STUDIES ON VARIABILITY AND MANAGEMENT OF Alternaria … · STUDIES ON VARIABILITY AND MANAGEMENT OF...

STUDIES ON VARIABILITY AND MANAGEMENT OF Alternaria spp. CAUSING LEAF BLIGHT OF COTTON

Thesis submitted to the University of Agricultural Sciences, Dharwad

In partial fulfillment of the requirements for the Degree of

Master of Science (Agriculture)

in

Plant Pathology

By

SANGEETHA K. D.

DEPARTMENT OF PLANT PATHOLOGY COLLEGE OF AGRICULTURE, DHARWAD

UNIVERSITY OF AGRICULTURAL SCIENCES, DHARWAD – 580 005

JUNE, 2014

ADVISORY COMMITTEE

DHARWAD

JUNE, 2014 (S. A. ASHTAPUTRE)

CHAIRMAN Approved by: Chairman:

Members: 1.

2.

3.

(M. S. L. RAO)

(RAJESH S. PATIL)

(K. N. PAWAR)

(S. A. ASHTAPUTRE)

CONTENTS

Sl. No. Chapter Particulars

CERTIFICATE

ACKNOWLEDGEMENT

LIST OF TABLES

LIST OF FIGURES

LIST OF PLATES

LIST OF APPENDICES

1. INTRODUCTION

2. REVIEW OF LITERATURE

2.1 Survey for Alternaria blight in the major parts of northern Karnataka

2.2 Study of physiological and biochemical changes due to the disease

2.3 Variability studies in different isolates of Alternaria spp.

2.4 Evaluation of new molecules of fungicides against Alternaria blight

3. MATERIAL AND METHODS

3.1 General laboratory procedure


3.3 Collection and isolation of Alternaria spp.




3.7 Statistical analysis

4. EXPERIMENTAL RESULTS





5. DISCUSSION





6. SUMMARY AND CONCLUSIONS

REFERENCES

APPENDICES

LIST OF TABLES

Table No.

Title

1a. Survey for the severity of leaf blight of cotton during kharif 2013 in different parts of northern Karnataka

1b. Mean per cent disease index of Alternaria blight during survey (district and taluka-wise)

1c. Mean per cent disease index of Alternaria blight at different crop stages during survey

1d. Mean per cent disease index of Alternaria blight in different genotypes during survey

2. Effect of Alternaria leaf blight on chlorophyll 'a' content in Bt and non-Bt genotypes of cotton

3. Effect of Alternaria leaf blight on chlorophyll 'b' content in Bt and non-Bt genotypes of cotton

4. Effect of Alternaria leaf blight on total chlorophyll content in Bt and non-Bt genotypes of cotton

5. Effect of Alternaria leaf blight on total phenol content in Bt and non-Bt genotypes of cotton

6. Effect of Alternaria leaf blight on total sugar content in Bt and non-Bt genotypes of cotton

7. Effect of Alternaria leaf blight on reducing sugar content in Bt and non-Bt genotypes of cotton

8. Effect of Alternaria leaf blight on non-reducing sugar content in Bt and non-Bt genotypes of cotton

9. Effect of Alternaria leaf blight on gossypol content in Bt and non-Bt genotypes of cotton

10a. Morphological variability of isolates of Alternaria spp.

10b. Morphological variability of isolates of Alternaria spp.

11. Effect of incubation period on dry mycelial weight of Alternaria macrospora

12. Cultural variability of growth and sporulation of ten isolates of Alternaria spp. on different solid media

13a. Cultural variability of ten isolates of Alternaria spp. with respect to colony colour

13b. Cultural variability of ten isolates of Alternaria spp. with respect to colony margin colour

13c. Cultural variability of ten isolates of Alternaria spp. with respect to type of margin

13d. Cultural variability of ten isolates of Alternaria spp. with respect to mycelial growth

13e. Cultural variability of ten isolates of Alternaria spp. with respect to sectoring

14. Genetic sequences of isolates

15. In-vitro evaluation of fungicides in inhibiting mycelial growth of Alternaria macrospora

16. Efficacy of fungicides against Alternaria leaf blight of cotton

LIST OF FIGURES

Figure No.

Title

1. Survey for severity of Alternaria blight in cotton

2a. Mean per cent disease index of Alternaria leaf blight in different districts of northern Karnataka during kharif 2013

2b. Mean per cent disease index of Alternaria leaf blight in different talukas of northern Karnataka during kharif 2013

3. Effect of Alternaria leaf blight on chlorophyll 'a' content in Bt and non-Bt genotypes of cotton

4. Effect of Alternaria leaf blight on chlorophyll 'b' content in Bt and non-Bt genotypes of cotton

5. Effect of Alternaria leaf blight on total chlorophyll content in Bt and non-Bt genotypes of cotton

6. Effect of Alternaria leaf blight on total phenol content in Bt and non-Bt genotypes of cotton

7. Effect of Alternaria leaf blight on total sugar content in Bt and non-Bt genotypes of cotton

8. Effect of Alternaria leaf blight on reducing sugar content in Bt and non-Bt genotypes of cotton

9. Effect of Alternaria leaf blight on non reducing sugar content in Bt and non-Bt genotypes of cotton

10. Effect of Alternaria leaf blight on gossypol content in Bt and non-Bt genotypes of cotton

11. Effect of incubation period on dry mycelial weight of Alternaria macrospora

12. Cultural variability among the ten isolates of Alternaria spp. on different solid media

13. Phylogenetic relationship based on ITS rDNA among isolates of Alternaria spp.

14. In-vitro evaluation of fungicides in inhibiting mycelial growth of Alternaria macrospora

15. Efficacy of fungicides against Alternaria leaf blight of cotton

LIST OF PLATES

Plate No.

Title

1. Symptoms of Alternaria leaf blight of cotton

2. Survey for disease severity of Alternaria leaf blight of cotton

3. Pathogenicity studies

4. Growth of ten isolates of Alternaria spp. on PDA

5. Morphological variability of ten isolates of Alternaria spp.

6. Cultural variability among the ten isolates of Alternaria spp.on different solid media

7. PCR amplification of ten isolates of Alternaria spp. by using ITS-1 and 4

8. Amplification of ten isolates of Alternaria spp. by using AmF and AmR primer

9. Amplification of isolates of Alternaria spp. by using Aa F2 and Aa F3 primer

10. In vitro evaluation of different fungicides

11. In vivo evaluation of new molecules against Alternaria leaf blight

LIST OF APPENDICES

Appendix No.

Title

I. Rainfall data at Agricultural Research Station, Dharwad Farm, Dharwad, Karnataka

II. Cost of fungicides

INTRODUCTION

Cotton is one of the most ancient and important commercial crops next only to food grains and is the principal raw material for a flourishing textile industry. Cotton, although under pressure from synthetic fibers, has made a resurgence worldwide and remains as the most improved crop species producing lint plus oil and meal from seed (Nosberger et al., 2001).

From time immemorial, India is the only country known for its cotton fabrics, the rest of the world being clad mostly in wool, flax and silk. This was particularly from Asiatic Gossypium arboreum and Gossypium herbaceum, which were indigenous to India. From 1500 BC to 1700 AD, India was recognized as the cradle of cotton industry. India is the original home of domestication, diversification and development of the Asiatic cultivated cottons representing Gossypium herbaceum L. and Gossypium arboreum L. Cotton enjoyed a pride of place among cash crops from the earliest times. Cotton finds mention in the Rig Veda and Manu's Dharma Shashtra (Narayanan et al., 2002).

Cotton is the backbone of our sprawling textile industry contributing 7.00 per cent to our gross domestic product (GDP), fetching an export earning besides providing employment in the production, promotion, processing and trade. It accounts for 45 per cent of the world fiber and supplies 10 per cent of the world edible oil (Rathore, 2005).

Cotton plays a significant role in various aspects of the economy of the major developing countries. In India, no crop can compete with cotton for value addition and processing (Hitchings, 1984). Presently, India is considered as the centre of origin along with Peru and all four cultivated species of cotton are grown in India. The quality of Indian cotton is very high, absorbent, durable, extremely fine, lustrous and soft.

The Gossypium includes 50 species, four of which are cultivated, fourty four are wild diploids and two are wild tetraploids (Percival and Kohel, 1990). Out of the four cultivated species, Gossypium hirsutum L. and Gossypium barbadense L. commonly called as new world cottons, are tetraploids (2n = 4x = 52). Whereas, G. herbaceum L. and G. arboreum L. are diploids (2n = 2x = 26) and are commonly called as old world cottons. Cotton is grown in varied or diverse agro climatic conditions, varying from 8-32° N latitude and 70-80° longitude in 3 areas, viz., Northern, Central and Southern zones of India.

Cotton production is crucial to the economics of many developing countries in Africa, Asia and Latin America, where it makes major contribution to foreign exchange earning. The economic importance is mainly from its fiber. The lint is universally used as textile raw material. Cotton seed is the second most important source of vegetable oil and the cotton seed cake is the rich source of high quality protein for animal feed or with careful processing, for human food. Cotton seed contains 24 per cent protein, the main component of cotton seed cake forms about 47 per cent of products of the oil and is used for ruminant animals and as fertilizers. The oil constitutes about 15 per cent of the cotton seed and is used for manufacturing margarine, shortening, edible oil and other food products. It is also used in manufacturing industrial products such as soap and paints. The hull forms about 40 per cent of the seed and is used mainly as fertilizers or roughage in stock feed.

There has also been a manifold improvement in production, productivity and quality with virtual increase in area. India has the largest cotton area of 11.61 million hectares with a production of 33.4 million bales and a productivity of 489 kg/ha. Karnataka state has an area of 5.16 lakh hectares and a production of 12 lakh bales with a productivity of 572 kg/ha (Anon., 2012).

India accounts for 33 per cent (10.7 mha) of world cotton area and 22 per cent (5.4 mt) of world cotton production. In India, about 70 per cent area is covered by hybrids, 20 per cent by upland varieties and 10 per cent by diploid cultivars (Anon., 2011). The Egyptian cotton is cultivated in a very little area (2%) in few pockets of Tamil Nadu and Andhra Pradesh. The G. herbaceum is confined to two states, Gujarat and Karnataka. Two species viz., G. hirsutum and G. arboreum are cultivated in all the cotton growing states in India.

Despite the promising scenario in cotton, several factors are responsible for reduction in yield and quality deterioration of cotton in India. Diseases form a vital factor. The low productivity of cotton in Karnataka is attributed to many factors, one of which is the losses due to diseases, although insect pests continue to be a major production constraint. A large number of fungal, bacterial, viral and nematode diseases have been reported on cotton crop right from early stage to maturity. Among them, the economically most important ones are bacterial blight, Alternaria leaf spot, grey mildew, rust and vascular wilts which occur throughout the world (Kotasthane and Agrawal, 1970). Alternaria leaf

blight and other leaf spotting fungi pose an alarming situation (Gholve et al., 2012). In India, leaf spot of cotton (Alternaria macrospora Zimm,) was reported firstly by Uppal et al. (1935), from Bombay and later Rane and Patel (1956), reported it from Pune and Ahmednagar. Dastur et al. (1960) however observed it later in large scale and subsequently, many researchers recorded its occurrence from various provinces of India (Padmanaban and Narayanasamy, 1976; Chopra and Sharma, 1975). Bashi et al. (1983) reported that epidemics of Alternaria leaf spot in Israel decreased the yield of Pima-S-5 by 25 per cent. Vasudeva (1960) reported that disease was serious on three cotton varieties of G. hirsutum, the other cultivated species of Gossypium being resistant. Alternaria blight (A. macrospora) has been reported to cause about 20-30 per cent losses in seed cotton yield (Srinivasan, 1994; Chauhan et al, 1997; Mayee and Mukewar, 2007).

A study conducted by a team of cotton experts from the government has noted that Bt cotton hybrids are susceptible to diseases like bacterial blight, Alternaria leaf spot and grey mildew. Bacterial blight, Alternaria leaf spot and grey mildew were the major diseases on cotton identified in the central and southern parts of the country in 2004 (Ashok, 2005).

The comparative study on the incidence of diseases on Bt and non-Bt cotton carried out by the All India Coordinated Cotton Improvement Project (AICCIP) revealed that both Bt and non-Bt cotton hybrids are equally susceptible to bacterial blight, Alternaria leaf spot and grey mildew. However, the outbreak of Alternaria leaf blight and grey mildew disease in Central and South zones was very significant, especially in hybrids such as Bunny and certain Bt hybrids (Anon., 2005). Similarly, an incidence of 18.26 per cent para wilt, 16.71 per cent boll rot and 12.32 per cent grey mildew were noticed in Naigaon and Nanded during 2003-04 on MECH-184 Bt cotton in addition to the presence of Alternaria leaf spot and bacterial blight (Sharma et al., 2005).

However, the production potential of the crop has not been fully exploited due to several biotic and abiotic factors. The crop suffers from many fungal diseases, of which foliar diseases take a heavy toll and among the diseases, Alternaria leaf spot causes yield losses up to 26 per cent (Chattannavar et al., 2006). So, there is a further need to conduct the survey in major growing areas of northern Karnataka to identify the hot spots.

