The Interaction between Human Papillomavirus Type 16 and FADDIs Mediated by a Novel E6 Binding DomainSandy S. Tungteakkhun, Maria Filippova, Jonathan W. Neidigh,
Nadja Fodor, and Penelope J. Duerksen-Hughes* Department of Basic Sciences, Loma Linda University School of Medicine, Loma Linda, California 92354
Received 11 March 2008/Accepted 2 July 2008
High-risk strains of human papillomavirus, such as types 16 and 18, have been etiologically linked to cervicalcancer. Most cervical cancer tissues are positive for both the E6 and E7 oncoproteins, since it is theircooperation that results in successful transformation and immortalization of infected cells. We have reportedthat E6 binds to tumor necrosis factor receptor 1 and to Fas-associated death domain (FADD) and, in doingso, prevents E6-expressing cells from responding to apoptotic stimuli. The binding site of E6 to FADD localizesto the rst 23 amino acids of FADD and has now been further characterized by the use of deletion andsite-directed mutants of FADD in pull-down and functional assays. The results from these experimentsrevealed that mutations of serine 16, serine 18, and leucine 20 obstruct FADD binding to E6, suggesting thatthese residues are part of the E6 binding domain on FADD. Because FADD does not contain the two previouslyidentied E6 binding motifs, the Lxx Lsh motif, and the PDZ motif, a novel binding domain for E6 has beenidentied on FADD. Furthermore, peptides that correspond to this region can block E6/FADD binding in vitroand can resensitize E6-expressing cells to apoptotic stimuli in vivo. These results demonstrate the existence of a novel E6 binding domain.
Human papillomaviruses (HPVs) are small, double-strandedDNA viruses that preferentially infect epithelial tissues of thegenital tract, hands, and feet (25, 42). The high-risk strains, inparticular types 16 and 18, are closely associated with mostincidences of cervical cancer, currently the second most com-mon cancer and the fth leading cause of cancer-related deathsamong women worldwide (8, 38). High-risk strains are presentin greater than 90% of cervical cancer cases (over half of thesecases being positive for HPV-16) and have also been impli-cated in head and neck squamous cell carcinomas (16, 28).Specically, HPVs have been found in ca. 20% of cancersassociated with the oropharynx (31). Low-risk strains, such asHPV-6 and HPV-11, however, cause genital warts and do notlead to malignancy (43, 44).
In most cases of cervical carcinoma, the integration of viralDNA into the host genome precedes transformation of the celland is frequently accompanied by overexpression of the onco-proteins E6 and E7. Together, these two proteins are respon-sible for the deregulation of the cell cycle, due in part tointeractions with the tumor suppressor proteins p53 and pRb,leading to their inactivation (4). E6 is best known for its ability
to associate with the cellular protein E6AP, which together with E6 is responsible for directing the degradation of p53(15). This ability of E6 is essential for ensuring cellular survivaland for promoting viral propagation. In addition to p53, it isnow known that E6 interacts with a wide array of other cellularproteins (reviewed in references 36 and 59). Previously, wereported that the oncoprotein interacts with key regulators of
the apoptotic pathway, including tumor necrosis factor recep-tor 1 (TNFR1) (22), the adaptor molecule Fas-associateddeath domain (FADD) (21), and procaspase 8 (31). Morespecically, E6 binds to the C terminus of TNFR1 and to theN terminus of the death effector domains (DEDs) of FADDand procaspase 8.
The extrinsic pathway of apoptosis is initiated by binding of a ligand such as tumor necrosis factor alpha (TNF- ) or Fas-Lto its respective cell surface receptor (reviewed in references11 and 60), giving rise to formation of the death-inducingsignaling complex. Signal propagation then proceeds with re-cruitment of the adaptor protein FADD to the signaling com-plex via engagement between the death domains of Fas andFADD. Procaspase 8 then binds to FADD via DED engage-ment between the two proteins. In the presence of E6, how-ever, we have shown that FADD and caspase 8 are unable tocontinue to transmit the apoptotic signal because of the dose-dependent, E6-mediated acceleration of their degradation (21,27). These associations inhibit the propagation of apoptosisand allow the virus to avoid clearance by the host immuneresponse.
There are two known binding domains to which E6 prefer-entially binds when interacting with its protein partners. E6 isreported to bind to a sequence characterized by Lxx Lsh in which “x” represents any amino acid, “ ” is a hydrophobicresidue, “s” is an amino acid with a small side chain, and “h”is an amino acid that can make multiple hydrogen bondinginteractions with its side chain (3, 18, 37, 55). Proteins thatcontain this motif include the E6 binding partners E6AP,E6BP, and tuberin. In addition, binding of E6 to proteins suchas hDlg, hScrib, and MAGI-1 is mediated by their PDZ do-mains (24, 34). Therefore, to date, two E6-binding motifs havebeen identied. Interestingly, both of these motifs are absentfrom the sequence of FADD DED, although these two pro-
* Corresponding author. Mailing address: Department of Basic Sci-ences, Loma Linda University School of Medicine, 11085 CampusStreet, 121 Mortensen Hall, Loma Linda, CA 92354. Phone: (909)558-4300, ext. 81361. Fax: (909) 558-0177. E-mail: [email protected].
teins do indeed interact in both an in vitro and an in vivosystem (21). This suggests the existence of an additional bind-ing motif for E6.
In the present study, we sought to identify the residues of FADD that are required for E6 binding and, in doing so, haveidentied a novel E6 binding domain. We also explored thepossibility of using peptides to inhibit the interaction betweenE6 and its target protein. We found that peptide inhibitorsdesigned to mimic the hypothesized E6 binding domain suc-cessfully abrogated E6 binding to FADD DED in vitro andthat overexpressing this domain in cells restored the normalcellular response to apoptotic signals. Our ndings lend furthersupport to current literature regarding the feasibility of usingpeptides to obstruct protein-protein interactions and also con-tribute to the list of potential agents that can be used for thedesign of therapeutic approaches for cervical cancer.
MATERIALS AND METHODS
Reagents. Working stocks of monoclonal antibodies directed against Fas
(clone CH-11; Medical and Biological Laboratories Co., Ltd. [Nagoya, Japan]),monoclonal antibodies directed against -actin (Sigma) and HA (Roche AppliedScience), peroxidase-coupled monoclonal antibodies against glutathione S-trans-ferase (GST), peroxidase-coupled anti-rabbit polyclonal antibodies (Santa CruzBiotechnology), and rabbit polyclonal antibodies against FADD (Santa CruzBiotechnology) were used as previously reported (28). Cycloheximide (Sigma, St.Louis, MO), doxycycline (Clontech, Palo Alto, CA), and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT; Sigma) were prepared as previ-ously reported (28). Z-DEVD-FMK (Medical and Biological Laboratories Co.,Ltd. [Nagoya, Japan]) was dissolved in dimethyl sulfoxide to yield a 100 Mstock.
Cell culture. U2OS cells derived from a human osteosarcoma were obtainedfrom the American Type Culture Collection (Manassas, VA) and cultured inMcCoy’s 5A medium (Invitrogen, Carlsbad, CA) supplemented to contain 10%fetal bovine serum (Invitrogen), penicillin (100 U/ml), and streptomycin (100
g/ml) (Sigma). Cells were passaged and used at ca. 80% conuence. SiHa cells
derived from human cervical squamous cell carcinoma were obtained from the American Type Culture Collection (Manassas, VA) and cultured in Eagle min-imal essential medium (Invitrogen, Carlsbad, CA), supplemented as describedfor the maintenance of U2OS cells.
Plasmids. The pHA-E6 S and pHA-E6 AS plasmids have been describedpreviously (22) and, respectively, contain either the sense or the antisense ver-sions of epitope-tagged E6 (HA-E6) under the control of the cytomegaloviruspromoter. The following plasmids were obtained from and described in theTet-off kit from Clontech: the pTet-off plasmid, coding for tTA (tet activator);pTK-Hyg, coding for hygromycin resistance; and pTRE2, the cloning plasmid.pTRE HA-E6 was obtained by cloning the HindIII blunt-end BamHI fragmentinto the EcoRI blunt-end BamHI sites of the pTRE2 vector.
Carl Ware (La Jolla Institute for Allergy and Immunology, La Jolla, CA)kindly provided the pcDNA3-FADD plasmid (in the present study, this plasmidis referred to as pcDNA FADD), which served as the basis for all of ouradditional FADD-expressing constructs.
To express caspase 8 in the pAD plasmid (Stratagene) for use in the mam-malian two-hybrid assay, the caspase 8 DED sequence was obtained from cDNAprepared from U2OS cells by PCR amplication using the primers 5 -ACTTC AGCAGAAATCTTTATGATATTGGGGAAC-3 and 5 -GAGATTGTCATT ACCCCACACA-3 and was cloned in-frame with the activation domain of thepAD plasmid. To express FADD and its variants in the pBD plasmid (Strat-agene) for use in the mammalian two-hybrid assay, the appropriate region of FADD was cloned in-frame with the binding domain of the pBD plasmid.
