dormant and metabolically inactive, but differ from nutrient-
deprived cells by the mechanism of cellular inactivity [21]. Persister cells can be
generated by environmental stimuli including stresses to the cell membrane that can
trigger a cascade activating the expression of cognate toxins [22]. The expression of these
toxins can also be stochastically activated independent of environmental stresses to
produce dormant persister cells [23]. These toxins can inactivate metabolic processes and
can create a subpopulation of dormant cells. This inactive phenotype allows bacteria to
persist through antibiotic treatments. Once the antibiotic dosage is no longer lethal, a
subset of the persister cells will revert to the metabolically active state by a stochastic
mechanism that produces opposing antitoxins. These antitoxins will disable the effects of
the toxins to transition the once persister cells to a metabolic active state (Figure 1C)
[24].
Another subgroup of cells is able to secrete enzymes that degrade antibiotics,
hence benefiting the biofilm community as a whole (Figure 1D) [28]. This resistance
mechanism is coordinated by cell-to-cell communication or quorum sensing [25-27].
Combined, these mechanisms complicate biofilm-associated bacterial infections.
1.1.2 Biofilm matrix components
The extracellular polymeric substance (EPS) that comprise the biofilm matrix
include extracellular DNA (eDNA) [29], proteins, exopolysaccharides, and non-
polymeric compounds including lipopolysaccharides and rhamnolipids. The composition
of the EPS varies depending on environmental conditions and bacteria within the biofilm
[30-33]. eDNA, released from lysed bacterial or host cells, [32] can contribute to the pool
of eDNA in the biofilm and can serve as a public good that contributes to the growth of
the bacterial population [34-37]. Bacteria can uptake these polymers, thus contributing to
the sharing of genetic elements among biofilm-bound cells [30] or the nutritional needs
of the bacteria [38]. eDNA can also provide other functions. Discovered by nucleolytic
enzyme treatment on biofilms, cell-to-cell interactions are mediated by eDNA [39].
These polymers also chelate positive ions to generate a unique electrochemical
4
environment, which results in induction of a cationic antimicrobial peptide resistance
operon in P. aeruginosa [40].
Protein components associated with biofilms serve a variety of functions and
include extracellular proteins, cell surface adhesins, and cell appendages such as flagella,
pili, and fimbriae [41]. Secreted and surface-attached proteins contribute to the
development and stabilization of the mature biofilm architecture [42]. Secreted amyloid
repeats or cell-attached appendages aid initial cell-surface interactions [43], while
exopolysaccharide binding lectins [44] and eDNA binding pili [45] mediate cell-matrix
interactions. Secreted enzymes can also hydrolyze or degrade matrix components. This
degradation potentially serves a nutritional need, and it also allows for remodeling of the
biofilm thus facilitating detachment of the bacteria from the biofilm matrix, and a switch
to a planktonic lifestyle [29, 46-48].
Exopolysaccharides, which vary in charge, size, monosaccharide composition,
and chemical modifications, contribute to the structure and integrity of the biofilm, and
bacterial survival during host infection [49-52]. Carbohydrate polarity assists in water
retention in the biofilm [53]. The network of non-covalent interactions between hydroxyl
groups contributes to the robust nature of biofilms [54]. Glycosidic linkages affect
polysaccharide flexibility. For example, β-1,4 or β-1,3 bonds confer more rigidity, as is
seen in the cellulosic backbone of xanthan from Xanthomonas campestris, while the α-
1,2 or α-1,6 linkages found in many dextrans yield more flexible structures [55]. The
charge of the polysaccharide can also play a direct function. For example, anionic P.
aeruginosa alginate has been demonstrated to protect bacteria from aminoglycosides
antibiotics by directly binding and sequestering the cationic drug [56]. Certain
polysaccharides have also been shown to impede specific host immune system
components. Polysaccharide-I [9] or dextran secreted by Burkholderia cenocepacia have
been shown to interfere with the function of human neutrophils in vitro by directly
interfering with their chemotaxis function [57]. Carbohydrate modifications also
contribute to pathogenesis and/or biofilm properties. The acetyl groups of cepacian,
which contains one to three acetyl groups per trisaccharides repeat [58], was determined
to protect Burkholderia cepacia during infection by resisting the effects of reactive
oxygen species and reducing the susceptibility of cepacian to enzymatic degradation [59].
5
Deacetylation of poly-N-acetyl-glucosamine also plays a role in resistance against
neutrophil phagocytosis and cationic antimicrobial peptides, and is required for proper
surface attachment [60]. These structural and chemical properties illustrate the diversity
of exopolysaccharides that contribute to the prevalence of biofilms in many different
environments.
1.1.3 Pseudomonas aeruginosa
P. aeruginosa is an opportunistic Gram-negative pathogen capable of both
aerobic and anaerobic growth. P. aeruginosa is notorious for biofilm formation and is
difficult to eradicate when it adopts this growth lifestyle. The continued use of antibiotics
drive the evolution of efflux pumps in P. aeruginosa that give rise to inherent antibiotic
resistance [61]. The bacteria’s poorly permeable outer membrane and production of β-
lactamases also renders antibiotics ineffective [10]. The antibiotic resistance and growth
over a large temperature range allows P. aeruginosa to grow ubiquitously within soil,
water, man-made environments, and animal and plant surfaces [62]. The industrial effects
of P. aeruginosa include corroding and blocking pipelines, contaminating water, and
attaching to and damaging marine vessels [63, 64].
P. aeruginosa is primarily harmful to the health of plants and animals. Soft-rots
on vegetation [65] and root-based biofilm infections [4] have been linked to P.
aeruginosa and affect the agricultural production of tomatoes, onions, and beans. P.
aeruginosa also affects the health of human subpopulations including immunodeficient,
hospitalized, [66], and burn wound patients [67]. Complications of P. aeruginosa
infections include keratitis [66], dermatitis [68], and urinary [69] and respiratory tract
infections [70]. Chronic P. aeruginosa biofilm-associated infections are the leading cause
of morbidity and mortality in the cystic fibrosis (CF) patient population [70-73]. The
impact that P. aeruginosa biofilms have on industry, agriculture, and human health
illustrates the importance of understanding the mechanisms required for initial and
sustain growth within a biofilm.
6
1.2 Exopolysaccharides
1.2.1 P. aeruginosa biofilm exopolysaccharides
P. aeruginosa is genetically capable of synthesizing at least three
exopolysaccharides important for biofilm formation: alginate, Pel, and Psl
polysaccharides (Figure 2) [74]. In P. aeruginosa PAO1, Pel has been determined to
localize near the base of a biofilm where it interacts with eDNA [75], while Psl is found
typically at the periphery [76]. Atomic force microscopy on the biofilm material of an
alginate over-producing strain, P. aeruginosa FRD1, resulted in the visualization of
loosely coated material assumed to be alginate [74]. These three P. aeruginosa
exopolysaccharide biosynthesis and export is categorized as synthase-dependent or
Wzx/Wzy-like mechanisms [74].
Figure 2: Chemical composition of alginate, Pel, and Psl polysaccharides. P.
aeruginosa alginate is a random polymer of β-1,4 linked GulA and partially acetylated
ManA. Pel is a random 1,4 linked polymer of partially acetylated N-acetylglucosamine
and N-acetylgalactosamine, while Psl is a branched penta-saccharide repeat containing
glucose, mannose, and rhamnose.
Alginate Random polymer
Ac
Pel Random polymer
Psl
Repeat Polymer
Mannose
Rhamnose
Glucose Glucosamine
Galactosamine
Guluronic acid Mannuronic acid (ManA)
N-acetyl Glucosamine
N-acetyl Galactosamine
6 6
β4 β4 β4 β4 β4 β4 β4
2 and/or 3 4 4 4 4 4 4 4
β3 β3 β3 β3 β3 β3 β3
7
Synthase-dependent exopolysaccharide systems have four hallmark proteins or
protein domains: a membrane-embedded glycosyltransferase (GT), a bis-(3’,5’)-cyclic-
dimeric-guanosine monophosphate (c-di-GMP) receptor, a tetratricopeptide repeat (TPR)
containing protein, and a β-barrel porin [77]. The inner-membrane bound GT uses
activated sugar-nucleotide precursors to polymerize and translocate the polysaccharide
across the inner membrane. These systems also contain an inner-membrane embedded
co-polymerase regulated by c-di-GMP. Upon localization to the periplasmic space,
chemical modifications such as acetylation, deacetylation, and/or epimerization may
occur. A TPR containing protein is proposed to protect the polysaccharide from
degradation and assist in its extracellular export via the β-barrel porin [77].
Wzx/Wzy-like biosynthesis and export, named based on the Wzx and Wzy
proteins involved in group 1 capsular polysaccharide in E. coli, involves multiple proteins
and moieties: a polyisoprenoid lipid undecaprenol diphosphate acceptor, GT, flippase,
polysaccharide polymerase, polysaccharide co-polymerase, and α-helical outer membrane
polysaccharide export protein. GT’s polymerize and attach defined oligosaccharide
repeats to a polyisoprenoid lipid undecaprenol diphosphate acceptor bound to the
cytosolic leaflet of the inner membrane. An inner membrane-embedded flippase
translocates the oligosaccharide repeat to the periplasmic space, where a polymerase joins
the oligosaccharide repeats together to produce a high molecular weight polysaccharide.
This system also contains a family of proteins called polysaccharide co-polymerases with
complex functions not necessarily confined to polymerization [78]. However, all known
polysaccharide co-polymerases interact with an α-helical outer membrane export protein
to secrete the polymer [74, 77, 79, 80].
Deletion of critical exopolysaccharide biosynthesis and/or export genes in P.
aeruginosa in any of the aforementioned systems reduces its virulence [81-83]. These
findings have generated interest in targeting P. aeruginosa exopolysaccharide
biosynthesis and/or export proteins to address chronic infection, especially those
suffering from CF.
8
Figure 3: Schematic models of the P. aeruginosa alginate, Pel, and Psl biosynthetic complexes and psl, pel, and algD operon.
Known protein functions are coloured according to the legend above. A: psl operon genes contributing to synthesis and export of Psl.
B: Proteins encoded by the pel operon required for Pel production, C: Twelve algD operon proteins and AlgC involved in alginate
biosynthesis and export. Established alginate protein-protein interactions are indicated by black and white diamonds [81, 83-90]. P.
aeruginosa AlgL (AlgLPa) is proposed to be part of the trans-envelope complex but to date this has not been experimentally verified.
Protein stoichiometry for complex formation is not known. See text for details related to the role of each protein in the three
biosynthetic systems. ECM, Extracellular matrix; OM, outer membrane; PG, peptidoglycan, IM, inner membrane.
9
1.2.2 Psl Function, biosynthesis, and export
After the discovery of Psl in P. aeruginosa PAO1, it has since been identified in a
number of other P. aeruginosa strains, where it is typically the primary
exopolysaccharide within the biofilm [91, 92]. Gas chromatography–mass spectrometry
and nuclear magnetic resonance experiments have revealed that Psl is composed of a
branched penta-saccharide repeat unit (Figure 2) [93]. Deletion of essential psl genes
suggests that for many strains of P. aeruginosa, Psl promotes initial surface attachment
during biofilm formation [91]. A comparison between Psl overproducing and Psl
deficient strains also found that the polysaccharide can directly impair macrophage and
neutrophil function [94]. In recent static and continuous-flow biofilm experiments, it was
determined that Psl provides a first line defense against antibiotics due to its diverse
biochemical properties, especially during early biofilm formation [95]. During this stage
of biofilm formation, specific P. aeruginosa strains utilize Psl to mediate cell-cell
interactions to anchor bacterial cells [76]. Psl antibodies have also been isolated from
patients recovering from P. aeruginosa infections, demonstrating its clinical relevance
[96].
The Psl operon encodes twelve protein products (Figure 3A). Due to the predicted
structural similarities between PslA, PslE, and PslD from the Pel system, and WbaP,
Wzc, and Wza from the Escherichia coli group 1 capsular polysaccharide Wzy-
dependent system, respectively, the Psl system is proposed to function similarly to this E.
coli system [78]. Biosynthesis begins with the production of three activated precursors,
guanosine diphosphate mannose (GDP-Man), uridine diphosphate-glucose (UDP-
glucose), and thymidine diphosphate rhamnose (dTDP-rhamnose). The production of
UDP-glucose is initiated by the phosphoglucomutase activity of AlgC, which catalyzes
glucose-6-phosphate to glucose-1-phosphate [97]. Nucleotide carrier activation by GalU
completes the production of UDP-glucose [93]. The rml operon encodes genes required
for the production of the sugar nucleotide dTDP-rhamnose [93]. The production of GDP-
Man requires AlgC and the bifunctional PslB. PslB isomerizes fructose-6-phosphate to
mannose-6-phosphate. Mannose-1-phosphate is subsequently produced by the
phosphomannomutase activity of AlgC. PslB then transfers GDP and produces GDP-Man
[93]. Interestingly, PslB was found to be functionally redundant as pslB deletion mutants
10
are able to produce Psl due to the catalytic action of WbpW. This redundancy may also
suggest that PslB can produce precursors for other pathways [93].
The four predicted cytosolic GTs within the psl operon are PslI, PslF, PslH [98],
and PslC [99]. PslI, PslF, and PslH are classified according to the Carbohydrate-Active
Enzymes (CAZy) database as member of GT family 4 (GT-4) [100]. Phyre2 [101]
predictions suggest these putative GT’s are structurally related to PimA, a Mycobacteria
GT-4 [102]. PslC is predicted to belong to family GT-2 [99]. At present, the specific
substrates and reactions catalyzed by these enzymes are unknown.
Similarities between PslA and WbaP suggest that PslA provides the site for the
assembly of the pentasaccharide-repeat unit onto an isoprenoid lipid on the cytosolic side
of the inner membrane. Similar to the function of the Wzx flippase and Wzy polymerase,
PslK, PslJ, and PslL are proposed as functional flippases or polymerases [74]. However,
the specific functions are not known. PslE is the predicted polysaccharide co-polymerase
and proposed to be involved in both polymerization and to interact with the putative α-
helical outer membrane export protein, PslD. This parallels the determined function and
role of Wzc and Wzy, respectively.
Although little is currently known about the function and role of PslG, it has been
shown to exhibit in vitro hydrolytic activity towards Psl [103]. Furthermore, while not
essential for synthesis, overexpression of PslG in vivo has been observed to impair
biofilm formation [103]. PslG is proposed to function similarly to the non-essential endo-
glycases, ExoK and ExsH from the Gram-negative bacterium Sinorhizobium meliloti [7].
ExoK and ExsH are proposed to produce lower molecular weight polysaccharides that
serve as signaling molecules to promote symbiosis with its host plants [104, 105]. PslG
may similarly produce low molecular weight Psl as a signaling molecule to affect Psl
production [106]. This mechanism may be linked to c-di-GMP, a secondary messenger
signaling molecule that has been found to promote Psl production by an unknown
mechanism [107, 108].
11
1.2.3 Pel function, biosynthesis, and export
Pel contributes to biofilm formation at air-liquid interfaces; these biofilms are
called pellicles. Transposon screening identified the seven gene pel operon as required
for pellicle formation (Figure 3B) [82]. Through analytical glycosyl sugar and linkage
analysis, Pel was recently determined to be a 1-4 linked polymer of N-acetylglucosamine
and N-acetylgalactosamine. The polymer is assumed to be partially de-N-acetylated by
the deacetylase activity of PelA to produce a polymer with a net positive charge (Figure
2) [75]. Although the majority of the research on Pel biosynthesis and export focuses on
P. aeruginosa, bioinformatics studies indicate the presence of homologous operons in
other bacteria including Ralstonia solanacearum [109], Burkholderia terrae [110], and
Marinobacter aquaeolei [111]. Studies suggest Pel is involved in early stage biofilm
adherence [109], maintaining cell-to-cell interactions, and serving as the primary
structural scaffold in P. aeruginosa PA14 biofilms [112]. Since P. aeruginosa PA14 is
unable to produce Psl, it is proposed that Pel serves a structural role in this strain. The Pel
polymer has also been found to contribute to P. aeruginosa infections, and enhance
resistance to aminoglycoside antibiotics by an unknown mechanism [112]. The recently
demonstrated interaction between Pel and eDNA in an in vitro biofilm and Pel with host
polymers such as hyaluronic and mucin in vitro suggests Pel impacts pathogenesis [75].
Although characterization of Pel biosynthesis and export is currently in its early
stages, collective data suggests this process is synthase-dependent like alginate, poly-β-
1,6-N-acetyl-D-glucosamine (PNAG), and cellulose systems [77]. Bioinformatics
analyses and binding analyses suggest PelF is a member of GT-4, and uses a UDP-sugar
as the substrate [74, 75, 98]. It is hypothesized that the TPR of PelE [112] may interact
with PelA and PelB [74]. This complex may also associate with the co-polymerase PelD,
which was shown to regulate polymerization though binding of the secondary messenger,
c-di-GMP, to its degenerate GGDEF domain [113, 114]. PelD and PelE are believed to
assemble as a complex and be required for the regulation of biosynthesis and
translocation across the inner membrane. Collective data have shown that PelA is
bifunctional with both deacetylate and hydrolase activity [115, 116]. The role of PelA
deacetylase is currently unknown. The function of PelG is unknown, but bioinformatics
studies suggest it may be a member of the multidrug and toxic compound extrusion
12
transporter family (MATE), which are known to shuttle small molecules across the inner
membrane [74]. This shuttle system may be involved in modifying the Pel polymer.
At the outer membrane, PelB is predicted to contain an N-terminal periplasmic
TPR domain and C-terminal β-barrel [27]. The periplasmic TPR is thought to facilitate
interactions with other Pel proteins. As suggested for other synthase-dependent systems
PelB likely facilitates complex formation and acts as a conduit for export of the polymer
[74]. PelC has a lipid anchor and has been proposed to share structural similarity to the
periplasmic domain of E. coli TolB. TolB interacts with a peptidoglycan-associated
lipoprotein and is suggested to maintain outer membrane integrity [117]. Another
hypothesis is that PelC contains an α-helical region involved in membrane insertion
[118]. More research is required to better understand the role of many of the proteins in
this system.
