Studies on Lipidification of Streptokinase

Studies on Lipidification of Streptokinase: A Novel Strategyto Enhance the Stability and Activity

Pichaimuthu Suthakaran, PhD,1 Jaiiamadhumithaa Balasubramanian, BTech,1

Mirunalini Ravichandran, MS,1 Vidhyapriya Murugan, MSc,1

Lanka Naga Ramya, MSc,2 and Krishna Kanth Pulicherla, PhD3*

Thrombotic disorders and their associated problems are extensively prevalent in developed anddeveloping countries. Streptokinase (SK) is a well-known thrombolytic agent, which is very usefulin treating coronary thrombosis and acute myocardial infarction. Several attempts have been madeto date to make improvements of this wonderful molecule in terms of reducing or eliminating theproblems of eliciting immunogenicity and enhancing the half-life of the molecule. The presentresearch is focused to produce a recombinant SK with enhanced stability and biological activityby the methodology of lipid modification. SK was targeted successfully to the membrane with thehelp of modified apyrase signal sequence. Higher expression was reported for GJ1158 strain inLBON medium when compared with BL21 (DE3). The obtained recombinant SK was tested for itsbiological activity by the method of caseinolytic assay. The higher clearance zone was observed inrecombinant lipid-modified streptokinase, which denotes the enhanced activity of the protein. Thepresent trial of lipid modification of therapeutics, particularly SK, could help for its superior use asa thrombolytic agent and also paves way for many of the other clinical applications.

Keywords: lipid modification, apyrase signal sequence, thrombolysis, E.coli GJ1158, streptokinase

INTRODUCTION

Thrombosis and its related disorders are one of themajor causes of high mortality worldwide. Amongall the thrombolytic agents used, streptokinase (SK)is a highly marketed and efficaciously used drug indeveloping countries like India. It is an extracellularenzyme produced by different strains of b-hemolyticStreptococci and is known to be the first-generationthrombolytic agent that has a molecular mass of

47 kDa and contains 414 amino acids.1 This is moreeffective in treating acute myocardial infarction ratherthan recombinant tissue plasminogen activator.2 SKgets its plasminogen activity when complexed withplasmin or plasminogen. This complex is a proteasethat has high specificity and thus degrades anotherplasminogen molecule to plasmin by proteolysis.3,4

Irrespective of SK having numerous applications, ithas certain limitations for using it as an effectivethrombolytic agent that includes eliciting immunoge-nicity and shorter half-life in circulation. So, researchhas been focused to modify the enzyme for itsimprovement with respect to all the problems dis-cussed above along with the enhancement of plasmin-ogen activation. Many trials have been made withrespect to obtaining structurally modified SK by sev-eral methods such as genetic mutations and recombi-nant DNA technology.5–7 Chemical modificationswere also proven to be ineffective because of some ofthe bottlenecks.8 Despite numerous efforts made toimprove this amazing molecule, the present study is

1Centre for Biotechnology, Anna University, Chennai, India;2Department of Biotechnology, Acharya Nagarjuna University,Guntur, India; and 3Center for Bioseparation Technology, VITUniversity, Vellore, India.Jaiiamadhumithaa BS and M. Ravichandran contributed equally tothis study.The authors have no conflicts of interest to declare.*Address for correspondence: Center for Bioseparation Technology,VIT University, Vellore 632014, Tamil Nadu, India. E-mail:[email protected]

American Journal of Therapeutics 0, 000–000 (2014)

1075–2765 � 2014 Lippincott Williams & Wilkins www.americantherapeutics.com

Copyright ª Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.

mailto:[email protected]

aimed to produce a modified SK molecule having highbiological activity and enhanced stability by the meth-odology of lipid modification, which is an effectivestrategy without perturbing its structure and function.