To express FADD and its variants in the Escherichia coli system for subsequentprotein purication, the EcoRI-XhoI fragment from pM-FADD, coding forFADD, was cloned in-frame with the His 6 epitope of pTriEx-4 (Novagen) byusing the SmaI-XhoI sites in the multiple cloning site to produce the plasmidpHis-FADD. Production of the D1 construct (lacking amino acids 23 to 62) andthe D2 construct (lacking amino acids 1 to 79) has been previously described(21). The point mutations in the SELT, SSLS, SLT2, SLT3, and SLT4 constructs were created based on D1 by using a QuikChange site-directed mutagenesis kit(Stratagene) according to the manufacturer’s protocol. The following primer
pairs were used to create the FADD DED mutant constructs: 5 -GTGTCGTCCAGCCTGTCGAGCGGCCAGACGGTCGAGCTCCTGCGC-3 and 5 -GCGCAGGAGCTCGACCGTCTGGCCGCTCGACAGGCTGGACGACAC-3 forthe SELT mutations, 5 -CTGCACTCGGTGGCGTCCGGCACGGCGAGCAGCGAGCTGACC-3 and 5 -GGTCAGCTCGCTGCTCGCCGTGCCGGACGCCACCGAGTGCAG-3 for the SSLS mutations, 5 -CACTCGGTGTCGTCCGGCCTGGCGAGCGGCGAGGCGGTCGAGCTCCTGCGCGAGCTG-3 and5 - CAGCTCGCGCAGGAGCTGGACCGCCTCGCCGCTCGCCAGGCCGG
ACGACACCGAGTG-3 for the SLT2 mutations, 5 -TCGGTGTCGTCCAGCCTGTCGAGCACCGAGGTCAGCGAGCTCCTGCGCGAGCTG-3 and 5 -C AGCTCGCGCAGGAGCTCGCTGACCTCGGTGCTCGACAGGCTGGACGACACCGA-3 for the SLT3 mutations, and 5 - TCGGTGTCGTCCAGCCTGACCAGCACCGAGGTCACCGAGCTCCTGCGCGAGCTG-3 and 5 -CAGCTCGCGCAGGAGCTCGGTGACCTCGGTGCTGGTCAGGCTGGACGACACCGA-3 for the SLT4 mutations.
To express the N-terminal region of FADD DED implicated in E6 binding incells, the SacI-XbaI region was removed from pcDNA3-FADD.
To express His-tagged E6AP in E. coli for subsequent protein purication,EcoRI was used to remove the sequence of E6AP (amino acids 288 to 496)necessary for E6 binding from the pOTB7 plasmid (Open Biosystems). Thisfragment was subsequently cloned in-frame with the His 6 epitope of pTriEx-4(Novagen) by using the SmaI-PvuII sites in the multiple cloning site to producethe plasmid pHis-E6AP.
To express GST-tagged E6 in E. coli for subsequent protein purication, we
created a plasmid coding for the fusion protein GST-E6 by cloning E6(EcL136II-EcoRI blunt-end fragment) into the SmaI site of pGEX-2T (Amer-sham Biosciences).
Transfections. FuGENE VI (Roche Applied Science) was used to transfect allcells except SiHa, which were transfected with FuGENE HD (Roche AppliedScience), as directed by the manufacturer and as described previously (28).
Immunoblotting and immunoprecipitation. To prepare cell lysates for immu-noblot, cells (5 105 ) were lysed in 100 l of lysis buffer (50 mM Tris-HCl [pH7.5], 150 mM NaCl, 1% Triton X-100, 1 mM EDTA, 5% glycerol, 1 mM dithio-threitol, 1 mM phenylmethylsulfonyl uoride) for 10 min on ice. One tablet of protease inhibitor mixture (Roche Applied Science) was added per 10 ml of lysisbuffer just prior to use. The protein concentration in cleared lysates was mea-sured by using the Bio-Rad DC protein assay (Bio-Rad).
Lysates (40 g of total protein/lane) were then subjected to 12% sodiumdodecyl sulfate-polyacrylamide gel electrophoresis (SDS–12% PAGE) and trans-ferred to Immobilon P membranes (Millipore Corp.). Membranes were subse-quently blocked in 5% milk, followed by application of primary and secondaryantibodies in Tris-buffered saline–Tween 20 (TBST) solution. Proteins weredetected by applying the chemiluminescent SuperSignal West Femto or PicoMaximum Sensitivity substrate (Pierce).
To prepare cell lysates for immunoprecipitation, cells (5 105 ) were lysed in200 l of radioimmunoprecipitation assay buffer (25 mM Tris-HCl, 150 mMNaCl, 1% NP-40, 0.1% SDS, one tablet of protease inhibitor mixture per 10 mlof lysis buffer). Lysates were then incubated with 4 g of polyclonal antibodiesagainst FADD (Santa Cruz Biotechnology) for 1 h at 4°C on a rotator. Then, 50
l (per sample) of protein G-agarose (Roche Applied Science), which had beenpreviously blocked in 1% bovine serum albumin in TBST for 1 h at 4°C on arotator, was then added to the cell lysate-antibody mixture, followed by incuba-tion for an additional 1 h. The precipitated complex was then subjected toimmunoblotting and probed with the appropriate antibodies.
Treatment of cells with anti-Fas and cycloheximide. To measure cell survivalfollowing anti-Fas treatment, U2OS cells (1 104 cells/well) or SiHa cells (2104 cells/well) were seeded into 96-well plates and allowed to adhere overnight. Anti-Fas (50 ng/ml) was then added in the presence of cycloheximide (5 g/ml)to inhibit de novo protein synthesis, and the cells were incubated for 16 h priorto measuring cell viability by the MTT assay (28).
Development and use of the Tet-off system. U2OS cells capable of expressing variable amounts of HA-E6, regulated by the dose of doxycycline present in themedium, were created by using the Tet-off system (Clontech) according to themanufacturer’s protocol with some modications. Cultures of these cells weregrown in the indicated concentrations of the drug, which were maintainedthroughout the duration of the experiment.
Mammalian two-hybrid assay. The mammalian two-hybrid binding assay wasperformed as directed by the manufacturer (Stratagene). Transfection of theindicated combination of vectors and subsequent luciferase activity measure-ments were performed as previously described (28).
Expression and purication of recombinant proteins. Purication of GST,GST-E6, and the various His-tagged proteins was done as previously described(28).
In vitro pull-down assays. An in vitro pull-down assay was utilized to assess theability of bead-bound GST or GST-E6 proteins (glutathione beads from Sigma)to bind to bacterially expressed and puried FADD protein as previously de-scribed (28).
To examine the ability of peptides to inhibit the interaction between E6 andFADD, a 0, 10 or 25 M concentration of the respective peptides was added tothe mixture of proteins for incubation. Subsequent washes were performed asdescribed above.
p53 ELISA. A p53 enzyme-linked immunosorbent assay (ELISA) was used toquantify p53 levels in cells and was performed as previously described (20). AlphaScreen technology. AlphaScreen technology was used to assess the in-
teraction between GST-bound E6, the various His-tagged FADD DED mutants,and His-tagged E6AP as directed by the manufacturer (Perkin-Elmer). Thebinding assays were performed by using white 384-well Optiplates (Perkin-Elmer) in a total volume of 25 l. Proteins were diluted in a buffer containingphosphate-buffered saline, 10% glycerol, and 2 mM dithiothreitol. The Alpha-Screen kits (nickel-coated acceptor beads and glutathione-coated donor beads) were obtained from Perkin-Elmer. Then, 5 l of the buffer containing phos-phate-buffered saline, 0.1% bovine serum albumin, and 0.5% Tween 20 wasadded to the plate, followed by the addition of 5 l of each of the interactingprotein partners. After a 1-h incubation at room temperature, 5 l of both donorbeads and acceptor beads, at a concentration of 50 g/ml, was added to themixture. All manipulations involving AlphaScreen beads were done under sub-dued lighting. The plates were allowed to incubate overnight in the dark at room
temperature. The signal emitted from the interacting proteins was detected byusing an EnVision multilabel plate reader from Perkin-Elmer. For experimentsinvolving peptides, the indicated concentration of peptides was added prior tothe initial 1-h incubation.
Peptide synthesis. Peptides were synthesized by using a Trp-cage scaffold (48)on an ABI model 433A peptide synthesizer using fast FMOC (9-uorenyl-methoxy carbonyl) chemistry. The FMOC amino acids (with side chain protec-tion) were purchased from Advanced Chemtech, and the Wang resin preloaded with the appropriate C-terminal residue was purchased from Novabiochem. Theprotecting groups and resin support were cleaved from the peptide using reagentR (90% triuoroacetic acid, 5% thioanisol, 3% ethanedithiol, and 2% anisol). After ltering off the resin and concentrating the remaining solution, the peptide was precipitated in cold diethyl ether. The ether was removed, and the driedpeptide was dissolved in water with the minimum acetonitrile necessary forsolubility. Reversed-phase high-pressure liquid chromatography (HPLC) with amobile phase of acetonitrile with 0.08% triuoroacetic acid (A) and water with0.1% triuoroacetic acid (B) was used to obtain the puried peptide. AnalyticalHPLC indicated that the puried peptides were 98% pure. The expected massand fragmentation pattern of all peptides were obtained on our liquid chroma-tography-mass spectrometry system, a ThermoFinnigan LCQDeca XP massspectrometer with attached Surveyor HPLC, conrming the sequence of thesynthetic peptides. Additional peptides, without the Trp-cage scaffold, weresynthesized and used to assess their ability to block E6 binding to FADD DEDin vitro (Mimotopes).
