Structure and role of P. aeruginosa

AlgL in alginate biosynthesis

Steven Wong

A thesis submitted in conformity with the requirements for the degree

Master of Science

Department of Biochemistry, Faculty of Medicine

University of Toronto

© Copyright by Wong, Steven 2016

II

Structure and role of P. aeruginosa

AlgL in alginate biosynthesis

Steven Wong

Master of Science

Department of Biochemistry, Faculty of Medicine

University of Toronto

2016

Abstract

During chronic infection, Pseudomonas aeruginosa generate alginate-containing

biofilms in the lungs of cystic fibrosis patients. Mature bacterial alginate is a

heteropolymer of α-L-guluronic acid and partially acetylated β-D-mannuronic acid. P.

aeruginosa alginate biosynthesis requires thirteen proteins, including an alginate lyase,

AlgLPa, which has been proposed to have a bi-functional role, both as a lyase and as an

integral part of the cell envelope biosynthetic complex. How AlgLPa performs these

functions is currently poorly understood. We have used an in vitro structure-function

approach to explore the substrate recognition and catalytic mechanism of AlgLPa, and in

vivo complementation to explore the role of its activity in alginate biosynthesis. The

results presented suggest that AlgLPa is an endo-acting lyase with at least six subsites,

and that the loop containing K66 is critical for substrate binding and/or catalysis. The

complementation data supports the hypothesis that AlgLPa assembles into the cell

envelope biosynthetic complex.

III

Acknowledgements

There are too many individuals to list who have guided my professional and

academic development. I would like to first thank all my previous research supervisors

including Drs. Jeremy Wulff, Steve Perlman, Frank van Veggel, and Al Boraston.

Starting out as an eager undergrad in first year, it was their belief in me that gave me the

confidence to continue my research and academic pursuits. Their continuous support led

me on this path towards the Howell Lab. Dr. P. Lynne Howell and my committee

members, Drs. Jean-Philippe Julien and Charles Deber, continued that level of support

and helped guide and challenge me to achieve my maximum potential. Although I started

graduate studies to further my academic and professional development, I truly feel I have

gained much more because of their guidance and supervision.

Of course, I would not be successful without my lab members. Thanks to all those

who helped me realize failure is never the end, but an opportunity to reflect on how to

adapt to the challenges present. These great individuals include Dr. Roland Pfoh, Dr.

Perrin Baker, Dr. Kristin Low, Dr. Laura Riley, Dr. Sarah Kennedy, Dr. Dustin Little,

Erum Razvi, Lindsey Marmont, Greg Whitfield, Andreea Gheorghita, and the countless

co-op and summer students. Finally, I would like to give a big thanks to Dr. Stephanie

Tammam. On top of teaching me most technical skills and creating a welcoming

environment as a new student, she always challenged me to reflect on my work and see

everything as a larger scope. I cannot thank these individuals enough. Science succeeds

by the efforts of a team and the leadership of mentors along the way.

IV

Table of Contents

Chapter 1: Introduction 1 1.1 Biofilms 1

1.1.1 Biofilm function 1

1.1.2 Biofilm matrix components 3

1.1.3 Pseudomonas aeruginosa 5

1.2 Exopolysaccharides 6

1.2.1 P. aeruginosa biofilm exopolysaccharides 6

1.2.2 Psl Function, biosynthesis, and export 9

1.2.3 Pel function, biosynthesis, and export 11

1.2.4 Alginate 12

1.2.5 Alginate biosynthesis and export 13

1.3 Alginate system and alginate lyases 14

1.3.1 Alginate trans-envelope complex 14

1.3.2 Function and role of AlgLPa in the trans-envelope complex 15

1.3.3 Classification of alginate lyases 18

1.3.4 Catalytic mechanism and polysaccharide lyase subsites 19

1.4 Previous Work and Project Overview 21

1.4.1 Previous work 21

1.4.2 Project goal and thesis objectives 23

Chapter 2: Structural and Functional Characterization of AlgLPa 25 2.1 Materials and methods 25

2.1.1 Chemicals, bacterial strains, plasmids, and growth media 25

2.1.2 DNA manipulations 28

2.1.3 In vitro expression and purification of AlgL 28

2.1.4 Production of AlgL antibodies 29

2.1.5 Crystallization and structure determination of AlgL K66A 30

2.1.6 Structural analysis and sequence analysis of AlgL and A1-III 31

2.1.7 Protein-substrate computational modeling 31

2.1.8 Mass spectrometry product analysis 32

2.1.9 In vivo growth curve 32

2.1.10 Western blot analysis 33

2.1.11 Purification of alginate 33

2.1.12 Quantification of uronic acid 34

2.2 Results 35

2.2.1 Expression, purification and crystallization of AlgL constructs 35

2.2.2 K66A structure and function of the AlgL lid loop 39

2.2.3 AlgL contains at least six subsites 43

2.2.4 AlgL is an endo-lyase 46

2.2.5 Growth of P. aeruginosa is unaffected by an altered AlgL catalytic activity

during alginate production 48

2.3 Discussion 51

2.3.1 Molecular mechanism of AlgL catalysis 51

2.3.2 AlgL is a component of the trans-envelope complex 53

2.3.3 Model of AlgL in alginate biosynthesis and export 55

V

Chapter 3: Conclusions and Future Directions 58 3.1 Conclusions 58

3.2 Future Directions 58

3.2.1 Structural determination of AlgLPa-substrate complex 59

3.2.2 Further characterization of in vivo variants 59

3.2.3 Uncover trans-envelope complex protein-protein interactions 60

References 61

Appendix 76

VI

List of Tables

Table 1: Enzyme kinetic data for AlgLPa

Table 2: PolyManA substrates used for mass spectrometry and crystallization

trials

Table 3: Primers used for generation of in vivo variants

Table 4: Summary of data collection and preliminary refinement statistics for

AlgL K66A.

Table 5: O-propyl product molecular weights and corresponding signal in mass

spectrometry

Table 6: Quantification of uronic acids produced by PAO1 WPA complemented

strains

20

26

27

38

48

55

VII

List of Figures

Figure 1: Biofilm-driven bacterial defense mechanisms used against antibiotics

Figure 2: Chemical composition of alginate, Pel and Psl polysaccharides.

Figure 3: Schematic models of the P. aeruginosa alginate, Pel, and Psl

biosynthetic complexes and psl, pel, and algD operon.

Figure 4: Contrasting phenotypes of P. aeruginosa ΔalgL.

Figure 5: Convention for subsite labeling of polysaccharide lyases and proposed

alginate lyase catalytic mechanism

Figure 6: Structure of P. aeruginosa AlgLPa WT with emphasis on active site

residues and their putative function.

Figure 7: In vitro specific activity of AlgLPa variants.

Figure 8: SDS-PAGE analysis of the AlgL purification protocol

Figure 9: AlgL K66A crystals produced from crystallization screen and condition

optimization

Figure 10: Surface representation and cartoon model of AlgL K66A.

Figure 11: Structural comparison of lid loop in P. aeruginosa AlgL and

Sphingomonas species A1-III

Figure 12: AutoDock Vina free energy binding scores of AlgL-ManA model

Figure 13: Subsite identification by AutoDock Vina

Figure 14: Potential AlgL- ManA4-O-propyl products based on specific subsite binding

Figure 15: PAO1 WPA growth curve and AlgL and Δ Western blot analysis

Figure 16: Revised model for the role of AlgL in the trans-envelope complex

Figure A1: Electrospray mass spectrum obtained in the negative mode for an

aqueous ammonium acetate solution of ManA4-O-propyl

Figure A2: Mass spectrometry spectrum obtained in the negative mode for the AlgL

WT digestion of ManA4-O-propyl

2

6

8

16

19

21

22

37

38

42

43

45

46

48

50

57

60

60

VIII

List of Abbreviations

AP Alkaline phosphatase

AUC Analytical ultracentrifugation

BLI Biolayer interferometry

dp Degree of polymerization

CF Cystic fibrosis

c-di-GMP bis-(3’,5’)-cyclic-dimeric-guanosine monophosphate

CAZy Carbohydrate-active enzymes

DMSO Dimethyl sulfoxide

DNA Deoxyribonucleic acid

dNTP Deoxyribonucleotide

dTDP-rhamnose Thymidine diphosphate rhamnose

ECM Extracellular matrix

eDNA Extracellular DNA

EPS Extracellular polymeric substance

ESI Electrospray ionization

GDP-Man Guanosine diphosphate mannose

GDP-ManA Guanosine diphosphate mannuronic acid

GmR Gentamicin resistance

GulA α-L-guluronic acid

GT Glycosyltransferases

HEPES N-(2-hydroxyethyl)piperazine-N’-(2-ethansulfonic acid)

His6 Hexahistidine

IM Inner membrane

ITC Isothermal titration calorimetry

LB Lysogeny broth

LIC Ligation-independent cloning

ManA β-D-mannuronic acid

MATE Multidrug and toxic compound extrusion transporter family

MR Molecular replacement

MS Mass spectrometry

IX

MW Molecular weight

Ni2+

NTA Nickel nitrile-triacetate

OM Outer membrane

PAGE Polyacrylamide gel electrophoresis

PCR Polymerase chain reaction

PEG Polyethylene glycol

PG Peptidoglycan

PL Polysaccharide lyase

PNAG poly-β-1,6-N-acetyl-D-glucosamine

polyGulA Poly-guluronic acid

polyManA Poly-mannuronic acid

polyManAGulA Poly-mannuronic and -guluronic acid

rmsd Root mean square deviation

SAXS Small-angle x-ray scattering

SDS Sodium dodecyl sulfate

Tris Tris(hydroxymethyl)aminomethane

TPR Tetratricopeptide repeat

UDP-glucose Uridine diphosphate-glucose

WT Wild-type

1

Chapter 1: Introduction

1.1 Biofilms

1.1.1 Biofilm function

Bacteria facing fluctuating environmental stresses and stimuli frequently undergo

physiological changes. These stimuli can trigger bacteria to switch between two different

life forms: the free-swimming single-celled planktonic state or the heterogeneous multi-

cellular community embedded within a self-produced matrix or biofilm state [1-3]. The

biofilm matrix is composed of various extracellular polymeric substances [4] that serve

individual and/or synergistic functions. Bacterial growth within a biofilm promotes cell-

to-cell communication, population heterogeneity, and protective properties that result in

increased tolerance to antibiotics, the host immune response and detergents [5-12]. The

advantages conferred by growth within biofilms has led to the discovery of bacterial

biofilms in a range of different environments including oil storage and transfer containers

[13] and the International Space Station [14]. These biofilms can lead to industrial

biocorrosion: accelerated corrosion of metallic materials caused by the metabolic activity

of microorganisms [13]. Pathogenic bacteria can also develop biofilms within animal

hosts [15]. While the planktonic bacterial lifestyle is typically associated with acute

infections, biofilms are frequently involved in chronic conditions due to the advantages

conferred by this lifestyle. Biofilm-related infections place a heavy burden on the

healthcare system through its involvement in chronic infection and biofilm formation on

medical devices [16]. Biofilm-related infections are estimated to be present in up to 80%

of human bacterial infections [15].

The tolerance of bacteria within a biofilm to antibiotic treatment occurs through a

number of mechanisms: limited nutrient penetration, decreased effective concentration of

antibiotics, the presence of persister cells, and the secretion of antibiotic-active enzymes

[3, 17-27]. The dense biofilm matrix limits the diffusive properties of all compounds.

2

This creates a gradient, such that at the center of the biofilm, there is a low pH

environment with low O2 and high CO2 partial pressures. Compared to the biofilm

periphery, the biofilm interior is starved of nutrients and as a result, bacterial growth and

metabolism is significantly reduced. Many antibiotics target active bacterial cellular

processes and therefore their susceptibility to antibiotics is reduced (Figure 1A) [17].

Limited diffusion within the matrix also decreases the concentration of exogenously

added antibiotics at the biofilm core. Since threshold concentrations of antibiotics are

required to inhibit bacterial growth, the exposure of cells within the interior of the biofilm

to sub-minimal inhibitory concentrations of antibiotics promotes the growth and enriches

for antibiotic resistance of these cells (Figure 1B) [18].

Figure 1: Biofilm-driven bacterial defense mechanisms used against antibiotics. A:

Nutrients deprivation. B: Limited antibiotic diffusion. C: Presence of persister cells. D:

Secretion of antibiotic inhibiting enzymes. These mechanisms or biofilm characteristics

minimize the effectiveness of antibiotics against biofilms. Adapted from an image from

http://www.biofilm.montana.edu/.

Nutrient depletion creates an altered microenvironment

with decreased cellular activity

Slow diffusion

limits the amount of antibiotics

penetrating the interior of the

biofilm

Subpopulations secrete enzymes to render antibiotics ineffective to the

biofilm community

Heterogeneity increases the

number of persister cells with inherent antibiotic

resistance

A D

B C

3

The metabolic variation among bacteria within biofilms also aids growth during

infection. Persister cells are dormant and metabolically inactive, but differ from nutrient-

deprived cells by the mechanism of cellular inactivity [21]. Persister cells can be

generated by environmental stimuli including stresses to the cell membrane that can

trigger a cascade activating the expression of cognate toxins [22]. The expression of these

toxins can also be stochastically activated independent of environmental stresses to

produce dormant persister cells [23]. These toxins can inactivate metabolic processes and

can create a subpopulation of dormant cells. This inactive phenotype allows bacteria to

persist through antibiotic treatments. Once the antibiotic dosage is no longer lethal, a

subset of the persister cells will revert to the metabolically active state by a stochastic

mechanism that produces opposing antitoxins. These antitoxins will disable the effects of

the toxins to transition the once persister cells to a metabolic active state (Figure 1C)

[24].

Another subgroup of cells is able to secrete enzymes that degrade antibiotics,

hence benefiting the biofilm community as a whole (Figure 1D) [28]. This resistance

mechanism is coordinated by cell-to-cell communication or quorum sensing [25-27].

Combined, these mechanisms complicate biofilm-associated bacterial infections.

1.1.2 Biofilm matrix components

The extracellular polymeric substance (EPS) that comprise the biofilm matrix

include extracellular DNA (eDNA) [29], proteins, exopolysaccharides, and non-

polymeric compounds including lipopolysaccharides and rhamnolipids. The composition

of the EPS varies depending on environmental conditions and bacteria within the biofilm

[30-33]. eDNA, released from lysed bacterial or host cells, [32] can contribute to the pool

of eDNA in the biofilm and can serve as a public good that contributes to the growth of

the bacterial population [34-37]. Bacteria can uptake these polymers, thus contributing to

the sharing of genetic elements among biofilm-bound cells [30] or the nutritional needs

of the bacteria [38]. eDNA can also provide other functions. Discovered by nucleolytic

enzyme treatment on biofilms, cell-to-cell interactions are mediated by eDNA [39].

These polymers also chelate positive ions to generate a unique electrochemical

4

environment, which results in induction of a cationic antimicrobial peptide resistance

operon in P. aeruginosa [40].

Protein components associated with biofilms serve a variety of functions and

include extracellular proteins, cell surface adhesins, and cell appendages such as flagella,

pili, and fimbriae [41]. Secreted and surface-attached proteins contribute to the

development and stabilization of the mature biofilm architecture [42]. Secreted amyloid

repeats or cell-attached appendages aid initial cell-surface interactions [43], while

exopolysaccharide binding lectins [44] and eDNA binding pili [45] mediate cell-matrix

interactions. Secreted enzymes can also hydrolyze or degrade matrix components. This

degradation potentially serves a nutritional need, and it also allows for remodeling of the

biofilm thus facilitating detachment of the bacteria from the biofilm matrix, and a switch

to a planktonic lifestyle [29, 46-48].

Exopolysaccharides, which vary in charge, size, monosaccharide composition,

and chemical modifications, contribute to the structure and integrity of the biofilm, and

bacterial survival during host infection [49-52]. Carbohydrate polarity assists in water

retention in the biofilm [53]. The network of non-covalent interactions between hydroxyl

groups contributes to the robust nature of biofilms [54]. Glycosidic linkages affect

polysaccharide flexibility. For example, β-1,4 or β-1,3 bonds confer more rigidity, as is

seen in the cellulosic backbone of xanthan from Xanthomonas campestris, while the α-

1,2 or α-1,6 linkages found in many dextrans yield more flexible structures [55]. The

charge of the polysaccharide can also play a direct function. For example, anionic P.

aeruginosa alginate has been demonstrated to protect bacteria from aminoglycosides

antibiotics by directly binding and sequestering the cationic drug [56]. Certain

polysaccharides have also been shown to impede specific host immune system

components. Polysaccharide-I [9] or dextran secreted by Burkholderia cenocepacia have

been shown to interfere with the function of human neutrophils in vitro by directly

interfering with their chemotaxis function [57]. Carbohydrate modifications also

contribute to pathogenesis and/or biofilm properties. The acetyl groups of cepacian,

which contains one to three acetyl groups per trisaccharides repeat [58], was determined

to protect Burkholderia cepacia during infection by resisting the effects of reactive

oxygen species and reducing the susceptibility of cepacian to enzymatic degradation [59].

5

Deacetylation of poly-N-acetyl-glucosamine also plays a role in resistance against

neutrophil phagocytosis and cationic antimicrobial peptides, and is required for proper

surface attachment [60]. These structural and chemical properties illustrate the diversity

of exopolysaccharides that contribute to the prevalence of biofilms in many different

environments.

1.1.3 Pseudomonas aeruginosa

P. aeruginosa is an opportunistic Gram-negative pathogen capable of both

aerobic and anaerobic growth. P. aeruginosa is notorious for biofilm formation and is

difficult to eradicate when it adopts this growth lifestyle. The continued use of antibiotics

drive the evolution of efflux pumps in P. aeruginosa that give rise to inherent antibiotic

resistance [61]. The bacteria’s poorly permeable outer membrane and production of β-

lactamases also renders antibiotics ineffective [10]. The antibiotic resistance and growth

over a large temperature range allows P. aeruginosa to grow ubiquitously within soil,

water, man-made environments, and animal and plant surfaces [62]. The industrial effects

of P. aeruginosa include corroding and blocking pipelines, contaminating water, and

attaching to and damaging marine vessels [63, 64].

P. aeruginosa is primarily harmful to the health of plants and animals. Soft-rots

on vegetation [65] and root-based biofilm infections [4] have been linked to P.

aeruginosa and affect the agricultural production of tomatoes, onions, and beans. P.

aeruginosa also affects the health of human subpopulations including immunodeficient,

hospitalized, [66], and burn wound patients [67]. Complications of P. aeruginosa

infections include keratitis [66], dermatitis [68], and urinary [69] and respiratory tract

infections [70]. Chronic P. aeruginosa biofilm-associated infections are the leading cause

of morbidity and mortality in the cystic fibrosis (CF) patient population [70-73]. The

impact that P. aeruginosa biofilms have on industry, agriculture, and human health

illustrates the importance of understanding the mechanisms required for initial and

sustain growth within a biofilm.

6

1.2 Exopolysaccharides

1.2.1 P. aeruginosa biofilm exopolysaccharides

P. aeruginosa is genetically capable of synthesizing at least three

exopolysaccharides important for biofilm formation: alginate, Pel, and Psl

polysaccharides (Figure 2) [74]. In P. aeruginosa PAO1, Pel has been determined to

localize near the base of a biofilm where it interacts with eDNA [75], while Psl is found

typically at the periphery [76]. Atomic force microscopy on the biofilm material of an

alginate over-producing strain, P. aeruginosa FRD1, resulted in the visualization of

loosely coated material assumed to be alginate [74]. These three P. aeruginosa

exopolysaccharide biosynthesis and export is categorized as synthase-dependent or

Wzx/Wzy-like mechanisms [74].