1.2.4 Alginate
In 1881, alginate was first extracted and discovered in seaweed [119]. Alginate
depositions in the cell walls of brown algae or Phaeophyceae offer structural support to
the organism [120]. The chemical structure of alginate was determined to be a random
polymer of ManA and its C5’ its epimer GulA in algae [121, 122]. The anionic properties
imparted by virtue of the GulA and ManA uronic acids allows alginate to associate with
divalent cations such as calcium and magnesium to increase intermolecular bonding
[123]. More recent studies have demonstrated alginate biosynthesis and export in
Azotobacter [124] and Pseudomonas spp. [125] where the polymer is involved in the
formation of desiccation resistant cysts [126, 127] and biofilm formation, respectively. P.
aeruginosa alginate contributes to biofilm structural integrity and water retention of the
biofilm matrix [120, 128]. P. aeruginosa alginate producing strains display a
characteristic mucoid phenotype that is common in isolates from CF patients suffering
from chronic infection [91, 129]. Bacterial alginates also have additional O2’ and/or O3’
acetylation modifications, which reduce alginate solubility [55]. Acetylation affects the
thickness of the biofilm and results in decreased nutrient diffusion [55]. Alginate
acetylation has been suggested to contribute to inter- and intra-polysaccharide
13
interactions. These interactions contribute to the tensile strength of the biofilm and
impacts the overall architecture and structure of the biofilm [130]. These functions of
alginate acetylation affect the resilience of the biofilm and improve pathogenesis [55,
130]. O-acetylation was determined to contribute to chronic lung infection by directly
hindering macrophage function [11]. Alginate epimerization also affects the cohesive
properties of the biofilm [131] and impairs complement functions of the immune system
[12]. The integral role alginate plays in CF P. aeruginosa biofilm-linked infections has
resulted in a significant amount of interest in studying the pathogen’s alginate
biosynthesis and export mechanism.
1.2.5 Alginate biosynthesis and export
Alginate biosynthesis and export in P. aeruginosa requires twelve proteins
encoded by the algD operon, and AlgC encoded elsewhere on the chromosome (Figure
3C) [74, 132]. Alginate biosynthesis begins with AlgC, AlgD, and the bifunctional
enzyme AlgA. The phosphomannose activity of AlgA isomerizes fructose-6-phosphate to
mannose-6-phosphate [125]. AlgC subsequently generates mannose-1-phosphate [133],
which is activated to guanosine diphosphate-mannose by AlgD [134]. This compound is
converted to guanosine diphosphate mannuronic acid (GDP-ManA) by AlgA [125].
GDP-ManA is proposed to be polymerized and transported across the inner membrane by
Alg8 and Alg44 [99, 135-137]. Alg8 is classified as a GT-2 [138] that catalyzes the
polymerization of ManA [90], and interacts with the co-polymerase Alg44. Structural
studies, in vitro binding analyses, and in vivo alginate quantification assays have
demonstrated that alginate polymerization requires binding of c-di-GMP to the
cytoplasmic PilZ domain of Alg44 [136].
The linear nascent ManA polymer is subsequently modified as it passes through
the periplasm. To produce the mature polymer, ManA can be selectively epimerized by
AlgG [139] or acetylated at its O2’ and/or O3’ hydroxyl by the action of AlgI, AlgJ, AlgF
and AlgX [107, 140]. It is proposed that AlgI transfers an, as yet unidentified, acetyl
donor across the inner membrane [74] that is catalyzed by the acetylesterase activity of
either AlgJ or AlgX [107] and/or passed between them before alginate acetylation occurs.
In vitro AlgJ does not bind to alginate [107]. In contrast the ability of AlgX to directly
14
bind to and exhibit acetyltransferase activity towards alginate suggests AlgX is the
terminal enzyme that acetylates the nascent polymer [107]. ΔalgF strains were found to
produce non-acetylated polymer, suggesting its involvement in alginate acetylation [140].
The structure of the outer membrane lipoprotein AlgK has been determined and
was found to contain 9.5 TPR motifs [141]. As described in more detail below, AlgK
along with AlgG, Alg44, Alg8, AlgX, and AlgLPa, are proposed to form a trans-envelope
complex that guides alginate through the periplasm (Figure 3C) to allow export of the
polymer through the highly electropositive β-barrel porin, AlgE [107, 141-144].
1.3 Alginate system and alginate lyases
1.3.1 Alginate trans-envelope complex
The presence of an alginate trans-envelope complex was first proposed during
characterization of in vivo knockouts in two P. aeruginosa mucoid strains FRD1 or
PDO300. P. aeruginosa FRD1 and PDO300 contain genetically different non-functional
mutations in mucA. MucA is an anti-sigma factor that suppresses AlgU (also known in
the literature as algT) [145], the sigma factor required for transcription of the algD
operon. FRD1 is a clinically isolated strain while PDO300 was genetically engineered
from the non-mucoid P. aeruginosa PAO1 strain.
P. aeruginosa FRD1 and PDO300 Δalg44 [89] and Δalg8 [90] strains do not
produce alginate or free uronic acids. It was proposed that deletion of the GT or co-
polymerase prevents alginate polymerization. In contrast, P. aeruginosa FRD1 and
PDO300 ΔalgK [87], FRD1 ΔalgX [84], FRD1 ΔalgG [87], and PDO300 ΔalgE [85]
strains were found to secrete degraded alginate products. These observations led to the
hypothesis that a trans-envelope complex formed by these proteins protects the
polysaccharide from degradation. Deletion of any of the trans envelope components
disrupts the complex, thereby exposing the polysaccharide to AlgLPa, the alginate lyase,
which in turn hydrolyses the polymer to produce short uronic acids. Subsequent in vivo
pull-down experiments have shown an interaction between AlgK and AlgX [86], while
more recent mutual stability analysis suggests interactions between: AlgG-Alg8, AlgG-
15
AlgK, Alg44-Alg8, Alg44-AlgK, Alg44-AlgX, and AlgK-AlgE (Figure 3C) [88]. These
findings relate to the trans-envelope complex help guide on-going work in our lab that
aims to determine its detailed molecular mechanism.
1.3.2 Function and role of AlgLPa in the trans-envelope complex
AlgLPa was initially proposed to regulate alginate polymer length, but no data
currently supports this role [146]. The hypothesis that AlgL regulates alginate polymer
length would suggest that the combination of AlgI, AlgJ, AlgF, and AlgX, AlgG, and
AlgLPa function on nascent polymer to produce mature alginate of a regulated length
prior to export. AlgLPa has also been suggested to act on mature alginate by aiding in
dissemination from adhered surfaces, as induced cells overexpressing AlgLPa were
observed to exhibit greater cell sloughing compared to non-induced cells [147]. Finally,
two groups have proposed that AlgLPa interacts with other proteins in the trans-envelope
complex [81, 83]. The methods used by these two groups to generate and analyze algL
deletion strains are different. In each case, the P. aeruginosa FRD1 strain was used and
the algD operon promoter replaced with an isopropyl β-D-1-thiogalactopyranoside
(IPTG) inducible promoter. Both studies deleted the majority of algL. A gentamycin
resistance (GmR) cassette with its intact promoter but without its transcriptional stop site
was subsequently inserted into algL. In addition to the production of full-length
polycistronic mRNA with all alginate genes and the GmR cassette, the production of
mRNA containing only the GmR cassette and downstream genes, algIJFA, will result.
The presence of an antibiotic resistance cassette with an independent promoter is known
to increase expression of downstream genetic elements [148].
Albrecht et al. [81] characterized an algL, ΔalgL, and ΔalgL::algL strain. In all
three strains the algD operon promoter was replaced with a Ptac promoter. In addition, the
ΔalgL and its in trans complemented strain ΔalgL::algL WT have replaced algL with a
GmR cassette. Another complementation strain was produced by introducing an
enzymatically inactive variant or algL in trans. Because of the plasmid copy number,
complementation in trans will also increase the amount of translated AlgL. Growth was
characterized after induction on solid media plates. The algL strain appeared non-lethal
16
and mucoid upon induction of alginate production (Figure 4A) and non-lethal and non-
mucoid in the absence of IPTG [81]. The ΔalgL strain was non-lethal and non-mucoid
upon induction (Figure 4B), and the mucoid phenotype was restored when complemented
in trans with WT algL (Figure 4C). In contrast, the mucoid phenotype was not restored
by complementation in trans using catalytically inactive algL variants [81]. The authors
proposed catalytically active AlgLPa is required for alginate production.
In contrast, Jain et al. [83] replaced the algD operon promoter with Ptrc and
inserted a different GmR cassette. This ΔalgL strain was characterized by induction in
liquid rather than solid media and the cell morphology was assessed by electron
microscopy. This strain was observed to be lethal upon induction of alginate production,
a phenotype that the authors suggested was due to the accumulation of periplasmic
alginate (Figure 4D-F).
17
Figure 4: Contrasting phenotypes of P. aeruginosa ΔalgL. Top (ABC): Interruption of
algL results in a non-mucoid phenotype, which can be rescued by complementation with
algL WT. The absence of a mucoid phenotype upon deletion of AlgLPa is proposed to
result from a disassembled trans-envelope complex. This would prevent alginate
production. Bottom (DEF): Knockout strain produced a conditionally lethal phenotype,
which displayed swelled membranes after 4 hours and lysed cells after 6 hours. Figure
reproduced from references [81, 83], with permission from the Journal of Bacteriology
and Immunity and Infection. Copyright © 2005, American Society for Microbiology.
algL ΔalgL ΔalgL::algL
‘
0 h 4 h 6 h
‘
A
D
B CA
E F
18
The data from Albrecht et al. [81] and Jain et al. [83] suggest different models for
AlgL function. Albrecht et al. [81] suggested an absence of AlgLPa results in a non-
functional alginate biosynthetic system that is incapable of producing alginate. This
finding would support a model in which the Alg8/Alg44 complex, required for alginate
polymerization, is influenced by the presence of AlgLPa. In contrast, Jain et al. [83]
suggested AlgLPa is not required for alginate production. This observation does not
support the involvement of AlgLPa in the biosynthesis of the Alg8/Alg44 complex.
Although these models of alginate biosynthesis differ, both groups hypothesize that in the
absence of AlgLPa, the trans-envelope biosynthetic complex does not form. However, as
described above there are important caveats to each experimental design that potentially
imbalance the stoichiometry of the alginate system. This likely impacts the phenotypes of
the strains and therefore how the data can be interpreted. With the availability of more
modern genetic methods we have developed new ΔalgL strains to overcome the pitfalls
of these experiments; the phenotypes of these ΔalgL strains have been characterized in
this thesis to understand the role and function of AlgL (section 2.2.5).
1.3.3 Classification of alginate lyases
Alginate lyases have been isolated from a variety of different sources including
algae, fungi, and bacteria. Alginate lyases found in organisms lacking alginate
biosynthetic machinery are proposed to provide energy through catabolism and digestion
of extracellular alginate produced by other organisms [149]. The growing number of
identified and characterized alginate lyases has allowed a variety of different
classification systems to be developed that help compare these enzymes [150]. Defined
by the CAZy database on the basis of primary sequence identity, alginate lyases have
been classified into seven specific polysaccharide lyase (PL) families: PL-5, PL-6, PL-7,
PL-14, PL-15, PL-17, and PL-18 [151, 152]. AlgLPa is classified as a member of PL-5.
This characterization allows for comparisons between AlgLPa and other family members,
such as the A1-III alginate lyase from Sphingomonas sp., which has been structurally and
functionally characterized [153].
19
Alginate lyases are further sub-characterized by substrate specificity, based on the
degree of alginate epimerization. This has led to the classification of alginate lyases into
broad poly-mannuronic acid (polyManA), poly-guluronic acid (polyGulA) [154], or poly-
mannuronic and -guluronic acid (polyManAGulA) specific lyases. However, alginate
lyases are not necessarily specific for just one polymer and may exhibit modest catalysis
towards other polymer types [150]. Organisms can possess multiple lyases with varying
efficiencies towards different substrates, e.g. the five extracellular alginate lyases found
in Azotobacter vinelandii each exhibit varying catalytic efficiencies on different ManA
and GulA patterns. These lyases are suggested to aid vegetative growth or cyst formation
[155].
1.3.4 Catalytic mechanism and polysaccharide lyase subsites
The catalytic mechanism of alginate lyases begins by the deprotonation of C5’
hydrogen by a catalytic base, B, usually an arginine or an asparagine (Figure 5A). The
generated anionic intermediate is stabilized by a basic residue, N, which is commonly
histidine (Figure 5B). This allows donation of a proton from the catalytic acid, HA, to
form a double bond between C4’ and C5’ and cleave the glycosidic bond (Figure 5B).
The catalytic acid is frequently tyrosine. This results in the production of an enoic acid
and uronic acid (Figure 5C).
PLs also possess a characteristic mode of action, which can be endo- or exo-
acting [149]. To understand the mode of action, it is useful to understand the accepted
labeling system for active site monosaccharide subsites (Figure 5). Positive and negative
integers, excluding zero, denote specific monosaccharide binding subsites within the
active site, with the highest positive integer describing the reducing end of the polymer.
Glycosidic bond cleavage occurs between the +1 and -1 subsites, to produce an uronic
acid at the +1 subsite and enoic acid at the -1 subsite [156]. Alginate lyases that produce
enoic acid monosaccharides released from the -1 subsite are known as exo-lyases. All
other alginate lyases are categorized as endo-lyases.
20
Figure 5: Convention for subsite labeling of polysaccharide lyases and proposed
alginate lyase catalytic mechanism. Positive and negative integers specify
monosaccharide-binding subsites relative to the cleavage site between -1 and +1.
Cleavage of the polymer generates an enoic acid motif at the -1 subsite. Substrate is in
black, enzyme residues and subsites are in green, with the cleavage point indicated by the
pink arrow. The putative AlgLPa catalytic residues are described: B, catalytic base
(AlgLPa R249); HA, catalytic acid (AlgLPa Y256); N, anionic intermediate neutralizer
(AlgLPa H202). Based on an image by Davies et al. [156]. The yellow arrow indicates a
progression in the reaction mechanism.
21
1.4 Previous Work and Project Overview
1.4.1 Previous work
The in vitro biochemical properties of AlgLPa have been characterized previously
[157]. Kinetic studies of AlgLPa using acetylated and chemically deacetylated polyManA
and polyMG polymers purified from P. aeruginosa suggest that the enzyme is specific
for deacetylated polyManA and polyManAGulA as the kcat/Km for each of these
substrates was comparable and higher than observed for the acetylated polymers (Table
1).
Table 1: Enzyme kinetic data for AlgLPa. PolyManA and poly-MG alginate samples
were purified from P. aeruginosa FRD462 and FRD1, respectively. P. aeruginosa
FRD462 contains an algG point mutation and exclusively produces polyManA [158]. The
polymers were deacetylated prior to analysis by base deacetylation using sodium
hydroxide [157]. The polyManA and polyManA-OAc polymers had an average degree of
polymerization (dp) of 133, while polyManAGulA and polyManAGulA-OAc had dp
values of 263. [157].
Substrate kcat/Km (s-1
M-1
) kcat (s-1
) Km (153)
polyM 2.5 ± 0.6 x 106 32 ± 3 13 ± 3
polyM-OAc 0.30 ± 0.06 x 106 1.5 ± 0.1 5 ± 1
polyManAGulA 3.1 ± 0.9 x 106 32 ± 4 11 ± 3
polyManAGulA-OAc 0.5 ± 0.1 x 106 1.2 ± 0.1 2.6 ± 0.7
To further understand the mechanism of action and molecular details for catalysis,
the structure of AlgLPa was determined in our lab by a former postdoctoral fellow, Dr.
Francis Wolfram. Although the crystal for AlgLPa WT was soaked with ManA3, only a
monomer could be modeled in the active site (PDB ID: 4OZV; Figure 6A). Based on the
22
crystal structure and alignments with other lyases, active site variants of AlgLPa were
constructed (Figure 6AB). Y256 was mutated to interfere with its function as the putative
catalytic acid, HA (Figure 5B and 6B). The cationic H202, denoted as N in figure 5B,
was modified to disrupt its potential ability to neutralize the anionic product intermediate.
K66, W205, and Y259 were targeted because of their proposed role in direct substrate
interactions. The specific activities of these AlgLPa point variants towards chemically
deacetylated-polyManA and -polyManAGulA were determined (Figure 7). In contrast to
the data obtained by Farrell et al. [157], this data suggested that AlgLPa exhibits substrate
specificity towards polyManA with only modest activity towards polyManAGulA.
Figure 6: Structure of P. aeruginosa AlgLPa WT with emphasis on active site
residues and their putative function. A: WT AlgLPa in teal complexed with ManA in
purple (PDB ID: 4OZV). B: WT AlgLPa active site residues targeted for site directed
mutagenesis and characterized using an in vitro specific activity assay are indicated in
orange. The proposed role of each specific residue is indicated.
Residue Proposed Role
K66A Direct substrate interaction
H202A Neutralize anionic catalytic intermediate
R249 Catalytic base
Y256F Catalytic acid
W205F Direct substrate interaction
Y259F Direct substrate interaction
A B
W205
Y259 Y256
H202
K66
R249
23
Figure 7: In vitro specific activity of AlgLPa variants. K66A, H202A, R249E, and
Y256F were found to be inactive, while W205F and Y259F variants exhibited
intermediate (Int.) and hyperactive activity, respectively. The substrate was prepared as
described by Farrell et al. [157]. Quantitative data are presented as the mean ± SE and
compared statistically by Student's t-test with n = 3 for all variants. * indicates a p-value
≤ 0.05. Statistical significance in blue and red compare polyManA of WT and polyGulA
of WT to other variants.
1.4.2 Project goal and thesis objectives
Although a function for AlgLPa has been proposed, the molecular details of the
catalytic mechanism and specificity have not been fully characterized. The goal of this
project was therefore to determine the role of AlgLPa in alginate biosynthesis, and the
molecular details for its catalytic mechanism and substrate specificity. To understand the
molecular details of AlgLPa, a structural analysis of an AlgLPa variant and comparison to
WT AlgLPa and a structurally similar alginate lyase were completed. The X-ray structure
determined was complemented with in silico analyses and mass spectroscopy
experiments.