RESULTS
Amino acids within the N terminus of FADD DED mediatebinding of HPV-16 E6. Previously, we have reported that ex-pression of HPV-16 E6 protects cells from Fas-induced apop-tosis, leading to increased cell viability compared to cells lack-ing E6. Using a tet-regulated system in which the presence of doxycycline inhibited the expression of E6, we found that pro-tection from Fas-induced apoptosis is due to the E6-mediatedaccelerated degradation of FADD. In the presence of E6 (0 ngof doxycycline/ml), FADD undergoes accelerated degradation.With 100 ng of doxycycline/ml added to the culture medium,however, a lack of E6 expression results in increased amountsof FADD protein. Elevated levels of FADD allow for theefcient propagation of the apoptotic signal corresponding tothe decreased viability observed in Fig. 1A. The residues thatmediate E6 binding localize to the N-terminal 23 amino acidsof FADD DED (21). A deletion mutant lacking amino acids 2to 79 (D2) was unable to bind to E6 complexed to GST beads
in an in vitro pull-down assay. However, a deletion mutantdecient in the nucleotides coding for amino acids 23 to 62(D1) demonstrated strong binding to E6, implicating the sig-nicance of the N terminus of FADD DED in E6 binding. Tofurther localize the regions of FADD required for binding,site-directed mutagenesis was utilized. The additional mutants were constructed based on D1 since this construct bound ef-ciently to E6 and thus harbors all of the residues necessary forbinding. Figure 1B displays the sequence of the various FADDDED mutants used to assess binding to GST-E6.
Mutant FADD proteins were bacterially expressed, puried,and used in in vitro pull-down assays with glutathione beadsbound to GST-E6. After SDS-PAGE separation and immuno-blotting of the proteins bound to the beads, a band correspond-ing to the SELT mutant protein was observed (data notshown). This band appeared to be weaker than the band cor-responding to D1, indicating a reduction in the ability of E6 tobind this protein. Nonetheless, the appearance of a proteinband points to the ability of GST-E6 to efciently bind to andpull-down the FADD protein despite the mutations made.Because this set of mutations did not eliminate binding, wecontinued to introduce mutations into FADD DED. The nextset of mutations was made in the region adjacent to that whichcodes for the SELT amino acids (SSLS). The results of subse-quent pull-down assays demonstrated that while binding wasslightly reduced with this SSLS mutant, it was not eliminated, which is similar to the ndings obtained with the SELT con-struct.
In order to identify a set of mutations that could completelyeliminate E6 binding, another construct, SLT2, was created, which incorporated some mutations from SELT and somemutations from SSLS (Fig. 1B). In vitro pull-down assays withpuried E6 and SLT2 proteins demonstrated that E6 was un-
able to bind to SLT2, implying that the region of FADDencoding the 5 amino acids mutated in SLT2 is necessary forE6 binding and that mutating specic amino acids in this bind-ing pocket can efciently inhibit binding. Figure 2A depicts thethree-dimensional structure of FADD DED, and Fig. 2B uses yellow to highlight the amino acids mutated in SLT2. However, when we tested this mutant protein in a series of biologicalassays to determine whether the mutations would also impairthe normal functions of FADD, we found that the mutantprotein was unable to undergo normal turnover in cells, tomediate the transmission of the apoptotic signal, and to ef-ciently bind to procaspase 8 DED. Therefore, it is likely thatthe ve mutations introduced into the sequence of FADDDED may have induced a major conformational change in theprotein structure.
The SLT3 and SLT4 sets of three amino acid mutations inFADD DED inhibit E6/FADD binding and E6-mediated FADDdegradation while preserving caspase 8 binding and the abilityto induce apoptosis. The inability of the SLT2 construct toexecute the normal functions of FADD led to the creationof additional mutants in order to locate the residues in theDED of FADD specic for E6 binding. Since the ability tobind E6 was lost with the ve mutations in SLT2, this sug-gests that some combination of these amino acids is relevantto the mediation of oncoprotein binding. SLT3 and SLT4 were created based on the amino acids that were mutated inthe original SLT2 construct and incorporate three mutations
rather than the ve in SLT2. Figures 2C and D depict theamino acids that were mutated in SLT3 and SLT4 in yellow.The three-dimensional rendition of the FADD DED proteindemonstrates that the E6 binding domain on FADD is com-prised of amino acids that localize to the outer surface of theprotein. Figure 3A lists the sequences of the constructs usedto perform the next set of in vitro pull-down assays withGST-E6.
Pull-down assays of proteins bound to GST-E6 and subse-quent immunoblotting demonstrate that although E6 can ef-ciently bind to D1, it cannot bind to SLT2 (as previously noted)and that the binding to SLT3 and SLT4 is nearly undetectable(Fig. 3B). Therefore, the amino acids that were mutated inthese proteins are those that are involved in facilitating E6/FADD binding.
The inability of GST-E6 to pull-down the SLT3 and SLT4proteins suggests that the binding pocket for E6 is disrupted bythe amino acid changes introduced. In order to verify ourndings, Perkin-Elmer’s AlphaScreen technology was used. AlphaScreen, which is based on the transfer of ambient oxygen
from the donor bead (coupled to GST-E6) to the acceptorbead (coupled to His-FADD), is a very sensitive method forassessing binding interactions. The data obtained from AlphaScreen analysis with puried GST-E6 and the variousFADD mutants reveals that although there is strong bindingbetween E6 and D1, the binding of E6 to SLT2, SLT3, andSLT4 is signicantly reduced (Fig. 3C). Thus, results from twoindependent in vitro assays demonstrate that the SLT3 andSLT4 proteins are unable to bind to E6.
Since the mutations in SLT3 and SLT4 can inhibit E6 bind-ing in vitro, we tested the consequences of E6 expression onthe stability of the mutant proteins in vivo. Previously, we havedemonstrated that E6 binds to wild-type FADD and heightensthe rate at which it undergoes degradation. Moreover, FADDbecomes unavailable to continue transmission of the apoptoticsignal, making E6 expressing cells resistant to death-inducingstimuli (21). Disruption of E6 binding in cells should, there-fore, lead to the inability of E6 to promote the accelerateddegradation of FADD, thus enabling FADD to propagate theapoptotic signal once initiated.
FIG. 1. Mutation of specic amino acids in the N terminus of FADD DED can block E6 binding. (A) E6 expression protects cells fromFas-induced apoptosis. Control cells not expressing E6 or cells expressing E6 under the control of the tetracycline/doxycycline response element,
U2OSE6tet24, were grown in the presence of the indicated concentrations of doxycycline for 48 h. Cells were then treated with 50 ng of anti-Fas/mlin the presence of 5 g of cycloheximide/ml. Cells were incubated for an additional 16 h prior to measuring cell viability via the MTT assay.Measurements were made in triplicate, and the error bars represent the standard deviation. (B) The protein sequences of the mutants that werecreated based on the sequence of D1 (lacking amino acids 23 to 62) are shown, along with the results of in vitro pull-down assays with E6 complexedto GST beads. The amino acids that were mutated in each construct are highlighted in red. The SELT, SSLS, and SLT2 names were chosen basedon amino acids in the regions where the mutations were made.
To test whether the mutations in the SLT3 and SLT4 con-structs can obstruct E6-mediated degradation of FADD in anin vivo system, U2OS cells that express E6 under the control of the tetracycline response element were transfected with plas-mids coding for the mutant proteins. U2OSE6tet24 cells cul-tured with either 0 or 100 ng of doxycycline/ml were trans-fected with plasmids encoding wild-type or mutant FADDproteins. In the presence of E6, wild-type FADD undergoesaccelerated degradation. In the absence of E6, however, higherlevels of wild-type FADD protein can be detected (rightmosttwo bands in Fig. 4A, upper panel). In contrast, transfection with the SLT3 and SLT4 constructs results in detectable levelsof FADD protein expression in both the presence (0 ng of doxycycline/ml) and absence (100 ng of doxycycline/ml) of E6
(Fig. 4A, upper panel). Densitometry of results obtained fromthree independent experiments supports these ndings (Fig.4A, lower panel). This suggests that the mutations introducedin these constructs change the nature of the E6 binding pocketon FADD DED, interfere with the ability of E6 to mediateFADD degradation, and result in normal FADD protein ex-pression in the presence of E6.