Figure 2: Chemical composition of alginate, Pel, and Psl polysaccharides. P.

aeruginosa alginate is a random polymer of β-1,4 linked GulA and partially acetylated

ManA. Pel is a random 1,4 linked polymer of partially acetylated N-acetylglucosamine

and N-acetylgalactosamine, while Psl is a branched penta-saccharide repeat containing

glucose, mannose, and rhamnose.

Alginate Random polymer

Ac

Pel Random polymer

Psl

Repeat Polymer

Mannose

Rhamnose

Glucose Glucosamine

Galactosamine

Guluronic acid Mannuronic acid (ManA)

N-acetyl Glucosamine

N-acetyl Galactosamine

6 6

β4 β4 β4 β4 β4 β4 β4

2 and/or 3 4 4 4 4 4 4 4

β3 β3 β3 β3 β3 β3 β3

7

Synthase-dependent exopolysaccharide systems have four hallmark proteins or

protein domains: a membrane-embedded glycosyltransferase (GT), a bis-(3’,5’)-cyclic-

dimeric-guanosine monophosphate (c-di-GMP) receptor, a tetratricopeptide repeat (TPR)

containing protein, and a β-barrel porin [77]. The inner-membrane bound GT uses

activated sugar-nucleotide precursors to polymerize and translocate the polysaccharide

across the inner membrane. These systems also contain an inner-membrane embedded

co-polymerase regulated by c-di-GMP. Upon localization to the periplasmic space,

chemical modifications such as acetylation, deacetylation, and/or epimerization may

occur. A TPR containing protein is proposed to protect the polysaccharide from

degradation and assist in its extracellular export via the β-barrel porin [77].

Wzx/Wzy-like biosynthesis and export, named based on the Wzx and Wzy

proteins involved in group 1 capsular polysaccharide in E. coli, involves multiple proteins

and moieties: a polyisoprenoid lipid undecaprenol diphosphate acceptor, GT, flippase,

polysaccharide polymerase, polysaccharide co-polymerase, and α-helical outer membrane

polysaccharide export protein. GT’s polymerize and attach defined oligosaccharide

repeats to a polyisoprenoid lipid undecaprenol diphosphate acceptor bound to the

cytosolic leaflet of the inner membrane. An inner membrane-embedded flippase

translocates the oligosaccharide repeat to the periplasmic space, where a polymerase joins

the oligosaccharide repeats together to produce a high molecular weight polysaccharide.

This system also contains a family of proteins called polysaccharide co-polymerases with

complex functions not necessarily confined to polymerization [78]. However, all known

polysaccharide co-polymerases interact with an α-helical outer membrane export protein

to secrete the polymer [74, 77, 79, 80].

Deletion of critical exopolysaccharide biosynthesis and/or export genes in P.

aeruginosa in any of the aforementioned systems reduces its virulence [81-83]. These

findings have generated interest in targeting P. aeruginosa exopolysaccharide

biosynthesis and/or export proteins to address chronic infection, especially those

suffering from CF.

8

Figure 3: Schematic models of the P. aeruginosa alginate, Pel, and Psl biosynthetic complexes and psl, pel, and algD operon.

Known protein functions are coloured according to the legend above. A: psl operon genes contributing to synthesis and export of Psl.

B: Proteins encoded by the pel operon required for Pel production, C: Twelve algD operon proteins and AlgC involved in alginate

biosynthesis and export. Established alginate protein-protein interactions are indicated by black and white diamonds [81, 83-90]. P.

aeruginosa AlgL (AlgLPa) is proposed to be part of the trans-envelope complex but to date this has not been experimentally verified.

Protein stoichiometry for complex formation is not known. See text for details related to the role of each protein in the three

biosynthetic systems. ECM, Extracellular matrix; OM, outer membrane; PG, peptidoglycan, IM, inner membrane.

9

1.2.2 Psl Function, biosynthesis, and export

After the discovery of Psl in P. aeruginosa PAO1, it has since been identified in a

number of other P. aeruginosa strains, where it is typically the primary

exopolysaccharide within the biofilm [91, 92]. Gas chromatography–mass spectrometry

and nuclear magnetic resonance experiments have revealed that Psl is composed of a

branched penta-saccharide repeat unit (Figure 2) [93]. Deletion of essential psl genes

suggests that for many strains of P. aeruginosa, Psl promotes initial surface attachment

during biofilm formation [91]. A comparison between Psl overproducing and Psl

deficient strains also found that the polysaccharide can directly impair macrophage and

neutrophil function [94]. In recent static and continuous-flow biofilm experiments, it was

determined that Psl provides a first line defense against antibiotics due to its diverse

biochemical properties, especially during early biofilm formation [95]. During this stage

of biofilm formation, specific P. aeruginosa strains utilize Psl to mediate cell-cell

interactions to anchor bacterial cells [76]. Psl antibodies have also been isolated from

patients recovering from P. aeruginosa infections, demonstrating its clinical relevance

[96].

The Psl operon encodes twelve protein products (Figure 3A). Due to the predicted

structural similarities between PslA, PslE, and PslD from the Pel system, and WbaP,

Wzc, and Wza from the Escherichia coli group 1 capsular polysaccharide Wzy-

dependent system, respectively, the Psl system is proposed to function similarly to this E.

coli system [78]. Biosynthesis begins with the production of three activated precursors,

guanosine diphosphate mannose (GDP-Man), uridine diphosphate-glucose (UDP-

glucose), and thymidine diphosphate rhamnose (dTDP-rhamnose). The production of

UDP-glucose is initiated by the phosphoglucomutase activity of AlgC, which catalyzes

glucose-6-phosphate to glucose-1-phosphate [97]. Nucleotide carrier activation by GalU

completes the production of UDP-glucose [93]. The rml operon encodes genes required

for the production of the sugar nucleotide dTDP-rhamnose [93]. The production of GDP-

Man requires AlgC and the bifunctional PslB. PslB isomerizes fructose-6-phosphate to

mannose-6-phosphate. Mannose-1-phosphate is subsequently produced by the

phosphomannomutase activity of AlgC. PslB then transfers GDP and produces GDP-Man

[93]. Interestingly, PslB was found to be functionally redundant as pslB deletion mutants

10

are able to produce Psl due to the catalytic action of WbpW. This redundancy may also

suggest that PslB can produce precursors for other pathways [93].

The four predicted cytosolic GTs within the psl operon are PslI, PslF, PslH [98],

and PslC [99]. PslI, PslF, and PslH are classified according to the Carbohydrate-Active

Enzymes (CAZy) database as member of GT family 4 (GT-4) [100]. Phyre2 [101]

predictions suggest these putative GT’s are structurally related to PimA, a Mycobacteria

GT-4 [102]. PslC is predicted to belong to family GT-2 [99]. At present, the specific

substrates and reactions catalyzed by these enzymes are unknown.

Similarities between PslA and WbaP suggest that PslA provides the site for the

assembly of the pentasaccharide-repeat unit onto an isoprenoid lipid on the cytosolic side

of the inner membrane. Similar to the function of the Wzx flippase and Wzy polymerase,

PslK, PslJ, and PslL are proposed as functional flippases or polymerases [74]. However,

the specific functions are not known. PslE is the predicted polysaccharide co-polymerase

and proposed to be involved in both polymerization and to interact with the putative α-

helical outer membrane export protein, PslD. This parallels the determined function and

role of Wzc and Wzy, respectively.

Although little is currently known about the function and role of PslG, it has been

shown to exhibit in vitro hydrolytic activity towards Psl [103]. Furthermore, while not

essential for synthesis, overexpression of PslG in vivo has been observed to impair

biofilm formation [103]. PslG is proposed to function similarly to the non-essential endo-

glycases, ExoK and ExsH from the Gram-negative bacterium Sinorhizobium meliloti [7].

ExoK and ExsH are proposed to produce lower molecular weight polysaccharides that

serve as signaling molecules to promote symbiosis with its host plants [104, 105]. PslG

may similarly produce low molecular weight Psl as a signaling molecule to affect Psl

production [106]. This mechanism may be linked to c-di-GMP, a secondary messenger

signaling molecule that has been found to promote Psl production by an unknown

mechanism [107, 108].

11

1.2.3 Pel function, biosynthesis, and export

Pel contributes to biofilm formation at air-liquid interfaces; these biofilms are

called pellicles. Transposon screening identified the seven gene pel operon as required

for pellicle formation (Figure 3B) [82]. Through analytical glycosyl sugar and linkage

analysis, Pel was recently determined to be a 1-4 linked polymer of N-acetylglucosamine

and N-acetylgalactosamine. The polymer is assumed to be partially de-N-acetylated by

the deacetylase activity of PelA to produce a polymer with a net positive charge (Figure

2) [75]. Although the majority of the research on Pel biosynthesis and export focuses on

P. aeruginosa, bioinformatics studies indicate the presence of homologous operons in

other bacteria including Ralstonia solanacearum [109], Burkholderia terrae [110], and

Marinobacter aquaeolei [111]. Studies suggest Pel is involved in early stage biofilm

adherence [109], maintaining cell-to-cell interactions, and serving as the primary

structural scaffold in P. aeruginosa PA14 biofilms [112]. Since P. aeruginosa PA14 is

unable to produce Psl, it is proposed that Pel serves a structural role in this strain. The Pel

polymer has also been found to contribute to P. aeruginosa infections, and enhance

resistance to aminoglycoside antibiotics by an unknown mechanism [112]. The recently

demonstrated interaction between Pel and eDNA in an in vitro biofilm and Pel with host

polymers such as hyaluronic and mucin in vitro suggests Pel impacts pathogenesis [75].

Although characterization of Pel biosynthesis and export is currently in its early

stages, collective data suggests this process is synthase-dependent like alginate, poly-β-

1,6-N-acetyl-D-glucosamine (PNAG), and cellulose systems [77]. Bioinformatics

analyses and binding analyses suggest PelF is a member of GT-4, and uses a UDP-sugar

as the substrate [74, 75, 98]. It is hypothesized that the TPR of PelE [112] may interact

with PelA and PelB [74]. This complex may also associate with the co-polymerase PelD,

which was shown to regulate polymerization though binding of the secondary messenger,

c-di-GMP, to its degenerate GGDEF domain [113, 114]. PelD and PelE are believed to

assemble as a complex and be required for the regulation of biosynthesis and

translocation across the inner membrane. Collective data have shown that PelA is

bifunctional with both deacetylate and hydrolase activity [115, 116]. The role of PelA

deacetylase is currently unknown. The function of PelG is unknown, but bioinformatics

studies suggest it may be a member of the multidrug and toxic compound extrusion

12

transporter family (MATE), which are known to shuttle small molecules across the inner

membrane [74]. This shuttle system may be involved in modifying the Pel polymer.

At the outer membrane, PelB is predicted to contain an N-terminal periplasmic

TPR domain and C-terminal β-barrel [27]. The periplasmic TPR is thought to facilitate

interactions with other Pel proteins. As suggested for other synthase-dependent systems

PelB likely facilitates complex formation and acts as a conduit for export of the polymer

[74]. PelC has a lipid anchor and has been proposed to share structural similarity to the

periplasmic domain of E. coli TolB. TolB interacts with a peptidoglycan-associated

lipoprotein and is suggested to maintain outer membrane integrity [117]. Another

hypothesis is that PelC contains an α-helical region involved in membrane insertion

[118]. More research is required to better understand the role of many of the proteins in

this system.

1.2.4 Alginate

In 1881, alginate was first extracted and discovered in seaweed [119]. Alginate

depositions in the cell walls of brown algae or Phaeophyceae offer structural support to

the organism [120]. The chemical structure of alginate was determined to be a random

polymer of ManA and its C5’ its epimer GulA in algae [121, 122]. The anionic properties

imparted by virtue of the GulA and ManA uronic acids allows alginate to associate with

divalent cations such as calcium and magnesium to increase intermolecular bonding

[123]. More recent studies have demonstrated alginate biosynthesis and export in

Azotobacter [124] and Pseudomonas spp. [125] where the polymer is involved in the

formation of desiccation resistant cysts [126, 127] and biofilm formation, respectively. P.

aeruginosa alginate contributes to biofilm structural integrity and water retention of the

biofilm matrix [120, 128]. P. aeruginosa alginate producing strains display a

characteristic mucoid phenotype that is common in isolates from CF patients suffering

from chronic infection [91, 129]. Bacterial alginates also have additional O2’ and/or O3’

acetylation modifications, which reduce alginate solubility [55]. Acetylation affects the

thickness of the biofilm and results in decreased nutrient diffusion [55]. Alginate

acetylation has been suggested to contribute to inter- and intra-polysaccharide

13

interactions. These interactions contribute to the tensile strength of the biofilm and

impacts the overall architecture and structure of the biofilm [130]. These functions of

alginate acetylation affect the resilience of the biofilm and improve pathogenesis [55,

130]. O-acetylation was determined to contribute to chronic lung infection by directly

hindering macrophage function [11]. Alginate epimerization also affects the cohesive

properties of the biofilm [131] and impairs complement functions of the immune system

[12]. The integral role alginate plays in CF P. aeruginosa biofilm-linked infections has

resulted in a significant amount of interest in studying the pathogen’s alginate

biosynthesis and export mechanism.

1.2.5 Alginate biosynthesis and export

Alginate biosynthesis and export in P. aeruginosa requires twelve proteins

encoded by the algD operon, and AlgC encoded elsewhere on the chromosome (Figure

3C) [74, 132]. Alginate biosynthesis begins with AlgC, AlgD, and the bifunctional

enzyme AlgA. The phosphomannose activity of AlgA isomerizes fructose-6-phosphate to

mannose-6-phosphate [125]. AlgC subsequently generates mannose-1-phosphate [133],

which is activated to guanosine diphosphate-mannose by AlgD [134]. This compound is

converted to guanosine diphosphate mannuronic acid (GDP-ManA) by AlgA [125].

GDP-ManA is proposed to be polymerized and transported across the inner membrane by

Alg8 and Alg44 [99, 135-137]. Alg8 is classified as a GT-2 [138] that catalyzes the

polymerization of ManA [90], and interacts with the co-polymerase Alg44. Structural

studies, in vitro binding analyses, and in vivo alginate quantification assays have

demonstrated that alginate polymerization requires binding of c-di-GMP to the

cytoplasmic PilZ domain of Alg44 [136].

The linear nascent ManA polymer is subsequently modified as it passes through

the periplasm. To produce the mature polymer, ManA can be selectively epimerized by

AlgG [139] or acetylated at its O2’ and/or O3’ hydroxyl by the action of AlgI, AlgJ, AlgF

and AlgX [107, 140]. It is proposed that AlgI transfers an, as yet unidentified, acetyl

donor across the inner membrane [74] that is catalyzed by the acetylesterase activity of

either AlgJ or AlgX [107] and/or passed between them before alginate acetylation occurs.

In vitro AlgJ does not bind to alginate [107]. In contrast the ability of AlgX to directly

14

bind to and exhibit acetyltransferase activity towards alginate suggests AlgX is the

terminal enzyme that acetylates the nascent polymer [107]. ΔalgF strains were found to

produce non-acetylated polymer, suggesting its involvement in alginate acetylation [140].

The structure of the outer membrane lipoprotein AlgK has been determined and

was found to contain 9.5 TPR motifs [141]. As described in more detail below, AlgK

along with AlgG, Alg44, Alg8, AlgX, and AlgLPa, are proposed to form a trans-envelope

complex that guides alginate through the periplasm (Figure 3C) to allow export of the

polymer through the highly electropositive β-barrel porin, AlgE [107, 141-144].

1.3 Alginate system and alginate lyases

1.3.1 Alginate trans-envelope complex

The presence of an alginate trans-envelope complex was first proposed during

characterization of in vivo knockouts in two P. aeruginosa mucoid strains FRD1 or

PDO300. P. aeruginosa FRD1 and PDO300 contain genetically different non-functional

mutations in mucA. MucA is an anti-sigma factor that suppresses AlgU (also known in

the literature as algT) [145], the sigma factor required for transcription of the algD

operon. FRD1 is a clinically isolated strain while PDO300 was genetically engineered

from the non-mucoid P. aeruginosa PAO1 strain.

P. aeruginosa FRD1 and PDO300 Δalg44 [89] and Δalg8 [90] strains do not

produce alginate or free uronic acids. It was proposed that deletion of the GT or co-

polymerase prevents alginate polymerization. In contrast, P. aeruginosa FRD1 and

PDO300 ΔalgK [87], FRD1 ΔalgX [84], FRD1 ΔalgG [87], and PDO300 ΔalgE [85]

strains were found to secrete degraded alginate products. These observations led to the

hypothesis that a trans-envelope complex formed by these proteins protects the

polysaccharide from degradation. Deletion of any of the trans envelope components

disrupts the complex, thereby exposing the polysaccharide to AlgLPa, the alginate lyase,

which in turn hydrolyses the polymer to produce short uronic acids. Subsequent in vivo

pull-down experiments have shown an interaction between AlgK and AlgX [86], while

more recent mutual stability analysis suggests interactions between: AlgG-Alg8, AlgG-

15

AlgK, Alg44-Alg8, Alg44-AlgK, Alg44-AlgX, and AlgK-AlgE (Figure 3C) [88]. These

findings relate to the trans-envelope complex help guide on-going work in our lab that

aims to determine its detailed molecular mechanism.

1.3.2 Function and role of AlgLPa in the trans-envelope complex

AlgLPa was initially proposed to regulate alginate polymer length, but no data

currently supports this role [146]. The hypothesis that AlgL regulates alginate polymer

length would suggest that the combination of AlgI, AlgJ, AlgF, and AlgX, AlgG, and

AlgLPa function on nascent polymer to produce mature alginate of a regulated length

prior to export. AlgLPa has also been suggested to act on mature alginate by aiding in

dissemination from adhered surfaces, as induced cells overexpressing AlgLPa were

observed to exhibit greater cell sloughing compared to non-induced cells [147]. Finally,

two groups have proposed that AlgLPa interacts with other proteins in the trans-envelope

complex [81, 83]. The methods used by these two groups to generate and analyze algL

deletion strains are different. In each case, the P. aeruginosa FRD1 strain was used and

the algD operon promoter replaced with an isopropyl β-D-1-thiogalactopyranoside

(IPTG) inducible promoter. Both studies deleted the majority of algL. A gentamycin

resistance (GmR) cassette with its intact promoter but without its transcriptional stop site

was subsequently inserted into algL. In addition to the production of full-length

polycistronic mRNA with all alginate genes and the GmR cassette, the production of

mRNA containing only the GmR cassette and downstream genes, algIJFA, will result.

The presence of an antibiotic resistance cassette with an independent promoter is known

to increase expression of downstream genetic elements [148].

Albrecht et al. [81] characterized an algL, ΔalgL, and ΔalgL::algL strain. In all

three strains the algD operon promoter was replaced with a Ptac promoter. In addition, the

ΔalgL and its in trans complemented strain ΔalgL::algL WT have replaced algL with a

GmR cassette. Another complementation strain was produced by introducing an

enzymatically inactive variant or algL in trans. Because of the plasmid copy number,

complementation in trans will also increase the amount of translated AlgL. Growth was

characterized after induction on solid media plates. The algL strain appeared non-lethal

16

and mucoid upon induction of alginate production (Figure 4A) and non-lethal and non-

mucoid in the absence of IPTG [81]. The ΔalgL strain was non-lethal and non-mucoid

upon induction (Figure 4B), and the mucoid phenotype was restored when complemented

in trans with WT algL (Figure 4C). In contrast, the mucoid phenotype was not restored

by complementation in trans using catalytically inactive algL variants [81]. The authors

proposed catalytically active AlgLPa is required for alginate production.