Plant derivatives possessing pesticidal properties are evoking worldwide interest as an alternative or as supplements to the existing pesticides for several reasons (Toriyama, 1972). Integration of chemicals, plant extracts and abiotic agents along with resistance for managing plant diseases has been considered as a novel approach (Papavizas, 1973).

There is an urgent need for optimization of spray schedule for management of the most destructive pathogen Alternaria spp. There is a need to understand different aspects of Alternaria spp. with respect to its morphological, physiological, pathogenic and genetic variability since not much work has been done on these aspects in the past. In addition, it helps in comprehensive understanding of the causal organism.

Keeping these points in view, the present investigation was under taken to study the variability and management of Alternaria leaf blight of cotton caused by Alternaria macrospora with the following objectives.

1. Survey for Alternaria blight in the major parts of northern Karnataka.

2. Study of physiological and biochemical changes due to the disease.

3. Variability studies in different isolates of Alternaria spp.

4. Evaluation of new molecules of fungicides against Alternaria blight.

REVIEW OF LITERATURE

Cotton (Gossypium spp.), is a premier commercial crop in India. Alternaria leaf blight of cotton caused by Alternaria macrospora Zimm, is one of the major foliar diseases occurring in all parts of the world, wherever cotton is grown. The studies with respect to survey, biochemical changes, variability and its management are taken into consideration while reviewing the literature. Accordingly, the literature pertaining to the above aspects is presented hereunder.

Symptomatology

Alternaria leaf spot

Small, dull to dark brown, circular or irregular shaped spots appear on leaf varying in diameter from 0.5 to 10 mm. They often develop concentric rings and represent a target board like appearance which is better defined on the upper surface. When mature they have dry, grey centres which may crack and even drop. The spots may coalesce and occupy large area of the leaf (Watkins, 1981).

Gulhane and Gurjar (2011) describes the symptom of Alternaria leaf blight as small, pale to brown, round or irregular spots measuring 0.5 - 3 mm in diameter and cracked centers appears on the affected leaves of the plant. Affected leaves become dry and fall off. The disease may cause cankers on the stem. The infection spreads to the bolls and finally falls off.

Etiology

Alternaria leaf spot

Four species of Alternaria viz., A. alternata (Fr.) Keissler, A. gossypiana (Thum.) Hopk, A. gossypium (Thum.) Hopk and A. macrospora Zimm. have been reported to cause leaf and twig blight of cotton (Jones, 1928 and Ling and Juhwa, 1941). The leaf spot is more often attributed to A. macrospora Zimm. However, in Zimbabwe, Hopkins (1931) concluded that although A. macrospora was present in the crop, the more important leaf spot pathogen was an Alternaria species which unlike A. macrospora producing conidia in chains, but with spore dimension outside the range accepted for A. alternata, Hopkins described this species as A. gossypiana (Thum.) Hopkins.

Based on the material collected in Southern and Central Africa, which is available in the herbarium collected at the International Mycological Institute, David (1988) has retained this description. Raut (1990) said about association of different species of Alternaria on cotton. Alternaria macrospora and A. gossypiana were found to be aggressive, attacking all the stages of crop growth manifesting in seed rot, damping off, seedling blight, mummification of bolls etc., while, other two species of Alternaria were weak and secondary parasites.

The average mycelial width of A. macrospora ranged from 3.0 to 3.40 µm. The size of conidia ranged from 20.81-56.23 x 9.2- 27.10 µm with 1 to 6 transverse and 0 to 4 longitudinal septa (Jadhav et al., 2011).

Morphology and biology

The causative agents of Alternaria Leaf Spot of Cotton (Macrosporium Leaf Spot) are fungi, Alternaria gossypii and A. macrospora which are developing only in anamorphic stages. Mycelium of A. gossypii is dark brown. Conidiophores are brown, single or in groups. Conidia are light-brown, 22-

27 x 9-11 µm in size. They affect cotyledons of seedlings, bolls and their fiber. Mycelium of A. macrospora is dark-brown. Conidiophores are light brown, single or in groups. Conidia are red-brown,

90-180 x 15-22 µm in size. They affect leaves, bracts in seedlings, adult plants and bolls. The causative agents cause necrosis on cotyledons, leaves, and bolls of cotton in form of dark-green and then brown, rounded or various shaped spots with clearly expressed zonality. At high humidity, light pink or dark conidial sporulation appears on necrotic spots. Affected boll fiber is brownish-red. Systematic position of the causative agents of cotton alternariosis and macrosporiosis is sometimes considered indistinct; they may represent one or two different species. Sources of the infection are affected crop residues, seeds, and also weeds. Additional vectors of the infection are aphids parasitizing cotton plants.


Rane and Patel (1956) noticed for the first time Alternaria leaf spot of cotton at transitional belt of Dharwad. The disease was also observed from Poona and Ahmednagar district on Co-4-B-40 cotton variety. Bhaskaran and Shanmugam (1973) stated that the leaf spot disease of cotton caused by A. macrospora has been noticed on large scale on hirsutum cottons around Coimbatore.

A roving survey conducted by Harlapur et al. (2004) in farmers fields during 2002-03 for cotton disease problems in Ghataprabha Left Bank Canal Command Area Region of Karnataka, revealed the prevalence of disease, namely Alternaria leaf blight, grey mildew and bacterial blight, during different crop growth periods. The severe incidence of Alternaria leaf blight and grey mildew was noticed during August to September and October to November months, respectively. Bacterial leaf blight severity was noticed during September to October.

The maximum severity of Alternaria leaf spot was 50.00 and 58.88 per cent during 2005-06 and 2006-07 in Erapura, Raichur on Bunny Bt and in Kolur, Bellary on Encounter-Bt (KCH-135Bt) respectively. In non-Bt cotton, maximum severity of 47.00 per cent was noticed in Yadgiri, Gulbarga district on cv. Bhagya (Ramegowda, 2007).

Several Alternaria spp. are known to cause diseases of cotton throughout the world, however, these species are usually considered as weak pathogens of upland cotton (Gossypium hirsutum L.). Alternaria macrospora and A. alternata are the predominant species experienced in the Southwestern United States. During the 2006 growing season, there was an increased report in foliar diseases throughout the high plains of Texas. Significant reductions in yield and quality were observed within infected areas compared to healthy non-infected areas, resulting in a lower value and subsequently a $ 296/acre reduction in overall crop value (Woodward et al., 2007).

A survey was conducted by Hosagoudar et al. (2008) in areas of Dharwad, Haveri, Belgaum, Bagalkot, Gadag, Bellary, Raichur and Gulbarga districts of North Karnataka. The results indicated that grey mildew was high in Dharwad, Haveri, Belgaum and Gadag districts. It also indicated that Alternaria blight was recorded in all eight districts. The highest incidence in Dharwad district was observed at ARS, Dharwad farm and Main Agricultural Research Station, Dharwad. Bacterial blight was recorded only in Dharwad district.

A survey conducted by Chattannavar et al. (2009) in Dharwad, Haveri, Belgaum, Gadag and Gulbarga districts of Karnataka revealed that Grey mildew was present in all cotton cultivated areas and disease incidence ranged from 5 to 30 per cent and was more pronounced in Dharwad, Haveri and Gadag. The next disease was both Alternaria blight and Verticilliun wilt which ranged from 5 to 40 per cent and these were most prevalent in Dharwad and Gulbarga districts. The Bacterial blight and Fusarium wilt were the least in order.

Alternaria blight was recorded in all the six districts of northern Karnataka. The incidence of Alternaria blight in Dharwad district was observed at ARS, Dharwad Farm and Shiraguppi, Nalavadi recorded thirty and ten per cent of Alternaria blight disease incidence respectively (Chattannavar et al., 2011).

Survey work conducted during 2010-11 and 2011-12 by Hosagoudar (2012) revealed that the disease was found in severe form in all the districts during kharif 2010-11 and disease severity ranged from 5.42 to 32.16 per cent in different parts of the districts surveyed. During kharif 2011-12, the disease severity ranged from 8.75 to 28.42 per cent in different parts of the districts surveyed.

A survey carried out during kharif 2012 revealed the incidence of the Alternaria leaf blight of cotton in Dharwad, Gadag, Koppal, Haveri, Belgaum, Bagalkot, Bijapur, Yadgiri, Bellary, Raichur and Gulbarga districts of northern Karnataka. The maximum per cent disease index of Alternaria blight was recorded in Belgaum (35.05) followed by, Bellary (31.54) and Raichur (29.49) district (Anil, 2013).


Ever since Walker and Link (1935) related the high level of protocatechuicacid in the outer scales of onion to its resistance to smudge, various workers have reported and related certain biochemical contents and/or changes to the mechanism of the resistance (Kirkham, 1957; Horsfall and Diamond, 1957; Wood, 1972).

2.2.1 Chlorophyll content

Photosynthesis is a process of trapping the radiant energy and converting it into stable chemical potential by synthesizing organic compounds. Photosynthesis involves a series of complex reactions that result in the conversion of radiant energy into chemical energy. Chlorophyll, xanthophylls and Carotenes are the leaf pigments which are involved in photosynthesis.

Among these pigments, chlorophyll is the major pigment, which traps the radiant energy and converts it into chemical energy. Any alterations in the content of these pigments will in turn affect the photosynthesis. Photosynthesis can be directly affected by plant pathogens, because many organisms induce chlorosis, indicating an effect of the chloroplast and/or the chlorophyll content of the plant.

Patel and Vaishnav (1987) reported that there was loss in chlorophyll content in groundnut leaves infected by Puccinia arachidis Speg. as compared to healthy leaves. Kaur and Dhillon (1990) concluded that infection by C. personatum caused a decrease in total chlorophyll content.

Benagi (1995) and Ashtaputre (1992) studied the effect of late leaf-spot disease on chlorophyll content in groundnut varieties and reported substantial loss of chlorophyll in susceptible varieties than that in partially resistant varieties.

Nandagopal (1995) reported that wheat genotypes resistant to Erwinia havaiiensis contained more chlorophyll 'a', 'b' and total chlorophyll compared to susceptible genotypes.

Malli et al. (2000) studied the effect of development of mungbean yellow mosaic virus on biochemical constituents of mothbean genotypes. It was found that chlorophyll 'a' and 'b' content was more in susceptible genotypes than in resistant genotypes following mungbean yellow mosaic virus infection. However there was a significant decrease in the content of total chlorophyll with the increasing intensity of the disease.

2.2.2 Total phenol content

Plant tissues contain a large number of phenolic compounds. The most important of which are simple phenols, coumarine, most flavonoids, certain amino acids, prosthetic groups, some enzymes, plant pigments and complex derivatives such as lignins. Phenolic substances are known to participate in a number of physiological processes which are essential for growth and development, such as oxidation reduction reactions, lignification and stimulation as well as inhibition of auxin activity. Phenolic compounds occur in a variety of simple and complex forms. Simple phenols such as, cinnamic, coumarine, caffeic, protocatechuic, chlorogenic and quinic acid exhibit antimicrobial activities.

Infection in certain diseases is characterized by increased synthesis of certain precursors of phenolic compounds and oxidation products of phenolics, such as quinones which exhibit more toxicity to microorganisms than their reduced forms. Positive correlation between the amount of phenolic content and degree of resistance to plant disease has been evidenced by several workers.

It has been frequently observed that phenol accumulation takes place in all the infected plant tissues but more rapid accumulation of phenolics takes place in incompatible host pathogen complex than in the compatible ones (Kiraly and Farkas, 1962).

Tomiyama (1963) reported that the accumulation of phenolics in diseased plants was a common phenomenon observed in many host pathogen interactions. The increase in phenolics concentration might arise from the release of phenol from their glucosides by the enzyme glucosidase of their host or pathogen (Pridham, 1965).

Bhatia et al. (1972) concluded from their studies that the ability of tomato plants to resist infection caused by Alternaria solani (ELL and Mart) Jones and Grout depend on the quantity of phenolics in the leaf, stem and roots of the plants. Higher amounts of total phenolics and orthodihydroxy phenolics were found in the resistant variety than in the susceptible variety.

Bhullar et al. (1972) determined the post-infectional level in both resistant and susceptible variety of chilli infected by early blight. In general, a higher inherent phenolic level was observed in the tissues of resistant variety than in those of the susceptible one. An increase in phenolic content was observed in the inoculated plants of both the varieties over the control.

Bashan (1986) showed that healthy cotton seedlings, stems had a lower phenolic content, but resistant plants had an all together relatively higher phenolic content than susceptible plants. Further, they observed that, in cotton plants infected with A. macrospora, phenolics were oxidized by polyphenol oxidase rather than peroxidase and catalase.