To further characterize the SLT3 and SLT4 mutants, wetested whether normal protein turnover would be affected when cells express these proteins. At 24 h after transfectingU2OS cells with the various FADD constructs, cells weretreated with cycloheximide for 0, 2, or 4 h to inhibit de novoprotein synthesis. Figure 4B demonstrates that wild-typeFADD undergoes degradation and results in decreased pro-
FIG. 2. The SLT2 set of ve mutations in FADD DED that localize to the E6 binding domain occupy a patch on the surface of the FADDprotein. The PDB has published the three-dimensional structure of FADD DED (accession number 1a1w). This structure was viewed utilizing theViewer Lite program. The structure of the wild-type protein is shown (A), and the amino acids mutated in the various mutant constructs arehighlighted in yellow (B, C, and D).
tein expression over time, whereas expression of the SLT3mutant protein is stable at all time points, similar to what wasobserved for the SLT2 mutant (data not shown). This suggeststhat the amino acids mutated here also impair protein turn-
over. However, the SLT4 mutant behaves as the wild-typeprotein as seen by diminished protein expression over time,indicating functional protein turnover. Therefore, although themutations in both SLT3 and SLT4 prevent E6 binding, only the
FIG. 3. Two combinations of three amino acid mutations in FADD inhibit E6 binding. (A) Schematic representation of the additional FADD DEDmutants used to map the region of E6 binding. The protein sequence of the mutants that were created based on the sequence of D1 (lacking amino acids23 to 62) are shown, along with the results of in vitro pull-down assays with E6 complexed to GST beads. The amino acids that were mutated in eachconstruct are highlighted in red. (B) Mutating three amino acids in the N terminus of FADD DED inhibits E6 binding to FADD. Glutathionebead-bound GST wasused to pull-downbacteriallyexpressed andpuried wild-typeFADD(D1)protein (lane 1);GST-E6 wasused to pull down puried wild-type D1 and FADD variants SLT2, SLT3, and SLT4 (lanes 2 to 5), as described previously. For the upper panel, blots were probed, followingSDS-PAGE separation of proteins and transfer to membranes, with antibodies to FADD. For the lower panel, the same membrane was stripped and reprobed with antibodies to GST. (C) AlphaScreen technology veries that E6 cannot bind to the FADD mutants SLT2, SLT3, and SLT4. GST-tagged E6 at 10 3 M was incubated for 1 h with 0.5, 0.1, or 0.02 M His-tagged D1 protein at room temperature. Glutathione-coated donor beads and nickel-coated acceptor beads were then added, and plates were read on an EnVision multilabel plate reader after an overnight incubation period in the absence of light.
protein encoded by the SLT4 construct allows for normal pro-tein turnover of FADD.
As mentioned previously, the mutations in SLT2 are in theregion necessary for binding to procaspase 8 and for the sub-sequent transmission of the apoptotic signal. To test whetherthe expressed SLT3 and SLT4 mutant proteins can facilitateapoptosis, U2OS cells were transfected with the pcDNA plas-mid (vector alone), pcDNA FADD, pcDNA SLT3, or pcDNASLT4. Cell viability measurements were made 48 h posttrans-fection. Figure 4C demonstrates that, unlike SLT2, the muta-tions in SLT3 and SLT4 do not impair apoptosis, resulting in viability that is comparable to cells expressing wild-type FADDprotein. This indicates that the mutations in SLT3 and SLT4do not abolish recruitment of procaspase 8 to the DED regionof FADD. To further examine this proposed binding, a mam-malian two-hybrid system was used to assess this protein-pro-tein interaction. Figure 4D shows that, whereas procaspase 8DED cannot associate with SLT2, the amino acid changes inSLT3 and especially in SLT4 do not eliminate the procaspase8 DED interaction with FADD DED. This, combined withthe results in Fig. 4B, suggests that the amino acids mutatedin SLT3 and SLT4 primarily affect HPV 16 E6 binding toFADD and that the behavior of the SLT4 mutant moreclosely resembles that of wild-type FADD with respect toturnover and procaspase 8 binding. These results indicatethat the residues mutated in SLT3 and SLT4 do not inter-fere with procaspase 8 recruitment and activation or trans-mission of apoptotic signals.
The E6 binding domain on FADD DED localizes to the outersurface of the protein. In localizing the E6 binding site onFADD DED, several mutant constructs were created, as listedin Fig. 1B and 3A. Site-directed mutagenesis of specic resi-dues in the protein sequence resulted in a reduction in the
ability of E6 to efciently bind to FADD. The various combi-nations of amino acids that were selected for mutation aresummarized in Fig. 5A. Each of the mutant constructs harborsmutations in the amino acids that reside in the N-terminal 23amino acids of the FADD DED sequence. Although a diverseset of amino acid changes hinder E6/FADD binding to various
degrees, it is the three amino acids mutated in SLT4 thatappear to be most specic for oncoprotein binding. The avail-ability of the three-dimensional structure of FADD in theProtein Data Bank (PDB) allows for the visualization of theimplicated E6 binding domain (Fig. 5B). In this representation,the amino acids mutated in SLT4 (serine 16, serine 18, andleucine 20) are depicted in blue, and those mutated in SLT2but not SLT4 (serine 14 and threonine 21) are shown in yellow.The relevant amino acids occupy a patch on the surface of FADD.
Peptide inhibitors that mimic the E6 binding domain onFADD DED can inhibit the E6/FADD interaction. Based onthe structure shown in Fig. 5B, the residues that constitute theE6 binding domain localize to the outer surface of FADDDED. This suggests that peptides or peptide-like moleculesmay be effective in inhibiting the E6/FADD interaction. It hasbeen reported that synthetic peptides have been successfullyused to inhibit protein-protein interactions (37). Identicationof the region on FADD that mediates oncoprotein bindingthus allows for the creation of peptides that mimic the E6binding domain. Figure 6A shows the sequences of two pep-tides, varying in length, that were synthesized based on theproposed E6 binding domain (A and B). In addition, the se-quences of two peptides synthesized based on reports that theycan be successfully used to block E6 binding to its knownprotein partner E6AP are shown (C and D) (37, 55). Sincesmaller peptides often lack a well-dened three-dimensionalstructure, the peptides were grafted onto a Trp-cage scaffold(47), which is itself helical, and may help stabilize the second-ary structure of the small peptide (19). In vitro pull-downassays were performed with bacterially expressed and puriedFADD protein, glutathione beads bound to GST-E6, and thepeptide inhibitors. After testing various concentrations of the
peptides, ranging from 0 to 100 M (data not shown), peptide A seemed to be the most promising in blocking E6 bindingutilizing in vitro pull-down assays, such that the addition of a 25
M concentration of peptide A signicantly reduced the in-teraction between E6 and FADD DED. Peptide B had someinhibitory activity, although it was less than that seen with
FIG. 4. Two combinations of three amino acid mutations in FADD DED inhibit E6-mediated FADD degradation, while leaving other testedbiological functions of FADD intact. (A) E6 cannot bind to SLT3 or SLT4 and thus does not mediate the accelerated degradation of the mutantFADD proteins. For the upper panel, U2OSE6tet24 cells cultured with 0 or 100 ng of doxycycline/ml were transfected with plasmids encoding wild-type FADD, the SLT3 mutant, or the SLT4 mutant FADD protein. At 24 h posttransfection, cell lysates were prepared for immunoblotting,and subsequent membranes were blotted with antibodies against FADD to analyze FADD content. For the lower panel, transfection experiments were repeated three times, and densitometric analysis of the resultant protein bands was performed by using a ChemiImager 4400 (AlphaInnotechCorp.). Error bars represent the standard deviations obtained from three separate experiments. (B) The three amino acid mutations in SLT4 donot inhibit the ability of FADD to undergo normal turnover. U2OS cells were transfected with pcDNA FADD wild type (lanes 1 to 3), pcDNASLT3 (lanes 4 to 6), or pcDNA SLT4 (lanes 7 to 9), as described before. At 24 h posttransfection, cycloheximide (5 g/ml) was added to inhibitde novo protein synthesis, and cells were then lysed at the indicated time points and used for immunoblotting. The subsequent membrane wasblotted with antibodies against FADD to analyze FADD content (top panel). For the center panel, the same membrane was stripped and reblotted with antibodies against -actin to normalize for loading. For the bottom panel, the same membrane was stripped and reblotted with antibodiesagainst green uorescent protein (GFP) to demonstrate transfection efciency. (C) The mutations made in SLT3 and SLT4 do not inhibit theability of FADD to trigger apoptosis. U2OS cells were transfected with either pcDNA (empty vector), pcDNA FADD, pcDNA SLT3, or pcDNASLT4. At 24 h posttransfection, cell viability was measured via the MTT assay. Measurements were made in triplicate, and the error bars representthe standard deviation. (D) The amino acids mutated in SLT3 and SLT4 do not eliminate the ability of FADD DED to bind to procaspase 8 DED.Sequences encoding procaspase 8 DED, wild-type FADD DED, the SLT3 mutant, or the SLT4 mutant FADD DED were cloned into the bait orprey plasmids of a mammalian two-hybrid kit (Stratagene). The indicated combination of plasmids, along with a plasmid encoding the luciferasereporter gene, was transfected into cells that express E6 under the control of the tetracycline/doxycycline response element. Cells were treated withthe indicated concentrations of doxycycline to regulate E6 expression. Luciferase expression was measured by using a luminometer to detectchemiluminescence. Measurements were made in triplicate, and the error bars represent the standard deviation.
peptide A (data not shown). To further explore this inhibition,the peptides were used in an AlphaScreen analysis with puri-ed GST-E6 and His-FADD (D1) proteins. AlphaScreen, which is based on the transfer of ambient oxygen from thedonor bead (coupled to GST-E6) to the acceptor bead (cou-pled to His-FADD [D1]), is a very sensitive method for assess-ing the potential inhibitory activity of the peptides. The resultsfrom this assay (Fig. 6B) demonstrate that in the presence of both peptides A and B there is a signicant reduction in signal,indicating that the addition of these peptides prevents the
protein partners from coming into close proximity to one an-other. Peptides C and D, however, do not negatively affect thebinding between E6 and FADD, as seen by the unimpairedbinding at the three concentrations of peptides tested. Theseobservations highlight the specicity of peptides A and B inobstructing the E6/FADD interaction. Although both peptides A and B were comparably effective at blocking the interactionbetween E6 and FADD, we chose to focus our work on theshortest sequence of amino acids capable of efciently imped-ing E6/FADD binding, that of peptide A.