In contrast, Jain et al. [83] replaced the algD operon promoter with Ptrc and

inserted a different GmR cassette. This ΔalgL strain was characterized by induction in

liquid rather than solid media and the cell morphology was assessed by electron

microscopy. This strain was observed to be lethal upon induction of alginate production,

a phenotype that the authors suggested was due to the accumulation of periplasmic

alginate (Figure 4D-F).

17

Figure 4: Contrasting phenotypes of P. aeruginosa ΔalgL. Top (ABC): Interruption of

algL results in a non-mucoid phenotype, which can be rescued by complementation with

algL WT. The absence of a mucoid phenotype upon deletion of AlgLPa is proposed to

result from a disassembled trans-envelope complex. This would prevent alginate

production. Bottom (DEF): Knockout strain produced a conditionally lethal phenotype,

which displayed swelled membranes after 4 hours and lysed cells after 6 hours. Figure

reproduced from references [81, 83], with permission from the Journal of Bacteriology

and Immunity and Infection. Copyright © 2005, American Society for Microbiology.

algL ΔalgL ΔalgL::algL

‘

0 h 4 h 6 h

‘

A

D

B CA

E F

18

The data from Albrecht et al. [81] and Jain et al. [83] suggest different models for

AlgL function. Albrecht et al. [81] suggested an absence of AlgLPa results in a non-

functional alginate biosynthetic system that is incapable of producing alginate. This

finding would support a model in which the Alg8/Alg44 complex, required for alginate

polymerization, is influenced by the presence of AlgLPa. In contrast, Jain et al. [83]

suggested AlgLPa is not required for alginate production. This observation does not

support the involvement of AlgLPa in the biosynthesis of the Alg8/Alg44 complex.

Although these models of alginate biosynthesis differ, both groups hypothesize that in the

absence of AlgLPa, the trans-envelope biosynthetic complex does not form. However, as

described above there are important caveats to each experimental design that potentially

imbalance the stoichiometry of the alginate system. This likely impacts the phenotypes of

the strains and therefore how the data can be interpreted. With the availability of more

modern genetic methods we have developed new ΔalgL strains to overcome the pitfalls

of these experiments; the phenotypes of these ΔalgL strains have been characterized in

this thesis to understand the role and function of AlgL (section 2.2.5).

1.3.3 Classification of alginate lyases

Alginate lyases have been isolated from a variety of different sources including

algae, fungi, and bacteria. Alginate lyases found in organisms lacking alginate

biosynthetic machinery are proposed to provide energy through catabolism and digestion

of extracellular alginate produced by other organisms [149]. The growing number of

identified and characterized alginate lyases has allowed a variety of different

classification systems to be developed that help compare these enzymes [150]. Defined

by the CAZy database on the basis of primary sequence identity, alginate lyases have

been classified into seven specific polysaccharide lyase (PL) families: PL-5, PL-6, PL-7,

PL-14, PL-15, PL-17, and PL-18 [151, 152]. AlgLPa is classified as a member of PL-5.

This characterization allows for comparisons between AlgLPa and other family members,

such as the A1-III alginate lyase from Sphingomonas sp., which has been structurally and

functionally characterized [153].

19

Alginate lyases are further sub-characterized by substrate specificity, based on the

degree of alginate epimerization. This has led to the classification of alginate lyases into

broad poly-mannuronic acid (polyManA), poly-guluronic acid (polyGulA) [154], or poly-

mannuronic and -guluronic acid (polyManAGulA) specific lyases. However, alginate

lyases are not necessarily specific for just one polymer and may exhibit modest catalysis

towards other polymer types [150]. Organisms can possess multiple lyases with varying

efficiencies towards different substrates, e.g. the five extracellular alginate lyases found

in Azotobacter vinelandii each exhibit varying catalytic efficiencies on different ManA

and GulA patterns. These lyases are suggested to aid vegetative growth or cyst formation

[155].

1.3.4 Catalytic mechanism and polysaccharide lyase subsites

The catalytic mechanism of alginate lyases begins by the deprotonation of C5’

hydrogen by a catalytic base, B, usually an arginine or an asparagine (Figure 5A). The

generated anionic intermediate is stabilized by a basic residue, N, which is commonly

histidine (Figure 5B). This allows donation of a proton from the catalytic acid, HA, to

form a double bond between C4’ and C5’ and cleave the glycosidic bond (Figure 5B).

The catalytic acid is frequently tyrosine. This results in the production of an enoic acid

and uronic acid (Figure 5C).

PLs also possess a characteristic mode of action, which can be endo- or exo-

acting [149]. To understand the mode of action, it is useful to understand the accepted

labeling system for active site monosaccharide subsites (Figure 5). Positive and negative

integers, excluding zero, denote specific monosaccharide binding subsites within the

active site, with the highest positive integer describing the reducing end of the polymer.

Glycosidic bond cleavage occurs between the +1 and -1 subsites, to produce an uronic

acid at the +1 subsite and enoic acid at the -1 subsite [156]. Alginate lyases that produce

enoic acid monosaccharides released from the -1 subsite are known as exo-lyases. All

other alginate lyases are categorized as endo-lyases.

20

Figure 5: Convention for subsite labeling of polysaccharide lyases and proposed

alginate lyase catalytic mechanism. Positive and negative integers specify

monosaccharide-binding subsites relative to the cleavage site between -1 and +1.

Cleavage of the polymer generates an enoic acid motif at the -1 subsite. Substrate is in

black, enzyme residues and subsites are in green, with the cleavage point indicated by the

pink arrow. The putative AlgLPa catalytic residues are described: B, catalytic base

(AlgLPa R249); HA, catalytic acid (AlgLPa Y256); N, anionic intermediate neutralizer

(AlgLPa H202). Based on an image by Davies et al. [156]. The yellow arrow indicates a

progression in the reaction mechanism.

21

1.4 Previous Work and Project Overview

1.4.1 Previous work

The in vitro biochemical properties of AlgLPa have been characterized previously

[157]. Kinetic studies of AlgLPa using acetylated and chemically deacetylated polyManA

and polyMG polymers purified from P. aeruginosa suggest that the enzyme is specific

for deacetylated polyManA and polyManAGulA as the kcat/Km for each of these

substrates was comparable and higher than observed for the acetylated polymers (Table

1).

Table 1: Enzyme kinetic data for AlgLPa. PolyManA and poly-MG alginate samples

were purified from P. aeruginosa FRD462 and FRD1, respectively. P. aeruginosa

FRD462 contains an algG point mutation and exclusively produces polyManA [158]. The

polymers were deacetylated prior to analysis by base deacetylation using sodium

hydroxide [157]. The polyManA and polyManA-OAc polymers had an average degree of

polymerization (dp) of 133, while polyManAGulA and polyManAGulA-OAc had dp

values of 263. [157].

Substrate kcat/Km (s-1

M-1

) kcat (s-1

) Km (153)

polyM 2.5 ± 0.6 x 106 32 ± 3 13 ± 3

polyM-OAc 0.30 ± 0.06 x 106 1.5 ± 0.1 5 ± 1

polyManAGulA 3.1 ± 0.9 x 106 32 ± 4 11 ± 3

polyManAGulA-OAc 0.5 ± 0.1 x 106 1.2 ± 0.1 2.6 ± 0.7

To further understand the mechanism of action and molecular details for catalysis,

the structure of AlgLPa was determined in our lab by a former postdoctoral fellow, Dr.

Francis Wolfram. Although the crystal for AlgLPa WT was soaked with ManA3, only a

monomer could be modeled in the active site (PDB ID: 4OZV; Figure 6A). Based on the

22

crystal structure and alignments with other lyases, active site variants of AlgLPa were

constructed (Figure 6AB). Y256 was mutated to interfere with its function as the putative

catalytic acid, HA (Figure 5B and 6B). The cationic H202, denoted as N in figure 5B,

was modified to disrupt its potential ability to neutralize the anionic product intermediate.

K66, W205, and Y259 were targeted because of their proposed role in direct substrate

interactions. The specific activities of these AlgLPa point variants towards chemically

deacetylated-polyManA and -polyManAGulA were determined (Figure 7). In contrast to

the data obtained by Farrell et al. [157], this data suggested that AlgLPa exhibits substrate

specificity towards polyManA with only modest activity towards polyManAGulA.

Figure 6: Structure of P. aeruginosa AlgLPa WT with emphasis on active site

residues and their putative function. A: WT AlgLPa in teal complexed with ManA in

purple (PDB ID: 4OZV). B: WT AlgLPa active site residues targeted for site directed

mutagenesis and characterized using an in vitro specific activity assay are indicated in

orange. The proposed role of each specific residue is indicated.

Residue Proposed Role

K66A Direct substrate interaction

H202A Neutralize anionic catalytic intermediate

R249 Catalytic base

Y256F Catalytic acid

W205F Direct substrate interaction

Y259F Direct substrate interaction

A B

W205

Y259 Y256

H202

K66

R249

23

Figure 7: In vitro specific activity of AlgLPa variants. K66A, H202A, R249E, and

Y256F were found to be inactive, while W205F and Y259F variants exhibited

intermediate (Int.) and hyperactive activity, respectively. The substrate was prepared as

described by Farrell et al. [157]. Quantitative data are presented as the mean ± SE and

compared statistically by Student's t-test with n = 3 for all variants. * indicates a p-value

≤ 0.05. Statistical significance in blue and red compare polyManA of WT and polyGulA

of WT to other variants.

1.4.2 Project goal and thesis objectives

Although a function for AlgLPa has been proposed, the molecular details of the

catalytic mechanism and specificity have not been fully characterized. The goal of this

project was therefore to determine the role of AlgLPa in alginate biosynthesis, and the

molecular details for its catalytic mechanism and substrate specificity. To understand the

molecular details of AlgLPa, a structural analysis of an AlgLPa variant and comparison to

WT AlgLPa and a structurally similar alginate lyase were completed. The X-ray structure

determined was complemented with in silico analyses and mass spectroscopy

experiments.

We have also addressed the inconsistencies of the two previous in vivo ΔAlgLPa

experiments outlined above [81, 83]. The function and role of AlgLPa in vivo was probed

using cis complementation of a new unmarked, non-polar algL deletion mutant. Building

0%

50%

100%

150%

200%

WT K66A H202A R249E Y256F W205F Y259F

Sp

ecific

Activity R

ela

tive

to

Alg

L W

T o

n P

oly

M

polyManA polyManAGulA

* . * . * .. . * * . * .

Inactive Int. Activity Hyperactive

*

*

24

on the specific activity assays (Figure 7), a first set of complementation constructs of

point mutants affecting catalytic activity was generated, and the effects of the mutations

on growth and secreted alginate examined. The data described herein have enabled us to

further our understanding of the alginate system. We describe new molecular details for

AlgLPa catalysis and propose a more detailed model of the alginate biosynthetic and

export complex. According to our model, AlgLPa is a component of the trans-envelope

complex and is important for growth during alginate production. In the absence of AlgL,

the Alg8/Alg44 polymerization complex is functional. Interestingly, AlgLPa catalysis is

not essential for viability during alginate biosynthesis and export.

25

Chapter 2: Structural and Functional Characterization of AlgLPa

Chapter 2 describes the materials and methods, results, and discussion of the

structural and functional characterization of AlgLPa. All references to AlgL pertain to

AlgLPa unless otherwise specified. The construction of the His6-AlgL28-362 (residues 28 –

362) vector, all point mutants, the production of AlgL antibodies, and the purification

protocol for the in vitro study were designed by Dr. Francis Wolfram with the assistance

of Ms. Kritica Arora. The ManA4-O-propyl substrate was the generous gift of Drs. Marthe

Walvoort and Jeroen Codée, Leiden University. Mass spectrometry experiments were

completed by Drs. Elena Kitova and John Klassen, University of Alberta. Dr. Roland

Pfoh provided assistance in the structure determination. P. aeruginosa PAO1 WPA and

all materials required to produce in vivo point mutants of algL were provided by Mr.

Gregory Whitfield and Ms. Allison Guitor.

2.1 Materials and methods

2.1.1 Chemicals, bacterial strains, plasmids, and growth media

Chemicals and reagents, unless otherwise stated, were supplied by Sigma-Aldrich

Canada Ltd. (Oakville, ON). Purified ManA4, ManA6, and ManA10, were obtained from

Marine Oligo (Qingdao, China) and ManA4-O-propyl, ManA5-O-propyl, and ManA10-O-propyl

were synthesized and provided by Drs. Marthe Walvoort and Jeroen Codée (Table 2)

[159]. Lysogeny broth (LB) growth media was obtained from Bio Shop (Burlington,

ON). DNA manipulations were performed in E. coli DH5α or Top10, while in vitro

protein expression was performed in E. coli Origami™ 2 (DE3) Singles™ competent

cells from EMD Millipore (Darmstadt, Germany). All DNA manipulations were

confirmed by sequencing at ACGT DNA Technologies Corporation (Toronto, ON). A

two-step in vitro purification procedure was used to generate a homogeneous sample.

Affinity chromatography using Ni2+

- nitrilotriacetic acid (NiNTA) Superflow affinity

26

column obtained from Qiagen (Mississauga, ON) was followed by size exclusion

chromatography using a HiLoad 16/60 Superdex 200 prep-grade gel filtration column

(GE Healthcare, UK). The P. aeruginosa PAO1 ΔwspF Δpsl PBADalg (PAO1 WPA)

strain and pUC18T-miniTn7T-PBADalgL complementation plasmid, pUC18T-miniTn7T-

PBAD control plasmid without algL and the transformation helper plasmid, pTNS2, were

generated and provided by graduate student, Greg Whitfield, and a former co-op student,

Allison Guitor. These plasmids are based on the recombination protocol of Choi et al.

[160]. Primers were ordered for in vivo point mutations from Sigma-Aldrich Canada Ltd.

(Table 3). All P. aeruginosa strains were grown using modified alginate-producing

(MAP) media containing 100 mM monosodium glutamate, 7.5 mM monosodium

phosphate, 16.8 mM dipotassium phosphate, and 10 mM magnesium sulfate [161].

Unless otherwise specified, kanamycin was used at 50 μg mL-1

for E. coli DH5α, Top10,

or Origami™ 2 (DE3) Singles™ competent cells and gentamycin, 30 μg mL-1

for P.

aeruginosa PAO1 WPA.

27

Table 2: PolyManA substrates used for mass spectrometry and crystallization trials.

Synthetic polyManA containing C1’ O-propyl [159] group were used for mass

spectrometry experiments, while crystallization trials used purified polyManA, which

contains a C1’ hydroxyl.

Name

Molecular

Weight

(g mol-1

)

Structure

ManA4 772.51

ManA6 1074.76

ManA10 1779.26

ManA4-O-propyl 764.59

O-

O-propyl

28

Table 3: Primers used for generation of in vivo variants. Non-bolded and non-

underlined characters indicate the native sequence, while bolded letters designate the

codon affected and underlined characters refer to the mutated nucleotides.

Variant Forward Primer (5’ → 3’) Reverse Primer (3’ → 5’)

K66A CACCAGCGCGTACGAAGGCTCCGATTCG CTTCGTACGCGCTGGTGAAGACCAGGCTG

H202A CAACAACGCTTCCTACTGGGCGGCCTGGTCGG CCAGTAGGAAGCGTTGTTGATCTTCTTCAGCGGC

W205F ATTCCTACTTTGCGGCCTGGTCGGTGATGTCC GGCCGCAAAGTAGGAATGGTTGTTGATCTTCTTCAGC

Y259F CTACCACAACTTTGCGCTGCCACCGCTGG GCAGCGCAAAGTTGTGGTAGGCGAGGGCG

2.1.2 DNA manipulations

Cloning of His6-AlgL28-362 WT, K66A, and Y259A on pET28-MHL vector

(Structural Genomics Consortium, Toronto, ON) is as described in Wolfram et al. [162]

and was obtained from Dr. Francis Wolfram. For in vivo complementation, algL point

mutants were generated on the pUC18T-miniTn7T-PBADalgL plasmid using the

QuikChange® Lightning kit. All plasmid constructs were verified by sequencing. PAO1

WPA complementation was performed by electroporation using 150 ng of pUC18T-

miniTn7T-PBADalgL and 150 ng of pTNS2 into PAO1 WPA [163, 164].

2.1.3 In vitro expression and purification of AlgL

Overexpression of WT His6AlgL28–362 and mutant variants was achieved by

transformation of pET28-MHL plasmid vectors into E. coli Origami™ 2 competent cells.

Starter cultures were grown overnight in 50 mL LB broth at 310 K in a shaking

incubator. Two percent (v/v) overnight starter cultures were inoculated in 1 L of LB

broth. Cultures were grown at 310 K until an approximate optical density (OD600) of 0.7.

Cultures were subsequently induced with IPTG to a final concentration of 1 mM and

grown for a further 16 h at 291 K. Cells were isolated by centrifugation at 5000 × g for

20 min at 277 K. The cell pellet was stored at 253 K until needed. The frozen cell pellet

was thawed on ice and re-suspended in 50 mL cold lysis buffer (300 mM NaCl, 50 mM

Tris:HCl pH 7.5, and 10 mM imidazole) containing one SIGMAFAST EDTA-free

protease-inhibitor cocktail tablet. Cells were homogenized with three passes through an

29

Emulsifex C3 (Avestin Inc., Ottawa, ON) at 12,000 psi. The cell lysate was centrifuged at

25000 × g for 30 min at 278 K to pellet cell debris and insoluble material. The soluble

cell lysate was loaded onto a 5 mL Ni2+

-NTA gravity column equilibrated with lysis

buffer. The column was washed with 10 column volumes of lysis buffer, 6 column

volumes of lysis buffer with 75 mM imidazole, and 6 column volumes of lysis buffer

with 300 mM imidazole. The elution sample containing 300 mM imidazole was

concentrated using an Amicon Ultra centrifugation filter device (Milipore, Germany)

with a 30 kDa cutoff. The concentrated sample was further purified by size exclusion

chromatography on a HiLoad 16/60 Superdex 200 gel filtration column in a buffer

containing 150 mM NaCl, 20 mM Tris:HCl pH 7.5, and 5% glycerol. Select fractions

from the Ni2+

-NTA and gel filtration protocol were analyzed by combining equal

volumes of protein sample with SDS-PAGE sample buffer (20% (v/v) glycerol, 126 mM

Tris:HCl pH 8.0, 4% (w/v) sodium dodecyl sulfate, and 0.02% (w/v) bromophenol blue),

boiling at 373 K for 15 min, and loading each sample onto a 16% (v/v) polyacrylamide

gel to determine the purity. Protein concentration was measured using the Pierce® BCA

Protein Assay Kit (Thermo Scientific, Rockford, IL).

2.1.4 Production of AlgL antibodies

The production of α-AlgL antibodies, completed by Dr. Francis Wolfram,

followed a similar protocol to that previously described for α-Alg44 antibodies [136]. In

brief, purified His6-AlgL28-362 (section 2.1.3) was used to generate rabbit antiserum using

a 70-day standard protocol (Cedarlane Laboratories, Burlington, ON). The α-AlgL

antiserum was purified using the method from Salamitou et al. [165]. Purified His6-

AlgL28-362 was overloaded into each lane of a 14% (v/v) polyacrylamide gel and

transferred to a polyvinylidene fluoride (PVDF) membrane. After staining the membrane

with Ponceau S, the His6-AlgL28-362 band was excised and blocked using phosphate-

buffered saline (PBS), pH 7, with 5% (w/v) skim milk powder and 0.1% (v/v) Tween-20

for 1 h at room temperature. The membrane was incubated with α-AlgL antiserum for 16

h at 277 K and 2 h at room temperature and washed with PBS. The membrane was

incubated with 700 μl of 0.2 M glycine, pH 2.2, for 15 min, to elute the α-AlgL

30

antibodies and neutralized with 300 μl of 1 M K2HPO4. Antibodies were dialyzed using

3.5 kDa molecular weight cut-off membrane into PBS for 24 h at 277 K and mixed 1:1

with 100% glycerol. Samples were stored at 253 K until needed.