We have also addressed the inconsistencies of the two previous in vivo ΔAlgLPa
experiments outlined above [81, 83]. The function and role of AlgLPa in vivo was probed
using cis complementation of a new unmarked, non-polar algL deletion mutant. Building
0%
50%
100%
150%
200%
WT K66A H202A R249E Y256F W205F Y259F
Sp
ecific
Activity R
ela
tive
to
Alg
L W
T o
n P
oly
M
polyManA polyManAGulA
* . * . * .. . * * . * .
Inactive Int. Activity Hyperactive
*
*
24
on the specific activity assays (Figure 7), a first set of complementation constructs of
point mutants affecting catalytic activity was generated, and the effects of the mutations
on growth and secreted alginate examined. The data described herein have enabled us to
further our understanding of the alginate system. We describe new molecular details for
AlgLPa catalysis and propose a more detailed model of the alginate biosynthetic and
export complex. According to our model, AlgLPa is a component of the trans-envelope
complex and is important for growth during alginate production. In the absence of AlgL,
the Alg8/Alg44 polymerization complex is functional. Interestingly, AlgLPa catalysis is
not essential for viability during alginate biosynthesis and export.
25
Chapter 2: Structural and Functional Characterization of AlgLPa
Chapter 2 describes the materials and methods, results, and discussion of the
structural and functional characterization of AlgLPa. All references to AlgL pertain to
AlgLPa unless otherwise specified. The construction of the His6-AlgL28-362 (residues 28 –
362) vector, all point mutants, the production of AlgL antibodies, and the purification
protocol for the in vitro study were designed by Dr. Francis Wolfram with the assistance
of Ms. Kritica Arora. The ManA4-O-propyl substrate was the generous gift of Drs. Marthe
Walvoort and Jeroen Codée, Leiden University. Mass spectrometry experiments were
completed by Drs. Elena Kitova and John Klassen, University of Alberta. Dr. Roland
Pfoh provided assistance in the structure determination. P. aeruginosa PAO1 WPA and
all materials required to produce in vivo point mutants of algL were provided by Mr.
Gregory Whitfield and Ms. Allison Guitor.
2.1 Materials and methods
2.1.1 Chemicals, bacterial strains, plasmids, and growth media
Chemicals and reagents, unless otherwise stated, were supplied by Sigma-Aldrich
Canada Ltd. (Oakville, ON). Purified ManA4, ManA6, and ManA10, were obtained from
Marine Oligo (Qingdao, China) and ManA4-O-propyl, ManA5-O-propyl, and ManA10-O-propyl
were synthesized and provided by Drs. Marthe Walvoort and Jeroen Codée (Table 2)
[159]. Lysogeny broth (LB) growth media was obtained from Bio Shop (Burlington,
ON). DNA manipulations were performed in E. coli DH5α or Top10, while in vitro
protein expression was performed in E. coli Origami™ 2 (DE3) Singles™ competent
cells from EMD Millipore (Darmstadt, Germany). All DNA manipulations were
confirmed by sequencing at ACGT DNA Technologies Corporation (Toronto, ON). A
two-step in vitro purification procedure was used to generate a homogeneous sample.
Affinity chromatography using Ni2+
- nitrilotriacetic acid (NiNTA) Superflow affinity
26
column obtained from Qiagen (Mississauga, ON) was followed by size exclusion
chromatography using a HiLoad 16/60 Superdex 200 prep-grade gel filtration column
(GE Healthcare, UK). The P. aeruginosa PAO1 ΔwspF Δpsl PBADalg (PAO1 WPA)
strain and pUC18T-miniTn7T-PBADalgL complementation plasmid, pUC18T-miniTn7T-
PBAD control plasmid without algL and the transformation helper plasmid, pTNS2, were
generated and provided by graduate student, Greg Whitfield, and a former co-op student,
Allison Guitor. These plasmids are based on the recombination protocol of Choi et al.
[160]. Primers were ordered for in vivo point mutations from Sigma-Aldrich Canada Ltd.
(Table 3). All P. aeruginosa strains were grown using modified alginate-producing
(MAP) media containing 100 mM monosodium glutamate, 7.5 mM monosodium
phosphate, 16.8 mM dipotassium phosphate, and 10 mM magnesium sulfate [161].
Unless otherwise specified, kanamycin was used at 50 μg mL-1
for E. coli DH5α, Top10,
or Origami™ 2 (DE3) Singles™ competent cells and gentamycin, 30 μg mL-1
for P.
aeruginosa PAO1 WPA.
27
Table 2: PolyManA substrates used for mass spectrometry and crystallization trials.
Synthetic polyManA containing C1’ O-propyl [159] group were used for mass
spectrometry experiments, while crystallization trials used purified polyManA, which
contains a C1’ hydroxyl.
Name
Molecular
Weight
(g mol-1
)
Structure
ManA4 772.51
ManA6 1074.76
ManA10 1779.26
ManA4-O-propyl 764.59
O-
O-propyl
28
Table 3: Primers used for generation of in vivo variants. Non-bolded and non-
underlined characters indicate the native sequence, while bolded letters designate the
codon affected and underlined characters refer to the mutated nucleotides.
Variant Forward Primer (5’ → 3’) Reverse Primer (3’ → 5’)
K66A CACCAGCGCGTACGAAGGCTCCGATTCG CTTCGTACGCGCTGGTGAAGACCAGGCTG
H202A CAACAACGCTTCCTACTGGGCGGCCTGGTCGG CCAGTAGGAAGCGTTGTTGATCTTCTTCAGCGGC
W205F ATTCCTACTTTGCGGCCTGGTCGGTGATGTCC GGCCGCAAAGTAGGAATGGTTGTTGATCTTCTTCAGC
Y259F CTACCACAACTTTGCGCTGCCACCGCTGG GCAGCGCAAAGTTGTGGTAGGCGAGGGCG
2.1.2 DNA manipulations
Cloning of His6-AlgL28-362 WT, K66A, and Y259A on pET28-MHL vector
(Structural Genomics Consortium, Toronto, ON) is as described in Wolfram et al. [162]
and was obtained from Dr. Francis Wolfram. For in vivo complementation, algL point
mutants were generated on the pUC18T-miniTn7T-PBADalgL plasmid using the
QuikChange® Lightning kit. All plasmid constructs were verified by sequencing. PAO1
WPA complementation was performed by electroporation using 150 ng of pUC18T-
miniTn7T-PBADalgL and 150 ng of pTNS2 into PAO1 WPA [163, 164].
2.1.3 In vitro expression and purification of AlgL
Overexpression of WT His6AlgL28–362 and mutant variants was achieved by
transformation of pET28-MHL plasmid vectors into E. coli Origami™ 2 competent cells.
Starter cultures were grown overnight in 50 mL LB broth at 310 K in a shaking
incubator. Two percent (v/v) overnight starter cultures were inoculated in 1 L of LB
broth. Cultures were grown at 310 K until an approximate optical density (OD600) of 0.7.
Cultures were subsequently induced with IPTG to a final concentration of 1 mM and
grown for a further 16 h at 291 K. Cells were isolated by centrifugation at 5000 × g for
20 min at 277 K. The cell pellet was stored at 253 K until needed. The frozen cell pellet
was thawed on ice and re-suspended in 50 mL cold lysis buffer (300 mM NaCl, 50 mM
Tris:HCl pH 7.5, and 10 mM imidazole) containing one SIGMAFAST EDTA-free
protease-inhibitor cocktail tablet. Cells were homogenized with three passes through an
29
Emulsifex C3 (Avestin Inc., Ottawa, ON) at 12,000 psi. The cell lysate was centrifuged at
25000 × g for 30 min at 278 K to pellet cell debris and insoluble material. The soluble
cell lysate was loaded onto a 5 mL Ni2+
-NTA gravity column equilibrated with lysis
buffer. The column was washed with 10 column volumes of lysis buffer, 6 column
volumes of lysis buffer with 75 mM imidazole, and 6 column volumes of lysis buffer
with 300 mM imidazole. The elution sample containing 300 mM imidazole was
concentrated using an Amicon Ultra centrifugation filter device (Milipore, Germany)
with a 30 kDa cutoff. The concentrated sample was further purified by size exclusion
chromatography on a HiLoad 16/60 Superdex 200 gel filtration column in a buffer
containing 150 mM NaCl, 20 mM Tris:HCl pH 7.5, and 5% glycerol. Select fractions
from the Ni2+
-NTA and gel filtration protocol were analyzed by combining equal
volumes of protein sample with SDS-PAGE sample buffer (20% (v/v) glycerol, 126 mM
Tris:HCl pH 8.0, 4% (w/v) sodium dodecyl sulfate, and 0.02% (w/v) bromophenol blue),
boiling at 373 K for 15 min, and loading each sample onto a 16% (v/v) polyacrylamide
gel to determine the purity. Protein concentration was measured using the Pierce® BCA
Protein Assay Kit (Thermo Scientific, Rockford, IL).
2.1.4 Production of AlgL antibodies
The production of α-AlgL antibodies, completed by Dr. Francis Wolfram,
followed a similar protocol to that previously described for α-Alg44 antibodies [136]. In
brief, purified His6-AlgL28-362 (section 2.1.3) was used to generate rabbit antiserum using
a 70-day standard protocol (Cedarlane Laboratories, Burlington, ON). The α-AlgL
antiserum was purified using the method from Salamitou et al. [165]. Purified His6-
AlgL28-362 was overloaded into each lane of a 14% (v/v) polyacrylamide gel and
transferred to a polyvinylidene fluoride (PVDF) membrane. After staining the membrane
with Ponceau S, the His6-AlgL28-362 band was excised and blocked using phosphate-
buffered saline (PBS), pH 7, with 5% (w/v) skim milk powder and 0.1% (v/v) Tween-20
for 1 h at room temperature. The membrane was incubated with α-AlgL antiserum for 16
h at 277 K and 2 h at room temperature and washed with PBS. The membrane was
incubated with 700 μl of 0.2 M glycine, pH 2.2, for 15 min, to elute the α-AlgL
30
antibodies and neutralized with 300 μl of 1 M K2HPO4. Antibodies were dialyzed using
3.5 kDa molecular weight cut-off membrane into PBS for 24 h at 277 K and mixed 1:1
with 100% glycerol. Samples were stored at 253 K until needed.
2.1.5 Crystallization and structure determination of AlgL K66A
Protein samples of the His6AlgL28–362 K66A and Y259A inactive variants were
concentrated to 8 – 24 mg mL-1
. Crystallization trials were set up using a Gryphon LCP
robot with 96-well Art Robbins Instruments Intelli-Plates (Art Robbins Instruments,
Sunnyvale, CA) producing drops of a 1:1 ratio of reservoir solution to protein samples
with or without ~ 2 mM ManA4, ManA6, and ManA10 at a final volume of 2 μL using the
sitting drop method. Commercially available screens from Microlytic (MCSG Suite 1 - 4)
were used during this screening procedure. Plates were stored at 293 K and imaged
periodically using a CrystalMation DT Minstrel Crystal Hotel Imager (Rigaku, Japan). A
His6AlgL28–362 Y259A crystal obtained from the crystallization screen was used with the
Seed Bead Kit (Hampton Research, Aliso Viejo, CA) to generate a microseed stock
solution for matrix screening. This seed stock was used to rescreen all His6AlgL28–362
variants using the streak seeding method. Promising crystallization conditions from the
second screen were optimized by varying precipitant, buffer, and/or salt concentrations
and reservoir solution pH using the Desktop Alchemist™ liquid handling system
(Rigaku, Japan). The crystallization condition was further optimized using the HR2-428
Additive Screen (Hampton Research, Aliso Viejo, CA). Crystal optimization trials on
AlgL K66A were set up by hand using the hanging-drop vapor diffusion method in 48-
well VDX plates (Hampton Research, Aliso Viejo, CA) and stored at 293 K. Specific
crystallization conditions are detailed in sections 2.2.1.
Prior to analysis, AlgL K66A crystals were cryoprotected by soaking them for 30
s in a crystallization solution supplemented with 10 - 20% (v/v) glycerol, ethylene glycol,
or polyethylene glycol (PEG) 400 before vitrification by flash freezing. Approximately 2
mM ManA4 was also included in the cryoprotectant solutions for crystals formed from
crystallization drop without supplemented substrate. Screening and/or data collection was
completed on all frozen crystals using a D8 Venture X-ray Diffractometer (Bruker AXS,
31
Germany) at the Centre for Advanced Structural Analysis (The Hospital for Sick
Children, Toronto, ON) with the assistance of Dr. Roland Pfoh. 510 total image scans of
1˚ oscillations with 60 s exposure times per image were collected using the diffractometer
equipped with a Kappa four-circle goniometer and a Photon 100 detector at a crystal-to-
detector distance of 75 mm. Data was indexed, integrated, scaled and merged using the
Proteum 2 software (Bruker AXS, Germany). The structure was solved by molecular
replacement (MR) with WT AlgL (PDB ID: 4OZV) as the starting model using Phaser
[166]. Translation/Libration/Screw groups used during the refinement were determined
automatically using the TLSMD web server [167]. The electron density maps were of
sufficient quality for subsequent manual model building and the addition of waters using
PHENIX and COOT [168, 169]. Model refinement was performed using
PHENIX.REFINE and progress was monitored by the reduction and convergence of
Rwork and Rfree [168]. All programs for crystallographic data analysis were accessed
through SBGrid [170]. Statistics for data collection and refinement are listed in table 4.
2.1.6 Structural analysis and sequence analysis of AlgL and A1-III
All figures that display the structure of WT AlgL and K66A variant, and the
Sphingomonas spp. A1-III H192A apo- and tetrasaccharide complexed structures (PDB
ID: 4F10 and 4E1Y) were generated using PyMol 1.6.0.0 [171]. Structural and sequence
similarity were determined using PyMol and BLAST [171-173], respectively. Surface
conservation of the structure was computed using the ConSurf server. The multiple
sequence alignment was built using MAFFT which collected homologues from
UNIREF90 with a minimum sequence identity of 35% [174, 175].
2.1.7 Protein-substrate computational modeling
Binding of mannuronate ManA1 to ManA10 homopolymers to WT AlgL were
investigated using AutoDock Vina 2.1.1 [176]. The structure files for the ManA ligands
were constructed using ChemAxon Marvin Sketch (Budapest, Hungary). An AlgL apo-
structure was produced by removing the ManA1 substrate from the WT AlgL:ManA1
structural model (PDB ID: 4OZV). Receptor and ligand PDB files were prepared for
32
docking using scripts provided from MGLTools 1.5.6 [177]. Docking was conducted
with a grid spacing of 0.375 and xyz of 38 × 54 × 34 using a rigid receptor with 10 poses
computed. Graphical representation of the top pose was generated using PyMol.
2.1.8 Mass spectrometry product analysis
The end point digestion of products of ManA4-O-propyl after incubation with WT
His6AlgL28–362 was completed by Drs. Elena Kitova and John Klassen (University of
Alberta). Purified AlgL was dialyzed against 200 mM ammonium acetate pH 7.0 using a
microconcentrator (Millipore Corp., Bedford, MA) with a MW cut-off of 30 kDa and
immediately used. Stock solutions of ManA4-O-propyl were prepared by dissolving the solid
compounds in ultrafiltered water (Milli-Q, Millipore, Bedford, MA) and immediately
used. For the end point digestion assay 67 μM of ManA4-O-propyl was added to 1.7 μM
purified WT His6AlgL28–362 and allowed to incubate for 30 min. Measurements were
carried out on a Synapt G2 quadrupole-ion mobility separation-time of flight mass
spectrometer (Waters, UK) equipped with a modified nanoflow ESI source. The sample
was introduced into the mass spectrometer at an approximate flow rate of 20 – 50 nL/min
and ionized by the ESI source. Ions were accelerated to approximately 2700 V into a 9.4-
T superconducting magnet. A SGI R5000 computer running Bruker Daltonics XMASS,
version 5.0, was used for data collection and analysis [178-180].
2.1.9 In vivo growth curve
The growth of PAO1 WPA ΔalgL and this strain complemented with WT algL
(PAO1 WPA ΔalgL::algL WT), and the K66A, H202A, W205F, and Y259F variants was
investigated. Two percent (v/v) overnight starter cultures were inoculated into 25 mL
MAP media. Growth was monitored every 30 min by measuring OD600. After reaching
mid-logarithmic growth phase at an approximate OD600 of 0.5, aliquots of cell lysate
were isolated for Western blot analysis. Cultures were subsequently induced with L-
arabinose to a final concentration of 0.5% (w/v) and at two hours post induction, aliquots
were again isolated for Western blot analysis.
33
2.1.10 Western blot analysis
Cell lysates for Western blot analyses were obtained as follows. Cell culture
aliquots were normalized by OD600 and centrifuged at 25,000 × g for 10 min to isolate
cell pellets. Cell pellets were combined with SDS-PAGE sample buffer and boiled at 373
K for 15 min prior to loading each sample onto a 16% (v/v) polyacrylamide gel. Bands
were transferred to a polyvinylidene fluoride (PVDF) membrane for immunoblotting
(Bio-rad). The membrane was subsequently blocked using 5% (w/v) skim milk dissolved
in Tris-buffered saline (50 mM Tris:HCl pH 7.5 and 150 mM NaCl) with 0.1% (v/v)
Tween-20 (TBST) for 1 h at room temperature. The membrane was incubated with the α-
AlgL or α-Alg44 antibody at a 1:1000 dilution in TBST at 277 K for 16 h. Blots were
washed three times in TBST then probed with goat α-rabbit horseradish peroxidase
(HRP)-conjugated secondary antibody (Bio-Rad) at 1:3000 dilution in TBST for 1 h at
room temperature. Blots were washed three times in TBST and once with Tris-buffered
saline. AlgL or Alg44 bands were detected using the Super Signal West Pico
chemiluminescent substrate from Pierce (Thermo Scientific, Waltham, MA).