FIG. 5. A specic combination of amino acids in the N terminus of FADD DED mediates E6/FADD binding. (A) Various mutant FADD constructsdesigned to localize the amino acids which facilitate E6 binding to FADD DED. Mutation of different combinations of amino acids in the N-terminal
23 amino acids of FADD DED lead to a reduction in the ability of E6 to bind FADD. (B) The three-dimensional structure of FADD DED as viewed with the Viewer Lite program with the amino acids mutated in SLT4 depicted in blue and those mutated in SLT2 but not SLT4 shown in yellow.
E6 binding to FADD DED is mediated by different aminoacids than those involved in E6 binding to E6AP. The aminoacid sequence that includes the E6 binding region on FADDDED shows some sequence similarity to the amino acid se-quence that includes the E6 binding region for E6AP. Theability of peptide A to obstruct the interaction between E6 andE6AP was therefore also tested. AlphaScreen analysis (Fig.6C) reveals that at the concentrations tested, peptide A spe-cically impairs E6/FADD (D1) binding while leaving E6/E6AP binding intact. To verify the effectiveness of this assaysystem, the binding between E6 and E6AP was tested in thepresence of known inhibitors of this interaction (peptides Cand D). As expected, Fig. 6C indicates that Peptides C and Dsignicantly impair E6/E6AP binding. These results providefurther evidence that the identied E6 binding domain onFADD is indeed novel.
The peptides listed in Fig. 6A were constructed with a Trp-cage scaffold, as previously mentioned. In addition, peptides Aand B were designed to represent the wild-type version of theputative E6 binding domain. In order to further test whetherthe amino acids identied as being those necessary for themediation of oncoprotein binding to FADD are indeed essen-tial for the inhibition of E6/FADD binding and to see whethershorter peptides lacking the Trp-cage could also function inthis way, a peptide encoding a short fragment of the FADDDED protein including a subset of the ve amino acid changesintroduced in SLT2 was synthesized. This peptide (peptide 2),along with a control peptide encoding the wild-type FADDprotein sequence (peptide 1), was used in an AlphaScreenanalysis with puried His-tagged FADD and GST-tagged E6proteins. As demonstrated in Fig. 6D, inclusion of peptide 1(wild-type sequence) resulted in a decrease in signal. Thisindicates a reduction in the binding between E6 and FADD,
even though peptide 1 is signicantly shorter than the previ-ously tested peptide A (compare Fig. 6A and D). However, itshould be noted that higher levels of this shorter peptide arenecessary to achieve inhibition. Peptide 2, which incorporatedsome of the mutations from SLT2, however, did not inhibitbinding at any of the concentrations tested, strengthening ourevidence for the specicity of the residues identied by muta-
FIG. 6. Peptides can be used to block the interaction between E6and FADD DED in vitro. (A) Peptides synthesized and tested for theability to obstruct binding between E6 and FADD. Peptides A and Bcorrespond to the proposed E6 binding domain on FADD. Peptides Cand D correspond to the E6 binding domain on E6AP. (B) Peptides which mimic the E6 binding domain on FADD can inhibit E6/FADDinteraction. Peptides A, B, C, and D at 0, 10, or 25 M was added toa mixture of puried His-tagged D1 (0.4 M) and GST-tagged E6proteins (10 3 M) (as described for Fig. 3C). After the speciedincubation period, the addition of beads, and an overnight incubation
in the absence of light, the plates were read on an EnVision multilabelplate reader. (C) Peptide A does not inhibit E6/E6-AP binding. Pep-tide A at 0, 10, or 25 M was added to a mixture of puried His-taggedD1 and GST-tagged E6 proteins (as described for Fig. 3C) or to amixture of puried His-tagged E6AP and GST-tagged E6 proteins.Peptides C and D, known inhibitors of E6/E6AP binding, at 0, 10, or25 M were added to mixtures of His-tagged E6AP and GST-taggedE6. (His-D1 at 0.5 M, His-E6AP at 0.5 M, and M GST-E6 at 10 3
M were used.) Plates were read as in panel B after an overnightincubation. (D) A peptide containing mutations in the amino acidsimplicated in mediating E6 binding to FADD supports our ndings of a novel E6 binding domain. For the top panel, peptides were synthe-sized and tested for the ability to obstruct binding between E6 andFADD (Mimotopes). For the bottom panel, peptide 1 (containing ashort fragment of the wild-type FADD protein sequence) and peptide2 (containing a short fragment of the FADD sequence with the 5amino acid changes introduced in the SLT2 construct) at 0, 50, 100, or400 M were added to mixtures of His-tagged D1 (0.4 M) andGST-tagged E6 (10 3 M). Plates were read as in panel B after anovernight incubation.
tion analysis. These observations further support our ndingsof a novel E6 binding domain that is characterized by a speciccombination of amino acids in the N terminus of FADD DED.
Expressing a peptide corresponding to the E6 binding do-main on FADD resensitizes E6-expressing cells to stimuli thatinduce apoptosis. The 23 amino acids in the N terminus of theDED of FADD appear to mediate oncoprotein binding basedupon the mutations made in the various constructs. Overex-pressing the region of FADD involved in E6 binding maycompetitively inhibit E6 binding to endogenous FADD in E6-expressing cells. This would leave more FADD available tofacilitate apoptosis once the apoptotic cascade of events isinitiated. To test this model, cells expressing either the sense(U2OSE612) or antisense (U2OSE6 AS) version of E6 wereeither transfected or not transfected with a plasmid encodingthe N-terminal 23 amino acids of FADD DED, hereafterreferred to as “pcDNA 23 aa” (Fig. 7A). At 24 h after trans-fection, cell lysates were prepared and endogenous FADDexpression was analyzed via Western blotting. Figure 7B dem-onstrates that in E6-expressing cells transfected with the plas-mid encoding the proposed E6 binding domain, E6 does notcause a loss of detectable steady-state levels of FADD (Fig. 7B,lane 1). In the absence of this peptide, however, the presenceof E6 results in a reduction in the levels of detectable FADDprotein due to degradation (Fig. 7B, lane 2). To test whetherE6-expressing cells can be resensitized to apoptosis-inducingstimuli when the E6-binding domain on FADD is overex-pressed, the HPV-negative cell line C33A and the HPV-posi-tive cancer cell lines SiHa and Caski were tested. After trans-fection of these cells with pcDNA 23 aa, cells were treated withanti-Fas to induce apoptosis via the extrinsic pathway and viability was measured by using the MTT assay. As shown inFig. 7C, viability of E6-expressing SiHa cells transfected with
vector alone is relatively high as a result of E6 binding toFADD and the resultant unsuccessful propagation of theapoptotic signal. However, upon transfection with pcDNA 23aa, the viability of E6-expressing cells is lower for cells trans-fected with pcDNA alone. Overexpression of the implicatedE6 binding domain on FADD in the HPV-positive Caski cellline reveals that although viability is reduced after the additionof anti-Fas, the difference in viability between cells transfected with pcDNA versus pcDNA 23 aa is less dramatic than that
observed for SiHa cells. This may be explained by the fact thatCaski cells are naturally sensitive to Fas. Taken together, theseresults indicate that the expression of a peptide correspondingto the E6 binding domain on FADD DED can resensitizeE6-expressing cells to apoptosis-inducing stimuli. Our ndingsalso suggest that the E6 oncoprotein contributes to the resis-tance of SiHa cells to Fas-induced apoptosis, in a context where the entire genome of HPV-16 is expressed.
Binding between E6 and E6AP leads to the formation of theubiquitin ligase moiety responsible for the degradation of thetumor suppressor protein p53. As previously mentioned, thereare sequence similarities between E6AP and FADD. However,despite these similarities, it has been shown that the aminoacids that direct oncoprotein binding to FADD are indeedunique and that peptides harboring this binding domain do notinterfere with E6/E6AP binding (Fig. 6C). This led to theprediction that sequences encoding this novel E6 binding do-main would have little or no effect on cellular p53 levels. Todirectly test this prediction, a p53 ELISA was used to deter-mine p53 levels in E6-expressing cells transfected with eitherthe pcDNA vector alone or with pcDNA 23 aa. After trans-fection of cells, mitomycin C was added to induce DNA dam-age and thereby increase cellular p53. As seen in Fig. 7D,transfection of either the control plasmid (pcDNA) or theplasmid coding for the 23-amino-acid peptide (pcDNA 23 aa)had no effect on the cellular level of p53, in either cells ex-pressing or lacking E6. These ndings further demonstrate thespecicity of the peptide inhibitor in obstructing E6/FADDbinding.