The process of lipid modification is widespread andis regarded as functionally important in most of thebiological systems. So, an alternative strategy in theform of site-directed lipid modification with the helpof genetic engineering was performed. Early discoveryof covalent attachment of lipid to a protein was firstdocumented in a study related to murein, an outermembrane lipoprotein called Braun lipoprotein ofEscherichia coli.9 Biochemical analysis revealed that thisprotein has an N-acyl S-diacylglyceryl modified cyste-ine group at the N-terminal end.10 Lipid modificationin bacterial system has been successfully evolved, andit is reported that bacteria consist of more than 770lipoproteins.11 The exact mechanism of the lipoproteinbiosynthetic pathway was clearly demonstrated,which shows the involvement of 3 enzymes in thereaction.12 Bacterial lipoprotein is synthesized as a sig-nal peptide containing precursors, and a diacyl glycer-ide group is attached to the signal peptide at N-terminus cysteine residue, the first amino acid in alllipoproteins. Signal peptide is a tripartite sequence,where the N region contains 5–7 residues with a posi-tive charge and the hydrophobic region is unchargedwith a modal value of 12 residues. Both N region andhydrophobic region are common to all lipoproteinsand nonlipoproteins. The distinguishing feature isthe c region that contains conserved amino acidsequence (LVI) (ASTVI) (GAS) C.13 An enzyme calleddiacyl glyceryl transferase catalyzes the attachment ofdiacyl glycerol to the cysteine, and prolipoprotein sig-nal peptidase cleaves the signal peptide. The exposedamino group is acylated using apolipoprotein transa-cylase, and the mature lipoprotein is translocated tothe outer membrane. Thus, by exploiting the lipidmodification strategies, the nonlipoprotein is geneti-cally engineered and converted into lipoprotein inE. coli, the famous recombinant host, and was provento be successful.14

Some of the modern man-made applications likeenzyme-linked immunosorbent assay, biosensors,and liposomes work by the concept of lipidification.This method is also reported to have widespreadusage in the field of pharmaceutical industry. Diseasessuch as multiple sclerosis, stroke, or tumors cannot beeasily treated, as blood–brain barrier (BBB) preventsthe unregulated passage of many molecules into thebrain from circulation.15 High lipid solubility helps inallowing molecules to pass across the BBB by passivediffusion. Chemical modification of drugs thatenhance lipophilicity results in increased distribution

of drug, which is very useful to treat variousdisorders.16–18 As the property of lipophilicityincreases, the transport of drugs through the barrier ofthe brain is enhanced, and many successful exampleswere reported for the usage of lipid carriers in the trans-port of drugs (Reinhard et al, 2010).19 In this study, SK(nonlipoprotein), a well-known agent used in thrombo-lytic therapy is subjected to lipid modification by attach-ing the signal sequence from Shigella20 in a T7 promoter–based expression vector pRSET-B and is transformedinto E. coli. The apyrase signal sequence that codes for23 amino acids is recognized, and the protein gets acyl-ated, which is targeted to the membrane with lipid moi-ety. This lipidification would lead to the enhancement ofvarious properties of SK with respect to stability.

MATERIALS AND METHODS

Bacterial strains, plasmids, and reagents

Maintenance host E. coli DH5a and the IPTG-inducibleexpression host E. coli BL21 (DE3) were procured fromInvitrogen. E. coli GJ1158, a salt inducible expression hostderived from E. coli BL21 (DE3) containing chromoso-mally integrated T7 RNA polymerase phage gene undertranscriptional control of the cis-regulatory elements ofthe osmotically responsible proU operon.21 It is wellknown that the formation of inclusion body may be sig-nificant in the lac promoter-based expression systems.Moreover, IPTG is more expensive and toxic.22 GJ1158was obtained from CCMB, Hyderabad, India. The Strep-tokinase gene (Skc) was obtained fromDr K. J. Mukherjee,Centre for Biotechnology, JNU, New Delhi, India. Lipid-modified apyrase signal peptide containing pRSET-Bvector was obtained from Dr Sankaran, CBT, AnnaUniversity, Chennai, India. All the chemicals usedin the preparation of reagents and buffers are of analyt-ical grade and procured from Hi Media Laboratory,Mumbai, India. Standard SK protein was purchasedfrom Cadila Pharmaceuticals, Ahmedabad, Gujarath,India. H3-palmitate labeling, palmitic acid [9,10 1H3](10 mCi/mL) was procured from American Radiola-beled Chemicals, St. Louis, MO.

E. coli BL21 (DE3) was grown at 378C in Luria Ber-tani (LB), nutrient broth (NB), or glucose yeast extract(GYE) medium, and all their recombinants weregrown in the presence of 100 mg/mL of ampicillin.E. coli GJ1158 was grown at 378C in the same abovemedium but without NaCl, and its recombinant wasgrown in the presence of 100 mg/mL of ampicillin.