2.1.11 Purification of alginate
Secreted or supernatent alginate was purified from the culture supernatant of
strains PAO1 WPA ΔalgL::algL WT, K66A, H202A, W205F, and Y259F. Samples from
a 25 mL culture after 24 h growth at 310 K in MAP media supplemented with 0.5% (w/v)
L-arabinose were collected. After the addition of one quarter culture volumes of 1.8%
(w/v) sodium chloride, cells were removed from these samples by centrifugation at
25,000 × g for 10 min. The cell pellet was washed with 1 mL of 1.8% (w/v) NaCl three
times and the washes were added to the culture supernatant. The cell pellet was
lyophilized for 24 h and weighed. Five times culture volumes of isopropanol were added
to the culture supernatant and stored at 253 K for 16 h to promote precipitation. The
precipitate was isolated by centrifugation at 25,000 × g for 10 min and lyophilized for 72
h. Samples were stored at 253 K until needed.
34
2.1.12 Quantification of uronic acid
The uronic acid concentration was determined by the carbazole assay [136, 181].
Thirty μL of purified alginate samples, described in section 2.1.11, was mixed with 1 mL
borate-sulfuric acid reagent (100 mM H3BO3 in H2SO4) on ice. Thirty μL of the carbazole
reagent (0.1% (w/v) carbazole in anhydrous ethanol) was added. The solution was heated
to 328 K for 30 min and cooled on ice. Absorbance at 530 nm was measured for each
sample. Brown seaweed alginic acid was used as a standard. The uronic acid yield was
normalized to dried cell mass.
35
2.2 Results
2.2.1 Expression, purification and crystallization of AlgL constructs
To understand the molecular mechanisms for AlgLPa substrate specificity and
catalysis, we attempted to co-crystallize AlgL with ManA4, ManA6, or ManA10 substrates
or produce apo-crystals of the inactive variants that could be subsequently soaked. AlgL
variants were purified to near homogeneity by this strategy (Figure 8). The average yield
of each preparation was approximately 20 – 30 mg. Screening AlgL K66A and Y259A,
inactive variants yielded just one crystallization condition for AlgL Y259A. Single
crystals of this variant grew at 13 mg mL-1
using 0.2 M potassium sulfate and 20% (w/v)
PEG 3350 after 5 days. Upon rescreening with the AlgL Y259A seed stock solution,
AlgL K66A at 16 mg mL-1
produced crystals in the crystallization condition containing
0.2 M potassium sulfate and 20% (w/v) PEG 3350 after 12 days (Figure 9A). Optimized
crystals of the AlgL K66A variant, grown using 0.275 M K2SO4, 19% (w/v) PEG 3350,
and 0.1 M N-(2-hydroxyethyl)piperazine-N’-(2-ethansulfonic acid) (HEPES) pH 6.9
(Figure 9B), were soaked for 10 min with a substrate and cryoprotection solution to yield
a final sample containing a concentration of 2 mM ManA4 and 20% (v/v) PEG 400 by
direct addition to the crystallization drop. The crystal was looped and vitrified for
crystallographic screening and data collection.
The AlgL K66A crystal was first screened to determine the diffraction quality,
unit cell and space group of the crystal. This analysis suggested the AlgL K66A crystal
had an orthorhombic cell. The structure was determined using molecular replacement
using WT AlgL as a search model to 2.50 Å. The Rwork and Rfree are 22.7% and 26.7%,
respectively (Table 4).
36
Figure 8: Representative SDS-PAGE gel of the AlgL purification protocol. A 16%
(v/v) polyacrylamide gel stained with Coomassie G-250 stain displaying the two-step
purification protocol described in section 2.1.3. Lanes: MW, molecular weight markers
(kDa); Ins, insoluble lysate; Sol, soluble lysate; FT, soluble lysate flow through; Wash,
wash using lysis buffer; 75, wash using lysis buffer with 75 mM imidazole; 300, elution
using lysis buffer with 300 mM imidazole; SEC, collected fractions from gel filtration
chromatography. Lanes FT, 75, and 300 are from the Ni affinity chromatography step.
Molecular weight markers at 40 kDa and 35 kDa are labeled. The band representing AlgL
K66A is denoted with an arrow.
AlgL K66A M
W
Ins
So
l
FT
Was
h
75
300
SE
C
40
35
37
Figure 9: AlgL K66A crystals. A: Initial crystallization conditions after screening.
Crystals grew using 16 mg mL-1
of AlgL K66A in 0.2 M potassium sulfate and 20%
(w/v) PEG 3350. B: Optimized crystallization condition used for data collection. Crystals
grew using 16 mg mL-1
of AlgL K66A in 0.275 M potassium sulfate, 19% (w/v) PEG
3350, and 0.1 M HEPES pH 6.9.
200 μm 200 μm
a b
38
Table 4: Summary of data collection and refinement statistics for AlgL K66A.
Data collection AlgL K66A
Wavelength (Å) 1.5406
Temperature (K) 100
Space Group P21212
Unit Cell Parameters (Å,°) a = 67.5 b = 58.7 c = 76.2
= = = 90.0
Resolution (Å) 2.50
Total No. of Reflections 113285
No. of Unique Reflections 10923
Redundancy a
10.3 (7.8)
Completeness (%) 99.3 (100.0)
Average I/σ (I) 16.0 (3.1)
Rmerge b
(%) 9.8 (43.5)
Refinement
Rwork/Rfree (%) c 22.7/26.7
No. atoms
Protein 2468
Solvent 63
Average B-factors (Å2)
Protein 43.4
Water 38.0
Root mean square deviations
Bond lengths (Å) 0.005
Bond angles () 0.70
Ramachandran plot d
Total Favoured 96.8
Total Allowed 100.0
a Values in parentheses correspond to highest resolution shell.
b
Rmerge
= hkl
i |I
i(hkl) – I(hkl)|/
hkl
i I
i(hkl), where I
i(hkl) and I(hkl) represent the diffraction-intensity
values of the individual measurements and the corresponding mean values, respectively.
c
Rwork
= Σ||Fobs
| − k|Fcalc
||/|Fobs
|, where Fobs
and Fcalc
are the observed and calculated structure factors,
respectively. Rfree
is the sum extended over a subset of reflections (5%) excluded from all stages of the
refinement.
d
As calculated using MolProbity [182].
39
2.2.2 K66A structure and function of the AlgL lid loop
Comparison of the AlgL K66A structure (Figure 10) to AlgL WT revealed an
RMSD of 0.368 Å over 316 residues due to its high structural similarity (Figure 11A).
Calculation of electrostatic surface charge using APBS Tools 2.1 plugin within PyMol
[183, 184] and surface residue conservation among other alginate lyases using the
ConSurf server [174, 175] of the AlgL K66A structure revealed a conserved large
positive active site cleft and a variable smaller negative surface outside (Figure 10). This
is perhaps not surprising as the alginate polymer is anionic. Although the electronegative
surface observed is not conserved across other alginate lyases (Figure 10), it may be
important for other interactions critical to the function of AlgL, such as protein-protein
interactions. No density was observed for the soaked substrate in the active site of AlgL
K66A (Figure 11A) and similarly we were unable to model residues 66 – 81 due to the
poor quality of the electron density in this region. This suggests the lid loop in this
structure is flexible. These residues contain a region known as the “lid loop” found in the
WT AlgL model and the structurally similar A1-III alginate lyase from Sphingomonas sp.
comparison of the AlgL K66A structure to WT AlgL and A1-III structure will highlight
the importance of this flexible loop.
The A1-III alginate lyase apo and ManAΔ-GulA-ManA-ManA tetrasaccharide
complexed structures (Δ denotes enoic acid motif from a β-elimination reaction) of the
Sphingomonas sp. H192A mutant (Figure 11B) are available in the PDB (PDB ID: 3EVH
and 4F10, respectively). AlgL WT and A1-III, which adopt a (/)5 fold, share 41% and
26% sequence similarity and identity [172, 173], respectively. Due to the structural
similarity, a comparison of the AlgL WT and A1-III:tetrasaccharide complexed structure
revealed an RMSD of 1.949 Å over 333 residues (Figure 12A). Both A1-III H192A
structures have a mutation in the catalytic histidine, which is equivalent to H202 in AlgL.
The tetrasaccharide in the A1-III structure binds to subsites -1 to +3, and suggests that
AlgL will similarly have at least four putative saccharide binding subsites. All three
structures contain the aforementioned lid loop that spans residues 64 - 78 and 64 - 85 in
AlgL and A1-III, respectively. The lid loop in the AlgL WT and A1-III complexed
structures both cover their substrates with K66 of AlgL and R67 of A1-III, the equivalent
40
conserved residue, directly interacting with the substrate (Figure 11AB). Comparison of
the lid-loop in the A1-III apo-enzyme and complexed structure revealed a 14 Å
movement of the loop (Figure 11B). These data suggest that the lid loop is
conformationally flexible and important for substrate binding [153]. The increased
flexibility of the lid loop in the AlgL K66A structure may impact this function.
Furthermore, in the AlgL K66A structure, residues that comprise the +3 and +2
subsites also displayed changes compared to the AlgL WT structure. In AlgL WT, it is
proposed that F351 binds the -3 subsite C5’ carboxylate, R352 binds the C2’ hydroxyl in
subsite -2, and W146 and E96 play a structural role in the region forming the -2 and -3
subsite, respectively. We were unable to model the side chains of E96, W146, and R352
in the K66A structure, while F351 was found in an alternative conformation. Residues in
+3 and +2 subsites seem to be affected by either the K66A point mutation and/or the
increased disorder observed for residues 66 - 81. This structural data combined with the
lack of enzymatic activity observed (Figure 7) suggests that K66 is critical for the
catalytic function of AlgL.
41
Figure 10: Surface representation and cartoon model of AlgL K66A. Data derived
from crystallographic data. Three identically rotated orientations are displayed for each
type of representation. Top: Cartoon model representation. Centre: Surface residue
conservation of AlgL homologs computed using the ConSurf server by aligning 81
unique sequences [174, 175]. The colour scale of conservation is provided at the bottom
right. Alignment parameters are described in section 2.1.6. Bottom: Electrostatic surface
representation of AlgL K66A. The electrostatic surface was calculated using the APBS
Tools 2.1 plugin within PyMol and is displayed from -5 kT/e (red) to +5 kT/e (blue) with
the scale bar provided at the bottom left [183, 184].
90 °
90 ° 90 °
90 °
90 ° 90 °
42
Figure 11: Structural comparison of lid loop in P. aeruginosa AlgL and
Sphingomonas species A1-III. Overall protein and magnified views of the active site
and lid loop are depicted in the left and right panels, respectively. A: AlgL WT structure
in complex with ManA1 in light purple superimposed to AlgL K66A apo-structure with a
disordered lid loop (represented in a dashed line in the right panel). B: A1-III H192A
structure in complex with ManAΔ-GulA-ManA-ManA tetrasaccharide in magenta
superimposed with A1-III H192A apo-structure revealing the conformational flexibility
of the lid-loop.
K66
P. aeruginosa
AlgL WT Complex & K66A
R67
Sphingomonas sp.
A1-III Complex & Apo
A
B
Lid Loop
Lid Loop
ManAΔ-GulA-ManA-ManA
ManA
43
2.2.3 AlgL contains at least six subsites
To model substrate-protein binding, homopolymers of ManA were docked into
the structure of P. aeruginosa AlgL WT using AutoDock Vina. Analysis of the AlgL-
ManA6 model revealed that seven of the ten solutions bound to similar substrate subsites.
When the in silico hexasaccharide bound structures were compared to the tetrasaccharide
of A1-III, it was found that these structures bound in the same orientation as the
tetrasaccharide in subsites -1 to +3. Of the seven in silico solutions, four solutions bound
to subsites +3 to -3, two solutions bound to subsites +5 to -1, while one solution bound to
subsites +4 to -2. The remaining three solutions bound in positions inconsistent with the
A1-III substrate. The overlapping subsites found in the seven comparable solutions
suggest AlgL contains at least 6 subsites, subsites +4 to -2. Furthermore, the similar
substrate orientation and location between these sets of solutions and the A1-III
tetrasaccharide complexed structure allowed us to validate these six subsites within AlgL
(Figure 13).
Docking of ManA7 produced solutions with comparable binding scores to ManA6.
Comparison of the ten AlgL-ManA7 docking solutions to the six subsites previously
established from the AlgL-ManA6 docking model found that the top five ManA7
solutions bind to the protein at subsites +4 to -2 with the extra monosaccharide pointing
outwards from the active site cleft. This extra monosaccharide did not have any
observable interactions with the protein. This suggests the extra monosaccharide on
ManA7 is not favourably accommodated into the AlgL active site and supports a six
subsites binding cleft. Similar results were found for ManA8, ManA9, and ManA10.
Shorter polymers displayed decreasing binding scores (Figure 13). Together, the
observations that non-interacting monosaccharides heptamers and longer substrate and
decreased binding scores in pentamer and shorter oligosaccharide models suggest ManA6
binding yielded the best solution.
44
Figure 12: AutoDock Vina free energy binding scores of AlgL-ManA model. Values
were calculated using AlgL WT and oligosaccharides of ManA1 to ManA10. The highest
binding score of the ten computed docking solutions are displayed.
0 2 4 6 8 100
5
6
8
10
12
Degrees of Polymerization
Fre
e E
nerg
y (
-kcal/m
ol)
45
Figure 13: Subsite identification by AutoDock Vina. Both representations are in the same orientation. Left: Superimposition of
AlgL WT-ManA6 modeled complex from the second highest binding score solution from AutoDock Vina, and experimentally
determined A1-III-tetrasaccharide complexed structure. Center: P. aeruginosa AlgL WT electrostatic surface showing subsites +4 to
+2. The lid loop covers subsites +1 to -2. Right: Magnified view of P. aeruginosa AlgL WT electrostatic surface with the lid loop
(residues 64 – 78) removed reveals all six subsites, +4 to -2. Electrostatic surfaces were calculated using the APBS Tools 2.1 plugin
within PyMol and displayed from -5 kT/e (red) to +5 kT/e (blue) [183, 184].
P. aeruginosa AlgL WT with ManA6
Sphingomonas sp. A1-III with ManA-ManA-GulA-ManAΔ
P. aeruginosa AlgL WT P. aeruginosa AlgL WT with lid loop removed
+4 +3 +2 +1 -2
-1
Reducing End
+4 +3 +2
46
2.2.4 AlgL is an endo-lyase
ManA4-O-propyl was synthesized by Drs. Martha Walvoort and Jeroen Codee from
Leiden University (Figure A1). The C1’ O-propyl group of the synthetic polymer was
important for product identification as this unique motif is fixed to the reducing end of
the substrate. For the interpretation the AlgL end point assay, in which AlgL was allowed
to digest ManA4-O-propyl for 30 min, it should be noted that cleavage occurs between the +1
and -1 subsite with the substrate’s reducing end orientated towards the -1 and -2 subsites
(Figure 5). Based on the mechanistic understanding of alginate lyases [150], AlgL can
theoretically only cleave ManA4-O-propyl when the O-propyl modified ManA
monosaccharide binds in the -1, -2, or hypothetical -3 subsite to generate ManAΔ1-O-propyl,
ManAΔ2-O-propyl, or ManAΔ3-O-propyl, respectively (Figure 14). From our mass
spectrometry results of the catalytic products, ManAΔ2-O-propyl and ManAΔ3-O-propyl were
observed, while ManAΔ1-O-propyl was not (Table 5). The major difference between these
catalytic events is the vacancy in the -2 subsite during the reaction that would produce
ManAΔ1-O-propyl. These data suggest the -2 subsite must be occupied for catalysis to occur.
Furthermore, the absence of a monosaccharide enoic acid product suggests that AlgL is
an endo-lyase.
47
Figure 14: Potential AlgL- ManA4-O-propyl products based on specific subsite binding.
Potential catalytic reactions on ManAΔ4-O-propyl required to generate ManAΔ1-O-propyl,
ManAΔ2-O-propyl, or ManAΔ3-O-propyl. Subsite binding requirements are specified on the left
with the products on the right. A box indicates the unique O-propyl products used to
confirm the occurrence of each of the three catalytic reactions.
Table 5: O-propyl product molecular weights and corresponding signal in mass
spectrometry. These characteristic products were used to confirm the three potential
catalytic reactions in Figure 14. Product peaks are summarized based on a negative mode
mass spectrometry spectrum (Figure A2).
Product
Name Product Structure
Theoretical
Molecule Weight
(g mol-1
)
Observed
Signal
(m/z)
ManΔ3-O-
propyl 570.1432 569.2255
ManΔ2-O-
propyl 394.1111 393.1638
ManΔ1-O-
propyl 218.0790
Not
Observed
O
H
HO
OHHOOC
O
O
HO
OHHOOC
O
O
HO
OHHOOC
O
O
H
HO
OHHOOC
O
O
HO
OHHOOC
O
O
H
HO
OHHOOC
O
48
2.2.5 Growth of P. aeruginosa is unaffected by an altered AlgL catalytic activity
during alginate production
To understand the effects of point mutations or removal of algL on growth, the
PAO1 WPA ΔalgL strain was complemented with the WT gene (PAO1 WPA
ΔalgL::algL WT), and the K66A, H202A, W205F, and Y259F variants. As a control the
PAO1 WPA ΔalgL strain was also complemented with the empty vector, pUC18T-
miniTn7T-PBAD. After antibiotic selection and gene sequencing to validate the strains, a
growth curve was subsequently completed for all strains. The OD600 of PAO1 WPA
ΔalgL::algL WT, K66A, H202A, W205F, and Y259F complemented strains followed
typical logarithmic growth pre- and post-induction (Figure 15A). The ΔalgL strain
exhibited slower growth compared to the complemented strains before induction. The
OD600 of the ΔalgL strain also decreased after induction. Analysis of AlgL levels by
Western blot before induction revealed low levels of AlgL and Alg44 in the
complemented strains (Figure 15B) suggesting a low level of expression exists from the
PBAD promoter in the absence of arabinose. AlgL and Alg44 levels increased substantially
after induction, with no difference in intensity between WT and mutant AlgL strains
(Figure 15B). In the algL strain, there was no AlgL signal pre- or post-induction. The
level of Alg44 post-induction in the algL strain was comparable to the complemented
strains post-induction.