DISCUSSION
In order to persist in their host after infection, viruses have
developed the ability to manipulate the host immune responseto avoid clearance (5, 30). The mechanisms utilized by virusesto avoid elimination are extensive and can target moleculesinvolved in a number of different steps along the cell deathcascade. Some viruses have developed means to impede apop-tosis during the initial steps of signal propagation by interfering with caspase 8 or FADD (7, 54, 61). In addition, while some viruses have developed mechanisms to evade the host immunesystem by producing homologues of cytokines and chemokines,
FIG. 7. Overexpressing the region of FADD implicated in E6 binding in cells blocks the interaction between E6 and FADD DED andresensitizes cells to apoptosis inducing stimuli. (A) The pcDNA3 vector encoding the 23 amino acid residues on FADD implicated in E6 bindingexpresses the novel E6 binding domain. The amino acids in the E6 binding domain of FADD, based on the mutations introduced in SLT4, arehighlighted in red. (B) Overexpression of the peptide corresponding to the E6 binding domain in cells interferes with E6-mediated FADDdegradation. U2OS cells expressing either the sense (U2OSE612) or antisense (U2OSE6 AS) version of E6 were either transfected (lanes 1 and3) or not transfected (lanes 2 and 4) with pcDNA 23 aa. At 24 h posttransfection, cell lysates were prepared, proteins separated by SDS-PAGEand transferred to a membrane. The membrane was then blotted with antibodies against FADD to analyze FADD expression (top panel). Thesame membrane was stripped and reblotted with antibodies against -actin to demonstrate that equivalent amounts of lysate were used for analysis(bottom panel). (C) Expression of the implicated E6 binding domain on FADD DED resensitizes E6-expressing cells to Fas-induced apoptosis.HPV-negative C33A cells or HPV-positive Caski and SiHa cells were transfected with pcDNA 23 aa or with pcDNA vector alone. At 24 hposttransfection, cells were treated with 50 ng of anti-Fas/ml in the presence of 5 g of cycloheximide/ml. Cells were incubated for an additional16 h prior to measuring cell viability via the MTT assay. Measurements were made in triplicate, and the error bars represent the standard deviation.The pcDNA 23 aa plasmid expresses detectable levels of our protein of interest (inset). U2OS cells were (lane 2) or were not (lane 1) transfected with the pcDNA 23 aa plasmid. At 48 h posttransfection, cell lysates were used for Western blot analysis with antibodies directed against FADD.(D) The 23-amino-acid region on FADD implicated in E6 binding does not interfere with the ability of E6 to bind and degrade p53. U2OS cellsexpressing (U2OSE612) or not expressing E6 (U2OSE6 AS) were transfected with pcDNA 23 aa or with pcDNA vector alone. At 24 hposttransfection, cells were treated with 2 g of mitomycin C/ml for 16 h prior to measuring p53 levels with ELISA. Measurements were madein triplicate, and the error bars represent the standard deviation.
as well as their receptors (1, 6, 14), others have developedmeans to obstruct both the extrinsic and intrinsic cell deathpathways simultaneously (9, 53, 62).
In order to escape elimination by the host, the HPV mod-ulates apoptosis through several mechanisms (26), includingthe interaction of its oncoprotein E6 with the tumor suppressorprotein p53 (46, 64). In addition, E6 can also bind to TNFR1(63), FADD (21), procaspase 8 (31), bax (35, 40), and bak (17,56), thus preventing proapoptotic signal transduction. Many,though not all of these binding interactions are followed byaccelerated degradation of the binding partner. It has previ-ously been reported that HPV-16-positive cervical carcinomacells are resistant to apoptosis induced by Fas L (33), althoughthe mechanism by which this occurs was not described. Insupport of this observation, we have reported that HPV-16 E6binds directly to the DED of FADD and mediates its degra-dation, thereby making HPV-infected cells resistant to Fas-induced apoptosis (21). This discovery contributes to the cur-rent ndings regarding the importance of FADD proteinexpression and cancer since it has been reported that defects inFADD expression correlate with tumor progression (58). Lossof functional FADD expression, for example, leads to a de-crease in cancer cell death and is followed by metastasis innon-small cell lung carcinoma (52).
Prior to our ndings with FADD, E6 had been shown tobind to a number of protein partners, including E6AP (32),E6BP (13), paxillin (57), and tuberin (39). The consensus se-quence by which E6 binds these proteins is Lxx Lsh (2, 39).Further analysis of the interaction between E6 and its proteinpartners revealed that the seven-residue leucine-containingmotif, LQELLGE, constitutes the E6 binding motif. E6 is alsoknown to interact with proteins that harbor a PDZ domain viaits C-terminal XT/SXV (41, 45) sequence of amino acids,
which is conserved among different HPV strains.We have shown that E6 binds to a 23-amino-acid region within the N terminus of FADD DED through the creation of a series of deletion (21) and site-directed mutants (Fig. 1B and3A). A sequence comparison between FADD DED and thereported protein partners of E6 revealed that not only doesFADD DED lack the Lxx Lsh motif but the PDZ-bindingmotif is also absent, suggesting the presence of a novel E6binding motif. Mutagenesis of regions in FADD that resembletruncated versions of the leucine-containing motif did not af-fect the efciency of E6 binding to FADD (21), lending furthersupport to the existence of an additional E6 binding motif. TheSSELT sequence was used as the basis for the series of muta-tions highlighted in Fig. 1B and 3A. Interestingly, although veamino acid changes in this region successfully abrogated on-coprotein binding, the ability of FADD to undergo normalprotein turnover, to propagate the apoptotic signal, and tointeract with procaspase 8 were also lost. A possible explana-tion for these phenomena may be that the mutations that wereintroduced in the SLT2 construct resulted in a conformationalchange in the structure of FADD, making it unable to interact with the proteins needed for proper function. These ndingsalso suggested that the E6 binding pocket on FADD is en-coded by some combination of the amino acids that weremutated in SLT2.
In looking at the constructs that were created to help local-ize the region of E6 binding to FADD, it appeared that the
ability of E6 to associate with FADD was signicantly reducedor inhibited when specic amino acids were mutated. Thisobservation led to the creation of SLT3 and SLT4, constructsthat harbor a combination of three amino acid mutations be-lieved to be important in mediating oncoprotein binding toFADD DED. Intriguingly, the proteins encoded by both con-structs were unable to bind to E6, as demonstrated by in vitropull-down assays (Fig. 3B), by AlphaScreen technology (Fig.3C), and by the lack of accelerated protein degradation in thepresence of E6 (Fig. 4A, 0 ng of doxycycline/ml). However,the difference between the two proteins lie in the ability of theprotein encoded by the SLT4 construct to more efcientlyundergo protein turnover in the presence of cycloheximide(Fig. 4B) and to bind procaspase 8 (Fig. 4D). This implies thatserine 16, serine 18, and leucine 20 are the residues within theN terminus of FADD DED that are involved in E6 binding andthat they do not interfere signicantly with the other testedfunctions of FADD.
The availability of the three-dimensional structure of FADDDED in the PDB (accession number 1a1w) allows for visual-ization of the structure, as well as the location of the intro-duced mutations. Figures 2 and 5 reveal that the mutationsmade in the SLT2, SLT3, and SLT4 constructs localize to theouter surface of the protein, suggesting that peptides designedto mirror the proposed E6 binding domain might be successfulin blocking E6 binding to its target protein, FADD. It haspreviously been reported that peptide or small molecule inhib-itors can be successfully used to block protein-protein interac-tion (68, 69).
Based upon the localization of the E6 binding domain to theN-terminal 23 amino acids of FADD, peptide inhibitors weredesigned (Fig. 6A). The literature indicates that the E6 bindingmotif has a strong tendency to form an -helix (3, 12). There-
fore, to encourage proper peptide conformation, the peptides were grafted directly onto the Trp-cage (38). Peptides con-structed with this backbone remain stable in aqueous solution without additional proteins (51). The results from both in vitropull-down assays (data not shown) and AlphaScreen analysis with the peptides (Fig. 6B) indicated that both peptides A andB were effective in inhibiting the E6/FADD interaction. Due tothe sequence similarity between FADD and E6AP in the re-gion of E6 binding, it was possible that peptides which harborthe amino acids that mediate E6 binding to E6AP might alsoaffect E6 binding to FADD. Therefore, the effects of twopeptides designed to contain the residues in the E6 bindingdomain on E6AP (Fig. 6A, peptides C and D) were also tested.In vitro binding assays demonstrate that neither of these pep-tides impaired the E6/FADD interaction (Fig. 6B). Further,incorporating peptide A in a high-throughput binding assaydemonstrated that the peptide specically reduces or inhibitsbinding of E6 to FADD while leaving the interaction betweenE6 and E6AP undisturbed (Fig. 6C). These results indicatethat the two proteins do not share the same E6 binding do-main. These data also demonstrate that peptides designed tomimic the proposed E6 binding domain on FADD can besuccessfully used to inhibit oncoprotein binding to FADDDED in vitro. This nding signicantly contributes to the cur-rent knowledge regarding the efcacious use of small mole-cules to block protein-protein interactions.
We also found that expression of the 23-amino-acid region
of FADD DED implicated in E6 binding in vivo successfullyresensitized E6-expressing cells to normal apoptotic stimuli(Fig. 7C) in the HPV-positive human cervical squamous car-cinoma cells. In the case of the SiHa cells, viability was reducedfrom 58% to approximately half that, and in CaSki cells, via-bility was reduced from ca. 10% to ca. 5%. Caski cells areinherently more sensitive to Fas-induced apoptosis, as can beseen by the signicantly lower viability in Caski cells comparedto SiHa cells after transfection with the pcDNA empty vector(Fig. 7C). In both cases, and with these very different levels of baseline sensitivity, transfection of pcDNA 23 aa led to a re-duction in viability after -Fas treatment. Taken together,these data support our ndings of a novel E6 binding domainthat is not made up of a linear sequence of amino acids butinstead is composed of a set of residues that form the structuraldomain necessary to facilitate E6 binding.