Hosagoudar et al. (2008) carried out biochemical studies on Laxmi, Abhadita, DCH-32 and RCH-2 Bt, JKCH-1 Bt, JKCH-2 Bt, of non-Bt and Bt genotypes of cotton, respectively. All were found susceptible to Alternaria blight. Results indicated that non-Bt genotypes recorded high amount of total protein as compared to Bt genotypes, but recorded lower total phenol and reducing sugar compared to Bt genotypes. In infected plants, decrease in total protein, total sugar and reducing sugar was more.

Biochemical studies were carried out by Hosagoudar et al. (2010) on non-Bt and Bt genotypes. High amount of protein was recorded in non-Bt genotypes but lower amount of total phenol, total sugar and reducing sugar was recorded. In early stage, high amount of non-reducing sugar and low amount at later stage were observed in non-Bt genotypes. Further there was decrease in total protein, total phenol, reducing sugar and non-reducing sugar in infected leaves.

2.2.3 Sugars

Sugars are precursors for synthesis of phenols, phytoalexins, lignin and callose. Hence, they play an important role in defense mechanism of plants. In general, the infection by some pathogens bring changes in respiratory pathway and photosynthesis which are the vital processes taking place inside the plant leading to wide fluctuations in sugars (Farkas and Kiraly, 1962; Kuc, 1966 and Klement and Goodman, 1967).

Horsfall and Diamond (1957) assigned a major role for sugars in disease resistance. They classified the diseases as high sugar diseases and low sugar diseases. Low sugar diseases occur severely when host sugar content is low and high sugar diseases occur when host sugar content is high.

The disease reaction has been correlated with the sugar level in different crop plants. Generally high levels of total sugars, reducing sugars and non-reducing sugars in the host plant are stated to be responsible for disease resistance (Bateman and Millar, 1966 and Jayapal and Mahadevan, 1968).

Gupta et al. (1984) stated that the sugars were maximum in resistant cultivars than in susceptible cultivars of mustard against Alternaria leaf blight. They also reported that, there was decrease in sugars due to infection both in resistant and susceptible cultivars.

In Jayadhar cotton variety, higher level of total sugars, reducing sugars, total phenols and amino acids were observed in both infected top and bottom leaves by Savanur (1984).

The total, reducing and non-reducing sugars were more in resistant cultivars than in the susceptible cultivars of chickpea as influenced by Alternaria blight (Bhargava and Khare, 1988).

Kiran et al. (2003) revealed that culture filtrate of Alternaria brassicae (Berk) Sacc. caused greater accumulation of total soluble and reducing sugars in susceptible Brassica juncea cv. Kranthi than resistant Brassica napus cv. GSH-1 and RH-781 than Kranthi.

2.2.4 Gossypol

Bell and Stipanovic (1978) reported that the major antibiotic metabolites in cotton are condensed proanthocyanidins formed from (+) catechin and (+) gallocatechin, and terpinoid aldehydes formed from desoxyhemigossypol. These metabolites occur in specific cells or tissue of healthy plants, and the terpinoids are formed in different cells from the proanthocyanidins. Concentration of the metabolites increases under the stress of disease or pest invasion. The structure, quantity, and localization of constitutive and infection-induced host metabolites and the speed of their induced biosynthesis, in relation to the resistance of tissues and varieties to diseases and pests.

Chakrabarty et al. (2002) showed the ability of resistant plants of cotton to prevent greater loss in total sugar upon infection appeared important for resistance. He also reported that the induced rather than constitutive levels of total phenol, gossypol and flavones played crucial role in governing resistance in cotton cultivars to grey mildew and the magnitude of induction was invariably higher in

resistant lines than in the susceptible plants. Besides the ability of resistant plants to prevent greater loss in phenolics upon infection appeared important for resistance.


2.3.1 Morphological variability among the different isolates

Ling and Juhwa (1941) described the morphological characters of A. macrospora as : conidia brown, obclavate with 2 to 8 transverse and 0 to 5 longitudinal septa, constricted, at each septation, measured 69 - 168 × 8 – 25 µ with long hyaline filiform, septate beaks, conidiophores brown, septate,

non-branched, measured 21 – 124 × 4 -10 µ.

Conidiophores of Alternaria macrospora arise singly or in groups from infected leaf tissue. They are erect, simple straight or flexious, almost cylindrical or tapering towards the apex and septate. They are pale brown in colour, with several conidial scars and are 4-9 µm thick and upto 180 µm in length. Conidia are solitary or occasionally in chains of two, straight or curved, obclavate or with the body of the conidium ellipsoidal tapering to a narrow beak and equal in length or upto twice as long as body. They are reddish brown in colour, usually minutely verruculose, with four to nine transverse septa and several longitudinal septa (Ellis, 1971).

There is a considerable variation in conidial length and although most descriptions of the

fungus suggest a maximum length not exceeding 180 µm, conidia isolated directly from infected leaf tissue in Zimbabwe frequently reached 240 µm (Hillocks, 1991). The body of the mature conidium was 15-22 µm thick at the broadest part.

The conidia of A. alternata were formed in chains of upto several spores and are pale to golden brown in colour with upto eight transverse septa and several longitudinal septa (Ellis, 1971).

The conidia were smaller than those of A. macrospora, having an overall length of 20-63 µm and 9-18 µm in width. The beak was short, being not more than one-third of the total length.

The conidia of A. gossypina was described by David (1988) as dark brown, with upto nine

transverse and one or two longitudinal septa. They are 30-55 x 12-15 µm in size, excluding the beak, which was 9-52 µm long.

Fourteen isolates differ in their morphological features with respect to conidial length (11.54 –

21.10 x 8.84 – 10.31 µm to 41.92 – 70.38 x 11.01 – 12.18 µm), beak length of conidia (20.19 µm to 40.36 µm), septation (0-7 vertical and horizontal), mycelial width (2.87 to 6.95 µm), colony colour (light grey to blackish), growth (flat to raised) and poor (A2, A3 and A7) to excellent (A4, A6, A9, A12 and A13) sporulation. Fourteen isolates of the fungus showed variation on their growth. Maximum growth was noticed in isolate A6 and A13 (88.67 mm), which was on par with A4 (87.00 mm). The least growth was recorded in isolate A1 (74.33 mm). Excellent sporulation was recorded in A4, A6, A9, A12 and A13. Further, good sporulation was noticed in A5. The isolates A1, A8, A10, A11 and A14 showed moderate sporulation. On the contrary, isolates A2, A3 and A7 had poor sporulation on the same medium (Ramegowda, 2007).

Anil (2013) studied morphological variability among twelve isolates. The colony margin ranged from irregular to smooth, colour of margin was light grey (A1, A2, A6 and A8), whitish pink (A3, A10 and A12) and light brown (A4, A5, A7, A9 and A11), few isolates showed raised growth (A2, A3, A5, A7 A8, A10 and A14) and the rest other flat growth. The isolates A3, A4 and A6 showed excellent

sporulation as against A2 and A11 showing poor sporulation and mycelia width ranged from 1.99 µm to 0.92 µm.

Rajender et al. (2013) studied morphological characters of twenty-five isolates of Alternaria

helianthi. The range of average conidial length and width varied from 124.2 (Ah-23) to 158.4 µm (Ah-12) and from 30.7 (Ah-9) to 40.1 µm (Ah-25), respectively. The average septation was highest in isolate Ah-7 (8.9), while that was least in Ah-3 (6.0).

2.3.2 Cultural variability among the different isolates

2.3.2.1 Growth phase of Alternaria spp. on liquid media

Padmanabhan and Narayanaswamy (1977) reported that A. macrospora attained maximum growth after fourteen days of incubation in Czapeck’s Dox medium. Desai (1979) reported progressive increment in the growth of A. macrospora with its peak on the twelth day and decreased thereafter.

Mahabaleswarappa (1981) recorded that maximum growth of A. carthami was on the twelth day of inoculation.

Sandhya (1996) reported that A. alternata attained maximum growth after 16 days of incubation in Czapeck’s Dox medium. Kulkarni (1998) reported that A. solani attained maximum growth after 9

th and 7

th days of incubation in Richard’s and potato dextrose agar media respectively.

Arunakumara (2006) recorded maximum growth of Alternaria solani after nine days of incubation in potato dextrose broth.

Roopa (2012) recorded maximum dry mycelia weight (249.27 mg) of Alternaria solani after 9th

day of inocubation in potato dextrose broth.

2.3.2.2 Effect of different solid media on the growth of isolates of Alternaria spp.

Maximum growth of A. tenuissima (Kunze ex Pers.) Wiltshire and A. macrospora Zimm. was observed on the fourteenth day of incubation in PDA and Czapeck’s broth respectively (Hanumanthaiah, 1976). The two isolates of A. alternata obtained maximum growth in Richard’s broth followed by Czapeck’s (Dox’s) medium (Mathur and Sarbhoy, 1977).

Padmanaban and Narayanasamy (1977) recorded a good growth of A. macrospora in both host leaf extract and Czapeck’s solution. However, Desai (1979) recorded the best growth of A. macrospora in Richard’s medium although it grew fairly well on other media tested.

The fungus A. macrospora sporulated rapidly on PDA when first isolated but rapidly became non-sporulating when stored. Culture can be encouraged to resporulate by subjecting them to mechanical damage by scrapping off the mycelial and replating followed by exposure to light and low temperature (Shahin and Shepherd, 1979).

Chandrashekar and Ball (1980) reported that A. alternata (Fries) Keissler grew satisfactorily on most media, with maximum growth on two per cent malt extract agar. A. alternata appears to have similar requirement of temperature and humidity for infection and sporulation. Experiments conducted by Rotem et al. (1988) suggested that symptom expression was greatly enhanced by exposure of the fungus to sunlight after initial infection.

Rotem et al. (1989) investigated the effect of environmental variables on sporulation of A. macrospora on Pima SJ5. Lesion appeared in five to seven days and gradually expanded. Conidia were then produced on the necrotic tissue of the lesion to initiate the secondary infection cycle. Sporulation was greatly enhanced by exposure to light before a period of moist, dark conditions. Sporulation was more prolific when dew periods were interrupted by dry periods than under a regime of continuous wetting. Spore production occurred over a wide range of temperature but peak sporulation occurred at 30

o C on green leaves at 25-30

o C on chlorotic leaves and 20-30

o C on

necrotic leaves.

Shekharappa (1999) observed that the maximum radial growth of A. sesami in host leaf extract agar, but there was no significant difference between host leaf extract, potato dextrose agar and carrot extract agar media. The least growth was observed in Czapeck’s agar media. The fungus, A. alternata made maximum mycelial growth on Richard’s medium (Gaddanakeri and Srikant Kulkarni, 1998).

Prasad (2002) reported that out of four non-synthetic media and three synthetic media tested for the growth of A. solani after nine days, PDA supplemented with CaCO3 and Sabouraud’s agar were found to be the best media. The maximum growth of A. sesami on PDA and excellent sporulation on Sabouraud’s agar were reported by Savitha (2004). Nine solid media were used to study the growth and morphological characteristics of A. solani. Maximum growth was observed on PDA, followed by corn meal agar which may be attributed to complex nature of natural media supporting good fungal growth (Arunakumara, 2006).

Mesta (2006) reported that isolates Ah-5, Ah-6, Ah-7 and Ah-8 were found significantly superior than other isolates with respect to radial growth on carrot agar and potato dextrose agar and dry mycelial weight in carrot broth and potato dextrose broth.

Naik et al. (2006) showed that A. solani, the incitant of early blight of tomato sporulated profusely on PDA supplemented with CaCO3.

Among twenty-five isolates of Alternaria helianthi, six isolates (Ah-2, Ah-5, Ah-7, Ah-18, Ah-23 and Ah-25) showed circular growth pattern and the remaining isolates recorded irregular growth with

wavy margin. Variation in colony diameter varied from 21.0 mm (Ah-19) to 42.0 mm (Ah-24). Isolates Ah-2, Ah-12, Ah-21, Ah-24 and Ah-25 recorded abundant sporulation (>12 × 104 spores ml-1), isolates Ah-3, Ah-14 and Ah-18 showed scanty sporulation (< 4× 104 spores ml-1) while the remaining displayed moderate sporulation (Rajender et al., 2013).

2.3.3 Molecular variability among the different isolates

Rapid PCR assay based on amplification of sequence of internal transcribed spacer (ITS) region of rDNA or pathogenicity genes have been developed and used for detection of several plant pathogens (Henson and French, 1993).

Molecular approaches, mainly the polymerase chain reaction have been used widely as the tool for detection of fungal pathogens (Martin et al., 2000, Schaad and Frederick, 2002).

Advances in Biotechnology have intensified efforts in recent years to develop novel methods for detection and identification of plant pathogens. Nucleic acid has increasingly been used in recent years to develop diagnostic assay for plant pathogens (Ward et al., 2004).

Molecular techniques, if not alone, can be used in conjunction with classical methods where the latter approaches can at least narrow pathogen diagnosis to genus level. Once genus is narrowed by morphology, symptomatology, host-specificity, etc., then PCR can be used to differentiate species (Chakrabarty et al., 2007).