2.1.5 Crystallization and structure determination of AlgL K66A

Protein samples of the His6AlgL28–362 K66A and Y259A inactive variants were

concentrated to 8 – 24 mg mL-1

. Crystallization trials were set up using a Gryphon LCP

robot with 96-well Art Robbins Instruments Intelli-Plates (Art Robbins Instruments,

Sunnyvale, CA) producing drops of a 1:1 ratio of reservoir solution to protein samples

with or without ~ 2 mM ManA4, ManA6, and ManA10 at a final volume of 2 μL using the

sitting drop method. Commercially available screens from Microlytic (MCSG Suite 1 - 4)

were used during this screening procedure. Plates were stored at 293 K and imaged

periodically using a CrystalMation DT Minstrel Crystal Hotel Imager (Rigaku, Japan). A

His6AlgL28–362 Y259A crystal obtained from the crystallization screen was used with the

Seed Bead Kit (Hampton Research, Aliso Viejo, CA) to generate a microseed stock

solution for matrix screening. This seed stock was used to rescreen all His6AlgL28–362

variants using the streak seeding method. Promising crystallization conditions from the

second screen were optimized by varying precipitant, buffer, and/or salt concentrations

and reservoir solution pH using the Desktop Alchemist™ liquid handling system

(Rigaku, Japan). The crystallization condition was further optimized using the HR2-428

Additive Screen (Hampton Research, Aliso Viejo, CA). Crystal optimization trials on

AlgL K66A were set up by hand using the hanging-drop vapor diffusion method in 48-

well VDX plates (Hampton Research, Aliso Viejo, CA) and stored at 293 K. Specific

crystallization conditions are detailed in sections 2.2.1.

Prior to analysis, AlgL K66A crystals were cryoprotected by soaking them for 30

s in a crystallization solution supplemented with 10 - 20% (v/v) glycerol, ethylene glycol,

or polyethylene glycol (PEG) 400 before vitrification by flash freezing. Approximately 2

mM ManA4 was also included in the cryoprotectant solutions for crystals formed from

crystallization drop without supplemented substrate. Screening and/or data collection was

completed on all frozen crystals using a D8 Venture X-ray Diffractometer (Bruker AXS,

31

Germany) at the Centre for Advanced Structural Analysis (The Hospital for Sick

Children, Toronto, ON) with the assistance of Dr. Roland Pfoh. 510 total image scans of

1˚ oscillations with 60 s exposure times per image were collected using the diffractometer

equipped with a Kappa four-circle goniometer and a Photon 100 detector at a crystal-to-

detector distance of 75 mm. Data was indexed, integrated, scaled and merged using the

Proteum 2 software (Bruker AXS, Germany). The structure was solved by molecular

replacement (MR) with WT AlgL (PDB ID: 4OZV) as the starting model using Phaser

[166]. Translation/Libration/Screw groups used during the refinement were determined

automatically using the TLSMD web server [167]. The electron density maps were of

sufficient quality for subsequent manual model building and the addition of waters using

PHENIX and COOT [168, 169]. Model refinement was performed using

PHENIX.REFINE and progress was monitored by the reduction and convergence of

Rwork and Rfree [168]. All programs for crystallographic data analysis were accessed

through SBGrid [170]. Statistics for data collection and refinement are listed in table 4.

2.1.6 Structural analysis and sequence analysis of AlgL and A1-III

All figures that display the structure of WT AlgL and K66A variant, and the

Sphingomonas spp. A1-III H192A apo- and tetrasaccharide complexed structures (PDB

ID: 4F10 and 4E1Y) were generated using PyMol 1.6.0.0 [171]. Structural and sequence

similarity were determined using PyMol and BLAST [171-173], respectively. Surface

conservation of the structure was computed using the ConSurf server. The multiple

sequence alignment was built using MAFFT which collected homologues from

UNIREF90 with a minimum sequence identity of 35% [174, 175].

2.1.7 Protein-substrate computational modeling

Binding of mannuronate ManA1 to ManA10 homopolymers to WT AlgL were

investigated using AutoDock Vina 2.1.1 [176]. The structure files for the ManA ligands

were constructed using ChemAxon Marvin Sketch (Budapest, Hungary). An AlgL apo-

structure was produced by removing the ManA1 substrate from the WT AlgL:ManA1

structural model (PDB ID: 4OZV). Receptor and ligand PDB files were prepared for

32

docking using scripts provided from MGLTools 1.5.6 [177]. Docking was conducted

with a grid spacing of 0.375 and xyz of 38 × 54 × 34 using a rigid receptor with 10 poses

computed. Graphical representation of the top pose was generated using PyMol.

2.1.8 Mass spectrometry product analysis

The end point digestion of products of ManA4-O-propyl after incubation with WT

His6AlgL28–362 was completed by Drs. Elena Kitova and John Klassen (University of

Alberta). Purified AlgL was dialyzed against 200 mM ammonium acetate pH 7.0 using a

microconcentrator (Millipore Corp., Bedford, MA) with a MW cut-off of 30 kDa and

immediately used. Stock solutions of ManA4-O-propyl were prepared by dissolving the solid

compounds in ultrafiltered water (Milli-Q, Millipore, Bedford, MA) and immediately

used. For the end point digestion assay 67 μM of ManA4-O-propyl was added to 1.7 μM

purified WT His6AlgL28–362 and allowed to incubate for 30 min. Measurements were

carried out on a Synapt G2 quadrupole-ion mobility separation-time of flight mass

spectrometer (Waters, UK) equipped with a modified nanoflow ESI source. The sample

was introduced into the mass spectrometer at an approximate flow rate of 20 – 50 nL/min

and ionized by the ESI source. Ions were accelerated to approximately 2700 V into a 9.4-

T superconducting magnet. A SGI R5000 computer running Bruker Daltonics XMASS,

version 5.0, was used for data collection and analysis [178-180].

2.1.9 In vivo growth curve

The growth of PAO1 WPA ΔalgL and this strain complemented with WT algL

(PAO1 WPA ΔalgL::algL WT), and the K66A, H202A, W205F, and Y259F variants was

investigated. Two percent (v/v) overnight starter cultures were inoculated into 25 mL

MAP media. Growth was monitored every 30 min by measuring OD600. After reaching

mid-logarithmic growth phase at an approximate OD600 of 0.5, aliquots of cell lysate

were isolated for Western blot analysis. Cultures were subsequently induced with L-

arabinose to a final concentration of 0.5% (w/v) and at two hours post induction, aliquots

were again isolated for Western blot analysis.

33

2.1.10 Western blot analysis

Cell lysates for Western blot analyses were obtained as follows. Cell culture

aliquots were normalized by OD600 and centrifuged at 25,000 × g for 10 min to isolate

cell pellets. Cell pellets were combined with SDS-PAGE sample buffer and boiled at 373

K for 15 min prior to loading each sample onto a 16% (v/v) polyacrylamide gel. Bands

were transferred to a polyvinylidene fluoride (PVDF) membrane for immunoblotting

(Bio-rad). The membrane was subsequently blocked using 5% (w/v) skim milk dissolved

in Tris-buffered saline (50 mM Tris:HCl pH 7.5 and 150 mM NaCl) with 0.1% (v/v)

Tween-20 (TBST) for 1 h at room temperature. The membrane was incubated with the α-

AlgL or α-Alg44 antibody at a 1:1000 dilution in TBST at 277 K for 16 h. Blots were

washed three times in TBST then probed with goat α-rabbit horseradish peroxidase

(HRP)-conjugated secondary antibody (Bio-Rad) at 1:3000 dilution in TBST for 1 h at

room temperature. Blots were washed three times in TBST and once with Tris-buffered

saline. AlgL or Alg44 bands were detected using the Super Signal West Pico

chemiluminescent substrate from Pierce (Thermo Scientific, Waltham, MA).

2.1.11 Purification of alginate

Secreted or supernatent alginate was purified from the culture supernatant of

strains PAO1 WPA ΔalgL::algL WT, K66A, H202A, W205F, and Y259F. Samples from

a 25 mL culture after 24 h growth at 310 K in MAP media supplemented with 0.5% (w/v)

L-arabinose were collected. After the addition of one quarter culture volumes of 1.8%

(w/v) sodium chloride, cells were removed from these samples by centrifugation at

25,000 × g for 10 min. The cell pellet was washed with 1 mL of 1.8% (w/v) NaCl three

times and the washes were added to the culture supernatant. The cell pellet was

lyophilized for 24 h and weighed. Five times culture volumes of isopropanol were added

to the culture supernatant and stored at 253 K for 16 h to promote precipitation. The

precipitate was isolated by centrifugation at 25,000 × g for 10 min and lyophilized for 72

h. Samples were stored at 253 K until needed.

34

2.1.12 Quantification of uronic acid

The uronic acid concentration was determined by the carbazole assay [136, 181].

Thirty μL of purified alginate samples, described in section 2.1.11, was mixed with 1 mL

borate-sulfuric acid reagent (100 mM H3BO3 in H2SO4) on ice. Thirty μL of the carbazole

reagent (0.1% (w/v) carbazole in anhydrous ethanol) was added. The solution was heated

to 328 K for 30 min and cooled on ice. Absorbance at 530 nm was measured for each

sample. Brown seaweed alginic acid was used as a standard. The uronic acid yield was

normalized to dried cell mass.

35

2.2 Results

2.2.1 Expression, purification and crystallization of AlgL constructs

To understand the molecular mechanisms for AlgLPa substrate specificity and

catalysis, we attempted to co-crystallize AlgL with ManA4, ManA6, or ManA10 substrates

or produce apo-crystals of the inactive variants that could be subsequently soaked. AlgL

variants were purified to near homogeneity by this strategy (Figure 8). The average yield

of each preparation was approximately 20 – 30 mg. Screening AlgL K66A and Y259A,

inactive variants yielded just one crystallization condition for AlgL Y259A. Single

crystals of this variant grew at 13 mg mL-1

using 0.2 M potassium sulfate and 20% (w/v)

PEG 3350 after 5 days. Upon rescreening with the AlgL Y259A seed stock solution,

AlgL K66A at 16 mg mL-1

produced crystals in the crystallization condition containing

0.2 M potassium sulfate and 20% (w/v) PEG 3350 after 12 days (Figure 9A). Optimized

crystals of the AlgL K66A variant, grown using 0.275 M K2SO4, 19% (w/v) PEG 3350,

and 0.1 M N-(2-hydroxyethyl)piperazine-N’-(2-ethansulfonic acid) (HEPES) pH 6.9

(Figure 9B), were soaked for 10 min with a substrate and cryoprotection solution to yield

a final sample containing a concentration of 2 mM ManA4 and 20% (v/v) PEG 400 by

direct addition to the crystallization drop. The crystal was looped and vitrified for

crystallographic screening and data collection.

The AlgL K66A crystal was first screened to determine the diffraction quality,

unit cell and space group of the crystal. This analysis suggested the AlgL K66A crystal

had an orthorhombic cell. The structure was determined using molecular replacement

using WT AlgL as a search model to 2.50 Å. The Rwork and Rfree are 22.7% and 26.7%,

respectively (Table 4).

36

Figure 8: Representative SDS-PAGE gel of the AlgL purification protocol. A 16%

(v/v) polyacrylamide gel stained with Coomassie G-250 stain displaying the two-step

purification protocol described in section 2.1.3. Lanes: MW, molecular weight markers

(kDa); Ins, insoluble lysate; Sol, soluble lysate; FT, soluble lysate flow through; Wash,

wash using lysis buffer; 75, wash using lysis buffer with 75 mM imidazole; 300, elution

using lysis buffer with 300 mM imidazole; SEC, collected fractions from gel filtration

chromatography. Lanes FT, 75, and 300 are from the Ni affinity chromatography step.

Molecular weight markers at 40 kDa and 35 kDa are labeled. The band representing AlgL

K66A is denoted with an arrow.

AlgL K66A M

W

Ins

So

l

FT

Was

h

75

300

SE

C

40

35

37

Figure 9: AlgL K66A crystals. A: Initial crystallization conditions after screening.

Crystals grew using 16 mg mL-1

of AlgL K66A in 0.2 M potassium sulfate and 20%

(w/v) PEG 3350. B: Optimized crystallization condition used for data collection. Crystals

grew using 16 mg mL-1

of AlgL K66A in 0.275 M potassium sulfate, 19% (w/v) PEG

3350, and 0.1 M HEPES pH 6.9.

200 μm 200 μm

a b

38

Table 4: Summary of data collection and refinement statistics for AlgL K66A.

Data collection AlgL K66A

Wavelength (Å) 1.5406

Temperature (K) 100

Space Group P21212

Unit Cell Parameters (Å,°) a = 67.5 b = 58.7 c = 76.2

= = = 90.0

Resolution (Å) 2.50

Total No. of Reflections 113285

No. of Unique Reflections 10923

Redundancy a

10.3 (7.8)

Completeness (%) 99.3 (100.0)

Average I/σ (I) 16.0 (3.1)

Rmerge b

(%) 9.8 (43.5)

Refinement

Rwork/Rfree (%) c 22.7/26.7

No. atoms

Protein 2468

Solvent 63

Average B-factors (Å2)

Protein 43.4

Water 38.0

Root mean square deviations

Bond lengths (Å) 0.005

Bond angles () 0.70

Ramachandran plot d

Total Favoured 96.8

Total Allowed 100.0

a Values in parentheses correspond to highest resolution shell.

b

Rmerge

= hkl

i |I

i(hkl) – I(hkl)|/

hkl

i I

i(hkl), where I

i(hkl) and I(hkl) represent the diffraction-intensity

values of the individual measurements and the corresponding mean values, respectively.

c

Rwork

= Σ||Fobs

| − k|Fcalc

||/|Fobs

|, where Fobs

and Fcalc

are the observed and calculated structure factors,

respectively. Rfree

is the sum extended over a subset of reflections (5%) excluded from all stages of the

refinement.

d

As calculated using MolProbity [182].

39

2.2.2 K66A structure and function of the AlgL lid loop

Comparison of the AlgL K66A structure (Figure 10) to AlgL WT revealed an

RMSD of 0.368 Å over 316 residues due to its high structural similarity (Figure 11A).

Calculation of electrostatic surface charge using APBS Tools 2.1 plugin within PyMol

[183, 184] and surface residue conservation among other alginate lyases using the

ConSurf server [174, 175] of the AlgL K66A structure revealed a conserved large

positive active site cleft and a variable smaller negative surface outside (Figure 10). This

is perhaps not surprising as the alginate polymer is anionic. Although the electronegative

surface observed is not conserved across other alginate lyases (Figure 10), it may be

important for other interactions critical to the function of AlgL, such as protein-protein

interactions. No density was observed for the soaked substrate in the active site of AlgL

K66A (Figure 11A) and similarly we were unable to model residues 66 – 81 due to the

poor quality of the electron density in this region. This suggests the lid loop in this

structure is flexible. These residues contain a region known as the “lid loop” found in the

WT AlgL model and the structurally similar A1-III alginate lyase from Sphingomonas sp.

comparison of the AlgL K66A structure to WT AlgL and A1-III structure will highlight

the importance of this flexible loop.

The A1-III alginate lyase apo and ManAΔ-GulA-ManA-ManA tetrasaccharide

complexed structures (Δ denotes enoic acid motif from a β-elimination reaction) of the

Sphingomonas sp. H192A mutant (Figure 11B) are available in the PDB (PDB ID: 3EVH

and 4F10, respectively). AlgL WT and A1-III, which adopt a (/)5 fold, share 41% and

26% sequence similarity and identity [172, 173], respectively. Due to the structural

similarity, a comparison of the AlgL WT and A1-III:tetrasaccharide complexed structure

revealed an RMSD of 1.949 Å over 333 residues (Figure 12A). Both A1-III H192A

structures have a mutation in the catalytic histidine, which is equivalent to H202 in AlgL.

The tetrasaccharide in the A1-III structure binds to subsites -1 to +3, and suggests that

AlgL will similarly have at least four putative saccharide binding subsites. All three

structures contain the aforementioned lid loop that spans residues 64 - 78 and 64 - 85 in

AlgL and A1-III, respectively. The lid loop in the AlgL WT and A1-III complexed

structures both cover their substrates with K66 of AlgL and R67 of A1-III, the equivalent

40

conserved residue, directly interacting with the substrate (Figure 11AB). Comparison of

the lid-loop in the A1-III apo-enzyme and complexed structure revealed a 14 Å

movement of the loop (Figure 11B). These data suggest that the lid loop is

conformationally flexible and important for substrate binding [153]. The increased

flexibility of the lid loop in the AlgL K66A structure may impact this function.

Furthermore, in the AlgL K66A structure, residues that comprise the +3 and +2

subsites also displayed changes compared to the AlgL WT structure. In AlgL WT, it is

proposed that F351 binds the -3 subsite C5’ carboxylate, R352 binds the C2’ hydroxyl in

subsite -2, and W146 and E96 play a structural role in the region forming the -2 and -3

subsite, respectively. We were unable to model the side chains of E96, W146, and R352

in the K66A structure, while F351 was found in an alternative conformation. Residues in

+3 and +2 subsites seem to be affected by either the K66A point mutation and/or the

increased disorder observed for residues 66 - 81. This structural data combined with the

lack of enzymatic activity observed (Figure 7) suggests that K66 is critical for the

catalytic function of AlgL.

41

Figure 10: Surface representation and cartoon model of AlgL K66A. Data derived

from crystallographic data. Three identically rotated orientations are displayed for each

type of representation. Top: Cartoon model representation. Centre: Surface residue

conservation of AlgL homologs computed using the ConSurf server by aligning 81

unique sequences [174, 175]. The colour scale of conservation is provided at the bottom

right. Alignment parameters are described in section 2.1.6. Bottom: Electrostatic surface

representation of AlgL K66A. The electrostatic surface was calculated using the APBS

Tools 2.1 plugin within PyMol and is displayed from -5 kT/e (red) to +5 kT/e (blue) with

the scale bar provided at the bottom left [183, 184].

90 °

90 ° 90 °

90 °

90 ° 90 °

42

Figure 11: Structural comparison of lid loop in P. aeruginosa AlgL and

Sphingomonas species A1-III. Overall protein and magnified views of the active site

and lid loop are depicted in the left and right panels, respectively. A: AlgL WT structure

in complex with ManA1 in light purple superimposed to AlgL K66A apo-structure with a

disordered lid loop (represented in a dashed line in the right panel). B: A1-III H192A

structure in complex with ManAΔ-GulA-ManA-ManA tetrasaccharide in magenta

superimposed with A1-III H192A apo-structure revealing the conformational flexibility

of the lid-loop.

K66

P. aeruginosa

AlgL WT Complex & K66A

R67

Sphingomonas sp.

A1-III Complex & Apo

A

B

Lid Loop

Lid Loop

ManAΔ-GulA-ManA-ManA

ManA

43

2.2.3 AlgL contains at least six subsites

To model substrate-protein binding, homopolymers of ManA were docked into

the structure of P. aeruginosa AlgL WT using AutoDock Vina. Analysis of the AlgL-

ManA6 model revealed that seven of the ten solutions bound to similar substrate subsites.

When the in silico hexasaccharide bound structures were compared to the tetrasaccharide

of A1-III, it was found that these structures bound in the same orientation as the

tetrasaccharide in subsites -1 to +3. Of the seven in silico solutions, four solutions bound

to subsites +3 to -3, two solutions bound to subsites +5 to -1, while one solution bound to

subsites +4 to -2. The remaining three solutions bound in positions inconsistent with the

A1-III substrate. The overlapping subsites found in the seven comparable solutions

suggest AlgL contains at least 6 subsites, subsites +4 to -2. Furthermore, the similar

substrate orientation and location between these sets of solutions and the A1-III

tetrasaccharide complexed structure allowed us to validate these six subsites within AlgL

(Figure 13).