E6 is a relatively short protein of 151 amino acids; however,attempts to purify E6 have proven difcult due to the highcontent of -helical and -sheet secondary structures. Theseproperties give rise to a protein that is both unstable andinsoluble once puried (23). Recently, however, a model of thestructure of HPV-16 E6 has been proposed based upon thecreation of an E6 mutant in which six nonconserved cysteines were replaced with serines (50) to enhance protein solubility.The protein was shown to retain the tested biological activitiesof its wild-type predecessor. Visualization of this proposedstructure (PDB accession no. 2FK4) reveals the -helicity of the protein. It is reported that E6 binds to its protein partnersthrough engagement of the leucine containing Lxx Lsh orPDZ motifs. We have demonstrated that E6 FADD interac-tion is mediated by a novel motif characterized by S16, S18,and L20. The highly irregular surface of the E6 protein sup-ports these ndings, suggesting that a combination of different
surface residues facilitates binding between E6 and at least someof its partners. The availability of the three-dimensional structureof E6 provides us with the future opportunity to localize theresidues on E6 that mediate binding to FADD.
Viruses, such as HPV, have developed means by which toavoid elimination by the host immune response in order tocontinue to persist and to propagate. The ability of the onco-protein E6 to protect infected cells from undergoing apoptosisthrough its interactions with the TNFR and the DEDs of bothprocaspase 8 and FADD enhance the prospective oncogenicityof the virus. This underlines the signicance of E6 in promot-ing virus survival postinfection. To date, several approacheshave been taken to inhibit E6 expression, including the admin-istration of small interfering RNA directed against E6 (49), theuse of antibody targeting designed to inhibit the interactionbetween E6 and p53 in order to prevent E6-mediated p53degradation (29), and the restoration of apoptosis in E6-in-fected cells through the administration of peptide aptamerstargeting E6 (10). Our nding of a novel E6 binding domain onFADD, a key player in viral oncogenesis, in conjunction withour results demonstrating successful use of peptide inhibitorsto block E6 activity further contribute to the list of potentialagents that can be used for the design of therapeutic ap-proaches for cervical cancer. In addition, since some head andneck cancers have been found to contain high-risk HPV types,our ndings may also aid in the design of therapeutic ap-proaches for these cancers as well.
ACKNOWLEDGMENTS
This study was supported by NIH grant 1 R01 CA-095461 (P.J.D.-H.).We thank Carl Ware (La Jolla Institute for Allergy and Immunol-
ogy) for the pcDNA-FADD-encoding plasmid and Ireland Burch forsynthesizing the peptide inhibitors.
REFERENCES
1. Alcami, A. 2003. Viral mimicry of cytokines, chemokines and their receptors.Nat. Rev. Immunol. 3:36–50.2. Baleja, J. D., J. J. Cherry, Z. Liu, H. Gao, M. C. Nicklaus, J. H. Voigt, J. J.
Chen, and E. J. Androphy. 2006. Identication of inhibitors to papillomavi-rus type 16 E6 protein based on three-dimensional structures of interactingproteins. Antivir. Res. 72:49–59.
3. Be, X., Y. Hong, J. Wei, E. J. Androphy, J. J. Chen, and J. D. Baleja. 2001.Solution structure determination and mutational analysis of the papilloma- virus E6 interacting peptide of E6AP. Biochemistry 40:1293–1299.
4. Bedell, M. A., K. H. Jones, and L. A. Laimins. 1987. The E6-E7 region of human papillomavirus type 18 is sufcient for transformation of NIH 3T3and rat-1 cells. J. Virol. 61:3635–3640.
5. Benedict, C. A. 2003. Viruses and the TNF-related cytokines, an evolvingbattle. Cytokine Growth Factor Rev. 14:349–357.
6. Benedict, C. A., T. A. Banks, and C. F. Ware. 2003. Death and survival: viralregulation of TNF signaling pathways. Curr. Opin. Immunol. 15:59–65.
7. Bertin, J., R. C. Armstrong, S. Ottilie, D. A. Martin, Y. Wang, S. Banks,G. H. Wang, T. G. Senkevich, E. S. Alnemri, B. Moss, M. J. Lenardo, K. J.
Tomaselli, and J. I. Cohen. 1997. Death effector domain-containing herpes- virus and poxvirus proteins inhibit both Fas- and TNFR1-induced apoptosis.Proc. Natl. Acad. Sci. USA 94:1172–1176.
8. Brink, A. A., G. D. Zielinski, R. D. Steenbergen, P. J. Snijders, and C. J.Meijer. 2005. Clinical relevance of human papillomavirus testing in cytopa-thology. Cytopathology 16:7–12.
9. Burgert, H. G., Z. Ruzsics, S. Obermeier, A. Hilgendorf, M. Windheim, and A. Elsing. 2002. Subversion of host defense mechanisms by adenoviruses.Curr. Top. Microbiol. Immunol. 269: 273–318.
10. Butz, K., C. Denk, A. Ullmann, M. Scheffner, and F. Hoppe-Seyler. 2000.Induction of apoptosis in human papillomavirus-positive cancer cells bypeptide aptamers targeting the viral E6 oncoprotein. Proc. Natl. Acad. Sci.USA 97:6693–6697.
11. Chen, G., and D. V. Goeddel. 2002. TNF-R1 signaling: a beautiful pathway.Science 296: 1634–1635.
12. Chen, J. J., Y. Hong, E. Rustamzadeh, J. D. Baleja, and E. J. Androphy.1998. Identication of an alpha helical motif sufcient for association withpapillomavirus E6. J. Biol. Chem. 273: 13537–13544.
13. Chen, J. J., C. E. Reid, V. Band, and E. J. Androphy. 1995. Interaction of papillomavirus E6 oncoproteins with a putative calcium-binding protein.Science 269: 529–531.
14. Cunnion, K. M. 1999. Tumor necrosis factor receptors encoded by poxvi-ruses. Mol. Genet. Metab. 67:278–282.
15. Daniels, P. R., C. M. Sanders, and N. J. Maitland. 1998. Characterization of the interactions of human papillomavirus type 16 E6 with p53 and E6-associated protein in insect and human cells. J. Gen. Virol. 79(Pt. 3):489–499.
16. D’Souza, G., A. R. Kreimer, R. Viscidi, M. Pawlita, C. Fakhry, W. M. Koch, W. H. Westra, and M. L. Gillison. 2007. Case-control study of humanpapillomavirus and oropharyngeal cancer. N. Engl. J. Med. 356: 1944–1956.
17. Du, J., G. G. Chen, A. C. Vlantis, P. K. Chan, R. K. Tsang, and C. A. vanHasselt. 2004. Resistance to apoptosis of HPV 16-infected laryngeal cancercells is associated with decreased Bak and increased Bcl-2 expression. CancerLett. 205: 81–88.
18. Elston, R. C., S. Napthine, and J. Doorbar. 1998. The identication of aconserved binding motif within human papillomavirus type 16 E6 bindingpeptides, E6AP and E6BP. J. Gen. Virol. 79(Pt. 2) :371–374.
19. Fairlie, D. P., M. L. West, and A. K. Wong. 1998. Towards protein surfacemimetics. Curr. Med. Chem. 5:29–62.
20. Filippova, M., and P. J. Duerksen-Hughes. 2003. Inorganic and dimethylatedarsenic species induce cellular p53. Chem. Res. Toxicol. 16:423–431.
21. Filippova, M., L. Parkhurst, and P. J. Duerksen-Hughes. 2004. The humanpapillomavirus 16 E6 protein binds to Fas-associated death domain andprotects cells from Fas-triggered apoptosis. J. Biol. Chem. 279: 25729–25744.
22. Filippova, M., H. Song, J. L. Connolly, T. S. Dermody, and P. J. Duerksen-Hughes. 2002. The human papillomavirus 16 E6 protein binds to tumornecrosis factor (TNF) R1 and protects cells from TNF-induced apoptosis.J. Biol. Chem. 277: 21730–21739.
23. Foster, S. A., G. W. Demers, B. G. Etscheid, and D. A. Galloway. 1994. Theability of human papillomavirus E6 proteins to target p53 for degradation in vivo correlates with their ability to abrogate actinomycin D-induced growtharrest. J. Virol. 68:5698–5705.
24. Gardiol, D., S. Galizzi, and L. Banks. 2002. Mutational analysis of the discslarge tumour suppressor identies domains responsible for human papillo-mavirus type 18 E6-mediated degradation. J. Gen. Virol. 83:283–289.
25. Garland, S. M. 2002. Human papillomavirus update with a particular focuson cervical disease. Pathology 34:213–224.
26. Garnett, T. O., and P. J. Duerksen-Hughes. 2006. Modulation of apoptosisby human papillomavirus (HPV) oncoproteins. Arch. Virol. 151: 2321–2335.
27. Garnett, T. O., M. Filippova, and P. J. Duerksen-Hughes. 2006. Accelerateddegradation of FADD and procaspase 8 in cells expressing human papillo-mavirus 16 E6 impairs TRAIL-mediated apoptosis. Cell Death Differ. 13:1915–1926.
28. Gillison, M. L., W. M. Koch, R. B. Capone, M. Spafford, W. H. Westra, L.
Wu, M. L. Zahurak, R. W. Daniel, M. Viglione, D. E. Symer, K. V. Shah, andD. Sidransky. 2000. Evidence for a causal association between humanpapillomavirus and a subset of head and neck cancers. J. Natl. Cancer Inst.92:709–720.