2.4.1 In vitro evaluation of fungicides

In in vitro evaluation of eight fungicides against A. alternata causing leaf blight of turmeric, Propiconazole (Tilt) was found to be superior in inhibiting the growth of the fungus while Ziram, a non systemic fungitoxicant found to be the best in inhibiting the growth of fungus (Mallikarjun, 1996).

Kamble et al. (2000) tested six fungicides against A. alternata under in vitro conditions. They reported that Mancozeb was highly effective in inhibiting the mycelial growth followed by Copper oxychloride and Iprodione at 1000, 2000 and 3800 ppm.

Surviliene and Dambrauskiene (2006) reported that the impact of different active ingredients of fungicides on the development of Alternaria species in vitro was estimated by using Azoxystrobin (Amistar 250 SC), Pyraclostrobin (Signum 334 WG), Trifloxystrobin (Zato 50 WG) and Tebuconazole (Folicur 250 EW). The growth colonies of micromycetes A. alternata (isolated from Thymus vulgaris, Leveisticum officinale), A. alternata, A. brassicae (isolated from Brassica oleracea convar. capitata var. alba) and A. dauci (isolated from Daucus carota) were tested on the PDA medium with additions of fungicides. All tested fungicides showed sufficient inhibitory activity on the growth of Alternaria spp. colonies, which decreased on average from 25-94 per cent over 21 days in comparison with the control.

Among the seed dressing fungicides, Iprodione + Carbendazim along with Captan (both at concentration of 0.3 and 0.2) were found superior as they recorded lower per cent infection and higher germination percentage and vigour index. In vitro evaluation of fungicides revealed that, Iprodione + Carbendazim and Mancozeb were effective combiproduct and non systemic fungicides. Difenconazole, Hexaconazole, Penconazole and Propiconazole were effective systemic fungicides. Propiconazole (0.1%) and Hexaconazole (0.1%) were found most effective in reducing the per cent disease index, getting the better seed and oil yields. The benefit cost ratio depicted that Propiconazole has given highest net returns over control (Mesta, 2006).

Ramegowda (2007) studied that Iprodione and Mancozeb among non-systemic fungicides and Tridemorph and Difenconazole among systemic fungicides were found to be the best in inhibiting the mycelial growth A. macrospora. Under field condition, Iprodione and Mancozeb at 0.2 per cent were most effective in reducing the disease severity and showed increased cotton yield. In terms of B:C ratio, mancozeb was supreme.

Arun Kumar (2008) studied that out of nine different fungicides tested in vitro, Propiconazole, Hexaconazole at all the concentration (0.1%, 0.2% and 0.3%) completely inhibited the mycelial growth of A. alternata.

2.4.2 In vivo evaluation of fungicides

Difenconazole @ 0.125 kg a.i./ha and Tebuconazole at 0.187 kg a.i./ha suppressed Alternaria leaf spot (A. macrospora) to a significant extent as compared to untreated plots and differences in yield of 15.6-39.0 per cent increase were significant in treated than the untreated plots (Shtienberg and Dreishpoun, 1991).

The efficacy of Iprodione and Mancozeb was reported by Ravichandra et al. (1994) against A. solani in tomato. The effectiveness of Mancozeb in controlling early blight of tomato was confirmed by Naveenkumar Singh et al. (2001).

The new chemical Folicur at 0.05 and 0.07 per cent was very effective against Alternaria blight and grey mildew followed by Copper oxychloride. Carbendazim and Wettable sulphur were effective only against grey mildew. Tebuconazole (Folicur) at 0.05 per cent and 0.07 per cent recorded the highest cotton yield (1586.92 and 1630.65 kg/ha, respectively) followed by Carbendazim (1484.04 kg/ha) and Copper oxychloride (1417.17 kg/ha) compared to only 1041.66 kg/ha in untreated control (Chattannavar et al., 2004).

A field experiment was conducted during kharif season to evaluate fungicides, Taqat 500 g per ha, Taqat 750 g per ha and propiconazole @ 0.1 per cent were effective in controlling the foliar diseases. Maximum yield of 2287.45 kg per hectare was recorded in Taqat 750 g per ha (Chattannavar et al., 2010).

A field experiment was carried out to know the effect of chemical sprays on foliar diseases, Alternaria leaf spot, bacterial leaf blight and grey mildew of cotton. Results revealed that all the chemicals significantly reduced foliar diseases of cotton as compared to untreated control under field condition. The significantly lowest PDI of 8.85 and 8.91 was found in treatment, Propiconazole (0.1%) and Taqat 750 g per ha, respectively (Lakhtaria et al., 2011).

In chemical management of Alternaria blight of cotton, nine chemical fungicides were used, of which Propineb @ 0.2% showed best disease control and high yield in field condition. Next best were Difenconazole and Penconazole (Anil, 2013).

The fungicides were evaluated under field conditions during 2010-2011 and 2011-2012. Two years pooled results revealed that seed treatment (ST) with Vitavax power (0.3%) + foliar spray (FS) of Propiconazole (0.1%) significantly lowered Alternaria leaf spot per cent disease index (5.54) with maximum yield of 2777.39 kg/ha which was on par with ST with Vitavax power (0.3%) + FS of Tebuconazole (0.1%) (6.92 PDI) (2685.80 kg/ha) followed by ST with Vitavax power (0.3%) + FS of Hexaconazole (0.1%) (8.47 PDI) (2554.02 kg/ha). However, the ST with Vitavax power (0.3%) + FS of Hexaconazole (0.1%) recorded highest incremental benefit:cost of 5.24 followed by ST with Vitavax power (0.3%) + FS of Propiconazole (0.1%) of 4.46 remained as next best fungicide (Hosagoudar and Chattannavar, 2014).

MATERIAL AND METHODS

The research work of the present investigation was carried out in the laboratory at both, Agricultural Research Station, Dharwad Farm and Department of Plant Pathology, College of Agriculture, University of Agricultural Sciences, Dharwad during 2013. The field experiments were also carried out at Agricultural Research Station, Dharwad Farm, in deep black soil. The research farm is situated at an altitude of 675 meters from mean sea level and latitude of 15°2' N, longitude of 76°6' E. Data over 67 years revealed an annual rainfall of 759.06 mm over an average of 96 rainy days. But the year 2013 received annual rainfall of 738.3 mm.

3.1 General laboratory procedure

3.1.1 Glassware cleaning

For all laboratory experimental studies, Borosil and Corning glassware were used. The glassware were kept for 24 hours in the cleaning solution containing 60.0 g of potassium dichromate, 60.0 ml of concentrated sulphuric acid in 1000 ml of water. They were washed with detergent solution followed by rinsing with tap water and finally with distilled water.

3.1.2 Sterilization

All glassware used in the studies were sterilized in an autoclave at 1.1 kg / cm2 pressure for

20 minutes and kept in hot air oven at 60oC for two hours. Both solid and liquid media were sterilized

at 1.1 kg / cm2 pressure for 15 minutes.


A roving survey was carried out during 2013 to know the incidence of Alternaria blight of cotton in major growing areas of North Karnataka viz., Dharwad, Gadag, Haveri, Belgaum, Bagalkot and Davangere districts, to assess the per cent disease index of Alternaria leaf blight in farmers’ fields and research farms.

Fields were selected randomly in a village on the survey route. In each field, plants were selected at random and the incidence and severity of the disease were recorded. The per cent disease incidence was assessed by counting the number of plants showing Alternaria blight. The incidence of Alternaria leaf blight was recorded by using 0 - 4 scale (Sheo Raj, 1988).

Grade Per cent leaf area covered (%) Reaction

0 0 Immune

1 0-10 Resistant

2 11-20 Moderately resistant

3 21-40 Moderately susceptible

4 >40 Susceptible

The recorded grades were converted into per cent disease index (PDI) by using the formula given by Wheeler (1969).

Per cent disease index

(PDI) =

Sum of numerical ratings x 100 Total number of leaves observed x maximum disease score

3.3 Collection and isolation of Alternaria spp.

Leaves of cotton infected by Alternaria spp. with typical dark brown, circular to irregular spots were collected from different cotton growing areas and Alternaria spp. were isolated from these infected leaves by standard tissue isolation technique in the laboratory.

3.3.1 Single spore isolation

Ten milli litre of clear, filtered two per cent water agar was poured into sterile petriplates and allowed to solidify. Dilute spore suspension was prepared in sterilized distilled water from 15 days old culture. One milli litre of such suspension was spread uniformly on agar plate. These plates were incubated at 27 ± 1

oC for 12 hrs. Then such plates were examined under microscope to locate single

isolated and germinated conidium and marked with ink on the surface of the plates. The growing

hyphal tip portion was transferred to PDA slants with the help of cork borer under aseptic conditions and incubated at 27 ± 1

oC. These culture tubes were used for further studies.

3.3.2 Proving the pathogenicity

Cotton seeds of hybrid Bunny Bt, were surface sterilized with 0.1 per cent Sodium hypochlorite and sown in earthen pots containing sterilized soil. They were allowed to grow for a month. Prior to inoculation, the plants were exposed to 95 per cent humidity for 24 hours. Thereafter, they were inoculated with spore suspension of (5.4 x 10

6 spores/ ml) the fungus, by using atomizer.

After inoculation, the plants were exposed in the same conditions for 24 hours. Suitable control plants were maintained by spraying of sterile distilled water. After the symptom expression, the organism was re-isolated from these artificially infected leaves and the culture obtained was compared with the original culture for confirmation.

3.3.3 Maintenance of the culture

The fungus was sub cultured on Potato Dextrose Agar (PDA) slants and allowed to grow at 27 ± 1

oC for 15 days. These slants were then preserved in the refrigerator at 5

oC and sub-cultured

once in two months. This pure culture was used for further studies.


Selection of test entries

In order to study the biochemical factors responsible for resistance to Alternaria blight of cotton caused by Alternaria macrospora Zimm., three each of Bt and non-Bt genotypes were selected. Among them, Jayadhar, Abhadita and DCH-32 were the non-Bt genotypes, RCH-2 Bt, MRC-7351 Bt and Bunny Bt were the Bt genotypes.

Sampling of leaves

Biochemical analysis was done at an interval of 90 and 120 DAS. Bt and non-Bt cotton sampling was done during morning hours. For sampling, five plants were selected at random. The top three healthy and diseased leaves were chosen for the purpose of biochemical analysis. The leaves were then transferred to polythene bags separately and carried to the laboratory in an ice box containing ice cubes to prevent any denaturation of enzymes.


About 100 mg of healthy and infected leaf sample of Bt and non-Bt genotypes was collected from the field. The chlorophyll was extracted in Dimethyl sulfoxide (DMSO) as described by Hiscos and Israelstan (1979). The leaf samples was placed in a test tube containing 7 ml DMSO and incubated at room temperature for 24 hours. The extracted liquid was transferred to graduated test tubes and volume was made up to 10 ml with DMSO. About 3 ml sample of chlorophyll extract was transferred to cuvette and OD values were read at 645, 652 and 663 nm along with DMSO blank in the spectrophotometer and chlorophyll content was calculated as per the formula of Arnon (1949) given below.

Total chlorophyll= (20.2 X A645 + 8.02 x A663) x V

X 1

1000 Fresh weight (mg/g)

Chlorophyll ‘a’= (12.7 X A663 - 2.69A645) x V

X 1

1000 Fresh weight (mg/g)

Chlorophyll ‘b’ = (22.9 X A645 - 14.5 X A663) x V

X 1

1000 Fresh weight (mg/g) where, A645 = Absorbance of extract at 645 nm

A663 = Absorbance of extract at 663 nm

V = Volume of the extract (10 ml)

W = Fresh weight of the sample (0.1g)

3.4.2 Total phenol content

Extraction of leaf material in alcohol

Five grams of leaf material was extracted in ethanol as per the procedure followed by Jaypal and Mahadevan (1968). The precipitate was removed by filtering the alcohol extract through Whatman No. 1 filter paper and the filtrate was made up to 25 ml with 80 per cent alcohol. Reducing sugars, non-reducing sugars, total sugars and phenols were estimated in alcohol extract of fresh healthy and diseased leaves.

The total phenols present in plant samples was estimated by following folin ciocalteau reagent method.

Reagents

1. Folin - ciocalteau reagent (FCR, 1%)

2. Sodium carbonate (2%)

Procedure

One ml each of alcoholic extract was taken in a test tube to which one ml of Folin ciocalteau reagent was added followed by two ml of sodium carbonate solution. The tubes were shaken well and heated in a hot water bath for exactly one minute and then cooled under running tap water. The content developed was diluted to 20 ml with distilled water and its absorbance was read at 650 nm in the spectrophotometer. The amount of phenols present in the sample was calculated from a standard curve prepared from catechol.

3.4.3 Sugars

Reducing sugars

The reducing sugar was estimated following Nelson's modification of Somogyi's method (Nelson, 1944).

Reagents

A. Alkaline copper reagent

Solution A:Twenty five gram of anhydrous sodium carbonate, 25 g of sodium potassium tartarate, 20 g of sodium bicarbonate and 200 g of sodium sulphate were dissolved in about 800 ml of distilled water and final volume was made up to one litre.