49
Figure 15: PAO1 WPA growth curve and Western blot analysis. Analysis of PAO1
WPA ΔalgL::algL complemented strains and ΔalgL. A: OD600 of each strain measured
every 30 min over a 10 h time period. The black diamond indicates the time of induction
at mid-logarithmic phase. Blue arrows indicate the pre- and post-induction time points at
which samples were taken for Western blot analysis. The pre-induction sampling
occurred immediately before induction. B: Western blot analyses using AlgL and Alg44
specific antibodies of the indicated strains at mid-logarithmic phase (pre-induction) and 2
h post-induction. The loading control was a non-specific band from the Alg44 Western
blot.
0 2 4 6 8 100.0
0.5
1.0
1.5algL
WT
H202A
W205F
Y259F
K66A
Time (h)
OD
600
Induction with 0.5% (w/v) arabinose
Aliquot isolation for Western blot
A
Δalg
L
WT
K66A
H202A
W205F
Y259F
Post-Induction
AlgL
Alg44
Control
ΔalgL::algL .
Δalg
L
WT
K66A
H202A
W205F
Y259F
Pre-Induction
ΔalgL::algL . B
50
2.2.6 Uronic acid production unaffected by changes in AlgL specific activity
To determine the effects of AlgL point mutations on alginate secretion, the
production of uronic acid was quantified after alginate induction in the PAO1 WPA
variants. To quantify the uronic acid concentration in each sample, including ManA and
GulA, a carbazole assay was performed on purified alginate secreted from the PAO1
WPA ΔalgL::algL WT, and K66A, H202A, W205F, and Y259F variants 24 h post-
induction. Similar amounts of uronic acid relative to the WT strain were produced by
each of the variants tested. The mean of each sample is within one standard deviation of
the mean of the WT strain (Table 6). This suggests that changes in catalytic activity do
not significantly affect the amount of uronic acid produced.
Table 6: Quantification of uronic acids produced by PAO1 WPA complemented
strains. Uronic acid quantification was normalized to total culture cell mass. Mean of six
to ten replicates ± standard deviation. All samples have p > 0.05 compared to AlgL WT
using an unpaired Student’s t-test.
Variant Uronic Acid Secretion/Dry Cell Mass (μg mg-1
)
WT 13 ± 6
K66A 18 ± 4
H202A 11 ± 3
W205F 16 ± 8
Y259F 15 ± 4
51
2.3 Discussion
2.3.1 Molecular mechanism of AlgL catalysis
New molecular details regarding AlgLPa catalysis have been revealed by our
biochemical and structural analyses. Our structural studies of AlgL K66A revealed that
the lid loop is disordered. To further understand the implications of these findings, AlgL
was compared to a structurally similar alginate lyase. A1-III is the only alginate lyase in
which the lid loop has been resolved [153]. It has been suggested that lid loop residue
Y68 (AlgL Y68) lowers the pKa of the key catalytic acid residue Y246 (AlgL Y256) and
forms a hydrogen bond to the substrate-interacting lid loop residue R67 (AlgL K66)
[153]. The lower than expected pKa value of Y246 is speculated to increase the catalytic
efficiency of A1-III [153]. Since the pKa value of tyrosine is typically high, this decrease
in pKa value would promote protonation as its proposed function as a catalytic acid. This
hypothesis is supported by in vitro kinetic studies on a point variant of A1-III. R67 was
demonstrated to interact directly with the substrate at the -1 subsite, which may be
positioned properly by Y68 in A1-III. These data support and can explain the importance
of the lid loop in catalysis [153]. In WT AlgLPa, Y68 interacts with Y256 and K66 in a
similar manner described by Mikami et al. [153]. The structural and sequence similarity
would suggest that AlgLPa Y68 performed a similar function to the comparable residue in
the A1-III structure. However, these suggestions are speculative without enzyme kinetic
data on AlgLPa. It is possible that the lid loop also functions to shield the entry of water
or other small molecules into the active site. This is a well characterized phenomenon in
lipases that require the removal of water from the hydrophobic core by the movement of
a lid structure [185, 186]. Although the chemical requirements for anionic alginate and
hydrophobic lipid binding to their respective enzymes differ, the lid loop may function to
hinder the movement of other small molecules, such as ions and small biomolecules, into
the active site.
Our mass spectrometry end point degradation assay shows that substrate binding
to the -2 subsite is required for catalysis. This data supports an endo-lyase mode of action
for AlgL. Structural analyses of other alginate endo-lyases have found a catalytic groove
52
with an opening at both ends [187]. It is hypothesized that the openings at both ends of
the catalytic groove allow substrates to continuously move though the enzyme during
catalysis. This characteristic catalytic groove, also found in AlgL, may contribute to the
ability of the protein to translocate alginate through the periplasmic space. A similar
hypothesis was suggested to occur for the two-domain deacetylase protein, PgaB, from E.
coli involved in the biosynthesis of PNAG [188]. PgaB was found to contain an extended
binding cleft with at least 12 subsites located between its interdomain linker and the C-
terminal domain. It was suggested that PNAG continuously binds and moves through the
PgaB active site cleft to facilitate translocation of the polysaccharide through the
periplasmic space. The extended active site of AlgL could similarly contribute to alginate
translocation if it forms a trans-envelope complex with other alginate proteins. This
hypothesis is further supported by the openings at both ends of the catalytic groove
observed in the AlgL structure. A requirement for this hypothesis would be that the rate
of movement through the active site cleft is more rapid than the rate of catalysis on the
long polymer [188].
Our in silico model of AlgL found six subsites suggesting at least six saccharide
binding subsites are contained in the AlgL active site cleft. An extended active site cleft
with multiple subsites is common for alginate lyases. The largest number of subsites
found to date, is in the intracellular alginate lyase from Enterobacter cloacae M-1, which
contains seven subsites [189]. Multiple subsites in alginate lyases and more specifically,
in AlgL, could serve a variety of functions. Weak protein-monosaccharide interactions
could require multiple subsite interactions to correctly position the substrate for catalysis.
This has been suggested for other multiple subsite containing enzymes [188]. The AlgL
active site cleft may also be involved in keeping alginate linearized during translocation
and preventing the nascent polymer from adopting secondary structures. Although to date
few studies have investigated the secondary structures of exopolysaccharides, one
prominent example found that the deletion of the extracellular Gluconacetobacter xylinus
CMCax carboxymethylcellulase involved in cellulose biosynthesis and export resulted in
the remarkably reduced cellulose secretion and observable twisted cellulose secondary
structure aggregated near the cell surface [190]. This suggested that the extracellular
glycoside hydrolase prevents the formation of a cellulose secondary structure that would
53
impede cellulose export. The presence of multiple saccharide binding sites on AlgL may
therefore help linearize the polymer and prevent the formation of a higher ordered
alginate structure. Linearization could also facilitate the catalysis of other alginate
modifying enzymes, such as the AlgIJFX acetylation machinery or the AlgG epimerase.
This hypothesis is supported by our observation that AlgL catalysis is not required for
alginate production. Similar to the suggestion that AlgL facilitates alginate translocation,
this related hypothesis would require the rate of polymer translocation through the AlgL
active site be more than the rapid rate of catalysis, which is currently unknown.
2.3.2 AlgL is a component of the trans-envelope complex
The low levels of AlgL among the ΔalgL::algL complemented strains in the
absence of L-arabinose suggests that the PBAD promoter is leaky. If AlgL is required for
viability during alginate production as proposed by Jain et al. [83], the leakiness of the
PBAD promoter could explain the delayed growth curve observed for the ΔalgL strain
before induction (Figure 15A). The low level of expression of proteins on the algD
operon, as seen by the low levels of Alg44 pre-induction due to the leaky PBAD promoter
controlling the entire alg operon (Figure 15B), may result in low levels of alginate
production. If a growth defect is observed during induced alginate production in the
absence of AlgL [83], a low level of alginate production may partially hinder growth, but
not overcome a threshold required to obtain a lethal phenotype. This non-lethal and
hindered growth phenotype was observed by the ΔalgL growth curve in the absence of L-
arabinose. Induction of the PBAD promoter could overcome this threshold and would
explain the lethal phenotype observed by the decrease in OD600 after induction for ΔalgL.
Our results also suggest AlgL catalysis does not affect viability upon induction of
the algD operon. This finding supports the study by Albrecht et al. [81] that suggested
catalytically inactive AlgL in P. aeruginosa is non-lethal after induction of the algD
operon. Our ΔalgL strain was observed to be lethal and suggests the absence of AlgL will
produce a lethal phenotype during alginate production. This suggests the mere presence
of AlgL, but not AlgL catalysis, is important for cell viability during alginate production.
This supports the hypothesis by Albrecht et al. [81] and Jain et al.
[83]
that AlgL forms
part of the trans-envelope complex.
54
Other bacterial systems, including for example the E. coli Wza–Wzc complex for
group 1 capsular polysaccharides export [80], type III secretion needle complex, and
TolC drug efflux in E. coli, are also proposed to form a trans-envelope complex. The
Wza–Wzc complex structure involved in capsular polysaccharide export revealed a trans-
envelope complex that contains two proteins in the periplasm that bridge the gap between
the outer and inner membrane without any adaptor proteins. Openings on the side of the
complex are proposed to serve as the access points for nascent polymer entry. It is
proposed that these observations in the Wza–Wzc complex allow periplasmic
biosynthesis proteins to couple with the export complex [80, 191].
The type III secretion needle [192] and E. coli TolC drug efflux pump complexes
[193] serve different functions. However, both systems are suggested to have adaptor
proteins in the periplasm involved in bridging the gap between the inner and outer
membrane bound proteins. This allows the secreted material in both systems to bypass
the periplasmic space in a concerted mechanism to prevent harm to the bacteria.
The alginate biosynthetic and export trans-envelope complex may have
similarities to both systems. The trans-envelope complex could similarly assist in
coupling the periplasmic machinery to the inner and outer membrane components, as
proposed for the group 1 capsular polysaccharides export system [80]. Proteins
associating with the outer membrane export, AlgE and AlgK, and inner membrane
biosynthesis machinery, Alg8 and Alg44, may facilitate coordinated acetylation by AlgJ,
F, I, and X and/or epimerization by AlgG. The described biosynthesis and export coupled
function would allow alginate inner and outer membrane components to serve as an
anchor to allow the periplasmic proteins to assemble into the complex. A coupled
mechanism seems plausible as a network of binary interactions have been characterized
involving the AlgE β-porin, AlgK TPR-containing protein, AlgX acetylation protein, and
AlgG epimerization protein [144]. Due to this network of interactions, interplay between
alginate production, epimerization, and/or acetylation is possible. While AlgL has been
proposed to interact with the trans-envelope complex proteins, our data has shown that
altering its catalytic activity does not affect alginate production. Whether other chemical
changes occur in the alginate polymer when AlgL’s catalytic activity is compromised is
presently unknown.
55
Similarly, the described function of the type III secretion needle and TolC drug
efflux pump complexes could be extended to the alginate complex. Without a trans-
envelope complex, alginate would be released into the periplasmic space in an
uncontrolled manner. This could potentially lead to two complications. Accumulation of
the polymer could ultimately lead to cell lysis. We currently hypothesize that cell lysis
occurs after 5.5 h of growth in our ΔalgL strain (Figure 15A). Alternatively, the anionic
nature of alginate localized to the periplasm could alter its electrochemical environment.
This would result in an elimination of the electrochemical gradient required for bacterial
metabolic processes such as the electron transport chain. A non-functional electron
transport chain will greatly impede the growth and metabolism of the bacteria and can
cause the bacteria to remain in a slow-growing state until the electrochemical gradient
can be reestablished or lead to cell death.
2.3.3 Model of AlgL in alginate biosynthesis and export
With our new data on AlgL, we propose a model for alginate biosynthesis and
export. The data presented support the hypothesis that AlgL is a critical component of the
trans-envelope complex, although it should be noted that to date no protein-protein
interactions with other members of the complex have been identified. As alginate is
synthesized, a trans-envelope complex involving Alg8, 44, L, G, X, J, F, K, and E, could
form to allow alginate to bypass the periplasm and enable coordinated alginate
modifications including acetylation, epimerization, and/or β-elimination. The complex
involves experimentally characterized binary interactions: Alg8-Alg44, Alg8-AlgG,
AlgK-AlgG, AlgK-AlgX, and AlgK-AlgE (Figure 16A). Altering the catalytic activity of
AlgL does not impair cell growth during alginate production, the yield of alginate export,
and presumably the ability to form the trans-envelope complex, but could affect alginate
modifications (Figure 16B). As established by our data and previous work on AlgL [83],
removal of AlgL leads to a growth defect. The absence of AlgL could lead to aberrant
formation of the trans-envelope complex. It is unknown whether the remaining proteins
in the complex continue to interact and form a partial trans-envelope complex in the
absence of AlgL. If the complex is not fully formed, synthesized alginate is likely to leak
56
into the periplasmic space. Accumulated alginate could lead to cell death by either of the
two aforementioned mechanisms (Figure 16C).
57
Figure 16: Revised model for the role of AlgL in the trans-envelope complex. AlgL protein-protein interactions are not known and
the enzyme is therefore placed arbitrarily into the trans-envelope complex. The stoichiometry of the protein components of the
putative trans-envelope complex is not known. Interactions validated are depicted by black and white diamonds. All interactions were
determined in our lab or by others [81, 83-90]. A: The ΔalgL::algL strain successfully forms the trans-envelope complex and alginate
is secreted. B: Complementation with inactive variant of algL results in formation of the trans-envelope complex and normal alginate
secretion. The inactive catalytic activity of AlgL does not affect the total yield of alginate. C: In the absence of AlgL in the ΔalgL
strain there is a missing component of the trans-envelope complex. The remaining proteins may or may not form a complex. It is
assumed that the accumulated alginate in the periplasmic space leads to cell death.
58
Chapter 3: Conclusions and Future Directions
3.1 Conclusions
From the data presented, we are able to draw several conclusions. The structure
determination and in vitro catalytic characterization of AlgL revealed that it contains a
flexible lid loop that appears to play an important role in catalysis and/or binding. In
contrast to WT AlgL, this loop is disordered in the inactive K66A point mutant. This
finding is supported by previous studies on the Sphingomonas sp. A1-III alginate lyase
where the corresponding lid loop has been proposed to exclude water molecules that
would interfere with catalysis. The loop also contains Y68, a residue proposed to
decrease the pKa of the catalytic acid.
Our in silico substrate-protein binding studies of AlgL identified at least six
saccharide subsites from -2 to +4. This model is consistent with our in vitro mass
spectrometry analysis and the Sphingomonas sp. A1-III structure. An extended active site
cleft is common among PL and may not only be required for catalysis but could also
potentially serve to linearize alginate during biosynthesis and export. Our in vitro mass
spectrometry characterization of alginate degradation products suggest that AlgL is an
endo-lyase and that the substrate needs to bind to the -1 and -2 subsites for catalysis to
occur. This data further supports our in silico model.
Our in vivo studies revealed that the ΔalgL strain displayed a growth defect.
Complementation of this mutant with WT AlgL or its catalytical variants exhibit a non-
lethal growth pattern after induction of alginate production. Western blot analyses found
similar levels of AlgL in all of the ΔalgL complemented strains, and similar levels of
alginate were produced. These data suggest removal of AlgL impairs cell viability, while
changes in the catalytic activity of AlgL do not affect cell viability or yield of alginate
during alginate biosynthesis and export.
3.2 Future Directions
While we have gained insight into the molecular details and function of AlgL, a
number of questions remain unanswered. Outstanding questions include: How do longer
substrates interact with AlgL? Does altering the catalytic activity of AlgL have an effect
59
on the chemical structure of the polymer? Which proteins does AlgL interact with in the
biosynthetic complex?
3.2.1 Structural determination of AlgLPa-substrate complex
A major goal of the structural analysis of AlgLPa was to determine the structure of
a protein-substrate complex to examine substrate binding. The K66A structure without
bound substrate and in vitro specific activities suggests this mutation may compromise
binding. An alternate method to determine the structure of AlgLPa in complex with a
substrate would be to determine the structure of the Y256F or H202A mutants. Initial
crystal conditions have been obtained for these variants, but need to be optimized. The
crystals would be soaked with alginate oligosaccharides. The structure of AlgLPa in
complex with the substrate will enable us to elucidate molecular details for substrate
binding and specificity and confirm our in silico model.
3.2.2 Further characterization of in vivo variants
Our studies on a first set of variants support the hypothesis that AlgLPa is part of a
trans-envelope complex. This data also established that altering AlgLPa’s catalytic
activity does not affect P. aeruginosa growth during alginate production. To confirm our
interpretation of the data, we will continue characterizing other variants, such as Y256F
and R249E. Furthermore, whether abrogating AlgLPa catalytic activity affects alginate
modifications such as the level of acetylation or epimerization has not been investigated.
It is possible that AlgLPa catalysis does not have a role in alginate biosynthesis or export.
This would suggest that AlgLPa only functions as a periplasmic adaptor protein. To
complete our understanding, the effect of inactivating AlgL activity on the chemical
structure of exported alginate will be examined. The degree of polymerization,
acetylation, and epimerization will be investigated [194-196]. A catalytically inactive in
vivo variant producing non-epimerized or non-acetylated alginate would suggest AlgLPa
catalysis precedes and/or is required for epimerization or acetylation, respectively.
60
3.2.3 Uncover trans-envelope complex protein-protein interactions
While we and others have suggested that AlgLPa is part of the biosynthetic
complex, the proteins that it may interact with are currently unknown. These protein-
protein interactions could be characterized by a number of methods. This procedure could
begin by investigating the in vivo stability of other alginate proteins in the PAO1 WPA
ΔalgL strain by Western blot analysis. Potential protein partners could be identified if the
absence of AlgL influenced the stability of known protein components of the biosynthetic
complex. Additionally, pull down experiments could be employed with or without cross-
linking in vivo to identify protein-protein interactions. Cross-linking can be accomplished
with a variety of reagents and the success of these experiments would require membrane
permeable reagents that enable cross-linking reaction at the protein-protein interaction
interfaces of AlgLPa. Pull-down experiments could be performed by fusion of an affinity
label to AlgLPa or the use of our polyclonal α-AlgL sera. Binding partners would be
identified by mass spectrometry or Western blot characterization.