Lipid modification of SK

The pRSET-B vector is a pUC-derived T7 expressionsystem, which is designed for high-level expression

2 Suthakaran et al

American Journal of Therapeutics (2014) 0(0) www.americantherapeutics.com


of heterologous proteins. This vector is altered asa lipid-modified vector (LM vector) by attaching themodified apyrase signal sequence, which codes for23 amino acids (MKTKNFLLFCIATNMIFIPSANA)by restricting the NdeI and BamHI sites. The recombi-nant lipid-modified streptokinase (LMSK) clone wasproduced by ligating the SK mature sequence inthe LM vector. The forward primer containing theBamHI site for the amplification of Skc gene was“GGCGGATCCATTGCTGGACCTGAG”, whereasthe reverse primer introducing the PstI restric-tion site consists of the following nucleotides:“AACTGCAGTTATTTGTCGTTAGG.” The polymerasechain reaction was performed using each 5 pmol of for-ward and reverse primers with annealing temperature at568C. The working concentration of dNTP was 0.2 mM,and the samples were subjected to 35 cycles with a finalextension at 728C. Both insert (SK) and LM vector wererestricted with BamHI and PstI restriction enzymes andthen ligated.Native or unmodified SK, the pRSETBSK clone was

designed in pRSET-B vector between NdeI and EcoRIsites. The following forward and reverse primers wereused: “GGAATTCCATATGATTGCTGGACCT” and“CGGAATTCTTATTTGTCGTTATC,” respectively, forthe construction of pRSETBSK. Polymerase chain reac-tion conditions are similar to LMSK.E. coli harboring LMSK expression was performed

by considering different parameters like expressionhost, medium, postinduction time, and postinductiontemperature. The recombinant SK constructs (LMSK)were transformed into the expression host BL21 (DE3)and GJ1158 and were allowed to grow in variousmedia such as LB, LBON, NB, NBON, GYE, andGYEON till 1.0 OD. The culture was induced witheither 0.5 mM IPTG or 0.3 M NaCl and kept at varioustemperatures such as 258C, 308C, and 378C for 3 hoursand 6 hours. After induction, the samples were ana-lyzed by 10% sodium dodecyl sulfate polyacrylamidegel electrophoresis (SDS-PAGE).

Subcellular fractionation and Tricine SDS-PAGE

The technique of subcellular fractionation is a method,where the proteins from cytoplasm, periplasm, andmembrane fractions are separated and are used in tar-geting studies. The recombinant SK culture wasinduced with 0.3 M NaCl at 1.0 OD and kept at 308Cfor 3 hours. The induced E. coli cells containing plas-mid were centrifuged at 5000 rpm for 10 minutes atroom temperature. The supernatant was discarded,and the pellet was washed with phosphate-bufferedsaline (PBS) or 0.9% saline. The suspension was centri-fuged at 5000 rpm for 10 minutes, and the pellet wasresuspended in lysis buffer containing (50 mM Tris,

10 mM EDTA, and 20% sucrose) 40 mL of lysozyme(1 mg/mL). The suspension was incubated at 378C for45 minutes, and after incubation, the cells were centri-fuged at 13,000 rpm for 15 minutes at 48C. The super-natant containing periplasmic protein was collected,and the pellet was then suspended thoroughly in corewater and kept at room temperature for 10 minutes.The mixture was then pelleted at 13,000 rpm for15 minutes at 48C, and the supernatant containing cyto-plasmic protein and the pellet containing membrane-targeted protein were suspended in PBS and analyzedby 10% SDS-PAGE.

After lipid modification, mobility shift was clearlydemonstrated by the methodology of Tricine SDS-PAGE,23 and this method has been effectively usedto identify the intermediates in the processes ofin vivo and in vitro lipid modification. Equal concen-trations of native and LMSK were loaded on to 15%Tricine SDS-PAGE (Tricine, 15%; C gel, 6%; run for 18hours at 100V). Tricine SDS-PAGE was performed asdescribed previously,24 and the obtained protein wasstained with Coomassie brilliant blue R-250.