Solution B:Fifteen grams of copper sulphate was dissolved in distilled water and one or two drops of concentrated sulphuric acid was added and made up to 100 ml with distilled water.

Solution A and B were mixed in 24 :1 (v/v) proportion just before use.

B. Arsenomolybdate reagent

Twenty five gram of ammonium molybdate was dissolved in 450 ml of distilled water. 21 ml of concentrated sulphuric acid was added and mixed with the above solution. 2. 3 g of sodium orthoarsenate was dissolved in 25 ml of distilled water. The above two solutions were mixed by stirring and placed in an incubator at 37°C for 24-48 hr. The reagent was stored in brown bottle.

Procedure

One ml of each sample (alcoholic extract) was pipetted to a test tube. To each 1 ml of extract, 1 ml of mixture of solution A and B was added. The test tubes were heated on a hot water bath for 20 min. The tubes were then cooled under running tap water. After cooling 1 ml of arsenomolybdate reagent was added. The above solution was diluted to 15 ml after 15 min. The absorbance of the solution was measured in spectrophotometer at 510 nm. The amount of reducing sugars was determined by using standard curve prepared.

Acid hydrolysis of non-reducing sugar and its estimation as reducing sugar

Non-reducing sugar was first hydrolyzed with the help of diluted hydrochloric acid. The hydrolysate was neutralized and the reducing sugar was estimated by Nelson Somogyi's method (Nelson, 1944).

Reagents

1. 0.1 and 1 N hydrochloric acid and 1 N sodium hydroxide.

2. Phenolphthalein indicator solution in alcohol.

Procedure

One ml each of alcohol extract was taken in a test tube and to it 1 N HCl was added. The test tubes were kept on hot water bath at 50

0C for 20 minutes. After cooking, one drop of indicator was

added and mixed well. To the solution, 1 N sodium hydroxide was added drop wise till the colour turned pink due to excess alkali. The excess alkali was reneutralized with 0.1 N hydrochloric acid till the solution became colourless. Then the volume was made up to 5 ml. From this, 1 ml was taken and reducing sugar present in hydrolysate was estimated by Nelson - Somogyi's method. The reducing sugar in the hydrolysate was a measure of total sugar. To get the quantity of non-reducing sugar, the quantity of reducing sugar was subtracted from total sugar and it was multiplied by a conversion factor of 0.95.

3.4.4 Gossypol content

Reagents

1. Phloroglucinol reagent

2. Ethanol 95%

Sample preparation

Five gram of fresh tissue was cut into small pieces and plunged into 15-20 ml of boiling 95 per cent ethyl alcohol for 5 min, and the extract was collected by filtering. Repeat the extraction with residue and combine both, dilute the combined extract to 40 per cent using distilled water and adjust the extract with 1N HCl to pH 3. Mix the content with 1.5 volume of diethyl ether @ 10

0C. Using

separating funnel, save the ether phase and wash with two changes of distilled water. Evaporate the ethyl extract in vacuum to dryness and re-dissolve the residue in the known volume of 95 per cent ethanol.

Procedure

Pipette out the different aliquots (1 or 2 ml) of the gossypol extract into test tubes. Add 0.5 ml of phloroglucinol reagent followed by 1 ml of conc. HCl to each tube. Incubate for 30 min with occassional shaking at room temperature, make the volume up to 10 ml with 80 per cent ethanol and read the absorbance at 550 nm (Nelson, 1944).


The studies were carried out to know the variation in the pathogen of different areas causing leaf blight in cotton. Morphological, cultural and genomic variations were assessed among different isolates collected.

3.5.1 Morphological variability among the bdifferent isolates

Morphological characters such as length and width of conidia, number of horizontal and vertical septa and beak length were measured under 40x using DIC (Differential Image Contrast) microscope and the pathogen was cultured on Potato Dextrose Agar. All the above mentioned measurements were compared with the descriptions given by Ellis (1971) regarding Alternaria macrospora and Alternaria alternata for identification of Alternaria spp.

The composition and preparation of the PDA media was obtained from Ainsworth and Bisby’s “Dictionary of the Fungi” by Hawksworth et al. (1983).

The composition of the media is given below.

Potato Dextrose Agar (PDA)

Peeled potato 200 g

Dextrose 20 g

Agar-agar 20 g

Distilled water 1000 ml (volume to make up).

Two hundred grams of peeled potatoes were cut into small pieces and boiled in distilled water and the extract was cooled by filtering through muslin cloth. Dextrose 20.0g and agar 20.0g of each were dissolved in potato extract and the final volume was made upto 1000 ml with distilled water and sterilized as described earlier and preserved for further use.


3.5.2.1 Growth phase of Alternaria macrospora in liquid medium

Thirty ml of potato dextrose broth (PDB) was added into each of 150 ml conical flasks and sterilized. The growth of the fungus was studied at 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 and 30 days after inoculation. The flasks were then inoculated with 5 mm disc of Alternaria spp. from actively growing culture and incubated at 25 ± 2°C. Each treatment was replicated three times. Three flasks were harvested separately at a time, starting from the third day onwards upto 30

th day by

leaving a gap of 48 hours between the two successive harvests. The cultures were filtered through previously weighed Whatman No. 42 filter paper, which were dried to a constant temperature at 60°C in hot air oven prior to filtration. The mycelial mat on the filter paper was thoroughly washed with sterile distilled water to get rid of the salts likely to be associated with the mycelial mass.

The filter paper along with the mycelial mat was dried to a constant temperature at 60°C for 8 hr, cooled and weighed immediately on an analytical balance. The difference between final and initial weight of filter paper discs were taken as the weight of the mycelia. The data were analysed statistically.


The isolates collected were grown on various solid media to find the difference in colony characters among them.

1. Potato Dextrose Agar

2. Potato Carrot Agar

3. Czapeck's Dox Agar

4. Host Extract Agar

5. Oat Meal Agar

6. Corn Meal Agar

7. Sabouraud's Dextrose Agar

8. V-8 Juice Agar

The composition and preparation of the above mentioned synthetic and non-synthetic media were obtained from Ainsworth and Bisby’s "Dictionary of the fungi" (Hawksworth et al., 1983). The composition of the media is given below.

1) Potato dextrose agar (PDA)

In most of the experimental studies, the potato dextrose agar (PDA) was used. The composition of PDA is as follows.

Potato peeled 200 g

Dextrose 20 g

Agar-agar 20 g

Distilled water 1000 ml (volume to make up)

Two hundred gram of peeled potatoes were cut into small bits and boiled in distilled water and the extract was collected by filtering through muslin cloth. Dextrose 20.0 g and agar 20.0 g each were dissolved in the potato extract and the final volume was made upto 1000 ml with distilled water and sterilized as described earlier and preserved for further use.

2) Potato carrot agar (PCA)

Grated potato 20 g

Grated carrot 20 g

Agar agar 20 g


Grated vegetables were boiled for 1 hr. in distilled water. The mixture was strained through fine sieve to which agar agar was added. It was boiled over water bath till agar dissolved. It was then sterilized at 121°C for 15 minutes.

3) Czapeck’s dox agar (CDA)

Sucrose (C6H12O6) 30 g

Sodium nitrate (NaNO3) 20 g

Potassium dihydrogen phosphate (KH2PO4) 1.0 g

Magnesium sulphate (MgSO4. 2H2O) 0.5 g

Potassium chloride (KCl) 0.5 g

Ferric chloride (FeCl3. 6H2O) 0.01 g

Agar-agar 20 g


All the ingredients except agar agar were mixed in 500 ml water. Agar-agar was melted in 500 ml distilled water. The two solutions were mixed thoroughly and the volume was made up to 1000 ml and was sterilized.

4) Host Extract Agar (HEA)

Healthy cotton plant leaves 200 g

Dextrose 20 g

Agar-agar 20 g


Cotton plant leaves were boiled in 500 ml water for 30 min. Extract was collected by filtering through muslin cloth. The agar agar was melted in 500 ml water, both the solutions were mixed and the volume was made up to 1000 ml and was sterilized.

5) Oat Meal Agar (OMA)

Oat flakes 30 g

Agar-agar 20 g


Oat flakes were boiled in 500 ml distilled water for 30 min and filtered through muslin cloth. Agar agar was melted in 500 ml distilled water separately. Both the solutions were mixed thoroughly and the volume was made up to 1000 ml and was sterilized.

6) Corn Meal Agar (CMA)

Corn flakes 60 g

Agar agar 20 g


Sixty grams of dehydrated corn flakes were boiled for 15 min in 500 ml of distilled water and filtered. Twenty gram of agar agar was melted separately and both the solutions were mixed. The volume was made up to 1000 ml and sterilized at 121°C for 15 minutes.

7) Sabouraud’s Dextrose Agar (SDA)

Dextrose 40 g

Peptone 10 g

Agar-agar 20 g


All the ingredients except agar agar were dissolved one by one in 400 ml distilled water and agar was dissolved separately in 500 ml distilled water and mixed with the above solution and the volume was made up to 1000 ml before sterilization.

8) V-8 juice agar (V8JA)

V-8 Juice (100 ml) 8.30 g

L-Asparagine 10 g

Yeast extract 2 g

Calcium carbonate (CaCO3) 2 g

Glucose 2 g

Agar-agar 20 g


All the ingredients except agar agar were dissolved one by one in 400 ml distilled water and agar was dissolved separately in 500 ml distilled water and mixed with the above solution and the volume was made up to 1000 ml before sterilization.

Twenty ml of media (PDA) was poured into sterilized petriplates and kept for solidification. After solidification, 5 mm discs of the Alternaria spp. were cut using a cork borer and a single disc was placed on the slat. Each set of the experiment was replicated twice and the plates were incubated at 27 ± 1

o C for 12 days. After 15 days, the observation of diameter of radial growth, type of colony

margin, colour of margin, mycelial growth, sectoring and sporulation were recorded. The sporulation was graded as follows.

Sl. No.

Score Grade Description

No. of spores/microscopic field (10×)

1. ++++ Excellent sporulation > 30 spores/microscopic field

2. +++ Good sporulation 21-30 spores/microscopic field

3. ++ Moderate sporulation 11-20 spores/microscopic field

4. + Poor sporulation 1-10 spores/microscopic field

5. – No sporulation < 1 spores/microscopic field


DNA isolation

The mycelium collected from the cultures of Alternaria spp. after 5 days of incubation was used for DNA isolation. Total genomic DNA from fungal isolates were extracted by following CTAB (Cetyl Trimethyl Ammonium Bromide) method (Kollar et al., 1990).

Materials used

1. Extraction buffer - 4% CTAB

2. Chloroform:isoamylalcohol mix (24:1)

3. Isopropanol

4. 70 per cent alcohol

5. TBE buffer

6. Sterile double distilled water

7. Pestle and mortar

8. -700 C Freezer

9. 1.5 ml Autoclaved eppendorf tube

10. Vortex mixer

11. Water bath

12. Ultracentrifuge and microfuge

13. Incubator

14. Micropipetter and autoclaved microtips

15. Culture of Alternaria spp.

Procedure

• The cultures were scraped using a clean glass slide in to a pestle and mortar and then ground well using CTAB buffer

• Ground cultures were transferred to the 2ml sterilized microfuge tube

• 3 µl of proteinase-K was added

• The tubes were incubated at 650 C in a water bath for 15-20 min with gentle inversion

• Equal volume of phenol : chloroform :isoamylalcohol was added and mixed well by inverting the tubes.

• The contents were centrifuged at 6000 rpm for 20 min at 100C

• The supernatant was taken and to this 600 µl of chloroform:isoamylalcohol (24:1) was added and mixed well and inverted

• Centrifuged the tube at 6000 rpm for 20 min at 100C

• The supernatant was collected and equal volume of chilled Isopropanol was added and was kept overnight at -20

0 C or 1 hr at -70

0 C


• Decanted the supernatant and washed the pellets with 70% alcohol


• Decanted the centrifuge and the pellet was air dried until alcohol smell disappeared

• 50 µl TE buffer with RNase (20 mg/ml) was added to the air dried pellet and stored at - 200 C

• These estimates were confirmed by staining DNA with ethidium bromide after electrophoresis in 1 per cent agarose gel at 80 V for 1 hr. in TAE buffer (0.4 M Tris-acetate, 0.001 M EDTA, pH 8.0) using known DNA concentration standards (� DNA, uncut).

Polymerase Chain Reaction (PCR) amplification

PCR amplification of rDNA sequences for Alternaria spp. was conducted in 20 µl reaction volumes using following primers and the reaction mixture mentioned below.