Following the success of these in vivo analyses, in vitro methods could be used to
characterize interactions biophysically. The stoichiometry of binary interaction could be
determined by isothermal titration calorimetry (ITC) and analytical ultracentrifugation
(AUC). Kinetic and thermodynamic parameters of binding could be examined using
biolayer interferometry (BLI) and ITC, respectively. Small-angle x-ray scattering
(SAXS) or co-crystallization studies have the potential to describe the orientation of
interacting proteins. These interactions could provide details on the position of AlgLPa in
the alginate biosynthesis and export trans-envelope complex and would provide greater
insight into the role of AlgLPa.
61
References
1. Collins, V. G. (1957) Planktonic bacteria, Journal of general microbiology 16,
268-272.
2. del Pozo, J. L., and Patel, R. (2007) The challenge of treating biofilm-associated
bacterial infections, Clinical pharmacology and therapeutics 82, 204-209.
3. Hall-Stoodley, L., Costerton, J. W., and Stoodley, P. (2004) Bacterial biofilms:
from the natural environment to infectious diseases, Nature reviews.
Microbiology 2, 95-108.
4. Walker, T. S., Bais, H. P., Deziel, E., Schweizer, H. P., Rahme, L. G., Fall, R.,
and Vivanco, J. M. (2004) Pseudomonas aeruginosa-plant root interactions.
Pathogenicity, biofilm formation, and root exudation, Plant physiology 134, 320-
331.
5. Stewart, P. S., and Costerton, J. W. (2001) Antibiotic resistance of bacteria in
biofilms, Lancet 358, 135-138.
6. Mah, T. F., and O'Toole, G. A. (2001) Mechanisms of biofilm resistance to
antimicrobial agents, Trends in microbiology 9, 34-39.
7. Costerton, J. W., Lewandowski, Z., Caldwell, D. E., Korber, D. R., and Lappin-
Scott, H. M. (1995) Microbial biofilms, Annual review of microbiology 49, 711-
745.
8. Vuong, C., Voyich, J. M., Fischer, E. R., Braughton, K. R., Whitney, A. R.,
DeLeo, F. R., and Otto, M. (2004) Polysaccharide intercellular adhesin (PIA)
protects Staphylococcus epidermidis against major components of the human
innate immune system, Cellular Microbiology 6, 269-275.
9. Cérantola, S., Marty, N., and Montrozier, H. (1996) Structural studies of the
acidic exopolysaccharide produced by a mucoid strain of Burkholderia cepacia,
isolated from cystic fibrosis, Carbohydrate Research 285, 59-67.
10. Davies, J. C. (2002) Pseudomonas aeruginosa in cystic fibrosis: pathogenesis and
persistence, Paediatric respiratory reviews 3, 128-134.
11. Nivens, D. E., Ohman, D. E., Williams, J., and Franklin, M. J. (2001) Role of
alginate and its O acetylation in formation of Pseudomonas aeruginosa
microcolonies and biofilms, Journal of Bacteriology 183, 1047-1057.
12. Pier, G. B., Coleman, F., Grout, M., Franklin, M., and Ohman, D. E. (2001) Role
of alginate O acetylation in resistance of mucoid Pseudomonas aeruginosa to
opsonic phagocytosis, Infection and Immunity 69, 1895-1901.
13. Lenhart, T. R., Duncan, K. E., Beech, I. B., Sunner, J. A., Smith, W., Bonifay, V.,
Biri, B., and Suflita, J. M. (2014) Identification and characterization of microbial
biofilm communities associated with corroded oil pipeline surfaces, Biofouling
30, 823-835.
14. Roman, M. C., and Minton-Summers, S. (1997) Assessment of biofilm formation
in the International Space Station Water Recovery and Management system, Life
Support and Biosphere Science: International Journal of Earth Space 5, 45-51.
15. Davies, D. (2003) Understanding biofilm resistance to antibacterial agents, Nature
Reviews Drug Discovery 2, 114-122.
16. Monteiro, D. R., Gorup, L. F., Takamiya, A. S., Ruvollo-Filho, A. C., de
Camargo, E. R., and Barbosa, D. B. (2009) The growing importance of materials
62
that prevent microbial adhesion: antimicrobial effect of medical devices
containing silver, International journal of antimicrobial agents 34, 103-110.
17. Walters, M. C., 3rd, Roe, F., Bugnicourt, A., Franklin, M. J., and Stewart, P. S.
(2003) Contributions of antibiotic penetration, oxygen limitation, and low
metabolic activity to tolerance of Pseudomonas aeruginosa biofilms to
ciprofloxacin and tobramycin, Antimicrobial agents and chemotherapy 47, 317-
323.
18. Stewart, P. S. (2003) Diffusion in biofilms, Journal of Bacteriology 185, 1485-
1491.
19. Czekalski, N., Berthold, T., Caucci, S., Egli, A., and Bürgmann, H. (2007)
Increased levels of multiresistant bacteria and resistance genes after wastewater
treatment and their dissemination into Lake Geneva, Switzerland, Role and
Prevalence of Antibiosis and the Related Resistance Genes in the Environment,
27.
20. Gullberg, E., Cao, S., Berg, O. G., Ilbäck, C., Sandegren, L., Hughes, D., and
Andersson, D. I. (2011) Selection of resistant bacteria at very low antibiotic
concentrations, PLOS Pathogens 7, e1002158.
21. Verstraeten, N., Knapen, W. J., Kint, C. I., Liebens, V., Van den Bergh, B.,
Dewachter, L., Michiels, J. E., Fu, Q., David, C. C., Fierro, A. C., Marchal, K.,
Beirlant, J., Versees, W., Hofkens, J., Jansen, M., Fauvart, M., and Michiels, J.
(2015) Obg and membrane depolarization are part of a microbial bet-hedging
strategy that leads to antibiotic tolerance, Molecular cell 59, 9-21.
22. Kotte, O., Volkmer, B., Radzikowski, J. L., and Heinemann, M. (2014)
Phenotypic bistability in Escherichia coli's central carbon metabolism, Molecular
Systems Biology 10, 736.
23. Verstraeten, N., Knapen, W. J., Kint, C. I., Liebens, V., Van den Bergh, B.,
Dewachter, L., Michiels, J. E., Fu, Q., David, C. C., and Fierro, A. C. (2015) Obg
and membrane depolarization are part of a microbial bet-hedging strategy that
leads to antibiotic tolerance, Molecular cell 59, 9-21.
24. Verstraeten, N., Knapen, W. J., Fauvart, M., and Michiels, J. (2015) Membrane
depolarization-triggered responsive diversification leads to antibiotic tolerance,
Microbial Cell 2, 299-301.
25. Dong, Y. H., and Zhang, L. H. (2005) Quorum sensing and quorum-quenching
enzymes, Journal of Microbiology 43 Spec No, 101-109.
26. Prince, A. S. (2002) Biofilms, antimicrobial resistance, and airway infection, The
New England journal of medicine 347, 1110-1111.
27. Kalia, V. C., and Purohit, H. J. (2011) Quenching the quorum sensing system:
potential antibacterial drug targets, Critical reviews in microbiology 37, 121-140.
28. Anderl, J. N., Franklin, M. J., and Stewart, P. S. (2000) Role of antibiotic
penetration limitation in Klebsiella pneumoniae biofilm resistance to ampicillin
and ciprofloxacin, Antimicrobial agents and chemotherapy 44, 1818-1824.
29. Mann, E. E., Rice, K. C., Boles, B. R., Endres, J. L., Ranjit, D., Chandramohan,
L., Tsang, L. H., Smeltzer, M. S., Horswill, A. R., and Bayles, K. W. (2009)
Modulation of eDNA release and degradation affects Staphylococcus aureus
biofilm maturation, PLOS One 4, e5822.
63
30. Flemming, H. C., and Wingender, J. (2010) The biofilm matrix, Nature reviews.
Microbiology 8, 623-633.
31. Macfarlane, S., and Dillon, J. F. (2007) Microbial biofilms in the human
gastrointestinal tract, Journal of applied microbiology 102, 1187-1196.
32. Mann, E. E., and Wozniak, D. J. (2012) Pseudomonas biofilm matrix composition
and niche biology, FEMS microbiology reviews 36, 893-916.
33. Zijnge, V., Ammann, T., Thurnheer, T., and Gmur, R. (2012) Subgingival biofilm
structure, Frontiers of oral biology 15, 1-16.
34. Molin, S., and Tolker-Nielsen, T. (2003) Gene transfer occurs with enhanced
efficiency in biofilms and induces enhanced stabilisation of the biofilm structure,
Current opinion in biotechnology 14, 255-261.
35. Whitchurch, C. B., Tolker-Nielsen, T., Ragas, P. C., and Mattick, J. S. (2002)
Extracellular DNA required for bacterial biofilm formation, Science 295, 1487.
36. Yang, L., Barken, K. B., Skindersoe, M. E., Christensen, A. B., Givskov, M., and
Tolker-Nielsen, T. (2007) Effects of iron on DNA release and biofilm
development by Pseudomonas aeruginosa, Microbiology 153, 1318-1328.
37. Watanabe, M., Sasaki, K., Nakashimada, Y., Kakizono, T., Noparatnaraporn, N.,
and Nishio, N. (1998) Growth and flocculation of a marine photosynthetic
bacterium Rhodovulum sp, Applied Microbiology and Biotechnology 50, 682-
691.
38. Finkel, S. E., and Kolter, R. (2001) DNA as a nutrient: novel role for bacterial
competence gene homologs, Journal of Bacteriology 183, 6288-6293.
39. Johnson, J. C., Waldrep, J. C., Guo, J., and Dhand, R. (2008) Aerosol delivery of
recombinant human DNase I: in vitro comparison of a vibrating-mesh nebulizer
with a jet nebulizer, Respiratory care 53, 1703-1708.
40. Mulcahy, H., Charron-Mazenod, L., and Lewenza, S. (2008) Extracellular DNA
chelates cations and induces antibiotic resistance in Pseudomonas aeruginosa
biofilms, PLOS Pathogens 4, e1000213.
41. Fong, J. N., and Yildiz, F. H. (2015) Biofilm matrix proteins, Microbiology
Spectrum 3.
42. Chiavelli, D. A., Marsh, J. W., and Taylor, R. K. (2001) The Mannose-Sensitive
Hemagglutinin ofVibrio cholerae Promotes Adherence to Zooplankton, Applied
and Environmental Microbiology 67, 3220-3225.
43. Romero, D., Aguilar, C., Losick, R., and Kolter, R. (2010) Amyloid fibers
provide structural integrity to Bacillus subtilis biofilms, Proceedings of the
National Academy Of Sciences 107, 2230-2234.
44. Absalon, C., Van Dellen, K., and Watnick, P. I. (2011) A communal bacterial
adhesin anchors biofilm and bystander cells to surfaces, PLOS Pathogens 7,
e1002210.
45. Heijstra, B. D., Pichler, F. B., Liang, Q., Blaza, R. G., and Turner, S. J. (2009)
Extracellular DNA and Type IV pili mediate surface attachment by Acidovorax
temperans, Antonie Van Leeuwenhoek 95, 343-349.
46. Martí, M., Trotonda, M. P., Tormo-Más, M. Á., Vergara-Irigaray, M., Cheung, A.
L., Lasa, I., and Penadés, J. R. (2010) Extracellular proteases inhibit protein-
dependent biofilm formation in Staphylococcus aureus, Microbes and Infection
12, 55-64.
64
47. Kaplan, J. B., Ragunath, C., Ramasubbu, N., and Fine, D. H. (2003) Detachment
of Actinobacillus actinomycetemcomitans biofilm cells by an endogenous β-
hexosaminidase activity, Journal of Bacteriology 185, 4693-4698.
48. Nijland, R., Hall, M. J., and Burgess, J. G. (2010) Dispersal of biofilms by
secreted, matrix degrading, bacterial DNase, PLOS One 5, e15668.
49. Ghafoor, A., Hay, I. D., and Rehm, B. H. (2011) Role of exopolysaccharides in
Pseudomonas aeruginosa biofilm formation and architecture, Applied and
Environmental Microbiology 77, 5238-5246.
50. Romling, U. (2002) Molecular biology of cellulose production in bacteria,
Research in microbiology 153, 205-212.
51. Vaningelgem, F., Zamfir, M., Mozzi, F., Adriany, T., Vancanneyt, M., Swings, J.,
and De Vuyst, L. (2004) Biodiversity of exopolysaccharides produced by
Streptococcus thermophilus strains is reflected in their production and their
molecular and functional characteristics, Applied and Environmental
Microbiology 70, 900-912.
52. Wingender, J., Strathmann, M., Rode, A., Leis, A., and Flemming, H. C. (2001)
Isolation and biochemical characterization of extracellular polymeric substances
from Pseudomonas aeruginosa, Methods in enzymology 336, 302-314.
53. Nwodo, U. U., Green, E., and Okoh, A. I. (2012) Bacterial exopolysaccharides:
functionality and prospects, International journal of molecular sciences 13,
14002-14015.
54. Klausen, M., Aaes˗Jørgensen, A., Molin, S., and Tolker˗Nielsen, T. (2003)
Involvement of bacterial migration in the development of complex multicellular
structures in Pseudomonas aeruginosa biofilms, Molecular Microbiology 50, 61-
68.
55. Sutherland, I. W. (2001) Biofilm exopolysaccharides: a strong and sticky
framework, Microbiology 147, 3-9.
56. Mah, T.-F., Pitts, B., Pellock, B., Walker, G. C., Stewart, P. S., and O'Toole, G.
A. (2003) A genetic basis for Pseudomonas aeruginosa biofilm antibiotic
resistance, Nature 426, 306-310.
57. Bylund, J., Burgess, L.-A., Cescutti, P., Ernst, R. K., and Speert, D. P. (2006)
Exopolysaccharides from Burkholderia cenocepacia inhibit neutrophil chemotaxis
and scavenge reactive oxygen species, Journal of Biological Chemistry 281,
2526-2532.
58. Cescutti, P., Scussolin, S., Herasimenka, Y., Impallomeni, G., Bicego, M., and
Rizzo, R. (2006) First report of a lyase for cepacian, the polysaccharide produced
by Burkholderia cepacia complex bacteria, Biochemical and Biophysical
Research Communications 339, 821-826.
59. Cuzzi, B., Cescutti, P., Furlanis, L., Lagatolla, C., Sturiale, L., Garozzo, D., and
Rizzo, R. (2012) Investigation of bacterial resistance to the immune system
response: cepacian depolymerisation by reactive oxygen species, Innate immunity
18, 661-671.
60. Vuong, C., Kocianova, S., Voyich, J. M., Yao, Y., Fischer, E. R., DeLeo, F. R.,
and Otto, M. (2004) A crucial role for exopolysaccharide modification in bacterial
biofilm formation, immune evasion, and virulence, Journal of Biological
Chemistry 279, 54881-54886.
65
61. Zavascki, A. P., Carvalhaes, C. G., Picao, R. C., and Gales, A. C. (2010)
Multidrug-resistant Pseudomonas aeruginosa and Acinetobacter baumannii:
resistance mechanisms and implications for therapy, Expert review of anti-
infective therapy 8, 71-93.
62. Winsor, G. L., Lam, D. K., Fleming, L., Lo, R., Whiteside, M. D., Yu, N. Y.,
Hancock, R. E., and Brinkman, F. S. (2011) Pseudomonas Genome Database:
improved comparative analysis and population genomics capability for
Pseudomonas genomes, Nucleic acids research 39, D596-600.
63. Pasmore, M., Todd, P., Smith, S., Baker, D., Silverstein, J., Coons, D., and
Bowman, C. N. (2001) Effects of ultrafiltration membrane surface properties on
Pseudomonas aeruginosa biofilm initiation for the purpose of reducing biofouling,
Journal of Membrane Science 194, 15-32.
64. Wang, H., Masters, S., Hong, Y., Stallings, J., Falkinham III, J. O., Edwards, M.
A., and Pruden, A. (2012) Effect of disinfectant, water age, and pipe material on
occurrence and persistence of Legionella, mycobacteria, Pseudomonas
aeruginosa, and two amoebas, Environmental Science and Technology 46, 11566-
11574.
65. Rahme, L. G., Stevens, E. J., Wolfort, S. F., Shao, J., Tompkins, R. G., and
Ausubel, F. M. (1995) Common virulence factors for bacterial pathogenicity in
plants and animals, Science 268, 1899-1902.
66. Lang, A. B., Horn, M. P., Imboden, M. A., and Zuercher, A. W. (2004)
Prophylaxis and therapy of Pseudomonas aeruginosa infection in cystic fibrosis
and immunocompromised patients, Vaccine 22 Suppl 1, S44-48.
67. Branski, L. K., Al-Mousawi, A., Rivero, H., Jeschke, M. G., Sanford, A. P., and
Herndon, D. N. (2009) Emerging infections in burns, Surgical infections 10, 389-
397.
68. Thomas, P., Moore, M., Bell, E., Friedman, S., Decker, J., Shayegani, M., and
Martin, K. (1985) Pseudomonas dermatitis associated with a swimming pool,
Jama 253, 1156-1159.
69. Saltzstein, D., Wachs, B., Perroncel, R., Benson, A., Herrington, J., Haverstock,
D., and Pertel, P. (2007) Complicated urinary tract infections treated with
extended-release ciprofloxacin with emphasis on Pseudomonas aeruginosa,
Journal of Chemotherapy 19, 694-702.
70. Hart, C. A., and Winstanley, C. (2002) Persistent and aggressive bacteria in the
lungs of cystic fibrosis children, British medical bulletin 61, 81-96.
71. Burns, J. L., Gibson, R. L., McNamara, S., Yim, D., Emerson, J., Rosenfeld, M.,
Hiatt, P., McCoy, K., Castile, R., Smith, A. L., and Ramsey, B. W. (2001)
Longitudinal assessment of Pseudomonas aeruginosa in young children with
cystic fibrosis, The Journal of infectious diseases 183, 444-452.