Docking of ManA7 produced solutions with comparable binding scores to ManA6.

Comparison of the ten AlgL-ManA7 docking solutions to the six subsites previously

established from the AlgL-ManA6 docking model found that the top five ManA7

solutions bind to the protein at subsites +4 to -2 with the extra monosaccharide pointing

outwards from the active site cleft. This extra monosaccharide did not have any

observable interactions with the protein. This suggests the extra monosaccharide on

ManA7 is not favourably accommodated into the AlgL active site and supports a six

subsites binding cleft. Similar results were found for ManA8, ManA9, and ManA10.

Shorter polymers displayed decreasing binding scores (Figure 13). Together, the

observations that non-interacting monosaccharides heptamers and longer substrate and

decreased binding scores in pentamer and shorter oligosaccharide models suggest ManA6

binding yielded the best solution.

44

Figure 12: AutoDock Vina free energy binding scores of AlgL-ManA model. Values

were calculated using AlgL WT and oligosaccharides of ManA1 to ManA10. The highest

binding score of the ten computed docking solutions are displayed.

0 2 4 6 8 100

5

6

8

10

12

Degrees of Polymerization

Fre

e E

nerg

y (

-kcal/m

ol)

45

Figure 13: Subsite identification by AutoDock Vina. Both representations are in the same orientation. Left: Superimposition of

AlgL WT-ManA6 modeled complex from the second highest binding score solution from AutoDock Vina, and experimentally

determined A1-III-tetrasaccharide complexed structure. Center: P. aeruginosa AlgL WT electrostatic surface showing subsites +4 to

+2. The lid loop covers subsites +1 to -2. Right: Magnified view of P. aeruginosa AlgL WT electrostatic surface with the lid loop

(residues 64 – 78) removed reveals all six subsites, +4 to -2. Electrostatic surfaces were calculated using the APBS Tools 2.1 plugin

within PyMol and displayed from -5 kT/e (red) to +5 kT/e (blue) [183, 184].

P. aeruginosa AlgL WT with ManA6

Sphingomonas sp. A1-III with ManA-ManA-GulA-ManAΔ

P. aeruginosa AlgL WT P. aeruginosa AlgL WT with lid loop removed

+4 +3 +2 +1 -2

-1

Reducing End

+4 +3 +2

46

2.2.4 AlgL is an endo-lyase

ManA4-O-propyl was synthesized by Drs. Martha Walvoort and Jeroen Codee from

Leiden University (Figure A1). The C1’ O-propyl group of the synthetic polymer was

important for product identification as this unique motif is fixed to the reducing end of

the substrate. For the interpretation the AlgL end point assay, in which AlgL was allowed

to digest ManA4-O-propyl for 30 min, it should be noted that cleavage occurs between the +1

and -1 subsite with the substrate’s reducing end orientated towards the -1 and -2 subsites

(Figure 5). Based on the mechanistic understanding of alginate lyases [150], AlgL can

theoretically only cleave ManA4-O-propyl when the O-propyl modified ManA

monosaccharide binds in the -1, -2, or hypothetical -3 subsite to generate ManAΔ1-O-propyl,

ManAΔ2-O-propyl, or ManAΔ3-O-propyl, respectively (Figure 14). From our mass

spectrometry results of the catalytic products, ManAΔ2-O-propyl and ManAΔ3-O-propyl were

observed, while ManAΔ1-O-propyl was not (Table 5). The major difference between these

catalytic events is the vacancy in the -2 subsite during the reaction that would produce

ManAΔ1-O-propyl. These data suggest the -2 subsite must be occupied for catalysis to occur.

Furthermore, the absence of a monosaccharide enoic acid product suggests that AlgL is

an endo-lyase.

47

Figure 14: Potential AlgL- ManA4-O-propyl products based on specific subsite binding.

Potential catalytic reactions on ManAΔ4-O-propyl required to generate ManAΔ1-O-propyl,

ManAΔ2-O-propyl, or ManAΔ3-O-propyl. Subsite binding requirements are specified on the left

with the products on the right. A box indicates the unique O-propyl products used to

confirm the occurrence of each of the three catalytic reactions.

Table 5: O-propyl product molecular weights and corresponding signal in mass

spectrometry. These characteristic products were used to confirm the three potential

catalytic reactions in Figure 14. Product peaks are summarized based on a negative mode

mass spectrometry spectrum (Figure A2).

Product

Name Product Structure

Theoretical

Molecule Weight

(g mol-1

)

Observed

Signal

(m/z)

ManΔ3-O-

propyl 570.1432 569.2255

ManΔ2-O-

propyl 394.1111 393.1638

ManΔ1-O-

propyl 218.0790

Not

Observed

O

H

HO

OHHOOC

O

O

HO

OHHOOC

O

O

HO

OHHOOC

O

O

H

HO

OHHOOC

O

O

HO

OHHOOC

O

O

H

HO

OHHOOC

O

48

2.2.5 Growth of P. aeruginosa is unaffected by an altered AlgL catalytic activity

during alginate production

To understand the effects of point mutations or removal of algL on growth, the

PAO1 WPA ΔalgL strain was complemented with the WT gene (PAO1 WPA

ΔalgL::algL WT), and the K66A, H202A, W205F, and Y259F variants. As a control the

PAO1 WPA ΔalgL strain was also complemented with the empty vector, pUC18T-

miniTn7T-PBAD. After antibiotic selection and gene sequencing to validate the strains, a

growth curve was subsequently completed for all strains. The OD600 of PAO1 WPA

ΔalgL::algL WT, K66A, H202A, W205F, and Y259F complemented strains followed

typical logarithmic growth pre- and post-induction (Figure 15A). The ΔalgL strain

exhibited slower growth compared to the complemented strains before induction. The

OD600 of the ΔalgL strain also decreased after induction. Analysis of AlgL levels by

Western blot before induction revealed low levels of AlgL and Alg44 in the

complemented strains (Figure 15B) suggesting a low level of expression exists from the

PBAD promoter in the absence of arabinose. AlgL and Alg44 levels increased substantially

after induction, with no difference in intensity between WT and mutant AlgL strains

(Figure 15B). In the algL strain, there was no AlgL signal pre- or post-induction. The

level of Alg44 post-induction in the algL strain was comparable to the complemented

strains post-induction.

49

Figure 15: PAO1 WPA growth curve and Western blot analysis. Analysis of PAO1

WPA ΔalgL::algL complemented strains and ΔalgL. A: OD600 of each strain measured

every 30 min over a 10 h time period. The black diamond indicates the time of induction

at mid-logarithmic phase. Blue arrows indicate the pre- and post-induction time points at

which samples were taken for Western blot analysis. The pre-induction sampling

occurred immediately before induction. B: Western blot analyses using AlgL and Alg44

specific antibodies of the indicated strains at mid-logarithmic phase (pre-induction) and 2

h post-induction. The loading control was a non-specific band from the Alg44 Western

blot.

0 2 4 6 8 100.0

0.5

1.0

1.5algL

WT

H202A

W205F

Y259F

K66A

Time (h)

OD

600

Induction with 0.5% (w/v) arabinose

Aliquot isolation for Western blot

A

Δalg

L

WT

K66A

H202A

W205F

Y259F

Post-Induction

AlgL

Alg44

Control

ΔalgL::algL .

Δalg

L

WT

K66A

H202A

W205F

Y259F

Pre-Induction

ΔalgL::algL . B

50

2.2.6 Uronic acid production unaffected by changes in AlgL specific activity

To determine the effects of AlgL point mutations on alginate secretion, the

production of uronic acid was quantified after alginate induction in the PAO1 WPA

variants. To quantify the uronic acid concentration in each sample, including ManA and

GulA, a carbazole assay was performed on purified alginate secreted from the PAO1

WPA ΔalgL::algL WT, and K66A, H202A, W205F, and Y259F variants 24 h post-

induction. Similar amounts of uronic acid relative to the WT strain were produced by

each of the variants tested. The mean of each sample is within one standard deviation of

the mean of the WT strain (Table 6). This suggests that changes in catalytic activity do

not significantly affect the amount of uronic acid produced.

Table 6: Quantification of uronic acids produced by PAO1 WPA complemented

strains. Uronic acid quantification was normalized to total culture cell mass. Mean of six

to ten replicates ± standard deviation. All samples have p > 0.05 compared to AlgL WT

using an unpaired Student’s t-test.

Variant Uronic Acid Secretion/Dry Cell Mass (μg mg-1

)

WT 13 ± 6

K66A 18 ± 4

H202A 11 ± 3

W205F 16 ± 8

Y259F 15 ± 4

51

2.3 Discussion

2.3.1 Molecular mechanism of AlgL catalysis

New molecular details regarding AlgLPa catalysis have been revealed by our

biochemical and structural analyses. Our structural studies of AlgL K66A revealed that

the lid loop is disordered. To further understand the implications of these findings, AlgL

was compared to a structurally similar alginate lyase. A1-III is the only alginate lyase in

which the lid loop has been resolved [153]. It has been suggested that lid loop residue

Y68 (AlgL Y68) lowers the pKa of the key catalytic acid residue Y246 (AlgL Y256) and

forms a hydrogen bond to the substrate-interacting lid loop residue R67 (AlgL K66)

[153]. The lower than expected pKa value of Y246 is speculated to increase the catalytic

efficiency of A1-III [153]. Since the pKa value of tyrosine is typically high, this decrease

in pKa value would promote protonation as its proposed function as a catalytic acid. This

hypothesis is supported by in vitro kinetic studies on a point variant of A1-III. R67 was

demonstrated to interact directly with the substrate at the -1 subsite, which may be

positioned properly by Y68 in A1-III. These data support and can explain the importance

of the lid loop in catalysis [153]. In WT AlgLPa, Y68 interacts with Y256 and K66 in a

similar manner described by Mikami et al. [153]. The structural and sequence similarity

would suggest that AlgLPa Y68 performed a similar function to the comparable residue in

the A1-III structure. However, these suggestions are speculative without enzyme kinetic

data on AlgLPa. It is possible that the lid loop also functions to shield the entry of water

or other small molecules into the active site. This is a well characterized phenomenon in

lipases that require the removal of water from the hydrophobic core by the movement of

a lid structure [185, 186]. Although the chemical requirements for anionic alginate and

hydrophobic lipid binding to their respective enzymes differ, the lid loop may function to

hinder the movement of other small molecules, such as ions and small biomolecules, into

the active site.

Our mass spectrometry end point degradation assay shows that substrate binding

to the -2 subsite is required for catalysis. This data supports an endo-lyase mode of action

for AlgL. Structural analyses of other alginate endo-lyases have found a catalytic groove

52

with an opening at both ends [187]. It is hypothesized that the openings at both ends of

the catalytic groove allow substrates to continuously move though the enzyme during

catalysis. This characteristic catalytic groove, also found in AlgL, may contribute to the

ability of the protein to translocate alginate through the periplasmic space. A similar

hypothesis was suggested to occur for the two-domain deacetylase protein, PgaB, from E.

coli involved in the biosynthesis of PNAG [188]. PgaB was found to contain an extended

binding cleft with at least 12 subsites located between its interdomain linker and the C-

terminal domain. It was suggested that PNAG continuously binds and moves through the

PgaB active site cleft to facilitate translocation of the polysaccharide through the

periplasmic space. The extended active site of AlgL could similarly contribute to alginate

translocation if it forms a trans-envelope complex with other alginate proteins. This

hypothesis is further supported by the openings at both ends of the catalytic groove

observed in the AlgL structure. A requirement for this hypothesis would be that the rate

of movement through the active site cleft is more rapid than the rate of catalysis on the

long polymer [188].

Our in silico model of AlgL found six subsites suggesting at least six saccharide

binding subsites are contained in the AlgL active site cleft. An extended active site cleft

with multiple subsites is common for alginate lyases. The largest number of subsites

found to date, is in the intracellular alginate lyase from Enterobacter cloacae M-1, which

contains seven subsites [189]. Multiple subsites in alginate lyases and more specifically,

in AlgL, could serve a variety of functions. Weak protein-monosaccharide interactions

could require multiple subsite interactions to correctly position the substrate for catalysis.

This has been suggested for other multiple subsite containing enzymes [188]. The AlgL

active site cleft may also be involved in keeping alginate linearized during translocation

and preventing the nascent polymer from adopting secondary structures. Although to date

few studies have investigated the secondary structures of exopolysaccharides, one

prominent example found that the deletion of the extracellular Gluconacetobacter xylinus

CMCax carboxymethylcellulase involved in cellulose biosynthesis and export resulted in

the remarkably reduced cellulose secretion and observable twisted cellulose secondary

structure aggregated near the cell surface [190]. This suggested that the extracellular

glycoside hydrolase prevents the formation of a cellulose secondary structure that would

53

impede cellulose export. The presence of multiple saccharide binding sites on AlgL may

therefore help linearize the polymer and prevent the formation of a higher ordered

alginate structure. Linearization could also facilitate the catalysis of other alginate

modifying enzymes, such as the AlgIJFX acetylation machinery or the AlgG epimerase.

This hypothesis is supported by our observation that AlgL catalysis is not required for

alginate production. Similar to the suggestion that AlgL facilitates alginate translocation,

this related hypothesis would require the rate of polymer translocation through the AlgL

active site be more than the rapid rate of catalysis, which is currently unknown.

2.3.2 AlgL is a component of the trans-envelope complex

The low levels of AlgL among the ΔalgL::algL complemented strains in the

absence of L-arabinose suggests that the PBAD promoter is leaky. If AlgL is required for

viability during alginate production as proposed by Jain et al. [83], the leakiness of the

PBAD promoter could explain the delayed growth curve observed for the ΔalgL strain

before induction (Figure 15A). The low level of expression of proteins on the algD

operon, as seen by the low levels of Alg44 pre-induction due to the leaky PBAD promoter

controlling the entire alg operon (Figure 15B), may result in low levels of alginate

production. If a growth defect is observed during induced alginate production in the

absence of AlgL [83], a low level of alginate production may partially hinder growth, but

not overcome a threshold required to obtain a lethal phenotype. This non-lethal and

hindered growth phenotype was observed by the ΔalgL growth curve in the absence of L-

arabinose. Induction of the PBAD promoter could overcome this threshold and would

explain the lethal phenotype observed by the decrease in OD600 after induction for ΔalgL.

Our results also suggest AlgL catalysis does not affect viability upon induction of

the algD operon. This finding supports the study by Albrecht et al. [81] that suggested

catalytically inactive AlgL in P. aeruginosa is non-lethal after induction of the algD

operon. Our ΔalgL strain was observed to be lethal and suggests the absence of AlgL will

produce a lethal phenotype during alginate production. This suggests the mere presence

of AlgL, but not AlgL catalysis, is important for cell viability during alginate production.

This supports the hypothesis by Albrecht et al. [81] and Jain et al.

[83]

that AlgL forms

part of the trans-envelope complex.

54

Other bacterial systems, including for example the E. coli Wza–Wzc complex for

group 1 capsular polysaccharides export [80], type III secretion needle complex, and

TolC drug efflux in E. coli, are also proposed to form a trans-envelope complex. The

Wza–Wzc complex structure involved in capsular polysaccharide export revealed a trans-

envelope complex that contains two proteins in the periplasm that bridge the gap between

the outer and inner membrane without any adaptor proteins. Openings on the side of the

complex are proposed to serve as the access points for nascent polymer entry. It is

proposed that these observations in the Wza–Wzc complex allow periplasmic

biosynthesis proteins to couple with the export complex [80, 191].

The type III secretion needle [192] and E. coli TolC drug efflux pump complexes

[193] serve different functions. However, both systems are suggested to have adaptor

proteins in the periplasm involved in bridging the gap between the inner and outer

membrane bound proteins. This allows the secreted material in both systems to bypass

the periplasmic space in a concerted mechanism to prevent harm to the bacteria.

The alginate biosynthetic and export trans-envelope complex may have

similarities to both systems. The trans-envelope complex could similarly assist in

coupling the periplasmic machinery to the inner and outer membrane components, as

proposed for the group 1 capsular polysaccharides export system [80]. Proteins

associating with the outer membrane export, AlgE and AlgK, and inner membrane

biosynthesis machinery, Alg8 and Alg44, may facilitate coordinated acetylation by AlgJ,

F, I, and X and/or epimerization by AlgG. The described biosynthesis and export coupled

function would allow alginate inner and outer membrane components to serve as an

anchor to allow the periplasmic proteins to assemble into the complex. A coupled

mechanism seems plausible as a network of binary interactions have been characterized

involving the AlgE β-porin, AlgK TPR-containing protein, AlgX acetylation protein, and

AlgG epimerization protein [144]. Due to this network of interactions, interplay between

alginate production, epimerization, and/or acetylation is possible. While AlgL has been

proposed to interact with the trans-envelope complex proteins, our data has shown that

altering its catalytic activity does not affect alginate production. Whether other chemical

changes occur in the alginate polymer when AlgL’s catalytic activity is compromised is

presently unknown.

55

Similarly, the described function of the type III secretion needle and TolC drug

efflux pump complexes could be extended to the alginate complex. Without a trans-

envelope complex, alginate would be released into the periplasmic space in an

uncontrolled manner. This could potentially lead to two complications. Accumulation of

the polymer could ultimately lead to cell lysis. We currently hypothesize that cell lysis

occurs after 5.5 h of growth in our ΔalgL strain (Figure 15A). Alternatively, the anionic

nature of alginate localized to the periplasm could alter its electrochemical environment.

This would result in an elimination of the electrochemical gradient required for bacterial

metabolic processes such as the electron transport chain. A non-functional electron

transport chain will greatly impede the growth and metabolism of the bacteria and can

cause the bacteria to remain in a slow-growing state until the electrochemical gradient

can be reestablished or lead to cell death.

2.3.3 Model of AlgL in alginate biosynthesis and export

With our new data on AlgL, we propose a model for alginate biosynthesis and

export. The data presented support the hypothesis that AlgL is a critical component of the

trans-envelope complex, although it should be noted that to date no protein-protein

interactions with other members of the complex have been identified. As alginate is

synthesized, a trans-envelope complex involving Alg8, 44, L, G, X, J, F, K, and E, could

form to allow alginate to bypass the periplasm and enable coordinated alginate

modifications including acetylation, epimerization, and/or β-elimination. The complex

involves experimentally characterized binary interactions: Alg8-Alg44, Alg8-AlgG,

AlgK-AlgG, AlgK-AlgX, and AlgK-AlgE (Figure 16A). Altering the catalytic activity of

AlgL does not impair cell growth during alginate production, the yield of alginate export,

and presumably the ability to form the trans-envelope complex, but could affect alginate

modifications (Figure 16B). As established by our data and previous work on AlgL [83],

removal of AlgL leads to a growth defect. The absence of AlgL could lead to aberrant

formation of the trans-envelope complex. It is unknown whether the remaining proteins

in the complex continue to interact and form a partial trans-envelope complex in the

absence of AlgL. If the complex is not fully formed, synthesized alginate is likely to leak

56

into the periplasmic space. Accumulated alginate could lead to cell death by either of the

two aforementioned mechanisms (Figure 16C).

57

Figure 16: Revised model for the role of AlgL in the trans-envelope complex. AlgL protein-protein interactions are not known and

the enzyme is therefore placed arbitrarily into the trans-envelope complex. The stoichiometry of the protein components of the

putative trans-envelope complex is not known. Interactions validated are depicted by black and white diamonds. All interactions were

determined in our lab or by others [81, 83-90]. A: The ΔalgL::algL strain successfully forms the trans-envelope complex and alginate

is secreted. B: Complementation with inactive variant of algL results in formation of the trans-envelope complex and normal alginate

secretion. The inactive catalytic activity of AlgL does not affect the total yield of alginate. C: In the absence of AlgL in the ΔalgL

strain there is a missing component of the trans-envelope complex. The remaining proteins may or may not form a complex. It is

assumed that the accumulated alginate in the periplasmic space leads to cell death.