Primers

Organism Primer code

Sequence Size of

amplified product

Universal fungus ITS

ITS1 5' TCC GTA GGT GAA CCT GCG G 3' 560 bp

ITS4 5' TCC TCC GCT TAT TGA TAT GC 3'

Alternaria macrospora

AmF 5’ CGGTACTACTGTCATCTTCG 3' 442 bp

AmR 5’ CTTACGGTACCTGAGTTGAC 3'

Alternaria alternata Aa F2 5' TGCAATCAGCGTCAGTAACAAAT 3'

320 bp Aa F3 5' ATGGATGCTAGACCTTTGCTGAT 3'

Reaction mixture

Reagents Volume/tube (µl) Template DNA 2

Taq assay buffer (10x) (with MgCl2) 2

dNTP mix 1

Forward Primer- F 1

Reverse Primer- R 1

Taq Polymerase 0.3

Sterile distilled water 12.7

Total 20

PCR programme for amplification of 16S rDNA

Step

Universal fungus ITS Alternaria macrospora Alternaria alternata

Temp (oC)

Duration (min)

Temp (oC)

Duration (min)

Temp (oC)

Duration (min)

Initial denaturation 94 4 94 5 94 2

Denaturation 94 1 94 1 94 30 sec

Annealing 55 1 55 3 55 30 sec

Extension 72 1 72 2 72 30 sec

Final extension 72 20 72 10 72 5

Hold 4 30 4 30 4 30

Number of cycles: Denaturation Annealing Extension

35

30

35

The PCR protocol was standardized to amplify rDNA sequences from a strain each of Alternaria spp. infecting cultivated species of Bt cotton. Negative controls were used to test for false

priming and amplification. A 10 µl PCR amplification product for each of the Alternaria species was visualized on a 1 per cent agarose gel and viewed under UV light following staining with ethidium bromide.


3.6.1 In vitro evaluation of fungicides

The efficacy of systemic fungicides and combi product fungicides earlier reported effective against Alternaria macrospora were evaluated in vitro by poisoned food technique (Nene and Thapliyal, 1993) and using PDA as basal medium. Both were evaluated at 0.05, 0.075 and 0.1 per cent concentrations. The details of the tested fungicides are given below.

Sl. No.

Common Name Trade Name

a.i. Formu lations

Chemical Name

Systemic

1 Hexaconazole Contaf 5 SC RS-2- (2, 4-D) -1- (1H-1, 2, 4 Trizole- 1-yl) hezan 2-ol

2 Tebuconazole Folicur 250 EC 1- (4-chlorophenol) -4.4diamethyle-3- (1, 2, 4-triazole-1-yl-methyle-pemtene-3-ol

3 Propiconazole Tilt 25 EC 1-[2- (2, 4-dichlorophenyl) pentyl]-1H-1, 2, 4-Triazole

4 Pyraclostrobin Headline 20 WG Methyl 2-[1- (4-chlorophenyl) pyrazol-3-yloxymethyl]-N-methoxycarbanilate

5 Trifloxystrobin Flint 50 WG Methyl (E) -methoxyimino-{ (E) -α- [1- (α, α, α-trifluoro-mtolyl) ethylideneaminooxy]-o tolyl}acetate

Combi products

6 Pyraclostrobin 5% Cabrio 60 WG MethylN-{2-[1-(4-chlorophenyl) pyrazol-3-yloxymethyl]phenyl} (N-methoxy)

+ Metiram 55% Top carbamate

7 Tebuconazole 50% + Trifloxystrobin 25%

Nativo 75 WG Methyl (E) -2-{2 [6- (2-cyanophenoxy) pyrimidin-4yloxy]phenyl}-3- (Methoxyacrylate) benzeneacetate

8 Carbendazim 25% + Mancozeb 50%

Sprint 75 WS Methyl 2 Benzimidazole carbomate 25 + Manganese ethylene bis

dithiocarbonate plus zinc50

9 Hexaconazole 4% + Zineb 68%

Avatar 72 WP RS-2- (2, 4-D) -1- (1H-1, 2, 4 Trizole-1-yl) hezan 2-ol 4 + Zineb 68

PDA medium was used as a basal medium for the fungicidal study. It was prepared in 250 ml conical flask. 100 ml medium was taken in each flask. The medium was then sterilized at 15 lbs vapour pressure for 15 minutes. Required quantity of test fungicides were calculated and added in the sterilized medium separately. Flasks containing poisoned medium were shaken well to ensure uniform distribution of the fungicides. About 20 ml of poisoned PDA was poured in each of the sterilized petriplates and allowed to solidify. The plates were inoculated by pure culture of Alternaria macrospora. For this purpose, 5 mm disc of one week old culture was cut with a sterilized cork borer. The disc was lifted and transferred aseptically in the centre of petriplates containing the medium with test fungicides. Three plates were maintained for each treatment. The control plates without fungicides were also inoculated and incubated at 27±1°C for 15 days. The diameter of the colony was measured when maximum growth in control plate was achieved. The per cent inhibition was calculated by using the formula of Vincent (1947).

C - T I = ----------- x 100 C

Where,

I- per cent inhibition.

C- Mycelial growth in control

T- Mycelial growth in treatment


A field experiment was conducted during kharif 2013 at Agricultural Research Station, Dharwad Farm in order to estimate the disease severity and losses in yield due to Alternaria leaf blight disease on cotton and to find out a suitable fungicide in controlling the disease at field level.

The details of the experiment are given below.

Design : Randomized Block Design

Plot size : 2.7 x 6 meters

Row spacing : 90 × 30 cm

Variety : Bunny Bt

Treatments : 11

Replications : Three

Date of sowing : 01-07-2013

Fertilizer dose : 80:40:40 NPK kg/ha

All other cultural and pest management practices were imposed as recommended in package of practices. The first spray of each treatment was initiated as soon as the first symptom of leaf spot was seen in the field and repeated at an interval of 15 days. The fungicides used are listed below.

Sl. No. Common Name Trade Name

a.i. Formu lations

Chemical Name

Systemic

1 Trifloxystrobin (0.1%)

Flint 50 WG

Methyl (E) -methoxyimino-{ (E) -α-[1- (α,α,α-trifluoro-m tolyl)

ethylideneaminooxy]-o tolyl}acetate

3 Pyraclostrobin (0.1%)

Headline 20 WG

Methyl 2-[1- (4-chlorophenyl) pyrazol-3-yloxymethyl]-N-methoxycarbanilate

5 Kresoxymethyl (0.1%)

Cygnus 50 WG

Methyl (E) -methoxyimino[α- (o tolyloxy) -o-tolyl]acetate

6 Tebuconazole (0.1%)

Folicur 250 EC

1- (4-chlorophenol) -4.4diamethyle-3- (1, 2, 4-triazole-1-yl-methyle-pemtene 3-ol

7 Propiconazole (0.1%)

Tilt 25 EC

1-[2- (2, 4-dichlorophenyl) pentyl]-1H-1, 2, 4- Triazole

9 Hexaconazole (0.1%)

Contaf 5 SC

RS-2- (2, 4-D) -1- (1H-1, 2, 4 Trizole-1-yl) hezan 2-ol

Combi products

2 Tebuconazole 50% + Trifloxystrobin 25% (0.1%)

Nativo 75 WG Methyl (E) -2-{2 [6- (2-cyanophenoxy) pyrimidin-4yloxy]phenyl}-3- (Methoxyacrylate) benzeneacetate

4 Pyraclostrobin 5% + Metiram 55% (0.1%)

Cabrio Top 60 WG MethylN-{2-[1-(4-chlorophenyl) yrazol-3-yloxymethyl]phenyl} (N-methoxy) carbamate

8 Carbendazim 12% + Mancozeb 63% (0.2%)

Saaf 75 WP Methyl 2 Benzimidazole carbomate 12 + Manganese ethylene bis dithiocarbonate plus zinc 63

Non systemic

10 Mancozeb (0.25%)

IndofilM-45 75 WP Manganese ethylene bis dithiocarbonate plus zinc

Five plants were selected randomly in each plot and observation on severity of the disease on the foliage (using 0-4 scale) was recorded under different treatments one day before each spray and 15 days after the final spray. The cotton yield in each treatment was recorded and the data were statistically analyzed.

3.7 Statistical analysis

Statistical analysis was carried out as per the procedures given by Panse and Sukhatme (1985). Actual data in percentage were converted to angular values, before analysis according to the table given by Snedecor and Cochran (1967).

EXPERIMENTAL RESULTS Alternaria blight is an important disease among the different foliar diseases of cotton causing

an yield loss up to 33.43 per cent. Alternaria leaf blight is caused by Alternaria spp. Hence the study was concentrated on variability of pathogen and management of Alternaria leaf blight of cotton during kharif 2013, at Agricultural Research Station, Dharwad Farm and Department of Plant Pathology, College of Agriculture, UAS, Dharwad. The results obtained are presented hereunder.

Diagnosis of the disease was done by looking into external symptoms produced by the pathogen in host viz., small, dull to dark brown, circular or irregular shaped spots appear, varying in diameter from 0.5 to 10 mm. At later stages, they often develop in concentric rings and represent a target board appearance which is better defined on the upper surface. On severity, they show dry, grey centres which may crack and even drop. The spots may coalesce and form patches, occupy large area of the leaf. Necrotic lesions appears even on stem, squares and bolls. The symptoms observed on different plant parts are depicted in Plate 1.


The roving survey was conducted to assess the severity of Alternaria leaf blight of cotton during kharif 2013 in major cotton growing areas of northern Karnataka viz., Dharwad, Haveri, Belgaum, Bagalkot, Gadag and Davangere. The survey for symptomatology, severity, distribution and spread was carried out at physiological maturity. The disease incidence was recorded by following 0-4 scale (Sheo Raj, 1988) and later expressed as per cent disease index and the data pertaining to survey work viz., village wise, taluka wise, crop stage wise and genotype wise disease severity has been presented in Table 1a, 1b, 1c and 1d, Fig 1 and Plate 2.

Among the six districts surveyed, maximum mean disease severity of Alternaria blight was recorded in Dharwad (17.63%) followed by Belgaum (15.17%), Davangere (13.50%) and Gadag (13.00%) districts whereas, minimum mean disease severity was recorded at Haveri (10.25%) district. The highest disease severity of Alternaria leaf blight was observed in fields of Timmapur (36.00%) village followed by 30.00 per cent at Chandanamatti and Agricultural Research Station, Dharwad Farm of Dharwad district. Whereas, least severity was recorded at Mallur (5.00%) village of Haveri district followed by Sulikeri (6.00%) of Bagalkot district.

In Dharwad district, the mean disease severity of 17.63 per cent was recorded and the incidence ranged from 7.00 per cent to 36.00 per cent in Ingalahalli and Timmapur respectively. In Belgaum district, the mean disease severity of 15.17 per cent was recorded and the incidence ranged from 7.00 per cent to 22.00 per cent in Chikkodi and Kolavi respectively. The survey in Haveri district, which included four villages from four talukas revealed that the mean disease severity was 10.25 per cent with the range of 5.00 per cent (Mallur) to 15.00 per cent (Haveri). The mean disease severity recorded in Gadag district was 13.00 per cent with the range of 12.00 per cent to 16.00 per cent in Bairavahatti and Gadag, respectively.

Seven villages were surveyed in Bagalkot district and the mean disease severity was 10.71 per cent and the highest disease incidence was noticed at Kulageri (17.00%) whereas least was observed at Sulikeri (6.00%). In Davangere district, the mean disease severity of 13.50 per cent was recorded and only two villages were surveyed with an incidence of 17.00 percent (Kandhankovi) and 10.00 per cent (Bennihalli).

The mean per cent disease index in rainfed and irrigated condition at taluka level depicts that the taluk showing least PDI was Savanur taluk (5.00) of Haveri district and highest PDI was observed in Gokak taluk (22.00) of Belgaum district.

Results of mean PDI of Alternaria blight at different crop stages irrespective of genotypes and areas surveyed revealed that the disease severity was more at boll initiation (20.00%) stage with a range of 10-36 followed by boll opening (18.33%) stage with a range of 7-30. Seedling stage recorded least mean PDI (11.17) with a range of 5-20.

The mean per cent disease index in different genotypes irrespective of crop stage and areas surveyed revealed that the genotypes, Bunny Bt and NAMCOT.612 recorded maximum mean PDI of 30.00 with a range of 28-32 followed by Mallika Bt (25.50) with a range of 15-36. Whereas least PDI (5.00) was recorded in Jakpot Bt with a range of 3-7.