72. Fothergill, J. L., Winstanley, C., and James, C. E. (2012) Novel therapeutic
strategies to counter Pseudomonas aeruginosa infections, Expert review of anti-
infective therapy 10, 219-235.
73. Lambert, P. A. (2002) Mechanisms of antibiotic resistance in Pseudomonas
aeruginosa, Journal of the Royal Society of Medicine 95 Suppl 41, 22-26.
66
74. Franklin, M. J., Nivens, D. E., Weadge, J. T., and Howell, P. L. (2011)
Biosynthesis of the Pseudomonas aeruginosa Extracellular Polysaccharides,
Alginate, Pel, and Psl, Frontiers in microbiology 2, 167.
75. Jennings, L. K., Storek, K. M., Ledvina, H. E., Coulon, C., Marmont, L. S.,
Sadovskaya, I., Secor, P. R., Tseng, B. S., Scian, M., and Filloux, A. (2015) Pel is
a cationic exopolysaccharide that cross-links extracellular DNA in the
Pseudomonas aeruginosa biofilm matrix, Proceedings of the National Academy
Of Sciences 112, 11353-11358.
76. Ma, L., Conover, M., Lu, H., Parsek, M. R., Bayles, K., and Wozniak, D. J.
(2009) Assembly and development of the Pseudomonas aeruginosa biofilm
matrix, PLOS Pathogens 5, e1000354.
77. Whitney, J., and Howell, P. (2013) Synthase-dependent exopolysaccharide
secretion in Gram-negative bacteria, Trends in microbiology 21, 63-72.
78. Cuthbertson, L., Mainprize, I. L., Naismith, J. H., and Whitfield, C. (2009)
Pivotal roles of the outer membrane polysaccharide export and polysaccharide
copolymerase protein families in export of extracellular polysaccharides in gram-
negative bacteria, Microbiology and Molecular Biology Reviews 73, 155-177.
79. Whitfield, C. (2006) Biosynthesis and assembly of capsular polysaccharides in
Escherichia coli, Annual Review of Biochemistry 75, 39-68.
80. Dong, C., Beis, K., Nesper, J., Brunkan-LaMontagne, A. L., Clarke, B. R.,
Whitfield, C., and Naismith, J. H. (2006) Wza the translocon for E. coli capsular
polysaccharides defines a new class of membrane protein, Nature 444, 226-229.
81. Albrecht, M. T., and Schiller, N. L. (2005) Alginate lyase (AlgL) activity is
required for alginate biosynthesis in Pseudomonas aeruginosa, Journal of
Bacteriology 187, 3869-3872.
82. Friedman, L., and Kolter, R. (2004) Genes involved in matrix formation in
Pseudomonas aeruginosa PA14 biofilms, Molecular Microbiology 51, 675-690.
83. Jain, S., and Ohman, D. E. (2005) Role of an alginate lyase for alginate transport
in mucoid Pseudomonas aeruginosa, Infection and Immunity 73, 6429-6436.
84. Gutsche, J., Remminghorst, U., and Rehm, B. H. (2006) Biochemical analysis of
alginate biosynthesis protein AlgX from Pseudomonas aeruginosa: purification of
an AlgX-MucD (AlgY) protein complex, Biochimie 88, 245-251.
85. Hay, I. D., Rehman, Z. U., and Rehm, B. H. (2010) Membrane topology of outer
membrane protein AlgE, which is required for alginate production in
Pseudomonas aeruginosa, Applied and Environmental Microbiology 76, 1806-
1812.
86. Hay, I. D., Schmidt, O., Filitcheva, J., and Rehm, B. H. (2012) Identification of a
periplasmic AlgK-AlgX-MucD multiprotein complex in Pseudomonas aeruginosa
involved in biosynthesis and regulation of alginate, Applied Microbiology and
Biotechnology 93, 215-227.
87. Jain, S., Franklin, M. J., Ertesvag, H., Valla, S., and Ohman, D. E. (2003) The
dual roles of AlgG in C-5-epimerization and secretion of alginate polymers in
Pseudomonas aeruginosa, Molecular Microbiology 47, 1123-1133.
88. Rehman, Z. U., Wang, Y., Moradali, M. F., Hay, I. D., and Rehm, B. H. (2013)
Insights into the assembly of the alginate biosynthesis machinery in Pseudomonas
aeruginosa, Applied and Environmental Microbiology 79, 3264-3272.
67
89. Remminghorst, U., and Rehm, B. H. (2006) Alg44, a unique protein required for
alginate biosynthesis in Pseudomonas aeruginosa, FEBS letters 580, 3883-3888.
90. Remminghorst, U., and Rehm, B. H. (2006) In vitro alginate polymerization and
the functional role of Alg8 in alginate production by Pseudomonas aeruginosa,
Applied and environmental microbiology 72, 298-305.
91. Colvin, K. M., Irie, Y., Tart, C. S., Urbano, R., Whitney, J. C., Ryder, C., Howell,
P. L., Wozniak, D. J., and Parsek, M. R. (2012) The Pel and Psl polysaccharides
provide Pseudomonas aeruginosa structural redundancy within the biofilm matrix,
Environmental microbiology 14, 1913-1928.
92. Jackson, K. D., Starkey, M., Kremer, S., Parsek, M. R., and Wozniak, D. J. (2004)
Identification of psl, a locus encoding a potential exopolysaccharide that is
essential for Pseudomonas aeruginosa PAO1 biofilm formation, Journal of
Bacteriology 186, 4466-4475.
93. Byrd, M. S., Sadovskaya, I., Vinogradov, E., Lu, H., Sprinkle, A. B., Richardson,
S. H., Ma, L., Ralston, B., Parsek, M. R., and Anderson, E. M. (2009) Genetic and
biochemical analyses of the Pseudomonas aeruginosa Psl exopolysaccharide
reveal overlapping roles for polysaccharide synthesis enzymes in Psl and LPS
production, Molecular Microbiology 73, 622-638.
94. Mishra, M., Byrd, M. S., Sergeant, S., Azad, A. K., Parsek, M. R., McPhail, L.,
Schlesinger, L. S., and Wozniak, D. J. (2012) Pseudomonas aeruginosa Psl
polysaccharide reduces neutrophil phagocytosis and the oxidative response by
limiting complement‐mediated opsonization, Cellular Microbiology 14, 95-106.
95. Billings, N., Millan, M. R., Caldara, M., Rusconi, R., Tarasova, Y., Stocker, R.,
and Ribbeck, K. (2013) The extracellular matrix component Psl provides fast-
acting antibiotic defense in Pseudomonas aeruginosa biofilms, PLOS Pathogens
9, e1003526.
96. DiGiandomenico, A., Warrener, P., Hamilton, M., Guillard, S., Ravn, P., Minter,
R., Camara, M. M., Venkatraman, V., MacGill, R. S., and Lin, J. (2012)
Identification of broadly protective human antibodies to Pseudomonas aeruginosa
exopolysaccharide Psl by phenotypic screening, Journal of Experimental
Medicine 209, 1273-1287.
97. Coyne, M., Russell, K. S., Coyle, C. L., and Goldberg, J. B. (1994) The
Pseudomonas aeruginosa algC gene encodes phosphoglucomutase, required for
the synthesis of a complete lipopolysaccharide core, Journal of Bacteriology 176,
3500-3507.
98. Coutinho, P. M., Deleury, E., Davies, G. J., and Henrissat, B. (2003) An evolving
hierarchical family classification for glycosyltransferases, Journal of molecular
biology 328, 307-317.
99. Fritz, T. A., Hurley, J. H., Trinh, L. B., Shiloach, J., and Tabak, L. A. (2004) The
beginnings of mucin biosynthesis: the crystal structure of UDP-
GalNAc:polypeptide alpha-N-acetylgalactosaminyltransferase-T1, Proceedings of
the National Academy Of Sciences 101, 15307-15312.
100. Lombard, V., Ramulu, H. G., Drula, E., Coutinho, P. M., and Henrissat, B. (2014)
The carbohydrate-active enzymes database (CAZy) in 2013, Nucleic acids
research 42, D490-D495.
68
101. Kelley, L. A., and Sternberg, M. J. (2009) Protein structure prediction on the
Web: a case study using the Phyre server, Nature Protocols 4, 363-371.
102. Guerin, M. E., Kordulakova, J., Schaeffer, F., Svetlikova, Z., Buschiazzo, A.,
Giganti, D., Gicquel, B., Mikusova, K., Jackson, M., and Alzari, P. M. (2007)
Molecular recognition and interfacial catalysis by the essential
phosphatidylinositol mannosyltransferase PimA from mycobacteria, Journal of
Biological Chemistry 282, 20705-20714.
103. Baker, P., Whitfield, G. B., Hill, P. J., Little, D. J., Pestrak, M. J., Robinson, H.,
Wozniak, D. J., and Howell, P. L. (2015) Characterization of the Pseudomonas
aeruginosa Glycoside Hydrolase PslG Reveals That Its Levels Are Critical for Psl
Polysaccharide Biosynthesis and Biofilm Formation, Journal of Biological
Chemistry 290, 28374-28387.
104. Mendis, H. C., Queiroux, C., Brewer, T. E., Davis, O. M., Washburn, B. K., and
Jones, K. M. (2013) The succinoglycan endoglycanase encoded by exoK is
required for efficient symbiosis of Sinorhizobium meliloti 1021 with the host
plants Medicago truncatula and Medicago sativa (Alfalfa), Molecular Plant-
Microbe Interactions 26, 1089-1105.
105. Wang, L.-X., Wang, Y., Pellock, B., and Walker, G. C. (1999) Structural
Characterization of the Symbiotically Important Low-Molecular-Weight
Succinoglycan of Sinorhizobium meliloti, Journal of Bacteriology 181, 6788-
6796.
106. Drummelsmith, J., and Whitfield, C. (1999) Gene products required for surface
expression of the capsular form of the group 1 K antigen in Escherichia coli (O9a:
K30), Molecular Microbiology 31, 1321-1332.
107. Baker, P., Ricer, T., Moynihan, P. J., Kitova, E. N., Walvoort, M. T., Little, D. J.,
Whitney, J. C., Dawson, K., Weadge, J. T., and Robinson, H. (2014) P.
aeruginosa SGNH hydrolase-like proteins AlgJ and AlgX have similar topology
but separate and distinct roles in alginate acetylation, PLOS Pathogens 10,
e1004334.
108. Hickman, J. W., and Harwood, C. S. (2008) Identification of FleQ from
Pseudomonas aeruginosa as a c‐di‐GMP responsive transcription factor,
Molecular Microbiology 69, 376-389.
109. Vasseur, P., Vallet-Gely, I., Soscia, C., Genin, S., and Filloux, A. (2005) The pel
genes of the Pseudomonas aeruginosa PAK strain are involved at early and late
stages of biofilm formation, Microbiology 151, 985-997.
110. Haq, I. U., Graupner, K., Nazir, R., and van Elsas, J. D. (2014) The genome of the
fungal-interactive soil bacterium Burkholderia terrae BS001—A plethora of
outstanding interactive capabilities unveiled, Genome Biology and Evolution 6,
1652-1668.
111. Singer, E., Webb, E. A., Nelson, W. C., Heidelberg, J. F., Ivanova, N., Pati, A.,
and Edwards, K. J. (2011) Genomic potential of Marinobacter aquaeolei, a
biogeochemical “opportunitroph”, Applied and Environmental Microbiology 77,
2763-2771.
112. Colvin, K. M., Gordon, V. D., Murakami, K., Borlee, B. R., Wozniak, D. J.,
Wong, G. C., and Parsek, M. R. (2011) The Pel polysaccharide can serve a
69
structural and protective role in the biofilm matrix of Pseudomonas aeruginosa,
PLOS Pathogens 7, e1001264.
113. Lee, V. T., Matewish, J. M., Kessler, J. L., Hyodo, M., Hayakawa, Y., and Lory,
S. (2007) A cyclic‐di‐GMP receptor required for bacterial exopolysaccharide
production, Molecular Microbiology 65, 1474-1484.
114. Whitney, J. C., Colvin, K. M., Marmont, L. S., Robinson, H., Parsek, M. R., and
Howell, P. L. (2012) Structure of the cytoplasmic region of PelD, a degenerate
diguanylate cyclase receptor that regulates exopolysaccharide production in
Pseudomonas aeruginosa, Journal of Biological Chemistry 287, 23582-23593.
115. Colvin, K. M., Alnabelseya, N., Baker, P., Whitney, J. C., Howell, P. L., and
Parsek, M. R. (2013) PelA deacetylase activity is required for Pel polysaccharide
synthesis in Pseudomonas aeruginosa, Journal of Bacteriology 195, 2329-2339.
116. Baker, P., HIll, P. J., Snarr, B. D., Alnabelseya, N., Pestrak, M. J., Lee, M. J.,
Jennings, L. K., Tam, J., Melnyk, R., and Parsek, M. R. (2015)
Exopolysaccharide biosynthetic glycoside hydrolases can be utilized to disrupt
and prevent Pseudomonas aeruginosa biofilms, bioRxiv, 032714.
117. Bonsor, D. A., Grishkovskaya, I., Dodson, E. J., and Kleanthous, C. (2007)
Molecular mimicry enables competitive recruitment by a natively disordered
protein, Journal of the American Chemical Society 129, 4800-4807.
118. Vasseur, P., Soscia, C., Voulhoux, R., and Filloux, A. (2007) PelC is a
Pseudomonas aeruginosa outer membrane lipoprotein of the OMA family of
proteins involved in exopolysaccharide transport, Biochimie 89, 903-915.
119. Stanford, E. (1883) Algin: A New Substance Obtained from Some of the
Commoner Species of Marine Algæ, Scientific American 16, 6323-6324.
120. Haug, A., Larsen, B., and Smidsrød, O. (1974) Uronic acid sequence in alginate
from different sources, Carbohydrate Research 32, 217-225.
121. Fischer, F., and Dörfel, H. (1955) Die polyuronsäuren der braunalgen
(Kohlenhydrate der Algen I), Hoppe-Seyler´s Zeitschrift Für Physiologische
Chemie 302, 186-203.
122. Nelson, W. L., and Cretcher, L. H. (1930) The isolation and identification of d-
mannuronic acid lactone from the Macrocystis pyrifera, Journal of the American
Chemical Society 52, 2130-2132.
123. Vu, B., Chen, M., Crawford, R. J., and Ivanova, E. P. (2009) Bacterial
extracellular polysaccharides involved in biofilm formation, Molecules 14, 2535-
2554.
124. Pindar, D. F., and Bucke, C. (1975) The biosynthesis of alginic acid by
Azotobacter vinelandii, Biochemical Journal 152, 617-622.
125. Darzins, A., and Chakrabarty, A. (1984) Cloning of genes controlling alginate
biosynthesis from a mucoid cystic fibrosis isolate of Pseudomonas aeruginosa,
Journal of Bacteriology 159, 9-18.
126. Page, W., and Sadoff, H. (1975) Relationship between calcium and uroinic acids
in the encystment of Azotobacter vinelandii, Journal of Bacteriology 122, 145-
151.
127. Socolofsky, M. D., and Wyss, O. (1962) Resistance of the Azotobacter cyst,
Journal of Bacteriology 84, 119-124.
70
128. May, T. B., Shinabarger, D., Maharaj, R., Kato, J., Chu, L., DeVault, J. D.,
Roychoudhury, S., Zielinski, N. A., Berry, A., Rothmel, R. K., and et al. (1991)
Alginate synthesis by Pseudomonas aeruginosa: a key pathogenic factor in
chronic pulmonary infections of cystic fibrosis patients, Clinical microbiology
reviews 4, 191-206.
129. Pedersen, S. S., Hoiby, N., Espersen, F., and Koch, C. (1992) Role of alginate in
infection with mucoid Pseudomonas aeruginosa in cystic fibrosis, Thorax 47, 6-
13.
130. Wloka, M., Rehage, H., Flemming, H.-C., and Wingender, J. (2005) Structure and
rheological behaviour of the extracellular polymeric substance network of mucoid
Pseudomonas aeruginosa biofilms, Biofilms 2, 275-283.
131. Donati, I., Holtan, S., Mørch, Y. A., Borgogna, M., Dentini, M., and Skjåk-Bræk,
G. (2005) New hypothesis on the role of alternating sequences in calcium-alginate
gels, Biomacromolecules 6, 1031-1040.
132. Remminghorst, U., and Rehm, B. H. (2006) Bacterial alginates: from biosynthesis
to applications, Biotechnology letters 28, 1701-1712.
133. Zielinski, N. A., Chakrabarty, A., and Berry, A. (1991) Characterization and
regulation of the Pseudomonas aeruginosa algC gene encoding
phosphomannomutase, Journal of Biological Chemistry 266, 9754-9763.
134. Deretic, V., Gill, J., and Chakrabarty, A. (1987) Gene algD coding for
GDPmannose dehydrogenase is transcriptionally activated in mucoid
Pseudomonas aeruginosa, Journal of Bacteriology 169, 351-358.
135. Ramelot, T. A., Yee, A., Cort, J. R., Semesi, A., Arrowsmith, C. H., and
Kennedy, M. A. (2007) NMR structure and binding studies confirm that PA4608
from Pseudomonas aeruginosa is a PilZ domain and a c-di-GMP binding protein,
Proteins: Structure, Function, and Bioinformatics 66, 266-271.
136. Whitney, J. C., Whitfield, G. B., Marmont, L. S., Yip, P., Neculai, A. M.,
Lobsanov, Y. D., Robinson, H., Ohman, D. E., and Howell, P. L. (2015) Dimeric
c-di-GMP is required for post-translational regulation of alginate production in
Pseudomonas aeruginosa, Journal of Biological Chemistry 290, 12451-12462.
137. De Angelis, F., Lee, J. K., O'Connell, J. D., 3rd, Miercke, L. J., Verschueren, K.
H., Srinivasan, V., Bauvois, C., Govaerts, C., Robbins, R. A., Ruysschaert, J. M.,
Stroud, R. M., and Vandenbussche, G. (2010) Metal-induced conformational
changes in ZneB suggest an active role of membrane fusion proteins in efflux
resistance systems, Proceedings of the National Academy Of Sciences 107,
11038-11043.