Radiolabeling assay

The plasmid containing LMSK, native SK, and LM vec-tor was transformed into the E. coli expression hostGJ1158. Transformants were grown in LBON mediumcontaining ampicillin (100 mg/mL). At 0.4 OD, the cellswere supplemented with 10 mCi of (9,10 1H3) palmitateand incubated for 15–20 minutes in the shaker at 378C.The culture was then induced with 0.3 M NaCl andkept in the shaker at 308C. After 5 hours, the cells wereharvested, and the pellet was resuspended in PBS. AfterSDS-PAGE analysis, the gel was stained with 1 M KCl,and the LMSK (48.5 kDa) was excised from the gel andtreated with 1 M NaCl followed by Millipore water.Then, the gel pieces were treated with 100% ethanoland allowed to dry. After complete drying, 100 mL ofscintillation fluid was added and counted in a scintilla-tion counter as cpm (counts per minute).

Caseinolytic assay

Biological activity of SK was identified in vitro by themethod of caseinolytic assay. All the recombinantswere grown in LB or LBONmedium and induced with0.5 mM IPTG or 0.3 M NaCl for different time intervalsat different temperature conditions. Ninety milligramof agarose was taken and dissolved in 7.5 mL of50 mM Tris having a pH of 8.0 along with 150 mMNaCl and is mixed with 20 volume percent of boiledmilk. The mixture was cooled, added with 5% ofplasma (500 mL), and poured into a sterile plate. Aftersolidification, wells were bored in the assay medium,and lysate was added into each well. Finally, the

Lipidification of Streptokinase 3

www.americantherapeutics.com American Journal of Therapeutics (2014) 0(0)


diameter of zone of caseinolysis was measured after anincubation period of 3–5 hours at 378C, and biologicalactivity was determined by comparing against thestandard SK loaded in a separate well. For determin-ing the changes in the stability of LMSK, the casein-olytic activity was analyzed for a period of 3–11 hoursin the above-mentioned standard conditions.

Heated plasma agar plate assay

Heated plasma agar plate assay is also used to determinethe thrombolytic activity for plasminogen activators.

About 15 mL of LB agar was melted; then human plasmawas collected and was kept separately at 568C for20 minutes. Both medium and plasma were mixedtogether, poured into sterile petri plates, and allowed tosolidify. Wells were bored on the solidified agar medium,and 2 mg of purified native and LMSK were loaded onthe wells and kept at 378C for overnight.

RESULTS

Development and expression of LMSK

In the present study, lipid modification is performed ina specialized vector known as lipid-modified apyrasevector, which is a modified pRSET-B vector. Skc gene(1. 25 kb) was successfully ligated into the LM vectorusing BamHI and PstI enzyme sites.

The plasmid containing recombinant streptokinase(LMSK) was transformed into E. coli strain BL21(DE3) and GJ1158. From the analysis, it was observedthat characteristic protein expression above 47 kDawas found out. Also, it was observed that GJ1158 inLBON medium at 308C showed slightly higher expres-sion (Figures 1, 2). All other mediums and tempera-tures in both BL21 (DE3) and GJ1158 showed a similarlevel of expression (Figure 3).

The recombinant SK producing clone was theninoculated in large-scale (10 mL) LBON mediumand induced with 0.3 M NaCl at 308C. The lipid mod-ification was further confirmed by cell fractionationtechniques.

FIGURE 1. Overexpression of modified SK in GJ1158 in

LBON medium. Lysates of samples were analyzed in

10% SDS-PAGE. Lane 1: protein marker; lane 2: vector

control; lane 3: uninduced LMSK; and lanes 4 and 6:

induced LMSK for 3 hours at 378C and 308C, respectively.Similarly, lane 5: induced LMSK for 6 hours at 378C and

308C, respectively. The expression of the 48.5 kDa pro-

tein (modified SK) is indicated by an arrow.

FIGURE 2. Expression of modified SK in BL21 (DE3). Ly-

sates of samples were analyzed in 10% SDS-PAGE. Lane

1: protein marker; lane 2: vector control; lane 3: unin-

duced LMSK; and lanes 4 and 6: induced LMSK for 3

hours at 308C and 378C, respectively. Similarly, lanes 5

and 7: induced LMSK for 6 hours at 308C and 378C,respectively. The expression of the 48.5 kDa protein

(modified SK) is indicated by an arrow.