58

Chapter 3: Conclusions and Future Directions

3.1 Conclusions

From the data presented, we are able to draw several conclusions. The structure

determination and in vitro catalytic characterization of AlgL revealed that it contains a

flexible lid loop that appears to play an important role in catalysis and/or binding. In

contrast to WT AlgL, this loop is disordered in the inactive K66A point mutant. This

finding is supported by previous studies on the Sphingomonas sp. A1-III alginate lyase

where the corresponding lid loop has been proposed to exclude water molecules that

would interfere with catalysis. The loop also contains Y68, a residue proposed to

decrease the pKa of the catalytic acid.

Our in silico substrate-protein binding studies of AlgL identified at least six

saccharide subsites from -2 to +4. This model is consistent with our in vitro mass

spectrometry analysis and the Sphingomonas sp. A1-III structure. An extended active site

cleft is common among PL and may not only be required for catalysis but could also

potentially serve to linearize alginate during biosynthesis and export. Our in vitro mass

spectrometry characterization of alginate degradation products suggest that AlgL is an

endo-lyase and that the substrate needs to bind to the -1 and -2 subsites for catalysis to

occur. This data further supports our in silico model.

Our in vivo studies revealed that the ΔalgL strain displayed a growth defect.

Complementation of this mutant with WT AlgL or its catalytical variants exhibit a non-

lethal growth pattern after induction of alginate production. Western blot analyses found

similar levels of AlgL in all of the ΔalgL complemented strains, and similar levels of

alginate were produced. These data suggest removal of AlgL impairs cell viability, while

changes in the catalytic activity of AlgL do not affect cell viability or yield of alginate

during alginate biosynthesis and export.

3.2 Future Directions

While we have gained insight into the molecular details and function of AlgL, a

number of questions remain unanswered. Outstanding questions include: How do longer

substrates interact with AlgL? Does altering the catalytic activity of AlgL have an effect

59

on the chemical structure of the polymer? Which proteins does AlgL interact with in the

biosynthetic complex?

3.2.1 Structural determination of AlgLPa-substrate complex

A major goal of the structural analysis of AlgLPa was to determine the structure of

a protein-substrate complex to examine substrate binding. The K66A structure without

bound substrate and in vitro specific activities suggests this mutation may compromise

binding. An alternate method to determine the structure of AlgLPa in complex with a

substrate would be to determine the structure of the Y256F or H202A mutants. Initial

crystal conditions have been obtained for these variants, but need to be optimized. The

crystals would be soaked with alginate oligosaccharides. The structure of AlgLPa in

complex with the substrate will enable us to elucidate molecular details for substrate

binding and specificity and confirm our in silico model.

3.2.2 Further characterization of in vivo variants

Our studies on a first set of variants support the hypothesis that AlgLPa is part of a

trans-envelope complex. This data also established that altering AlgLPa’s catalytic

activity does not affect P. aeruginosa growth during alginate production. To confirm our

interpretation of the data, we will continue characterizing other variants, such as Y256F

and R249E. Furthermore, whether abrogating AlgLPa catalytic activity affects alginate

modifications such as the level of acetylation or epimerization has not been investigated.

It is possible that AlgLPa catalysis does not have a role in alginate biosynthesis or export.

This would suggest that AlgLPa only functions as a periplasmic adaptor protein. To

complete our understanding, the effect of inactivating AlgL activity on the chemical

structure of exported alginate will be examined. The degree of polymerization,

acetylation, and epimerization will be investigated [194-196]. A catalytically inactive in

vivo variant producing non-epimerized or non-acetylated alginate would suggest AlgLPa

catalysis precedes and/or is required for epimerization or acetylation, respectively.

60

3.2.3 Uncover trans-envelope complex protein-protein interactions

While we and others have suggested that AlgLPa is part of the biosynthetic

complex, the proteins that it may interact with are currently unknown. These protein-

protein interactions could be characterized by a number of methods. This procedure could

begin by investigating the in vivo stability of other alginate proteins in the PAO1 WPA

ΔalgL strain by Western blot analysis. Potential protein partners could be identified if the

absence of AlgL influenced the stability of known protein components of the biosynthetic

complex. Additionally, pull down experiments could be employed with or without cross-

linking in vivo to identify protein-protein interactions. Cross-linking can be accomplished

with a variety of reagents and the success of these experiments would require membrane

permeable reagents that enable cross-linking reaction at the protein-protein interaction

interfaces of AlgLPa. Pull-down experiments could be performed by fusion of an affinity

label to AlgLPa or the use of our polyclonal α-AlgL sera. Binding partners would be

identified by mass spectrometry or Western blot characterization.

Following the success of these in vivo analyses, in vitro methods could be used to

characterize interactions biophysically. The stoichiometry of binary interaction could be

determined by isothermal titration calorimetry (ITC) and analytical ultracentrifugation

(AUC). Kinetic and thermodynamic parameters of binding could be examined using

biolayer interferometry (BLI) and ITC, respectively. Small-angle x-ray scattering

(SAXS) or co-crystallization studies have the potential to describe the orientation of

interacting proteins. These interactions could provide details on the position of AlgLPa in

the alginate biosynthesis and export trans-envelope complex and would provide greater

insight into the role of AlgLPa.

61

References

1. Collins, V. G. (1957) Planktonic bacteria, Journal of general microbiology 16,

268-272.

2. del Pozo, J. L., and Patel, R. (2007) The challenge of treating biofilm-associated

bacterial infections, Clinical pharmacology and therapeutics 82, 204-209.

3. Hall-Stoodley, L., Costerton, J. W., and Stoodley, P. (2004) Bacterial biofilms:

from the natural environment to infectious diseases, Nature reviews.

Microbiology 2, 95-108.

4. Walker, T. S., Bais, H. P., Deziel, E., Schweizer, H. P., Rahme, L. G., Fall, R.,

and Vivanco, J. M. (2004) Pseudomonas aeruginosa-plant root interactions.

Pathogenicity, biofilm formation, and root exudation, Plant physiology 134, 320-

331.

5. Stewart, P. S., and Costerton, J. W. (2001) Antibiotic resistance of bacteria in

biofilms, Lancet 358, 135-138.

6. Mah, T. F., and O'Toole, G. A. (2001) Mechanisms of biofilm resistance to

antimicrobial agents, Trends in microbiology 9, 34-39.

7. Costerton, J. W., Lewandowski, Z., Caldwell, D. E., Korber, D. R., and Lappin-

Scott, H. M. (1995) Microbial biofilms, Annual review of microbiology 49, 711-

745.

8. Vuong, C., Voyich, J. M., Fischer, E. R., Braughton, K. R., Whitney, A. R.,

DeLeo, F. R., and Otto, M. (2004) Polysaccharide intercellular adhesin (PIA)

protects Staphylococcus epidermidis against major components of the human

innate immune system, Cellular Microbiology 6, 269-275.

9. Cérantola, S., Marty, N., and Montrozier, H. (1996) Structural studies of the

acidic exopolysaccharide produced by a mucoid strain of Burkholderia cepacia,

isolated from cystic fibrosis, Carbohydrate Research 285, 59-67.

10. Davies, J. C. (2002) Pseudomonas aeruginosa in cystic fibrosis: pathogenesis and

persistence, Paediatric respiratory reviews 3, 128-134.

11. Nivens, D. E., Ohman, D. E., Williams, J., and Franklin, M. J. (2001) Role of

alginate and its O acetylation in formation of Pseudomonas aeruginosa

microcolonies and biofilms, Journal of Bacteriology 183, 1047-1057.

12. Pier, G. B., Coleman, F., Grout, M., Franklin, M., and Ohman, D. E. (2001) Role

of alginate O acetylation in resistance of mucoid Pseudomonas aeruginosa to

opsonic phagocytosis, Infection and Immunity 69, 1895-1901.

13. Lenhart, T. R., Duncan, K. E., Beech, I. B., Sunner, J. A., Smith, W., Bonifay, V.,

Biri, B., and Suflita, J. M. (2014) Identification and characterization of microbial

biofilm communities associated with corroded oil pipeline surfaces, Biofouling

30, 823-835.

14. Roman, M. C., and Minton-Summers, S. (1997) Assessment of biofilm formation

in the International Space Station Water Recovery and Management system, Life

Support and Biosphere Science: International Journal of Earth Space 5, 45-51.

15. Davies, D. (2003) Understanding biofilm resistance to antibacterial agents, Nature

Reviews Drug Discovery 2, 114-122.

16. Monteiro, D. R., Gorup, L. F., Takamiya, A. S., Ruvollo-Filho, A. C., de

Camargo, E. R., and Barbosa, D. B. (2009) The growing importance of materials

62

that prevent microbial adhesion: antimicrobial effect of medical devices

containing silver, International journal of antimicrobial agents 34, 103-110.

17. Walters, M. C., 3rd, Roe, F., Bugnicourt, A., Franklin, M. J., and Stewart, P. S.

(2003) Contributions of antibiotic penetration, oxygen limitation, and low

metabolic activity to tolerance of Pseudomonas aeruginosa biofilms to

ciprofloxacin and tobramycin, Antimicrobial agents and chemotherapy 47, 317-

323.

18. Stewart, P. S. (2003) Diffusion in biofilms, Journal of Bacteriology 185, 1485-

1491.

19. Czekalski, N., Berthold, T., Caucci, S., Egli, A., and Bürgmann, H. (2007)

Increased levels of multiresistant bacteria and resistance genes after wastewater

treatment and their dissemination into Lake Geneva, Switzerland, Role and

Prevalence of Antibiosis and the Related Resistance Genes in the Environment,

27.

20. Gullberg, E., Cao, S., Berg, O. G., Ilbäck, C., Sandegren, L., Hughes, D., and

Andersson, D. I. (2011) Selection of resistant bacteria at very low antibiotic

concentrations, PLOS Pathogens 7, e1002158.

21. Verstraeten, N., Knapen, W. J., Kint, C. I., Liebens, V., Van den Bergh, B.,

Dewachter, L., Michiels, J. E., Fu, Q., David, C. C., Fierro, A. C., Marchal, K.,

Beirlant, J., Versees, W., Hofkens, J., Jansen, M., Fauvart, M., and Michiels, J.

(2015) Obg and membrane depolarization are part of a microbial bet-hedging

strategy that leads to antibiotic tolerance, Molecular cell 59, 9-21.

22. Kotte, O., Volkmer, B., Radzikowski, J. L., and Heinemann, M. (2014)

Phenotypic bistability in Escherichia coli's central carbon metabolism, Molecular

Systems Biology 10, 736.

23. Verstraeten, N., Knapen, W. J., Kint, C. I., Liebens, V., Van den Bergh, B.,

Dewachter, L., Michiels, J. E., Fu, Q., David, C. C., and Fierro, A. C. (2015) Obg

and membrane depolarization are part of a microbial bet-hedging strategy that

leads to antibiotic tolerance, Molecular cell 59, 9-21.

24. Verstraeten, N., Knapen, W. J., Fauvart, M., and Michiels, J. (2015) Membrane

depolarization-triggered responsive diversification leads to antibiotic tolerance,

Microbial Cell 2, 299-301.

25. Dong, Y. H., and Zhang, L. H. (2005) Quorum sensing and quorum-quenching

enzymes, Journal of Microbiology 43 Spec No, 101-109.

26. Prince, A. S. (2002) Biofilms, antimicrobial resistance, and airway infection, The

New England journal of medicine 347, 1110-1111.

27. Kalia, V. C., and Purohit, H. J. (2011) Quenching the quorum sensing system:

potential antibacterial drug targets, Critical reviews in microbiology 37, 121-140.

28. Anderl, J. N., Franklin, M. J., and Stewart, P. S. (2000) Role of antibiotic

penetration limitation in Klebsiella pneumoniae biofilm resistance to ampicillin

and ciprofloxacin, Antimicrobial agents and chemotherapy 44, 1818-1824.

29. Mann, E. E., Rice, K. C., Boles, B. R., Endres, J. L., Ranjit, D., Chandramohan,

L., Tsang, L. H., Smeltzer, M. S., Horswill, A. R., and Bayles, K. W. (2009)

Modulation of eDNA release and degradation affects Staphylococcus aureus

biofilm maturation, PLOS One 4, e5822.

63

30. Flemming, H. C., and Wingender, J. (2010) The biofilm matrix, Nature reviews.

Microbiology 8, 623-633.

31. Macfarlane, S., and Dillon, J. F. (2007) Microbial biofilms in the human

gastrointestinal tract, Journal of applied microbiology 102, 1187-1196.

32. Mann, E. E., and Wozniak, D. J. (2012) Pseudomonas biofilm matrix composition

and niche biology, FEMS microbiology reviews 36, 893-916.

33. Zijnge, V., Ammann, T., Thurnheer, T., and Gmur, R. (2012) Subgingival biofilm

structure, Frontiers of oral biology 15, 1-16.

34. Molin, S., and Tolker-Nielsen, T. (2003) Gene transfer occurs with enhanced

efficiency in biofilms and induces enhanced stabilisation of the biofilm structure,

Current opinion in biotechnology 14, 255-261.

35. Whitchurch, C. B., Tolker-Nielsen, T., Ragas, P. C., and Mattick, J. S. (2002)

Extracellular DNA required for bacterial biofilm formation, Science 295, 1487.

36. Yang, L., Barken, K. B., Skindersoe, M. E., Christensen, A. B., Givskov, M., and

Tolker-Nielsen, T. (2007) Effects of iron on DNA release and biofilm

development by Pseudomonas aeruginosa, Microbiology 153, 1318-1328.

37. Watanabe, M., Sasaki, K., Nakashimada, Y., Kakizono, T., Noparatnaraporn, N.,

and Nishio, N. (1998) Growth and flocculation of a marine photosynthetic

bacterium Rhodovulum sp, Applied Microbiology and Biotechnology 50, 682-

691.

38. Finkel, S. E., and Kolter, R. (2001) DNA as a nutrient: novel role for bacterial

competence gene homologs, Journal of Bacteriology 183, 6288-6293.

39. Johnson, J. C., Waldrep, J. C., Guo, J., and Dhand, R. (2008) Aerosol delivery of

recombinant human DNase I: in vitro comparison of a vibrating-mesh nebulizer

with a jet nebulizer, Respiratory care 53, 1703-1708.

40. Mulcahy, H., Charron-Mazenod, L., and Lewenza, S. (2008) Extracellular DNA

chelates cations and induces antibiotic resistance in Pseudomonas aeruginosa

biofilms, PLOS Pathogens 4, e1000213.

41. Fong, J. N., and Yildiz, F. H. (2015) Biofilm matrix proteins, Microbiology

Spectrum 3.

42. Chiavelli, D. A., Marsh, J. W., and Taylor, R. K. (2001) The Mannose-Sensitive

Hemagglutinin ofVibrio cholerae Promotes Adherence to Zooplankton, Applied

and Environmental Microbiology 67, 3220-3225.

43. Romero, D., Aguilar, C., Losick, R., and Kolter, R. (2010) Amyloid fibers

provide structural integrity to Bacillus subtilis biofilms, Proceedings of the

National Academy Of Sciences 107, 2230-2234.

44. Absalon, C., Van Dellen, K., and Watnick, P. I. (2011) A communal bacterial

adhesin anchors biofilm and bystander cells to surfaces, PLOS Pathogens 7,

e1002210.

45. Heijstra, B. D., Pichler, F. B., Liang, Q., Blaza, R. G., and Turner, S. J. (2009)

Extracellular DNA and Type IV pili mediate surface attachment by Acidovorax

temperans, Antonie Van Leeuwenhoek 95, 343-349.

46. Martí, M., Trotonda, M. P., Tormo-Más, M. Á., Vergara-Irigaray, M., Cheung, A.

L., Lasa, I., and Penadés, J. R. (2010) Extracellular proteases inhibit protein-

dependent biofilm formation in Staphylococcus aureus, Microbes and Infection

12, 55-64.

64

47. Kaplan, J. B., Ragunath, C., Ramasubbu, N., and Fine, D. H. (2003) Detachment

of Actinobacillus actinomycetemcomitans biofilm cells by an endogenous β-

hexosaminidase activity, Journal of Bacteriology 185, 4693-4698.

48. Nijland, R., Hall, M. J., and Burgess, J. G. (2010) Dispersal of biofilms by

secreted, matrix degrading, bacterial DNase, PLOS One 5, e15668.

49. Ghafoor, A., Hay, I. D., and Rehm, B. H. (2011) Role of exopolysaccharides in

Pseudomonas aeruginosa biofilm formation and architecture, Applied and

Environmental Microbiology 77, 5238-5246.

50. Romling, U. (2002) Molecular biology of cellulose production in bacteria,

Research in microbiology 153, 205-212.

51. Vaningelgem, F., Zamfir, M., Mozzi, F., Adriany, T., Vancanneyt, M., Swings, J.,

and De Vuyst, L. (2004) Biodiversity of exopolysaccharides produced by

Streptococcus thermophilus strains is reflected in their production and their

molecular and functional characteristics, Applied and Environmental

Microbiology 70, 900-912.

52. Wingender, J., Strathmann, M., Rode, A., Leis, A., and Flemming, H. C. (2001)

Isolation and biochemical characterization of extracellular polymeric substances

from Pseudomonas aeruginosa, Methods in enzymology 336, 302-314.

53. Nwodo, U. U., Green, E., and Okoh, A. I. (2012) Bacterial exopolysaccharides:

functionality and prospects, International journal of molecular sciences 13,

14002-14015.

54. Klausen, M., Aaes˗Jørgensen, A., Molin, S., and Tolker˗Nielsen, T. (2003)

Involvement of bacterial migration in the development of complex multicellular

structures in Pseudomonas aeruginosa biofilms, Molecular Microbiology 50, 61-

68.

55. Sutherland, I. W. (2001) Biofilm exopolysaccharides: a strong and sticky

framework, Microbiology 147, 3-9.

56. Mah, T.-F., Pitts, B., Pellock, B., Walker, G. C., Stewart, P. S., and O'Toole, G.

A. (2003) A genetic basis for Pseudomonas aeruginosa biofilm antibiotic

resistance, Nature 426, 306-310.

57. Bylund, J., Burgess, L.-A., Cescutti, P., Ernst, R. K., and Speert, D. P. (2006)

Exopolysaccharides from Burkholderia cenocepacia inhibit neutrophil chemotaxis

and scavenge reactive oxygen species, Journal of Biological Chemistry 281,

2526-2532.

58. Cescutti, P., Scussolin, S., Herasimenka, Y., Impallomeni, G., Bicego, M., and

Rizzo, R. (2006) First report of a lyase for cepacian, the polysaccharide produced

by Burkholderia cepacia complex bacteria, Biochemical and Biophysical

Research Communications 339, 821-826.

59. Cuzzi, B., Cescutti, P., Furlanis, L., Lagatolla, C., Sturiale, L., Garozzo, D., and

Rizzo, R. (2012) Investigation of bacterial resistance to the immune system

response: cepacian depolymerisation by reactive oxygen species, Innate immunity

18, 661-671.

60. Vuong, C., Kocianova, S., Voyich, J. M., Yao, Y., Fischer, E. R., DeLeo, F. R.,

and Otto, M. (2004) A crucial role for exopolysaccharide modification in bacterial

biofilm formation, immune evasion, and virulence, Journal of Biological

Chemistry 279, 54881-54886.