29. Grifn, H., R. Elston, D. Jackson, K. Ansell, M. Coleman, G. Winter, and J.Doorbar. 2006. Inhibition of papillomavirus protein function in cervicalcancer cells by intrabody targeting. J. Mol. Biol. 355: 360–378.
30. Hay, S., and G. Kannourakis. 2002. A time to kill: viral manipulation of thecell death program. J. Gen. Virol. 83:1547–1564.
31. Herrero, R., X. Castellsague, M. Pawlita, J. Lissowska, F. Kee, P. Balaram,T. Rajkumar, H. Sridhar, B. Rose, J. Pintos, L. Fernandez, A. Idris, M. J.Sanchez, A. Nieto, R. Talamini, A. Tavani, F. X. Bosch, U. Reidel, P. J.Snijders, C. J. Meijer, R. Viscidi, N. Munoz, and S. Franceschi. 2003.Human papillomavirus and oral cancer: the International Agency for Re-search on Cancer multicenter study. J. Natl. Cancer Inst. 95:1772–1783.
32. Huibregtse, J. M., M. Scheffner, and P. M. Howley. 1993. Localization of theE6-AP regions that direct human papillomavirus E6 binding, association with p53, and ubiquitination of associated proteins. Mol. Cell. Biol. 13:4918–
4927.33. Kobayashi, T., K. Tsutsumi, D. Kuwahara, H. Iwatake, and T. Takakuwa.2001. Resistance to Fas-mediated apoptosis in human papillomavirus type16-immortalized human laryngeal epithelial cells after tumorigenesis. Nip-pon Jibiinkoka Gakkai Kaiho 104: 139–146. (In Japanese.)
34. Lee, C., and L. A. Laimins. 2004. Role of the PDZ domain-binding motif of the oncoprotein E6 in the pathogenesis of human papillomavirus type 31.J. Virol. 78:12366–12377.
35. Li, B., and Q. P. Dou. 2000. Bax degradation by the ubiquitin/proteasome-dependent pathway: involvement in tumor survival and progression. Proc.Natl. Acad. Sci. USA 97:3850–3855.
36. Liu, Y., and J. D. Baleja. 2008. Structure and function of the papillomavirusE6 protein and its interacting proteins. Front. Biosci. 13:121–134.
37. Liu, Y., Z. Liu, E. Androphy, J. Chen, and J. D. Baleja. 2004. Design andcharacterization of helical peptides that inhibit the E6 protein of papilloma- virus. Biochemistry 43:7421–7431.
38. Longworth, M. S., and L. A. Laimins. 2004. Pathogenesis of human papil-lomaviruses in differentiating epithelia. Microbiol. Mol. Biol. Rev. 68:362–372.
39. Lu, Z., X. Hu, Y. Li, L. Zheng, Y. Zhou, H. Jiang, T. Ning, Z. Basang, C.Zhang, and Y. Ke. 2004. Human papillomavirus 16 E6 oncoprotein interfer-ences with insulin signaling pathway by binding to tuberin. J. Biol. Chem.279: 35664–35670.
40. Magal, S. S., A. Jackman, S. Ish-Shalom, L. E. Botzer, P. Gonen, R. Schlegel,and L. Sherman. 2005. Downregulation of Bax mRNA expression and pro-tein stability by the E6 protein of human papillomavirus 16. J. Gen. Virol.86:611–621.
41. Mantovani, F., and L. Banks. 2001. The human papillomavirus E6 proteinand its contribution to malignant progression. Oncogene 20:7874–7887.
42. Melton, J. L., and J. E. Rasmussen. 1991. Clinical manifestations of humanpapillomavirus infection in nongenital sites. Dermatol. Clin. 9:219–233.
43. Motoyama, S., C. A. Ladines-Llave, S. Luis Villanueva, and T. Maruo. 2004.The role of human papillomavirus in the molecular biology of cervical car-cinogenesis. Kobe. J. Med. Sci. 50:9–19.
44. Munger, K., A. Baldwin, K. M. Edwards, H. Hayakawa, C. L. Nguyen, M.Owens, M. Grace, and K. Huh. 2004. Mechanisms of human papillomavirus-induced oncogenesis. J. Virol. 78:11451–11460.
45. Munger, K., and P. M. Howley. 2002. Human papillomavirus immortaliza-tion and transformation functions. Virus Res. 89:213–228.
46. Munger, K., M. Scheffner, J. M. Huibregtse, and P. M. Howley. 1992. Inter-actions of HPV E6 and E7 oncoproteins with tumour suppressor geneproducts. Cancer Surv. 12:197–217.
47. Narayan, V. A., R. W. Kriwacki, and J. P. Caradonna. 1997. Structures of zinc nger domains from transcription factor Sp1. Insights into sequence-specic protein-DNA recognition. J. Biol. Chem. 272: 7801–7809.
48. Neidigh, J. W., R. M. Fesinmeyer, and N. H. Andersen. 2002. Designing a20-residue protein. Nat. Struct. Biol. 9:425–430.
49. Niu, X. Y., Z. L. Peng, W. Q. Duan, H. Wang, and P. Wang. 2006. Inhibitionof HPV 16 E6 oncogene expression by RNA interference in vitro and in vivo.Int. J. Gynecol. Cancer 16:743–751.
50. Nomine, Y., M. Masson, S. Charbonnier, K. Zanier, T. Ristriani, F. Deryck-ere, A. P. Sibler, D. Desplancq, R. A. Atkinson, E. Weiss, G. Orfanoudakis,B. Kieffer, and G. Trave. 2006. Structural and functional analysis of E6oncoprotein: insights in the molecular pathways of human papillomavirus-mediated pathogenesis. Mol. Cell 21:665–678.
51. Pitera, J. W., and W. Swope. 2003. Understanding folding and design: rep-lica-exchange simulations of “Trp-cage” miniproteins. Proc. Natl. Acad. Sci.USA 100: 7587–7592.
52. Shin, M. S., H. S. Kim, S. H. Lee, J. W. Lee, Y. H. Song, Y. S. Kim, W. S.Park, S. Y. Kim, S. N. Lee, J. Y. Park, J. H. Lee, W. Xiao, K. H. Jo, Y. P. Wang, K. Y. Lee, Y. G. Park, S. H. Kim, J. Y. Lee, and N. J. Yoo. 2002. Alterations of Fas-pathway genes associated with nodal metastasis in non-small cell lung cancer. Oncogene 21:4129–4136.
53. Shisler, J., C. Yang, B. Walter, C. F. Ware, and L. R. Gooding. 1997. Theadenovirus E3-10.4K/14.5K complex mediates loss of cell surface Fas(CD95) and resistance to Fas-induced apoptosis. J. Virol. 71:8299–8306.
54. Shisler, J. L., and B. Moss. 2001. Molluscum contagiosum virus inhibitors of apoptosis: the MC159 v-FLIP protein blocks Fas-induced activation of pro-caspases and degradation of the related MC160 protein. Virology 282: 14–25.
55. Sterlinko Grm, H., M. Weber, R. Elston, P. McIntosh, H. Grifn, L. Banks,and J. Doorbar. 2004. Inhibition of E6-induced degradation of its cellularsubstrates by novel blocking peptides. J. Mol. Biol. 335: 971–985.
56. Thomas, M., and L. Banks. 1998. Inhibition of Bak-induced apoptosis byHPV-18 E6. Oncogene 17:2943–2954.
57. Tong, X., and P. M. Howley. 1997. The bovine papillomavirus E6 oncopro-tein interacts with paxillin and disrupts the actin cytoskeleton. Proc. Natl. Acad. Sci. USA 94:4412–4417.
58. Tourneur, L., A. Buzyn, and G. Chiocchia. 2005. FADD adaptor in cancer.Med. Immunol. 4:1.
59. Tungteakkhun, S. S., and P. J. Duerksen-Hughes. 2008. Cellular bindingpartners of the human papillomavirus E6 protein. Arch. Virol. 153: 397–408.
60. Wallach, D., E. E. Varfolomeev, N. L. Malinin, Y. V. Goltsev, A. V.Kovalenko, and M. P. Boldin. 1999. Tumor necrosis factor receptor and Fassignaling mechanisms. Annu. Rev. Immunol. 17:331–367.
61. Wang, G. H., J. Bertin, Y. Wang, D. A. Martin, J. Wang, K. J. Tomaselli,R. C. Armstrong, and J. I. Cohen. 1997. Bovine herpesvirus 4 BORFE2protein inhibits Fas- and tumor necrosis factor receptor 1-induced apoptosisand contains death effector domains shared with other gamma-2 herpesvi-ruses. J. Virol. 71:8928–8932.
62. Zanardi, T. A., S. Yei, D. L. Lichtenstein, A. E. Tollefson, and W. S. Wold.2003. Distinct domains in the adenovirus E3 RID protein are required fordegradation of Fas and the epidermal growth factor receptor. J. Virol.77:11685–11696.
63. Zeng, M., A. Kumar, G. Meng, Q. Gao, G. Dimri, D. Wazer, H. Band, and V.Band. 2002. Human papillomavirus 16 E6 oncoprotein inhibits retinoic Xreceptor-mediated transactivation by targeting human ADA3 coactivator.J. Biol. Chem. 277: 45611–45618.
64. zur Hausen, H. 2000. Papillomaviruses causing cancer: evasion from host-cell control in early events in carcinogenesis. J. Natl. Cancer Inst. 92:690–698.