4 Suthakaran et al



Membrane targeting of SK in E. coli

Induced bacterial culture (pellet) was considered forsubcellular fractionation, and different compartmentsamples were loaded in 10% SDS-PAGE. From theresult, it was observed that characteristic proteinexpression was observed in the membrane fraction,and no bands corresponding to LMSK (above 47kDa) was found in both periplasmic and cytoplasmicfractions (Figure 4). Furthermore, the activity of mem-brane fraction was observed to be high when com-pared with the fractions from periplasm andcytoplasm (Figure 5). This result indicates that cyto-plasmic SK is targeted to the membrane by modifiedapyrase signal sequence.

Mobility shift in Tricine SDS-PAGE

An increase in the molecular mass due to lipidation ofprotein was analyzed using 15% Tricine SDS-PAGE byloading modified SK samples against the native protein.After staining and destaining, the mobility differencewas observed between native and LMSK correspondingto 47 kDa and 48.5 kDa, respectively (Figure 6). Thismobility shift indicates that the SK was subjected tolipid modification, and the attachment of lipid moietywas further confirmed by radiolabeling study.

Confirmation of lipid modification by radiolabelingstudy

Tricine SDS-PAGE and fractionation technique werethe first level of evidence, which showed that the

protein has undergone some modifications. Lipidationof protein was confirmed by performing radiolabelingassay by incorporating tritium-labeled palmitate. Themethod involves the incubation of cells with tritium-labeled palmitate (9,10 1H3) at 0.4 OD, which wasinduced with 0.3 M NaCl. The induced samples werekept at 308C for 5 hours. The desired protein wasexcised using 1 M KCl from SDS-PAGE and washedwith Millipore water; then, the gel pieces were dried,and the radioactivity was counted on scintillationcounter. From the literature review, it is optimized thatthe count of 90 cpm and above confirms the incorpora-tion of radiolabeled palmitate.25 For LMSK, the radio-activity was counted to be 129 cpm, which copiouslyproves that palmitate has been incorporated, and theprotein has undergone lipid modification (Table 1).

Activity and stability of LMSK

The membrane targeted LMSK was induced andloaded into 10% SDS-PAGE. After SDS-PAGE, theprotein was eluted from the gel by staining withKCl. The desired protein of size above 47 kDa wasexcised from the gel and eluted with simple diffusionmethod. The modified sample and the unmodified(native) sample were then eluted and quantifiedusing Bradford assay. After elution, the protein’s bio-logical activity was analyzed by plasma-caseinolyticassay. Two microgram protein concentration of boththe native and LMSK was subjected for caseinolyticassay plate and its activity was determined. Anunmodified SK was used as a control. Compared

FIGURE 3. Expression kinetics of modified SK. LMSK was transformed into BL21 (DE3) and GJ1158, then protein

expression was analyzed in different media like LB, LBON, NB, NBON, and GYE at different postinduction temperatures

such as 258C, 308C, and 378C. This graph illustrates the relative expression of LMSK, and it was calculated from target

protein (LMSK) expression from the total protein of expression in the SDS-PAGE. LBO, Luria Bertani omitted NaCl;

NBO, nutrient broth omitted NaCl; GYO, glucose yeast extract omitted NaCl.




with native SK, the LMSK showed higher zone ofclearance. This showed LMSK has more biologicalactivity than the unmodified SK. The plasminogenactivities of modified and unmodified SK werecalculated against the standard SK procured fromCadila, and they were determined as 75,734 IU/mgand 132,730 IU/mg, respectively (Figures 7, 8).LMSK has shown much higher stability at 378C com-pared with the native SK for about 9 hours with anactivity of 132,621 IU/mg. Furthermore, the throm-bolytic activity was confirmed by heated plasma agarplate assay. From this assay, it was concluded thatthe LMSK had higher thrombolytic activity thannative SK (Figure 9).

DISCUSSION

SK, a 47 kDa monomeric multidomain protein pro-duced by several b hemolytic strains of Streptococci isknown to be an inexpensive and valuable medicationfor thrombolysis, which binds and activates humanplasminogen.26 SK continues to be the only widelyused fibrinolytic agent in all developing countries forthe past 2 decades in the treatment of acute myocardialinfarction27 over its counterparts like urokinase, whichis less effective than SK and owing to the high cost oftissue plasminogen activator, which is 10 folds higherthan SK.