65

61. Zavascki, A. P., Carvalhaes, C. G., Picao, R. C., and Gales, A. C. (2010)

Multidrug-resistant Pseudomonas aeruginosa and Acinetobacter baumannii:

resistance mechanisms and implications for therapy, Expert review of anti-

infective therapy 8, 71-93.

62. Winsor, G. L., Lam, D. K., Fleming, L., Lo, R., Whiteside, M. D., Yu, N. Y.,

Hancock, R. E., and Brinkman, F. S. (2011) Pseudomonas Genome Database:

improved comparative analysis and population genomics capability for

Pseudomonas genomes, Nucleic acids research 39, D596-600.

63. Pasmore, M., Todd, P., Smith, S., Baker, D., Silverstein, J., Coons, D., and

Bowman, C. N. (2001) Effects of ultrafiltration membrane surface properties on

Pseudomonas aeruginosa biofilm initiation for the purpose of reducing biofouling,

Journal of Membrane Science 194, 15-32.

64. Wang, H., Masters, S., Hong, Y., Stallings, J., Falkinham III, J. O., Edwards, M.

A., and Pruden, A. (2012) Effect of disinfectant, water age, and pipe material on

occurrence and persistence of Legionella, mycobacteria, Pseudomonas

aeruginosa, and two amoebas, Environmental Science and Technology 46, 11566-

11574.

65. Rahme, L. G., Stevens, E. J., Wolfort, S. F., Shao, J., Tompkins, R. G., and

Ausubel, F. M. (1995) Common virulence factors for bacterial pathogenicity in

plants and animals, Science 268, 1899-1902.

66. Lang, A. B., Horn, M. P., Imboden, M. A., and Zuercher, A. W. (2004)

Prophylaxis and therapy of Pseudomonas aeruginosa infection in cystic fibrosis

and immunocompromised patients, Vaccine 22 Suppl 1, S44-48.

67. Branski, L. K., Al-Mousawi, A., Rivero, H., Jeschke, M. G., Sanford, A. P., and

Herndon, D. N. (2009) Emerging infections in burns, Surgical infections 10, 389-

397.

68. Thomas, P., Moore, M., Bell, E., Friedman, S., Decker, J., Shayegani, M., and

Martin, K. (1985) Pseudomonas dermatitis associated with a swimming pool,

Jama 253, 1156-1159.

69. Saltzstein, D., Wachs, B., Perroncel, R., Benson, A., Herrington, J., Haverstock,

D., and Pertel, P. (2007) Complicated urinary tract infections treated with

extended-release ciprofloxacin with emphasis on Pseudomonas aeruginosa,

Journal of Chemotherapy 19, 694-702.

70. Hart, C. A., and Winstanley, C. (2002) Persistent and aggressive bacteria in the

lungs of cystic fibrosis children, British medical bulletin 61, 81-96.

71. Burns, J. L., Gibson, R. L., McNamara, S., Yim, D., Emerson, J., Rosenfeld, M.,

Hiatt, P., McCoy, K., Castile, R., Smith, A. L., and Ramsey, B. W. (2001)

Longitudinal assessment of Pseudomonas aeruginosa in young children with

cystic fibrosis, The Journal of infectious diseases 183, 444-452.

72. Fothergill, J. L., Winstanley, C., and James, C. E. (2012) Novel therapeutic

strategies to counter Pseudomonas aeruginosa infections, Expert review of anti-

infective therapy 10, 219-235.

73. Lambert, P. A. (2002) Mechanisms of antibiotic resistance in Pseudomonas

aeruginosa, Journal of the Royal Society of Medicine 95 Suppl 41, 22-26.

66

74. Franklin, M. J., Nivens, D. E., Weadge, J. T., and Howell, P. L. (2011)

Biosynthesis of the Pseudomonas aeruginosa Extracellular Polysaccharides,

Alginate, Pel, and Psl, Frontiers in microbiology 2, 167.

75. Jennings, L. K., Storek, K. M., Ledvina, H. E., Coulon, C., Marmont, L. S.,

Sadovskaya, I., Secor, P. R., Tseng, B. S., Scian, M., and Filloux, A. (2015) Pel is

a cationic exopolysaccharide that cross-links extracellular DNA in the

Pseudomonas aeruginosa biofilm matrix, Proceedings of the National Academy

Of Sciences 112, 11353-11358.

76. Ma, L., Conover, M., Lu, H., Parsek, M. R., Bayles, K., and Wozniak, D. J.

(2009) Assembly and development of the Pseudomonas aeruginosa biofilm

matrix, PLOS Pathogens 5, e1000354.

77. Whitney, J., and Howell, P. (2013) Synthase-dependent exopolysaccharide

secretion in Gram-negative bacteria, Trends in microbiology 21, 63-72.

78. Cuthbertson, L., Mainprize, I. L., Naismith, J. H., and Whitfield, C. (2009)

Pivotal roles of the outer membrane polysaccharide export and polysaccharide

copolymerase protein families in export of extracellular polysaccharides in gram-

negative bacteria, Microbiology and Molecular Biology Reviews 73, 155-177.

79. Whitfield, C. (2006) Biosynthesis and assembly of capsular polysaccharides in

Escherichia coli, Annual Review of Biochemistry 75, 39-68.

80. Dong, C., Beis, K., Nesper, J., Brunkan-LaMontagne, A. L., Clarke, B. R.,

Whitfield, C., and Naismith, J. H. (2006) Wza the translocon for E. coli capsular

polysaccharides defines a new class of membrane protein, Nature 444, 226-229.

81. Albrecht, M. T., and Schiller, N. L. (2005) Alginate lyase (AlgL) activity is

required for alginate biosynthesis in Pseudomonas aeruginosa, Journal of

Bacteriology 187, 3869-3872.

82. Friedman, L., and Kolter, R. (2004) Genes involved in matrix formation in

Pseudomonas aeruginosa PA14 biofilms, Molecular Microbiology 51, 675-690.

83. Jain, S., and Ohman, D. E. (2005) Role of an alginate lyase for alginate transport

in mucoid Pseudomonas aeruginosa, Infection and Immunity 73, 6429-6436.

84. Gutsche, J., Remminghorst, U., and Rehm, B. H. (2006) Biochemical analysis of

alginate biosynthesis protein AlgX from Pseudomonas aeruginosa: purification of

an AlgX-MucD (AlgY) protein complex, Biochimie 88, 245-251.

85. Hay, I. D., Rehman, Z. U., and Rehm, B. H. (2010) Membrane topology of outer

membrane protein AlgE, which is required for alginate production in

Pseudomonas aeruginosa, Applied and Environmental Microbiology 76, 1806-

1812.

86. Hay, I. D., Schmidt, O., Filitcheva, J., and Rehm, B. H. (2012) Identification of a

periplasmic AlgK-AlgX-MucD multiprotein complex in Pseudomonas aeruginosa

involved in biosynthesis and regulation of alginate, Applied Microbiology and

Biotechnology 93, 215-227.

87. Jain, S., Franklin, M. J., Ertesvag, H., Valla, S., and Ohman, D. E. (2003) The

dual roles of AlgG in C-5-epimerization and secretion of alginate polymers in

Pseudomonas aeruginosa, Molecular Microbiology 47, 1123-1133.

88. Rehman, Z. U., Wang, Y., Moradali, M. F., Hay, I. D., and Rehm, B. H. (2013)

Insights into the assembly of the alginate biosynthesis machinery in Pseudomonas

aeruginosa, Applied and Environmental Microbiology 79, 3264-3272.

67

89. Remminghorst, U., and Rehm, B. H. (2006) Alg44, a unique protein required for

alginate biosynthesis in Pseudomonas aeruginosa, FEBS letters 580, 3883-3888.

90. Remminghorst, U., and Rehm, B. H. (2006) In vitro alginate polymerization and

the functional role of Alg8 in alginate production by Pseudomonas aeruginosa,

Applied and environmental microbiology 72, 298-305.

91. Colvin, K. M., Irie, Y., Tart, C. S., Urbano, R., Whitney, J. C., Ryder, C., Howell,

P. L., Wozniak, D. J., and Parsek, M. R. (2012) The Pel and Psl polysaccharides

provide Pseudomonas aeruginosa structural redundancy within the biofilm matrix,

Environmental microbiology 14, 1913-1928.

92. Jackson, K. D., Starkey, M., Kremer, S., Parsek, M. R., and Wozniak, D. J. (2004)

Identification of psl, a locus encoding a potential exopolysaccharide that is

essential for Pseudomonas aeruginosa PAO1 biofilm formation, Journal of

Bacteriology 186, 4466-4475.

93. Byrd, M. S., Sadovskaya, I., Vinogradov, E., Lu, H., Sprinkle, A. B., Richardson,

S. H., Ma, L., Ralston, B., Parsek, M. R., and Anderson, E. M. (2009) Genetic and

biochemical analyses of the Pseudomonas aeruginosa Psl exopolysaccharide

reveal overlapping roles for polysaccharide synthesis enzymes in Psl and LPS

production, Molecular Microbiology 73, 622-638.

94. Mishra, M., Byrd, M. S., Sergeant, S., Azad, A. K., Parsek, M. R., McPhail, L.,

Schlesinger, L. S., and Wozniak, D. J. (2012) Pseudomonas aeruginosa Psl

polysaccharide reduces neutrophil phagocytosis and the oxidative response by

limiting complement‐mediated opsonization, Cellular Microbiology 14, 95-106.

95. Billings, N., Millan, M. R., Caldara, M., Rusconi, R., Tarasova, Y., Stocker, R.,

and Ribbeck, K. (2013) The extracellular matrix component Psl provides fast-

acting antibiotic defense in Pseudomonas aeruginosa biofilms, PLOS Pathogens

9, e1003526.

96. DiGiandomenico, A., Warrener, P., Hamilton, M., Guillard, S., Ravn, P., Minter,

R., Camara, M. M., Venkatraman, V., MacGill, R. S., and Lin, J. (2012)

Identification of broadly protective human antibodies to Pseudomonas aeruginosa

exopolysaccharide Psl by phenotypic screening, Journal of Experimental

Medicine 209, 1273-1287.

97. Coyne, M., Russell, K. S., Coyle, C. L., and Goldberg, J. B. (1994) The

Pseudomonas aeruginosa algC gene encodes phosphoglucomutase, required for

the synthesis of a complete lipopolysaccharide core, Journal of Bacteriology 176,

3500-3507.

98. Coutinho, P. M., Deleury, E., Davies, G. J., and Henrissat, B. (2003) An evolving

hierarchical family classification for glycosyltransferases, Journal of molecular

biology 328, 307-317.

99. Fritz, T. A., Hurley, J. H., Trinh, L. B., Shiloach, J., and Tabak, L. A. (2004) The

beginnings of mucin biosynthesis: the crystal structure of UDP-

GalNAc:polypeptide alpha-N-acetylgalactosaminyltransferase-T1, Proceedings of

the National Academy Of Sciences 101, 15307-15312.

100. Lombard, V., Ramulu, H. G., Drula, E., Coutinho, P. M., and Henrissat, B. (2014)

The carbohydrate-active enzymes database (CAZy) in 2013, Nucleic acids

research 42, D490-D495.

68

101. Kelley, L. A., and Sternberg, M. J. (2009) Protein structure prediction on the

Web: a case study using the Phyre server, Nature Protocols 4, 363-371.

102. Guerin, M. E., Kordulakova, J., Schaeffer, F., Svetlikova, Z., Buschiazzo, A.,

Giganti, D., Gicquel, B., Mikusova, K., Jackson, M., and Alzari, P. M. (2007)

Molecular recognition and interfacial catalysis by the essential

phosphatidylinositol mannosyltransferase PimA from mycobacteria, Journal of

Biological Chemistry 282, 20705-20714.

103. Baker, P., Whitfield, G. B., Hill, P. J., Little, D. J., Pestrak, M. J., Robinson, H.,

Wozniak, D. J., and Howell, P. L. (2015) Characterization of the Pseudomonas

aeruginosa Glycoside Hydrolase PslG Reveals That Its Levels Are Critical for Psl

Polysaccharide Biosynthesis and Biofilm Formation, Journal of Biological

Chemistry 290, 28374-28387.

104. Mendis, H. C., Queiroux, C., Brewer, T. E., Davis, O. M., Washburn, B. K., and

Jones, K. M. (2013) The succinoglycan endoglycanase encoded by exoK is

required for efficient symbiosis of Sinorhizobium meliloti 1021 with the host

plants Medicago truncatula and Medicago sativa (Alfalfa), Molecular Plant-

Microbe Interactions 26, 1089-1105.

105. Wang, L.-X., Wang, Y., Pellock, B., and Walker, G. C. (1999) Structural

Characterization of the Symbiotically Important Low-Molecular-Weight

Succinoglycan of Sinorhizobium meliloti, Journal of Bacteriology 181, 6788-

6796.

106. Drummelsmith, J., and Whitfield, C. (1999) Gene products required for surface

expression of the capsular form of the group 1 K antigen in Escherichia coli (O9a:

K30), Molecular Microbiology 31, 1321-1332.

107. Baker, P., Ricer, T., Moynihan, P. J., Kitova, E. N., Walvoort, M. T., Little, D. J.,

Whitney, J. C., Dawson, K., Weadge, J. T., and Robinson, H. (2014) P.

aeruginosa SGNH hydrolase-like proteins AlgJ and AlgX have similar topology

but separate and distinct roles in alginate acetylation, PLOS Pathogens 10,

e1004334.

108. Hickman, J. W., and Harwood, C. S. (2008) Identification of FleQ from

Pseudomonas aeruginosa as a c‐di‐GMP responsive transcription factor,

Molecular Microbiology 69, 376-389.

109. Vasseur, P., Vallet-Gely, I., Soscia, C., Genin, S., and Filloux, A. (2005) The pel

genes of the Pseudomonas aeruginosa PAK strain are involved at early and late

stages of biofilm formation, Microbiology 151, 985-997.

110. Haq, I. U., Graupner, K., Nazir, R., and van Elsas, J. D. (2014) The genome of the

fungal-interactive soil bacterium Burkholderia terrae BS001—A plethora of

outstanding interactive capabilities unveiled, Genome Biology and Evolution 6,

1652-1668.

111. Singer, E., Webb, E. A., Nelson, W. C., Heidelberg, J. F., Ivanova, N., Pati, A.,

and Edwards, K. J. (2011) Genomic potential of Marinobacter aquaeolei, a

biogeochemical “opportunitroph”, Applied and Environmental Microbiology 77,

2763-2771.

112. Colvin, K. M., Gordon, V. D., Murakami, K., Borlee, B. R., Wozniak, D. J.,

Wong, G. C., and Parsek, M. R. (2011) The Pel polysaccharide can serve a

69

structural and protective role in the biofilm matrix of Pseudomonas aeruginosa,

PLOS Pathogens 7, e1001264.

113. Lee, V. T., Matewish, J. M., Kessler, J. L., Hyodo, M., Hayakawa, Y., and Lory,

S. (2007) A cyclic‐di‐GMP receptor required for bacterial exopolysaccharide

production, Molecular Microbiology 65, 1474-1484.

114. Whitney, J. C., Colvin, K. M., Marmont, L. S., Robinson, H., Parsek, M. R., and

Howell, P. L. (2012) Structure of the cytoplasmic region of PelD, a degenerate

diguanylate cyclase receptor that regulates exopolysaccharide production in

Pseudomonas aeruginosa, Journal of Biological Chemistry 287, 23582-23593.

115. Colvin, K. M., Alnabelseya, N., Baker, P., Whitney, J. C., Howell, P. L., and

Parsek, M. R. (2013) PelA deacetylase activity is required for Pel polysaccharide

synthesis in Pseudomonas aeruginosa, Journal of Bacteriology 195, 2329-2339.

116. Baker, P., HIll, P. J., Snarr, B. D., Alnabelseya, N., Pestrak, M. J., Lee, M. J.,

Jennings, L. K., Tam, J., Melnyk, R., and Parsek, M. R. (2015)

Exopolysaccharide biosynthetic glycoside hydrolases can be utilized to disrupt

and prevent Pseudomonas aeruginosa biofilms, bioRxiv, 032714.

117. Bonsor, D. A., Grishkovskaya, I., Dodson, E. J., and Kleanthous, C. (2007)

Molecular mimicry enables competitive recruitment by a natively disordered

protein, Journal of the American Chemical Society 129, 4800-4807.

118. Vasseur, P., Soscia, C., Voulhoux, R., and Filloux, A. (2007) PelC is a

Pseudomonas aeruginosa outer membrane lipoprotein of the OMA family of

proteins involved in exopolysaccharide transport, Biochimie 89, 903-915.

119. Stanford, E. (1883) Algin: A New Substance Obtained from Some of the

Commoner Species of Marine Algæ, Scientific American 16, 6323-6324.

120. Haug, A., Larsen, B., and Smidsrød, O. (1974) Uronic acid sequence in alginate

from different sources, Carbohydrate Research 32, 217-225.

121. Fischer, F., and Dörfel, H. (1955) Die polyuronsäuren der braunalgen

(Kohlenhydrate der Algen I), Hoppe-Seyler´s Zeitschrift Für Physiologische

Chemie 302, 186-203.

122. Nelson, W. L., and Cretcher, L. H. (1930) The isolation and identification of d-

mannuronic acid lactone from the Macrocystis pyrifera, Journal of the American

Chemical Society 52, 2130-2132.

123. Vu, B., Chen, M., Crawford, R. J., and Ivanova, E. P. (2009) Bacterial

extracellular polysaccharides involved in biofilm formation, Molecules 14, 2535-

2554.

124. Pindar, D. F., and Bucke, C. (1975) The biosynthesis of alginic acid by

Azotobacter vinelandii, Biochemical Journal 152, 617-622.

125. Darzins, A., and Chakrabarty, A. (1984) Cloning of genes controlling alginate

biosynthesis from a mucoid cystic fibrosis isolate of Pseudomonas aeruginosa,

Journal of Bacteriology 159, 9-18.

126. Page, W., and Sadoff, H. (1975) Relationship between calcium and uroinic acids

in the encystment of Azotobacter vinelandii, Journal of Bacteriology 122, 145-

151.

127. Socolofsky, M. D., and Wyss, O. (1962) Resistance of the Azotobacter cyst,

Journal of Bacteriology 84, 119-124.

70

128. May, T. B., Shinabarger, D., Maharaj, R., Kato, J., Chu, L., DeVault, J. D.,

Roychoudhury, S., Zielinski, N. A., Berry, A., Rothmel, R. K., and et al. (1991)

Alginate synthesis by Pseudomonas aeruginosa: a key pathogenic factor in

chronic pulmonary infections of cystic fibrosis patients, Clinical microbiology

reviews 4, 191-206.

129. Pedersen, S. S., Hoiby, N., Espersen, F., and Koch, C. (1992) Role of alginate in

infection with mucoid Pseudomonas aeruginosa in cystic fibrosis, Thorax 47, 6-

13.

130. Wloka, M., Rehage, H., Flemming, H.-C., and Wingender, J. (2005) Structure and

rheological behaviour of the extracellular polymeric substance network of mucoid

Pseudomonas aeruginosa biofilms, Biofilms 2, 275-283.

131. Donati, I., Holtan, S., Mørch, Y. A., Borgogna, M., Dentini, M., and Skjåk-Bræk,

G. (2005) New hypothesis on the role of alternating sequences in calcium-alginate

gels, Biomacromolecules 6, 1031-1040.

132. Remminghorst, U., and Rehm, B. H. (2006) Bacterial alginates: from biosynthesis

to applications, Biotechnology letters 28, 1701-1712.

133. Zielinski, N. A., Chakrabarty, A., and Berry, A. (1991) Characterization and

regulation of the Pseudomonas aeruginosa algC gene encoding

phosphomannomutase, Journal of Biological Chemistry 266, 9754-9763.