Table 1a: Survey for the severity of leaf blight of cotton during kharif 2013 in different parts of northern Karnataka

Locations Genotypes/

Cultivars Rainfed (R)/ Irrigated (I)

Crop stage PDI (%)

Dharwad District

Dharwad Taluk

Timmapur Mallika Bt R Boll initiation 36 Tadkod Neeraj Bt R Seedling 12 Garag Dr. Brent Bt R Seedling 8 Somapur Dr. Brent Bt R Boll initiation 11 Amminbhavi MRC-7351 Bt R Boll initiation 23 Marewada MRC-7351 Bt R Boll initiation 14 Belavadi MRC-7351 Bt R Seedling 13 Anegola MRC-7351 Bt I Seedling 10 Chandanamatti NAMCOT 612 R Boll opening 30 Govankoppa MRC-7351 Bt I Boll initiation 26 Yaadvada Dr. Brent Bt R Boll opening 28 Mulamuttala MRC-7351 Bt R Boll initiation 25 UAS,Dharwad Chiranjeevi Bt R Boll opening 22 ARS, Dharwad Farm Bunny Bt R Boll opening 30

Kalghatagi Taluk

Gambyapura Arjun Bt R Boll initiation 20 Dummvada Arjun Bt R Boll initiation 10

Hubli Taluk

Ingalahalli Cash Bt R Flowering 7 Shirguppi Dr. Brent Bt R Boll formation 11 Bhandiwad Bullet Bt R Boll formation 15 Unkal Bullet Bt R Flowering 16 Yamanuru MRC-7351 Bt R Flowering 11 Nelavadgi Mallika Bt R Boll formation 15 Bhadrapura MRC-7351 Bt R Boll formation 17

Navalgund Taluk

Annigeri Dr. Brent Bt R Boll formation 13

District mean 17.63

Belgaum District

Chikkodi Taluk

Chikkodi Vikram-5 BG II R Seedling 7

Gokak Taluk

Kolavi Vikram-5 BG II R Flowering 22

Hukkeri Taluk

Yamkanmardi Neeraj Bt R Seedling 10

Contd…..

Locations Genotypes/

Cultivars Rainfed (R)/ Irrigated (I)

Crop stage PDI (%)

Parasgad Taluk

Karlakatti Brahma Bt R Boll initiation 19

Saundatti Taluk

Saundatti Dr. Brent Bt R Seedling 13

Mallur Chaitanya Bt I Seedling 20

District mean 15.17

Haveri District

Haveri Taluk

Haveri MRC-7351 Bt I Seedling 15

Savanur Taluk

Mallur Jakpot Bt R Seedling 5

Ranebennur Taluk

Lingadahalli Vikram-5 BG II R Seedling 11

Hirekerur Taluk

Yogikoppa MRC-7351 Bt R Seedling 10

District mean 10.25

Gadag District

Gadag Taluk

Gadag Neeraj Bt R Boll initiation 16 Lakkundi Brahma Bt R Boll formation 11 Bairanahatti Neeraj Bt R Boll formation 12

District mean 13.00

Bagalkot District

Badami Taluk

Kulageri Cash Bt R Boll formation 17 Sulikeri Brahma Bt R Boll formation 6 Katageri Cash Bt R Boll opening 10 Konkanakoppa Neeraj Bt R Boll formation 8 Badami Cash Bt R Boll opening 11 Chikkanesargi Brahma Bt R Boll opening 7 Belur Neeraj Bt R Boll formation 16

District mean 10.71

Davangere District

Jagalur Taluk

Jagalur MRC-7351 R Boll opening 17

Harapanahalli Taluk

Bennihalli MRC-7351 R Boll opening 10

District mean 13.50

Table 1b: Mean per cent disease index of Alternaria blight during survey (district and taluka-wise)

Sl. No. District Taluk Mean PDI (%)

Rainfed Irrigated Taluk District

1. Dharwad

Dharwad 21 18 19.5

17.63 Kalghatagi 15 - 15 Hubli 13.14 - 13.14 Navalgund 13 - 13

2. Belgaum

Chikkodi 7 - 7

15.17 Gokak 22 - 22 Hukkeri 10 - 10 Parasgad 19 - 19 Saundatti 13 20 16.5

3. Haveri

Haveri - 15 15

10.25 Savanur 5 - 5 Ranebennur 11 - 11 Hirekerur 10 - 10

4. Gadag Gadag 13 - 13 13 5. Bagalkot Badami 10.71 - 10.71 10.71

6. Davangere Jagalur 17 - 17

13.5 Harapanahalli 10 - 10

Table 1c: Mean per cent disease index of Alternaria blight at different crop stages during survey

Crop stage Range (PDI %) Mean (PDI %)

Seedling 5-20 11.17 Flowering 7-22 14.00

Boll initiation 10-36 20.00 Boll opening 7-30 18.33

Boll formation 6-17 12.80

Table 1d: Mean per cent disease index of Alternaria blight in different genotypes during survey

Genotypes Range (PDI %) Mean (PDI %)

Arjun Bt 10-20 15.00 Brahma Bt 6-19 10.75 Bullet Bt 15-16 15.50 Bunny Bt 28-32 30.00 Cash Bt 7-17 11.25

Chaitanya Bt 18-22 20.00 Chiranjeevi Bt 20-24 22.00 Dr. Brent Bt 8-28 14.00 Jakpot Bt 3-7 5.00 Mallika Bt 15-36 25.50

MRC-7351 Bt 10-26 15.09 NAMCOT.612 28-32 30.00

Neeraj Bt 8-16 12.80 Vikram-5 BG II 7-22 13.33

Fig 1: Survey for severity of Alternaria blight in cotton

Plate 1: Symptoms of Alternaria leaf blight of cotton

Plate 2: Survey for disease severity of Alternaria leaf blight of cotton

Collection, isolation and maintenance of culture

Samples were collected from the surveyed area and isolation was done from Bt cotton leaves showing typical symptoms of the disease. Standard tissue and single spore isolation methods were followed after surface disinfection as described in "Material and Methods". The pure culture of the fungus was obtained after eight days of inoculation which showed whitish growth at initial stage turning later to ash grey colour. Such pure culture obtained was again sub cultured in Potato Dextrose Agar (PDA) slants and kept in the refrigerator at 5°C for further studies.

Pathogenicity test

For proving pathogenicity, all the ten isolates were artificially inoculated on the leaves of Bt cotton plants as described in “Material and Methods”. After seven days of inoculation, the leaves exhibited initial symptoms of infection. Small, dull to dark brown, circular or irregularly shaped spots varying in diameter from 0.5 to 10 mm were observed. They developed concentric rings and presented a target board appearance which is better defined on the upper surface. The spots coalesced and occupied larger area of the leaf. The symptoms were photographed and are presented in Plate 3. The isolates were re-isolated and the morphological character of the reisolated organisms were compared with the original culture. Hence, the causal agents of the disease were confirmed as different Alternaria spp.


Infection by pathogen brings about lot of changes in respiratory pathway and photosynthesis which are the vital processes taking place in the plant leading to wider fluctuation in biochemical components. Studies on role of biochemical parameters in Bt and non-Bt cotton genotypes were carried out in order to know the factors responsible for resistance or susceptibility as described in "Material and Methods" and the results are presented hereunder.


Destruction of chlorophyll content in diseased leaves is a common feature that can be noticed both in Bt and non-Bt genotypes. The estimation of total chlorophyll content was carried out at 90 and 120 DAS in both healthy and diseased leaves. Chlorophyll 'a', chlorophyll 'b' and total chlorophyll content were estimated. Chlorophyll content was compared between the healthy and diseased leaves.

4.2.1.1 Chlorophyll 'a'

The results of chlorophyll 'a' content recorded at different crop growth stages of non-Bt and Bt cotton under the influence of A. macrospora are presented in Table 2. There was decrease in the chlorophyll 'a' content from 90 to 120 DAS. It was found that there was significant difference in the chlorophyll 'a' content in genotypes, type of leaf (healthy and diseased) and their interaction at both the stages of crop.

At 90 DAS, MRC-7351 Bt recorded maximum chlorophyll 'a' content in both healthy (3.736 mg/g fresh weight) and diseased condition (2.796 mg/g fresh weight) among Bt genotypes. Among non-Bt genotypes, DCH-32 recorded highest chlorophyll 'a' content in healthy (2.816 mg/g fresh weight), whereas Abhadita recorded maximum chlorophyll 'a' content in diseased condition (1.930 mg/g fresh weight).

Healthy genotypes recorded highest mean chlorophyll 'a' content (2.748 mg/g fresh weight) when compared with diseased genotypes (1.932 mg/g fresh weight). Nevertheless, the mean chlorophyll 'a' content of healthy genotypes differed significantly superior over the diseased genotypes, irrespective of the genotypes.

The per cent decrease in the mean reducing sugar content was more in the non-Bt genotypes, Abhadita, Jayadhar and DCH-32 (27.85%) than the Bt genotypes, Bunny Bt, MRC-7351 Bt and RCH-2 Bt in healthy, but also per cent decrease in the mean reducing sugar content in diseased condition (34.62%). In addition, there was decrease in the per cent mean chlorophyll 'a' content in the diseased condition whether the genotypes was non-Bt (33.65%) or Bt (26.79%).

Plate 3: Pathogenicity studies

Table 2: Effect of Alternaria leaf blight on chlorophyll 'a' content in Bt and non-Bt genotypes of cotton

Chlorophyll 'a' (mg/g fresh weight)

Genotypes

90 DAS 120 DAS

Healthy Diseased

Per cent decrease

over healthy

Healthy Diseased

Per cent decrease

over healthy

Bunny Bt 3.426 2.133 2.726 1.120

MRC-7351 Bt 3.736 2.796 2.933 1.070

RCH-2 Bt 2.413 2.083 1.506 1.093

Mean 3.192 2.337 26.79 2.388 1.094 54.19

Abhadita 2.243 1.930 1.590 1.153

Jayadhar 1.850 1.170 1.316 0.900

DCH-32 2.816 1.483 2.076 0.943

Mean 2.303 1.528 33.65 1.661 0.999 39.86

Per cent decrease over Bt

27.85 34.62 30.44 8.68

Grand mean 2.748 1.932 2.025 1.046

Source S. Em.± CD at 1% S. Em.± CD at 1%

Genotypes (G) 0.016 0.064 0.015 0.060

Diseased (D) 0.009 0.037 0.008 0.032

G x D 0.024 0.095 0.021 0.083

DAS – Days after sowing

At 120 DAS, MRC-7351 Bt recorded maximum chlorophyll 'a' content in healthy (2.933 mg/g fresh weight, respectively) and Abhadita recorded maximum chlorophyll 'a' content in diseased condition (1.153 mg/g fresh weight).

Diseased plants of six genotypes recorded mean minimum chlorophyll 'a'content (1.046 mg/g fresh weight) and significantly decreased over the mean reducing sugar content of healthy plants (2.025 mg/g fresh weight). Also, the per cent mean chlorophyll 'a' content decreased in non-Bt genotypes in both healthy (30.44%) and in diseased condition (8.68%). Further, the mean per cent of chlorophyll 'a' content decreased at diseased condition in both non-Bt (39.86%) and Bt genotypes (54.19%).

4.2.1.2 Chlorophyll 'b'

The results of chlorophyll 'b' content recorded at different crop growth stages of non-Bt and Bt cotton under the influence of A. macrospora are depicted in Table 3. There was decrease in the chlorophyll 'b' content from 90 to 120 DAS, both in healthy and diseased plants. It was also found that there was significant difference in the chlorophyll 'b' content among genotypes, type of leaf (healthy and diseased) and their interaction.

At 90 DAS, Bunny Bt recorded maximum chlorophyll 'b' content in healthy (1.883 mg/g of fresh weight) and MRC-7351 Bt in diseased condition (1.273 mg/g fresh weight) which resulted in significant differences over all the genotypes. Jayadhar recorded significantly least chlorophyll 'b' content in both healthy (0.990 mg/g fresh weight) and diseased condition (0.616 mg/g fresh weight).

Healthy genotypes recorded maximum mean chlorophyll 'b' content (1.417 mg/g fresh weight) when compared with diseased condition (0.967 mg/g fresh weight). Nevertheless, the mean non-reducing sugar content of healthy genotypes differed significantly superior over the diseased genotypes.

The per cent decrease in the mean chlorophyll 'b' content was more in the non-Bt genotypes in both healthy (23.21%) and diseased (33.13%) genotypes. In addition, decrease in the per cent mean chlorophyll 'b' content in the diseased condition was more in non-Bt (37.04%) compared to Bt genotypes (27.69%).

At 120 DAS, Bunny Bt recorded maximum chlorophyll 'b' content in both healthy (1.420 mg/g fresh weight) and diseased condition (0.610 mg/g fresh weight) and differed significantly superior over other genotypes. Least chlorophyll 'b' content was recorded in Jayadhar (0.536 mg/g fresh weight) in healthy and DCH-32 (0.423 mg/g fresh weight) in diseased condition. Diseased plants of six genotypes recorded mean minimum chlorophyll 'b' content (0.509 mg/g fresh weight) and differed significantly less over the mean chlorophyll 'b' content of healthy plants (0.997 mg/g fresh weight).

Also, the per cent mean chlorophyll 'b' content decreased in non-Bt genotypes in healthy (34.06%) and in diseased condition (17.89%). Further, the mean per cent of chlorophyll 'b' content decreased at diseased condition in both Bt (53.46%) and non-Bt genotypes (42.05%).

4.2.1.3 Total chlorophyll

The results of total chlorophyll content differed significantly as far as genotypes, type of leaf (healthy and diseased leaf) and their interaction were concerned at both the stages of crop (Table 4).