Although various methods are available for therecombinant production of SK, the strategies for over-expression and purification are constantly being mod-ified. Efforts were made for expressing the SK fromE. coli, Bacillus subtilis, Saccharomyces cerevisiae, Pichiapastoris, and Schizosaccharomyces pombe, but the prob-lems of high glycosylation and degradation of proteinSK were observed.28,29 Despite all these attempts, thereis still a lot of research going on to improve the clotspecificity and enhance the productivity and biologicalactivity of SK.

In the present study, we made an attempt to lipidifythe SK for enhancing its stability and activity. Thetechnique of lipid modification renders the amphi-pathic property to a protein molecule and provideshydrophobic anchorage.14 Using the pRSET-B vector,the nonlipoprotein molecule is converted to a lipopro-tein molecule. It is a pUC-derived vector, which isused for high-level heterologous protein expression.The vector is modified by fusing the Shigella apyrasesignal sequence with mature skc gene, which resultedin obtaining clones of LMSK.

Expression studies were performed for the recombi-nant clone of LMSK in 2 different E. coli strains such asBL21 (DE3) and GJ1158 in various media at different

FIGURE 4. SDS-PAGE analysis of recombinant SK LMSK

by cell fractionation at 308C. Lane 1: protein marker; lane

2: induced WCL of LMSK; lane 3: induced WCL of LMSK;

lane 4: periplasmic fraction; lane 5: cytoplasmic fraction;

and lane 6: membrane fraction. The expression of the

48.5 kDa protein (modified SK) is indicated by an arrow.

WCL, whole cell lysate.

FIGURE 5. The activity of periplasmic, cytoplasmic, and

membrane fraction of LMSK. About 5 mg of total protein

was used to measure the activity after 8 hours of incu-

bation at 378C.

6 Suthakaran et al



ambient temperatures. From the expression profile, itwas observed that characteristic expression was foundin the LMSK construct in all the media. It was alsoobserved that the GJ1158 strain in LBON medium at308C showed higher expression, whereas in all othermedia and temperatures of both BL21 (DE3) andGJ1158 showed similar level of expression. These re-sults are in compliance with earlier reports, whichclearly say that GJ1158 showed more expression thanBL21 (DE3) and is found to be highly economical.14,26

Based on the mobility differences in Tricine SDS-PAGE, lipid modification of SK was confirmedinitially. Furthermore, cell fractionation studies areperformed by 10% SDS-PAGE, where 48.5 kDa SK

was found only in the membrane fraction but not inthe cytoplasm or periplasmic fraction. This clearly in-dicates that SK was targeted to the membrane by mod-ified apyrase signal sequence. Also, radiolabelingassay was performed, where the radioactivity wascounted to be 129 cpm, which copiously proves thatpalmitate has been incorporated, and the protein hasundergone lipid modification. Finally, the thrombo-lytic (biological activity) activity was performed forboth native and LMSKs, where LMSK showed higherzone of clearance indicating higher activity than thenative SK in both caseinolytic and heated plasma agar

Table 1. Confirmation of lipid modification of SK by

radiolabeling study.

S. No. OD

Scintillation counting (cpm)

LM vector pRSETBSK LMSK

1 0.5 36 37 93

2 0.4 30 37 129

At particular OD, the culture containing LMSK was incubated

with (9,10 1H3) palmitate for 20 minutes and induced with

0.3M NaCl. The desired protein band was excised from SDS-

PAGE by KCl staining. After drying, the radioactivity was mea-

sured in scintillation counter.

FIGURE 7. Comparative biological activity study of

native and LMSK. Two micrograms of native and LMSK

were loaded in (assay plate) well 1 and well 2, respec-

tively. After 6 hours of incubation at 378C, the zone of

clearance was observed to be more in LMSK.

FIGURE 8. The activity kinetics of native and LMSK.

About 2 mg of purified protein of native and modified

(LMSK) streptokinase were used to analyze the activity

at different incubation time point from 3–11 hours.

FIGURE 6. Mobility shift of LMSK in Tricine SDS-PAGE

(15%). Lane 1: protein marker; lane 2: vector control; lane

3: induced SK (native); and lane 4–5 induced LMSK. The

difference between native and LMSK protein is indicated

by an arrow.




plate assays. This heated plasma agar plate assay isa more specific and accurate method for determiningthe thrombolytic activity.30 The present study clearlyreflects the enhanced stability of SK.