134. Deretic, V., Gill, J., and Chakrabarty, A. (1987) Gene algD coding for

GDPmannose dehydrogenase is transcriptionally activated in mucoid

Pseudomonas aeruginosa, Journal of Bacteriology 169, 351-358.

135. Ramelot, T. A., Yee, A., Cort, J. R., Semesi, A., Arrowsmith, C. H., and

Kennedy, M. A. (2007) NMR structure and binding studies confirm that PA4608

from Pseudomonas aeruginosa is a PilZ domain and a c-di-GMP binding protein,

Proteins: Structure, Function, and Bioinformatics 66, 266-271.

136. Whitney, J. C., Whitfield, G. B., Marmont, L. S., Yip, P., Neculai, A. M.,

Lobsanov, Y. D., Robinson, H., Ohman, D. E., and Howell, P. L. (2015) Dimeric

c-di-GMP is required for post-translational regulation of alginate production in

Pseudomonas aeruginosa, Journal of Biological Chemistry 290, 12451-12462.

137. De Angelis, F., Lee, J. K., O'Connell, J. D., 3rd, Miercke, L. J., Verschueren, K.

H., Srinivasan, V., Bauvois, C., Govaerts, C., Robbins, R. A., Ruysschaert, J. M.,

Stroud, R. M., and Vandenbussche, G. (2010) Metal-induced conformational

changes in ZneB suggest an active role of membrane fusion proteins in efflux

resistance systems, Proceedings of the National Academy Of Sciences 107,

11038-11043.

138. Oglesby, L. L., Jain, S., and Ohman, D. E. (2008) Membrane topology and roles

of Pseudomonas aeruginosa Alg8 and Alg44 in alginate polymerization,

Microbiology 154, 1605-1615.

139. Wolfram, F., Kitova, E. N., Robinson, H., Walvoort, M. T., Codee, J. D., Klassen,

J. S., and Howell, P. L. (2014) Catalytic mechanism and mode of action of the

periplasmic alginate epimerase AlgG, Journal of Biological Chemistry 289, 6006-

6019.

140. Franklin, M. J., and Ohman, D. E. (2002) Mutant analysis and cellular

localization of the AlgI, AlgJ, and AlgF proteins required for O acetylation of

alginate in Pseudomonas aeruginosa, Journal of Bacteriology 184, 3000-3007.

71

141. Keiski, C. L., Harwich, M., Jain, S., Neculai, A. M., Yip, P., Robinson, H.,

Whitney, J. C., Riley, L., Burrows, L. L., Ohman, D. E., and Howell, P. L. (2010)

AlgK is a TPR-containing protein and the periplasmic component of a novel

exopolysaccharide secretin, Structure 18, 265-273.

142. Whitney, J. C., Neculai, A. M., Ohman, D. E., and Howell, P. L. (2009)

Expression, refolding, crystallization and preliminary X-ray analysis of

Pseudomonas aeruginosa AlgE, Acta crystallographica. Section F, Structural

biology and crystallization communications 65, 463-466.

143. Rehm, B. H., Boheim, G., Tommassen, J., and Winkler, U. K. (1994)

Overexpression of algE in Escherichia coli: subcellular localization, purification,

and ion channel properties, Journal of Bacteriology 176, 5639-5647.

144. Fata Moradali, M., Donati, I., Sims, I. M., Ghods, S., and Rehm, B. H. (2015)

Alginate Polymerization and Modification Are Linked in Pseudomonas

aeruginosa, mBio 6, e00453-00415.

145. Schnider-Keel, U., Lejbølle, K. B., Baehler, E., Haas, D., and Keel, C. (2001) The

Sigma Factor AlgU (AlgT) Controls Exopolysaccharide Production and Tolerance

towards Desiccation and Osmotic Stress in the Biocontrol Agent Pseudomonas

fluorescensCHA0, Applied and environmental microbiology 67, 5683-5693.

146. May, T. B., and Chakrabarty, A. M. (1994) Pseudomonas aeruginosa: genes and

enzymes of alginate synthesis, Trends in microbiology 2, 151-157.

147. Boyd, A., and Chakrabarty, A. M. (1994) Role of alginate lyase in cell

detachment of Pseudomonas aeruginosa, Applied and Environmental

Microbiology 60, 2355-2359.

148. Pougach, K., Semenova, E., Bogdanova, E., Datsenko, K. A., Djordjevic, M.,

Wanner, B. L., and Severinov, K. (2010) Transcription, processing and function

of CRISPR cassettes in Escherichia coli, Molecular microbiology 77, 1367-1379.

149. Wong, T. Y., Preston, L. A., and Schiller, N. L. (2000) Alginate lyase: review of

major sources and enzyme characteristics, structure-function analysis, biological

roles, and applications, Annual review of microbiology 54, 289-340.

150. Zhu, B., and Yin, H. (2015) Alginate lyase: Review of major sources and

classification, properties, structure-function analysis and applications,

Bioengineered 6, 125-131.

151. Lombard, V., Bernard, T., Rancurel, C., Brumer, H., Coutinho, P. M., and

Henrissat, B. (2010) A hierarchical classification of polysaccharide lyases for

glycogenomics, Biochemical Journal 432, 437-444.

152. Lombard, V., Golaconda Ramulu, H., Drula, E., Coutinho, P. M., and Henrissat,

B. (2014) The carbohydrate-active enzymes database (CAZy) in 2013, Nucleic

acids research 42, D490-495.

153. Mikami, B., Ban, M., Suzuki, S., Yoon, H. J., Miyake, O., Yamasaki, M., Ogura,

K., Maruyama, Y., Hashimoto, W., and Murata, K. (2012) Induced-fit motion of a

lid loop involved in catalysis in alginate lyase A1-III, Acta crystallographica.

Section D, Biological crystallography 68, 1207-1216.

154. Branda, S. S., Chu, F., Kearns, D. B., Losick, R., and Kolter, R. (2006) A major

protein component of the Bacillus subtilis biofilm matrix, Molecular

Microbiology 59, 1229-1238.

72

155. Gimmestad, M., Ertesvag, H., Heggeset, T. M., Aarstad, O., Svanem, B. I., and

Valla, S. (2009) Characterization of three new Azotobacter vinelandii alginate

lyases, one of which is involved in cyst germination, Journal of Bacteriology 191,

4845-4853.

156. Davies, G. J., Wilson, K. S., and Henrissat, B. (1997) Nomenclature for sugar-

binding subsites in glycosyl hydrolases, Biochemical Journal 321 ( Pt 2), 557-

559.

157. Farrell, E. K., and Tipton, P. A. (2012) Functional characterization of AlgL, an

alginate lyase from Pseudomonas aeruginosa, Biochemistry 51, 10259-10266.

158. Chitnis, C., and Ohman, D. (1990) Cloning of Pseudomonas aeruginosa algG,

which controls alginate structure, Journal of Bacteriology 172, 2894-2900.

159. Walvoort, M. T., van den Elst, H., Plante, O. J., Kröck, L., Seeberger, P. H.,

Overkleeft, H. S., van der Marel, G. A., and Codée, J. D. (2012) Automated

Solid‐Phase Synthesis of β‐Mannuronic Acid Alginates, Angewandte Chemie

124, 4469-4472.

160. Choi, K.-H., Gaynor, J. B., White, K. G., Lopez, C., Bosio, C. M., Karkhoff-

Schweizer, R. R., and Schweizer, H. P. (2005) A Tn7-based broad-range bacterial

cloning and expression system, Nature Methods 2, 443-448.

161. Franklin, M. J., Chitnis, C. E., Gacesa, P., Sonesson, A., White, D. C., and

Ohman, D. E. (1994) Pseudomonas aeruginosa AlgG is a polymer level alginate

C5-mannuronan epimerase, Journal of Bacteriology 176, 1821-1830.

162. Wolfram, F., Arora, K., Robinson, H., Neculai, A. M., Yip, P., and Howell, P.

(2012) Expression, purification, crystallization and preliminary X-ray analysis of

Pseudomonas aeruginosa AlgL, Acta crystallographica. Section F, Structural

biology and crystallization communications 68, 584-587.

163. Choi, K.-H., Kumar, A., and Schweizer, H. P. (2006) A 10-min method for

preparation of highly electrocompetent Pseudomonas aeruginosa cells: application

for DNA fragment transfer between chromosomes and plasmid transformation,

Journal of Microbiological Methods 64, 391-397.

164. Hmelo, L. R., Borlee, B. R., Almblad, H., Love, M. E., Randall, T. E., Tseng, B.

S., Lin, C., Irie, Y., Storek, K. M., and Yang, J. J. (2015) Precision-engineering

the Pseudomonas aeruginosa genome with two-step allelic exchange, Nature

Protocols 10, 1820-1841.

165. Salamitou, S., Lemaire, M., Fujino, T., Ohayon, H., Gounon, P., Beguin, P., and

Aubert, J.-P. (1994) Subcellular localization of Clostridium thermocellum

ORF3p, a protein carrying a receptor for the docking sequence borne by the

catalytic components of the cellulosome, Journal of bacteriology 176, 2828-2834.

166. McCoy, A. J., Grosse-Kunstleve, R. W., Adams, P. D., Winn, M. D., Storoni, L.

C., and Read, R. J. (2007) Phaser crystallographic software, Journal of Applied

Crystallography 40, 658-674.

167. Painter, J., and Merritt, E. A. (2006) TLSMD web server for the generation of

multi-group TLS models, Journal of Applied Crystallography 39, 109-111.

168. Adams, P. D., Afonine, P. V., Bunkoczi, G., Chen, V. B., Davis, I. W., Echols,

N., Headd, J. J., Hung, L. W., Kapral, G. J., Grosse-Kunstleve, R. W., McCoy, A.

J., Moriarty, N. W., Oeffner, R., Read, R. J., Richardson, D. C., Richardson, J. S.,

Terwilliger, T. C., and Zwart, P. H. (2010) PHENIX: a comprehensive Python-

73

based system for macromolecular structure solution, Acta crystallographica.

Section D, Biological crystallography 66, 213-221.

169. Emsley, P., and Cowtan, K. (2004) Coot: model-building tools for molecular

graphics, Acta crystallographica. Section D, Biological crystallography 60, 2126-

2132.

170. Morin, A., Eisenbraun, B., Key, J., Sanschagrin, P. C., Timony, M. A., Ottaviano,

M., and Sliz, P. (2013) Collaboration gets the most out of software, Elife 2,

e01456.

171. DeLano, W. L. (2002) The PyMOL molecular graphics system.

172. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990)

Basic local alignment search tool, Journal of molecular biology 215, 403-410.

173. Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W.,

and Lipman, D. J. (1997) Gapped BLAST and PSI-BLAST: a new generation of

protein database search programs, Nucleic acids research 25, 3389-3402.

174. Ashkenazy, H., Erez, E., Martz, E., Pupko, T., and Ben-Tal, N. (2010) ConSurf

2010: calculating evolutionary conservation in sequence and structure of proteins

and nucleic acids, Nucleic acids research, gkq399.

175. Landau, M., Mayrose, I., Rosenberg, Y., Glaser, F., Martz, E., Pupko, T., and

Ben-Tal, N. (2005) ConSurf 2005: the projection of evolutionary conservation

scores of residues on protein structures, Nucleic acids research 33, W299-W302.

176. Trott, O., and Olson, A. J. (2010) AutoDock Vina: improving the speed and

accuracy of docking with a new scoring function, efficient optimization, and

multithreading, Journal of Computational Chemistry 31, 455-461.

177. Sanner, M. F. (1999) Python: a programming language for software integration

and development, Journal of Molecular Graphics and Modelling 17, 57-61.

178. Lin, H., Kitova, E. N., and Klassen, J. S. (2013) Quantifying Protein-Ligand

Interactions by Direct ESI-MS Analysis. Evidence of Non-uniform Response

Factors Induced by High Molecular Weight Molecules and Complexes, Analytical

chemistry.

179. El-Hawiet, A., Kitova, E. N., and Klassen, J. S. (2012) Quantifying carbohydrate-

protein interactions by electrospray ionization mass spectrometry analysis,

Biochemistry 51, 4244-4253.

180. Sun, J., Kitova, E. N., Wang, W., and Klassen, J. S. (2006) Method for

distinguishing specific from nonspecific protein-ligand complexes in

nanoelectrospray ionization mass spectrometry, Analytical chemistry 78, 3010-

3018.

181. Knutson, C. A., and Jeanes, A. (1968) A new modification of the carbazole

analysis: application to heteropolysaccharides, Analytical Biochemistry 24, 470-

481.

182. Chen, V. B., Arendall, W. B., Headd, J. J., Keedy, D. A., Immormino, R. M.,

Kapral, G. J., Murray, L. W., Richardson, J. S., and Richardson, D. C. (2010)

MolProbity: all-atom structure validation for macromolecular crystallography,

Acta crystallographica. Section D, Biological crystallography 66, 12-21.

183. Dolinsky, T. J., Czodrowski, P., Li, H., Nielsen, J. E., Jensen, J. H., Klebe, G.,

and Baker, N. A. (2007) PDB2PQR: expanding and upgrading automated

74

preparation of biomolecular structures for molecular simulations, Nucleic acids

research 35, W522-W525.

184. Dolinsky, T. J., Nielsen, J. E., McCammon, J. A., and Baker, N. A. (2004)

PDB2PQR: an automated pipeline for the setup of Poisson–Boltzmann

electrostatics calculations, Nucleic acids research 32, W665-W667.

185. Rehm, S., Trodler, P., and Pleiss, J. (2010) Solvent‐induced lid opening in

lipases: A molecular dynamics study, Protein Science 19, 2122-2130.

186. Xu, T., Liu, L., Hou, S., Xu, J., Yang, B., Wang, Y., and Liu, J. (2012) Crystal

structure of a mono-and diacylglycerol lipase from Malassezia globosa reveals a

novel lid conformation and insights into the substrate specificity, Journal of

Structural Biology 178, 363-369.

187. Dong, S., Wei, T.-D., Chen, X.-L., Li, C.-Y., Wang, P., Xie, B.-B., Qin, Q.-L.,

Zhang, X.-Y., Pang, X.-H., and Zhou, B.-C. (2014) Molecular insight into the role

of the N-terminal extension in the maturation, substrate recognition, and catalysis

of a bacterial alginate lyase from polysaccharide lyase family 18, Journal of

Biological Chemistry 289, 29558-29569.

188. Little, D. J., Li, G., Ing, C., DiFrancesco, B. R., Bamford, N. C., Robinson, H.,

Nitz, M., Pomès, R., and Howell, P. L. (2014) Modification and periplasmic

translocation of the biofilm exopolysaccharide poly-β-1, 6-N-acetyl-d-

glucosamine, Proceedings of the National Academy of Sciences 111, 11013-

11018.

189. Shimokawa, T., Yoshida, S., Kusakabe, I., Takeuchi, T., Murata, K., and

Kobayashi, H. (1997) Some properties and action mode of (1→ 4)-α-L-

guluronan lyase from Enterobacter cloacae M-1, Carbohydrate Research 304,

125-132.

190. Nakai, T., Sugano, Y., Shoda, M., Sakakibara, H., Oiwa, K., Tuzi, S., Imai, T.,

Sugiyama, J., Takeuchi, M., and Yamauchi, D. (2013) Formation of highly

twisted ribbons in a carboxymethylcellulase gene-disrupted strain of a cellulose-

producing bacterium, Journal of bacteriology 195, 958-964.

191. Collins, R. F., Beis, K., Dong, C., Botting, C. H., McDonnell, C., Ford, R. C.,

Clarke, B. R., Whitfield, C., and Naismith, J. H. (2007) The 3D structure of a

periplasm-spanning platform required for assembly of group 1 capsular

polysaccharides in Escherichia coli, Proceedings of the National Academy of

Sciences 104, 2390-2395.

192. Marlovits, T. C., Kubori, T., Sukhan, A., Thomas, D. R., Galán, J. E., and Unger,

V. M. (2004) Structural insights into the assembly of the type III secretion needle

complex, Science 306, 1040-1042.

193. Du, D., Wang, Z., James, N. R., Voss, J. E., Klimont, E., Ohene-Agyei, T.,

Venter, H., Chiu, W., and Luisi, B. F. (2014) Structure of the AcrAB-TolC

multidrug efflux pump, Nature 509, 512-515.

194. Bjerkan, T. M., Lillehov, B. E., Wenche, S., Skjåk-Bræk, G., Valla, S., and

Ertesvåg, H. (2004) Construction and analyses of hybrid Azotobacter vinelandii

mannuronan C-5 epimerases with new epimerization pattern characteristics,

Biochemical Journal 381, 813-821.

75

195. Hestrin, S. (1949) The reaction of acetylcholine and other carboxylic acid

derivatives with hydroxylamine, and its analytical application, Journal of

Biological Chemistry 180, 249-261.

196. Skj, G., Grasdalen, H., and Larsen, B. (1986) Monomer sequence and acetylation

pattern in some bacterial alginates, Carbohydrate Research 154, 239-250.

76

Appendix

Figure A1: Electrospray mass spectrum obtained in the negative mode for an

aqueous ammonium acetate solution of ManA4-O-propyl. The 764 Da ManA4-O-propyl was

observed at 782 (M+NH4)+

m/z. All peaks are relative to the largest peak at 782 m/z.

Peaks at 392 (ManAΔ2-O-propyl) and 569 m/z (ManAΔ3-O-propyl) were not observed.

Figure A2: Mass spectrometry spectrum obtained in the negative mode for the AlgL

WT digestion of ManA4-O-propyl. The digestion products were analyzed after 30 min.

ManA4-O-propyl, ManAΔ3-O-propyl, and ManAΔ2-O-propyl at 763, 569, and 392 m/z, respectively,

were identified, while ManA1-O-propyl was not observed. All peaks are relative to the

largest peak at 763 m/z.

trap CE = 30.85/20/5/2 4-3 TRANSFER CE = 1

m/z100 200 300 400 500 600 700 800 900 1000 1100 1200

%

0

100

m/z100 200 300 400 500 600 700 800 900 1000 1100 1200

%

0

100

G2S_June07_16_30 2 (0.051) Cm (2:10) TOF MS ES+ 1.97e7782.2223

787.1752

803.1417

G2S_June07_16_29 9 (0.169) Cm (2:11) TOF MS ES- 9.33e5763.1619

761.1353

587.1332545.0858369.0540 733.1519

785.1429

801.1160

823.0939

829.0971

AlgL 1.7 uM L4-3 67 uM 500,1500,3000

m/z160 180 200 220 240 260 280 300 320 340 360 380 400 420 440 460 480 500 520 540 560 580 600 620 640 660 680 700 720 740 760 780 800

%

0

100

m/z160 180 200 220 240 260 280 300 320 340 360 380 400 420 440 460 480 500 520 540 560 580 600 620 640 660 680 700 720 740 760 780 800

%

0

100

m/z160 180 200 220 240 260 280 300 320 340 360 380 400 420 440 460 480 500 520 540 560 580 600 620 640 660 680 700 720 740 760 780 800

%

0

100

EK_G2_17July14_06 846 (28.565) Cm (846:886) TOF MS ES- 4.04e5763.3093

569.2255

392.1376429.1985 545.1915

587.2401

764.3040

765.3113

EK_G2_17July14_06 321 (10.849) Cm (298:325) TOF MS ES- 3.37e5763.3093

569.2255

392.1376

429.1985 545.1915587.2401

764.3040

765.3113

EK_G2_17July14_06 6 (0.219) Cm (1:7) TOF MS ES- 7.59e4763.3093

392.1376 569.2359

400.1303429.1985545.1915

587.2401

764.3161

785.2914

30 m

Rel

ativ

e A

bu

nd

ance

R

elat

ive

Ab

un

dan

ce