138. Oglesby, L. L., Jain, S., and Ohman, D. E. (2008) Membrane topology and roles
of Pseudomonas aeruginosa Alg8 and Alg44 in alginate polymerization,
Microbiology 154, 1605-1615.
139. Wolfram, F., Kitova, E. N., Robinson, H., Walvoort, M. T., Codee, J. D., Klassen,
J. S., and Howell, P. L. (2014) Catalytic mechanism and mode of action of the
periplasmic alginate epimerase AlgG, Journal of Biological Chemistry 289, 6006-
6019.
140. Franklin, M. J., and Ohman, D. E. (2002) Mutant analysis and cellular
localization of the AlgI, AlgJ, and AlgF proteins required for O acetylation of
alginate in Pseudomonas aeruginosa, Journal of Bacteriology 184, 3000-3007.
71
141. Keiski, C. L., Harwich, M., Jain, S., Neculai, A. M., Yip, P., Robinson, H.,
Whitney, J. C., Riley, L., Burrows, L. L., Ohman, D. E., and Howell, P. L. (2010)
AlgK is a TPR-containing protein and the periplasmic component of a novel
exopolysaccharide secretin, Structure 18, 265-273.
142. Whitney, J. C., Neculai, A. M., Ohman, D. E., and Howell, P. L. (2009)
Expression, refolding, crystallization and preliminary X-ray analysis of
Pseudomonas aeruginosa AlgE, Acta crystallographica. Section F, Structural
biology and crystallization communications 65, 463-466.
143. Rehm, B. H., Boheim, G., Tommassen, J., and Winkler, U. K. (1994)
Overexpression of algE in Escherichia coli: subcellular localization, purification,
and ion channel properties, Journal of Bacteriology 176, 5639-5647.
144. Fata Moradali, M., Donati, I., Sims, I. M., Ghods, S., and Rehm, B. H. (2015)
Alginate Polymerization and Modification Are Linked in Pseudomonas
aeruginosa, mBio 6, e00453-00415.
145. Schnider-Keel, U., Lejbølle, K. B., Baehler, E., Haas, D., and Keel, C. (2001) The
Sigma Factor AlgU (AlgT) Controls Exopolysaccharide Production and Tolerance
towards Desiccation and Osmotic Stress in the Biocontrol Agent Pseudomonas
fluorescensCHA0, Applied and environmental microbiology 67, 5683-5693.
146. May, T. B., and Chakrabarty, A. M. (1994) Pseudomonas aeruginosa: genes and
enzymes of alginate synthesis, Trends in microbiology 2, 151-157.
147. Boyd, A., and Chakrabarty, A. M. (1994) Role of alginate lyase in cell
detachment of Pseudomonas aeruginosa, Applied and Environmental
Microbiology 60, 2355-2359.
148. Pougach, K., Semenova, E., Bogdanova, E., Datsenko, K. A., Djordjevic, M.,
Wanner, B. L., and Severinov, K. (2010) Transcription, processing and function
of CRISPR cassettes in Escherichia coli, Molecular microbiology 77, 1367-1379.
149. Wong, T. Y., Preston, L. A., and Schiller, N. L. (2000) Alginate lyase: review of
major sources and enzyme characteristics, structure-function analysis, biological
roles, and applications, Annual review of microbiology 54, 289-340.
150. Zhu, B., and Yin, H. (2015) Alginate lyase: Review of major sources and
classification, properties, structure-function analysis and applications,
Bioengineered 6, 125-131.
151. Lombard, V., Bernard, T., Rancurel, C., Brumer, H., Coutinho, P. M., and
Henrissat, B. (2010) A hierarchical classification of polysaccharide lyases for
glycogenomics, Biochemical Journal 432, 437-444.
152. Lombard, V., Golaconda Ramulu, H., Drula, E., Coutinho, P. M., and Henrissat,
B. (2014) The carbohydrate-active enzymes database (CAZy) in 2013, Nucleic
acids research 42, D490-495.
153. Mikami, B., Ban, M., Suzuki, S., Yoon, H. J., Miyake, O., Yamasaki, M., Ogura,
K., Maruyama, Y., Hashimoto, W., and Murata, K. (2012) Induced-fit motion of a
lid loop involved in catalysis in alginate lyase A1-III, Acta crystallographica.
Section D, Biological crystallography 68, 1207-1216.
154. Branda, S. S., Chu, F., Kearns, D. B., Losick, R., and Kolter, R. (2006) A major
protein component of the Bacillus subtilis biofilm matrix, Molecular
Microbiology 59, 1229-1238.
72
155. Gimmestad, M., Ertesvag, H., Heggeset, T. M., Aarstad, O., Svanem, B. I., and
Valla, S. (2009) Characterization of three new Azotobacter vinelandii alginate
lyases, one of which is involved in cyst germination, Journal of Bacteriology 191,
4845-4853.
156. Davies, G. J., Wilson, K. S., and Henrissat, B. (1997) Nomenclature for sugar-
binding subsites in glycosyl hydrolases, Biochemical Journal 321 ( Pt 2), 557-
559.
157. Farrell, E. K., and Tipton, P. A. (2012) Functional characterization of AlgL, an
alginate lyase from Pseudomonas aeruginosa, Biochemistry 51, 10259-10266.
158. Chitnis, C., and Ohman, D. (1990) Cloning of Pseudomonas aeruginosa algG,
which controls alginate structure, Journal of Bacteriology 172, 2894-2900.
159. Walvoort, M. T., van den Elst, H., Plante, O. J., Kröck, L., Seeberger, P. H.,
Overkleeft, H. S., van der Marel, G. A., and Codée, J. D. (2012) Automated
Solid‐Phase Synthesis of β‐Mannuronic Acid Alginates, Angewandte Chemie
124, 4469-4472.
160. Choi, K.-H., Gaynor, J. B., White, K. G., Lopez, C., Bosio, C. M., Karkhoff-
Schweizer, R. R., and Schweizer, H. P. (2005) A Tn7-based broad-range bacterial
cloning and expression system, Nature Methods 2, 443-448.
161. Franklin, M. J., Chitnis, C. E., Gacesa, P., Sonesson, A., White, D. C., and
Ohman, D. E. (1994) Pseudomonas aeruginosa AlgG is a polymer level alginate
C5-mannuronan epimerase, Journal of Bacteriology 176, 1821-1830.
162. Wolfram, F., Arora, K., Robinson, H., Neculai, A. M., Yip, P., and Howell, P.
(2012) Expression, purification, crystallization and preliminary X-ray analysis of
Pseudomonas aeruginosa AlgL, Acta crystallographica. Section F, Structural
biology and crystallization communications 68, 584-587.
163. Choi, K.-H., Kumar, A., and Schweizer, H. P. (2006) A 10-min method for
preparation of highly electrocompetent Pseudomonas aeruginosa cells: application
for DNA fragment transfer between chromosomes and plasmid transformation,
Journal of Microbiological Methods 64, 391-397.
164. Hmelo, L. R., Borlee, B. R., Almblad, H., Love, M. E., Randall, T. E., Tseng, B.
S., Lin, C., Irie, Y., Storek, K. M., and Yang, J. J. (2015) Precision-engineering
the Pseudomonas aeruginosa genome with two-step allelic exchange, Nature
Protocols 10, 1820-1841.
165. Salamitou, S., Lemaire, M., Fujino, T., Ohayon, H., Gounon, P., Beguin, P., and
Aubert, J.-P. (1994) Subcellular localization of Clostridium thermocellum
ORF3p, a protein carrying a receptor for the docking sequence borne by the
catalytic components of the cellulosome, Journal of bacteriology 176, 2828-2834.
166. McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn, M. D., Storoni, L.
C., and Read, R. J. (2007) Phaser crystallographic software, Journal of Applied
Crystallography 40, 658-674.
167. Painter, J., and Merritt, E. A. (2006) TLSMD web server for the generation of
multi-group TLS models, Journal of Applied Crystallography 39, 109-111.
168. Adams, P. D., Afonine, P. V., Bunkoczi, G., Chen, V. B., Davis, I. W., Echols,
N., Headd, J. J., Hung, L. W., Kapral, G. J., Grosse-Kunstleve, R. W., McCoy, A.
J., Moriarty, N. W., Oeffner, R., Read, R. J., Richardson, D. C., Richardson, J. S.,
Terwilliger, T. C., and Zwart, P. H. (2010) PHENIX: a comprehensive Python-
73
based system for macromolecular structure solution, Acta crystallographica.
Section D, Biological crystallography 66, 213-221.
169. Emsley, P., and Cowtan, K. (2004) Coot: model-building tools for molecular
graphics, Acta crystallographica. Section D, Biological crystallography 60, 2126-
2132.
170. Morin, A., Eisenbraun, B., Key, J., Sanschagrin, P. C., Timony, M. A., Ottaviano,
M., and Sliz, P. (2013) Collaboration gets the most out of software, Elife 2,
e01456.
171. DeLano, W. L. (2002) The PyMOL molecular graphics system.
172. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990)
Basic local alignment search tool, Journal of molecular biology 215, 403-410.
173. Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W.,
and Lipman, D. J. (1997) Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs, Nucleic acids research 25, 3389-3402.
174. Ashkenazy, H., Erez, E., Martz, E., Pupko, T., and Ben-Tal, N. (2010) ConSurf
2010: calculating evolutionary conservation in sequence and structure of proteins
and nucleic acids, Nucleic acids research, gkq399.
175. Landau, M., Mayrose, I., Rosenberg, Y., Glaser, F., Martz, E., Pupko, T., and
Ben-Tal, N. (2005) ConSurf 2005: the projection of evolutionary conservation
scores of residues on protein structures, Nucleic acids research 33, W299-W302.
176. Trott, O., and Olson, A. J. (2010) AutoDock Vina: improving the speed and
accuracy of docking with a new scoring function, efficient optimization, and
multithreading, Journal of Computational Chemistry 31, 455-461.
177. Sanner, M. F. (1999) Python: a programming language for software integration
and development, Journal of Molecular Graphics and Modelling 17, 57-61.
178. Lin, H., Kitova, E. N., and Klassen, J. S. (2013) Quantifying Protein-Ligand
Interactions by Direct ESI-MS Analysis. Evidence of Non-uniform Response
Factors Induced by High Molecular Weight Molecules and Complexes, Analytical
chemistry.
179. El-Hawiet, A., Kitova, E. N., and Klassen, J. S. (2012) Quantifying carbohydrate-
protein interactions by electrospray ionization mass spectrometry analysis,
Biochemistry 51, 4244-4253.
180. Sun, J., Kitova, E. N., Wang, W., and Klassen, J. S. (2006) Method for
distinguishing specific from nonspecific protein-ligand complexes in
nanoelectrospray ionization mass spectrometry, Analytical chemistry 78, 3010-
3018.
181. Knutson, C. A., and Jeanes, A. (1968) A new modification of the carbazole
analysis: application to heteropolysaccharides, Analytical Biochemistry 24, 470-
481.
182. Chen, V. B., Arendall, W. B., Headd, J. J., Keedy, D. A., Immormino, R. M.,
Kapral, G. J., Murray, L. W., Richardson, J. S., and Richardson, D. C. (2010)
MolProbity: all-atom structure validation for macromolecular crystallography,
Acta crystallographica. Section D, Biological crystallography 66, 12-21.
183. Dolinsky, T. J., Czodrowski, P., Li, H., Nielsen, J. E., Jensen, J. H., Klebe, G.,
and Baker, N. A. (2007) PDB2PQR: expanding and upgrading automated
74
preparation of biomolecular structures for molecular simulations, Nucleic acids
research 35, W522-W525.
184. Dolinsky, T. J., Nielsen, J. E., McCammon, J. A., and Baker, N. A. (2004)
PDB2PQR: an automated pipeline for the setup of Poisson–Boltzmann
electrostatics calculations, Nucleic acids research 32, W665-W667.
185. Rehm, S., Trodler, P., and Pleiss, J. (2010) Solvent‐induced lid opening in
lipases: A molecular dynamics study, Protein Science 19, 2122-2130.
186. Xu, T., Liu, L., Hou, S., Xu, J., Yang, B., Wang, Y., and Liu, J. (2012) Crystal
structure of a mono-and diacylglycerol lipase from Malassezia globosa reveals a
novel lid conformation and insights into the substrate specificity, Journal of
Structural Biology 178, 363-369.
187. Dong, S., Wei, T.-D., Chen, X.-L., Li, C.-Y., Wang, P., Xie, B.-B., Qin, Q.-L.,
Zhang, X.-Y., Pang, X.-H., and Zhou, B.-C. (2014) Molecular insight into the role
of the N-terminal extension in the maturation, substrate recognition, and catalysis
of a bacterial alginate lyase from polysaccharide lyase family 18, Journal of
Biological Chemistry 289, 29558-29569.
188. Little, D. J., Li, G., Ing, C., DiFrancesco, B. R., Bamford, N. C., Robinson, H.,
Nitz, M., Pomès, R., and Howell, P. L. (2014) Modification and periplasmic
translocation of the biofilm exopolysaccharide poly-β-1, 6-N-acetyl-d-
glucosamine, Proceedings of the National Academy of Sciences 111, 11013-
11018.
189. Shimokawa, T., Yoshida, S., Kusakabe, I., Takeuchi, T., Murata, K., and
Kobayashi, H. (1997) Some properties and action mode of (1→ 4)-α-L-
guluronan lyase from Enterobacter cloacae M-1, Carbohydrate Research 304,
125-132.
190. Nakai, T., Sugano, Y., Shoda, M., Sakakibara, H., Oiwa, K., Tuzi, S., Imai, T.,
Sugiyama, J., Takeuchi, M., and Yamauchi, D. (2013) Formation of highly
twisted ribbons in a carboxymethylcellulase gene-disrupted strain of a cellulose-
producing bacterium, Journal of bacteriology 195, 958-964.
191. Collins, R. F., Beis, K., Dong, C., Botting, C. H., McDonnell, C., Ford, R. C.,
Clarke, B. R., Whitfield, C., and Naismith, J. H. (2007) The 3D structure of a
periplasm-spanning platform required for assembly of group 1 capsular
polysaccharides in Escherichia coli, Proceedings of the National Academy of
Sciences 104, 2390-2395.
192. Marlovits, T. C., Kubori, T., Sukhan, A., Thomas, D. R., Galán, J. E., and Unger,
V. M. (2004) Structural insights into the assembly of the type III secretion needle
complex, Science 306, 1040-1042.
193. Du, D., Wang, Z., James, N. R., Voss, J. E., Klimont, E., Ohene-Agyei, T.,
Venter, H., Chiu, W., and Luisi, B. F. (2014) Structure of the AcrAB-TolC
multidrug efflux pump, Nature 509, 512-515.
194. Bjerkan, T. M., Lillehov, B. E., Wenche, S., Skjåk-Bræk, G., Valla, S., and
Ertesvåg, H. (2004) Construction and analyses of hybrid Azotobacter vinelandii
mannuronan C-5 epimerases with new epimerization pattern characteristics,
Biochemical Journal 381, 813-821.
75
195. Hestrin, S. (1949) The reaction of acetylcholine and other carboxylic acid
derivatives with hydroxylamine, and its analytical application, Journal of
Biological Chemistry 180, 249-261.
196. Skj, G., Grasdalen, H., and Larsen, B. (1986) Monomer sequence and acetylation
pattern in some bacterial alginates, Carbohydrate Research 154, 239-250.
76
Appendix
Figure A1: Electrospray mass spectrum obtained in the negative mode for an
aqueous ammonium acetate solution of ManA4-O-propyl. The 764 Da ManA4-O-propyl was
observed at 782 (M+NH4)+
m/z. All peaks are relative to the largest peak at 782 m/z.
Peaks at 392 (ManAΔ2-O-propyl) and 569 m/z (ManAΔ3-O-propyl) were not observed.
Figure A2: Mass spectrometry spectrum obtained in the negative mode for the AlgL
WT digestion of ManA4-O-propyl. The digestion products were analyzed after 30 min.
ManA4-O-propyl, ManAΔ3-O-propyl, and ManAΔ2-O-propyl at 763, 569, and 392 m/z, respectively,
were identified, while ManA1-O-propyl was not observed. All peaks are relative to the
largest peak at 763 m/z.
trap CE = 30.85/20/5/2 4-3 TRANSFER CE = 1
m/z100 200 300 400 500 600 700 800 900 1000 1100 1200
%
0
100
m/z100 200 300 400 500 600 700 800 900 1000 1100 1200
%
0
100
G2S_June07_16_30 2 (0.051) Cm (2:10) TOF MS ES+ 1.97e7782.2223
787.1752
803.1417
G2S_June07_16_29 9 (0.169) Cm (2:11) TOF MS ES- 9.33e5763.1619
761.1353
587.1332545.0858369.0540 733.1519
785.1429
801.1160
823.0939
829.0971
AlgL 1.7 uM L4-3 67 uM 500,1500,3000
m/z160 180 200 220 240 260 280 300 320 340 360 380 400 420 440 460 480 500 520 540 560 580 600 620 640 660 680 700 720 740 760 780 800
%
0
100
m/z160 180 200 220 240 260 280 300 320 340 360 380 400 420 440 460 480 500 520 540 560 580 600 620 640 660 680 700 720 740 760 780 800
%
0
100
m/z160 180 200 220 240 260 280 300 320 340 360 380 400 420 440 460 480 500 520 540 560 580 600 620 640 660 680 700 720 740 760 780 800
%
0
100
EK_G2_17July14_06 846 (28.565) Cm (846:886) TOF MS ES- 4.04e5763.3093
569.2255
392.1376429.1985 545.1915
587.2401
764.3040
765.3113
EK_G2_17July14_06 321 (10.849) Cm (298:325) TOF MS ES- 3.37e5763.3093
569.2255
392.1376
429.1985 545.1915587.2401
764.3040
765.3113
EK_G2_17July14_06 6 (0.219) Cm (1:7) TOF MS ES- 7.59e4763.3093
392.1376 569.2359
400.1303429.1985545.1915
587.2401
764.3161
785.2914
30 m
Rel
ativ
e A
bu
nd
ance
R
elat
ive
Ab
un
dan
ce