Lipoproteins have a wider biological significancethan simply that in lipid transport. The property oflipid modification contributes to some of the signifi-cant functions in the localization and function of theproteins. Lipid modification by palmitoylation helps inprotein association with membranes, protein traffick-ing, and also recently it has been accepted as a regula-tor of protein stability as a quality control check point.Palmitoylation is also involved in regulating proteindegradation with respect to protein stability, whichcontributes to its therapeutic potentiality.31 Lipopro-tein drug transport within the systemic circulation isconsidered as a possible mechanism of delivery ofhydrophobic drugs to specific tissue sites. Enhancedlipoprotein drug transport using lipid-based formula-tions may provide improved efficacy and safety of thecompounds. Furthermore, this potentially modifies thepharmacokinetics, tissue distribution, and pharmaco-logical behavior of the compounds.14

The developed economic process of producing LMSKfrom a salt inducible system can be considered for fur-ther analysis to work at the level of BBB. Stroke ortumors cannot be treated easily as the BBB membraneprevents the unregulated passage of many moleculesinto the brain from circulation.32 So, lipid-modifieddrugs may help to overcome the problems because ofthe property that the water-soluble drugs cannot pene-trate the BBB, whereas the lipid-soluble drugs do so.Previous reports show that high lipid solubility hasshown to allow passage of some of the moleculesacross the BBB. Hence, the outcome of this study for

the first time pointed to SK, as LMSK with enhancedbioactivity would have chances to exploit in variedclinical applications.

CONCLUSIONS

Lipid modification is gaining huge importance com-mercially and biologically in several applicationsbecause of the modification of protein properties, with-out affecting its conformation or folding. This novelprotein engineering biotechnological tool is widely ex-ploited for many purposes like vaccine development,biosensors, enzyme-linked immunosorbent assay, andtargeted drug delivery by liposomal integrations andothers. SK is selected here for modification, as it isregarded as more effective therapeutics for treatingclot disorders. Modification of molecule is performedby fusion of lipoprotein signal sequence to N-terminalcysteine residue of SK. The obtained modified SKshows a scope in using for various medical applica-tions because of its enhanced properties like stabilityand activity.

ACKNOWLEDGMENTS

The authors would like to express their sincere grati-tude to Dr V. Murugan who had helped them by hisconstant support and encouragement that enabledthem to complete this study. The authors also thankDr Sankaran, Director, Centre for Biotechnology, AnnaUniversity, Chennai, India, for the facilities provided forperforming their research experiments. P. Suthakaranwas a recipient of fellowships from the UGC in Engi-neering and Technology, India.

REFERENCES

1. Malke H, Ferretti JJ. Streptokinase: cloning, expression andexcretion by Escherichia coli. Proc Natl Acad Sci U S A. 1984;81:3557–3561.

2. Sherry S, Marder VJ. Streptokinase and recombinant tis-sue plasminogen activator (rt-PA) are equally effective intreating acute myocardial infarction. Ann Intern Med.1991;114:417–423.

3. Bajaj AP, Castellino FJ. Activation of human plasmino-gen by equimolar levels of streptokinase. J Biol Chem.1977;252:492–498.

4. Castellino FJ. Recent advances in the chemistry of thefibrinolytic system. Chem Rev. 1981;81:431–446.

5. Banerjee A, Chisti Y, Banerjee UC. Streptokinase a clini-cally useful thrombolytic agent. Biotechnol Adv. 2004;22:287–307.

FIGURE 9. Comparative analysis by heated plasma agar

plate assay. About 2 mg of purified LMSK and native SK

were used for heated plasma agar plate assay and incu-

bated for overnight at 378C, and the zone of clearance

was observed to be more in LMSK.

8 Suthakaran et al



6. Yadav S, Aneja R, Kumar P, et al. Identification throughcombinatorial random and rational mutagenesis ofa substrate-interacting exosite in the g domain of strepto-kinase. J Biol Chem. 2011;286:6458–6469.

7. Joshi KK, Nanda JS, Kumar P, Sahni G. Biochim BiophysActa. 2012;1842:326–333.

8. Braun V, Rehn K. Chemical characterization, spatial distri-bution and function of alipoprotein (murein-lipoprotein) ofthe E. coli cell wall. The specific effect of trypsin on themembrane structure. Eur J Biochem. 1969;10:426–438.

9. Hantke K, Braun V. Covalent binding of lipid to protein.Eur J Biochem. 1973;34:284–296.

10. Madan Babu M, Sankaran K. DOLOP-database of bacte-rial lipoproteins. Bioinformatics. 2002;18:641–643.

11. Sankaran K, Wu C. Lipid modification of bacterial pro-lipoprotein. J Biol Chem. 1994;269:19701–19706.

12. Hayashi S, Wu HC. ‘Lipoproteins in bacteria’. J BioenergBiomembr. 1990;22:451–471.

13. Kamalakannan S, Murugan V, Jagannadham MV, et al.Bacterial lipid modification of proteins for novel proteinengineering applications. Protein Eng Des Select. 2004;17:721–729.

14. Banerjee S, Bhat MA. Neuron-glial interactions in blood-brain barrier formation Annu Rev Neurosci. 2007;30:235–258.

15. Frankenheim J, Brown RM. Bioavailability of drugs to thebrain and the blood-brain barrier. Research Monograph.1992;120:92–1910. DHHS publication number (ADM).

16. Misra A, Ganesh S, Shahiwala A. Drug delivery to thecentral nervous system: a review. J Pharm Pharm Sci.2003;6:252–273.

17. Juillerat-Jeanneret L. The targeted delivery of cancerdrugs across the blood-brain barrier: chemical modifica-tions of drugs or drug-nanoparticles? Drug Discov Today.2008;13. doi:10.1016/j.drudis.2008.09.005.1099-1106.

18. Bhargava T, Datta S, Ramachandran V, et al. VirulentShigella codes for a soluble apyrase: identification, char-acterization and cloning of the gene. Current Science.1995;68:293–300.

19. Reinhard G. Approaches to transport therapeutic drugsacross the blood- brain barrier to treat brain diseases.Neurobiol Dis. 2010;37:48–57.

20. Bhandari P, Gowrishankar J. An Escherichia coli hoststrain useful for efficient overproduction of cloned geneproducts with NaCl as the inducer. J Bacteriol. 1997;179:4403–4406.

21. Makrides SC. Strategies for achieving high-level expres-sion of genes in Escherichia coli. Microbiol Rev. 1996;60:512–538.

22. Schlesinger MJ. Lipid Modification of Proteins. Boca Raton,FL: CRC Press; 1993.

23. Strom MS, Nunn DN, Lory S. A single bifunctionalenzyme, PilD, catalyzes cleavage and N-methylation ofproteins belonging to the type IV pilin family. Proc NatlAcad Sci U S A. 1993;90:2404–2408.

24. Shruthi H, Anand P, Murugan V, et al. Twin argininetranslocase pathway and fast-folding lipoprotein biosyn-thesis in E. coli: interesting implications and applications.Mol Biosyst. 2010;6:999–1007.

25. Pulicherla KK, Krishna Satya A, Rekha VPB, et al. Stud-ies on cloning and economic production of recombinantStreptokinase in a novel osmotically inducible E. coliGJ1158. Int J Biomed Eng Technol. 2010;4:29–39.

26. Sikri N, Bardia A. “A history of streptokinase use in acutemyocardial infarction”. Tex Heart Inst J. 2007;34:318–327.

27. Kumar R, Singh J. Expression and secretion of a prokary-otic protein streptokinase without glycosylation and deg-radation in Schizosaccharomyces pombe. Yeast. 2004;21:1343–1358.

28. Pimienta E, Ayala JC, Rodriguez C, et al. Recombinantproduction of streptokinase by streptomyces lividans.Microb Cell Fact. 2007;6:20.

29. Jackson KW, Esmon N, Tang J. Streptokinase and staph-ylokinase. Methods Enzymol. 1981;80:387.

30. Nadolski MJ, Linder ME. Protein lipidation. FEBS J. 2007;274:5202–5210.

31. Wasan KM, Cassidy SM. Role of plasma lipoproteins inmodifying the biological activity of hydrophobic drugs.J Pharm Sci. 1998;87:411–424.

32. Kamalakkannan S, Murugan V, Sankaran K. Bacteriallipid modification of proteins and its potential applica-tions. Bioforum Europe Trends Techn Life Sci Res. 2005;9:44–46.




http://dx.doi.org/10.1016/j.drudis.2008.09.005.1099-1106

Date post:	11-Jan-2017
Category:	Documents
Upload:	krishna-kanth
View:	214 times
Download:	1 times

Studies on Lipidification of Streptokinase

Documents