At 90 DAS, MRC-7351 Bt recorded maximum total chlorophyll content in both healthy and diseased condition (5.200 and 3.971 mg/g fresh weight) which was significantly superior over other Bt genotypes. Among non-Bt genotypes, DCH-32 recorded highest total chlorophyll content in healthy condition (4.362 mg/g fresh weight) whereas, in diseased condition, Abhadita recorded highest total chlorophyll content (2.899 mg/g fresh weight). Among the six genotypes, least total chlorophyll content was recorded in Jayadhar in both healthy and diseased condition (2.902 and 2.002 mg/g fresh weight, respectively).

All the genotypes under healthy recorded maximum mean total chlorophyll content (4.132 mg/g fresh weight) and differed significantly superior over diseased condition (2.970 mg/g fresh weight). The per cent decrease in the mean total chlorophyll content was more in the non-Bt genotypes than the Bt genotypes both at healthy (23.67%) and diseased (31.96%) condition, respectively. In addition, there was decrease in the per cent mean total chlorophyll content in the diseased condition irrespective of whether the genotypes was non-Bt (32.76%) or Bt (24.56%).

Table 3: Effect of Alternaria leaf blight on chlorophyll 'b' content in Bt and non-Bt genotypes of cotton

Chlorophyll 'b' (mg/g fresh weight)

Genotypes

90 DAS 120 DAS

Healthy Diseased

Per cent decrease

over healthy

Healthy Diseased

Per cent decrease

over healthy

Bunny Bt 1.883 1.140 1.420 0.610

MRC-7351 Bt 1.453 1.273 1.366 0.476

RCH-2 Bt 1.473 1.066 0.816 0.590

Mean 1.603 1.159 27.69 1.201 0.559 53.46

Abhadita 1.260 1.010 0.830 0.523

Jayadhar 0.990 0.616 0.536 0.430

DCH-32 1.443 0.700 1.010 0.423

Mean 1.230 0.775 37.04 0.792 0.459 42.05


23.21 33.13 34.06 17.89

Grand mean 1.417 0.967 0.997 0.509


Genotypes (G) 0.015 0.061 0.015 0.059

Diseased (D) 0.009 0.037 0.009 0.038

G x D 0.020 0.080 0.021 0.085


At 120 DAS, MRC-7351 Bt recorded maximum total chlorophyll content in healthy (4.412 mg/g fresh weight) and Abhadita in diseased condition (1.834 mg/g fresh weight) and differed significantly superior over other genotypes. Whereas Jayadhar recorded least total chlorophyll content in healthy (1.952 mg/g fresh weight) and DCH-32 in diseased (1.409 mg/g fresh weight) condition.

Diseased plants of six genotypes recorded mean minimum chlorophyll content (1.674 mg/g fresh weight) and decreased significantly over the mean total chlorophyll content of healthy plants (3.053 mg/g fresh weight). Also, the per cent decrease in mean total chlorophyll content was more in the non-Bt genotypes in both healthy (30.37%) and diseased condition (12.23%). Further, the mean per cent of total sugar content decreased at diseased condition in both Bt (50.45%) and non-Bt genotypes (37.55%).

4.2.2 Total phenol

The observations on total phenol content as influenced by Alternaria macrospora at different stages of crop growth in three non-Bt and three Bt genotypes is depicted in Table 5. The results revealed that there was an increasing trend in total phenol content from 90 to 120 DAS and differed significantly among genotypes, type of leaf (healthy and diseased) and their interaction at both the stages of crop.

At 90 DAS, RCH-2 Bt recorded maximum total phenol content in healthy (4.456 mg/g fresh weight) and Bunny Bt recorded maximum total phenol content in diseased condition (3.080 mg/g fresh weight) and there was significant difference over other genotypes. Whereas Jayadhar recorded least total phenol content in both healthy (2.660 mg/g fresh weight) and diseased (1.893 mg/g fresh weight) condition. Diseased plants of six genotypes recorded mean minimum phenol content (2.528 mg per g fresh weight) than healthy (3.568 mg/g fresh weight).

Also, there was decrease in per cent mean phenol content in non-Bt genotypes over Bt genotypes in both healthy (30.60%) and diseased condition (27.44%). Further, the mean per cent decrease in total phenol content over healthy was more in Bt (30.44%) compared to non-Bt genotypes (27.27%).

At 120 DAS, among Bt genotypes, RCH-2 Bt recorded highest total phenol content in healthy (5.136 mg/g fresh weight) and MRC-7351 Bt recorded the highest total phenol content in diseased condition (3.410 mg/g fresh weight) and differed significantly over other genotypes. Least total phenol content was recorded in Abhadita in healthy (4.023 mg/g fresh weight) and Jayadhar in diseased condition (2.090 mg/g fresh weight).

All the genotypes under healthy condition recorded maximum mean phenol content (4.519 mg/g fresh weight) and differed significantly over the diseased genotypes (2.774 mg/g fresh weight). The per cent decrease in the mean phenol content was more in the non-Bt genotypes in both healthy and diseased conditions (4.12% and 22.52%, respectively) than the Bt genotypes. Irrespective of non-Bt or Bt genotypes, there was decrease in phenol content in diseased condition. Among non-Bt genotypes, the mean per cent decrease in phenol content (45.25%) was more compared to Bt genotypes (32.25%).

4.2.3 Total sugar

The total sugar recorded at different crop growth stages of non-Bt and Bt genotypes under the influence of A. macrospora is presented in Table 6. The total sugar content decreased from 90 to 120 DAS. The differences due to genotypes, type of leaf (healthy and diseased) and their interaction was found significant at both the stages.

At 90 DAS, Bunny Bt recorded the maximum total sugar content in both healthy (9.300 mg/g fresh weight) and diseased (6.550 mg/g fresh weight) condition which was on par with RCH-2 Bt (9.263 mg/g fresh weight) under healthy condition. Among non-Bt genotypes, both Jayadhar and DCH-32 recorded the maximum total sugar content in healthy (9.003 mg/g fresh weight). Jayadhar recorded highest total sugar content (5.876 mg/g fresh weight) in diseased condition which showed significant difference among other non-Bt genotypes. Abhadita recorded significantly lowest total sugar in both healthy (7.503 mg/g fresh weight) and diseased condition (4.826 mg/g fresh weight).

Healthy genotypes recorded highest mean total sugar content (8.621 mg/g fresh weight) when compared to diseased genotypes (5.574 mg/g fresh weight). Nevertheless, the mean total sugar content of healthy genotypes was significantly superior over the diseased genotypes irrespective of whether the genotype is either Bt or non-Bt.

Table 4: Effect of Alternaria leaf blight on total chlorophyll content in Bt and non-Bt genotypes of cotton

Total Chlorophyll (mg/g fresh weight)

Genotypes

90 DAS 120 DAS

Healthy Diseased

Per cent decrease

over healthy

Healthy Diseased

Per cent decrease

over healthy

Bunny Bt 5.167 3.467 4.250 1.820 MRC-7351 Bt 5.200 3.971 4.412 1.735 RCH-2 Bt 3.690 3.168 2.129 1.795

Mean 4.686 3.535 24.56 3.599 1.783 50.45

Abhadita 3.467 2.899 2.522 1.834 Jayadhar 2.902 2.002 1.951 1.451 DCH-32 4.362 2.314 3.043 1.409

Mean 3.577 2.405 32.76 2.506 1.565 37.55


23.67 31.96 30.37 12.23

Grand mean 4.132 2.970 3.053 1.674


Genotypes (G) 0.011 0.042 0.011 0.042 Diseased (D) 0.007 0.027 0.006 0.025 G x D 0.013 0.052 0.016 0.065


Table 5: Effect of Alternaria leaf blight on total phenol content in Bt and non-Bt genotypes of cotton

Total phenol (mg/g fresh weight)

Genotypes

90 DAS 120 DAS

Healthy Diseased

Per cent decrease

over healthy

Healthy Diseased

Per cent decrease

over healthy


Mean 4.212 2.930 30.44 4.614 3.126 32.25


Mean 2.923 2.126 27.27 4.424 2.422 45.25


30.60 27.44 4.12 22.52

Grand mean 3.568 2.528 4.519 2.774




Table 6: Effect of Alternaria leaf blight on total sugar content in Bt and non-Bt genotypes of cotton

Total sugar (mg/g fresh weight)

Genotypes

90 DAS 120 DAS

Healthy Diseased

Per cent decrease

over healthy

Healthy Diseased

Per cent decrease

over healthy

Bunny Bt 9.300 6.550 5.813 3.926

MRC-7351 Bt 7.650 5.226 5.636 3.600

RCH-2 Bt 9.263 5.966 4.586 3.113

Mean 8.738 5.914 32.32 5.345 3.546 33.66

Abhadita 7.503 4.826 4.400 3.186

Jayadhar 9.003 5.876 5.090 3.626

DCH-32 9.003 5.000 2.990 2.353

Mean 8.503 5.234 38.45 4.16 3.055 26.56


2.69 11.50

22.17 13.85

Grand mean 8.621 5.574 4.753 3.301


Genotypes (G) 0.079 0.318 0.039 0.158

Diseased (D) 0.047 0.186 0.022 0.086

G x D 0.113 0.453 0.054 0.217


The per cent decrease in the mean total sugar content was more in the non-Bt genotypes (2.69%) than the Bt genotypes (11.50%) both at healthy and diseased condition, respectively. In addition, there was decrease in the per cent mean total sugar content in the diseased condition irrespective of whether the genotypes was non-Bt (38.45%) or Bt (32.32%).

At 120 DAS, Bunny Bt and Jayadhar recorded maximum total sugar content in healthy (5.813 and 5.090 mg/g fresh weight, respectively) and in diseased condition (3.926 and 3.626 mg/g fresh weight, respectively) and differed significantly. Whereas DCH-32 recorded least total sugar content in both healthy and diseased condition (2.990 and 2.353 mg/g fresh weight, respectively). Diseased plants of six genotypes recorded mean minimum total sugar content (3.301 mg per g fresh weight) and differed significantly over the mean total sugar content of healthy plants (4.753 mg/g fresh weight).

Also, the per cent decrease in mean total sugar content was more in the non-Bt genotypes in both healthy (22.17%) and diseased condition (13.85%). Further, the mean per cent of total sugar content decreased at diseased condition in both non-Bt (26.56%) and Bt genotypes (33.66%).

4.2.4 Reducing sugar The results of reducing sugar content recorded at different crop growth stages of non-Bt and Bt cotton under the influence of A. macrospora are presented in Table 7. There was decrease in the reducing sugar content from 90 to 120 DAS. It was found that there was significant difference in the reducing sugar content in genotypes, type of leaf (healthy and diseased) and their interaction.

At 90 DAS, Bunny Bt recorded maximum reducing sugar content in healthy (5.413 mg/g fresh weight) and MRC-7351 Bt recorded maximum reducing sugar content in diseased condition (3.340 mg/g fresh weight). Reducing sugar content among Bt genotypes viz., Bunny Bt (3.153 mg/g fresh weight), MRC-7351 Bt (3.340 mg/g fresh weight) and RCH-2 Bt (3.323 mg/g fresh weight) were on par with each other. Among non-Bt genotypes, Jayadhar recorded highest reducing sugar content both in healthy (4.963 mg/g fresh weight) and diseased condition (3.800 mg/g fresh weight).

Healthy genotypes recorded highest mean reducing sugar content (4.376 mg/g fresh weight) when compared with diseased genotypes (3.037 mg/g fresh weight). Nevertheless, the mean reducing sugar content of healthy genotypes differed significantly superior over the diseased genotypes, irrespective of the genotypes.

The per cent decrease in the mean reducing sugar content was more in the non-Bt genotypes, Abhadita, Jayadhar and DCH-32 than the Bt genotypes, Bunny Bt, MRC-7351 Bt and RCH-2 Bt in both healthy (21.70%) and diseased condition (14.39%). In addition, there was decrease in the per cent mean reducing sugar content in the diseased condition of whether the genotypes was non-Bt (27.11%) or Bt (33.33%).

At 120 DAS, Bunny Bt and Jayadhar recorded maximum reducing sugar content in healthy (4.386 and 3.913 mg/g fresh weight, respectively). Among six genotypes, Jayadhar recorded maximum reducing sugar content in diseased condition (3.026 mg/g fresh weight) and differed significantly over other genotypes.

Diseased plants of six genotypes recorded mean minimum reducing sugar content (2.269 mg/g fresh weight) and significantly decreased over the mean reducing sugar content of healthy plants (3.234 mg/g fresh weight). Also, the per cent mean reducing sugar content decreased in non-Bt genotypes in both healthy (16.95%) and in diseased condition (8.29%). Further, the mean per cent of reducing sugar content decreased at diseased condition in both non-Bt (26.02%) and Bt genotypes (33.00%).

4.2.5 Non-reducing sugar The results of non-reducing sugar content recorded at different crop growth stages of non-Bt and Bt cotton under the influence of A. macrospora are depicted in Table 8. There was decrease in the non-reducing sugar content from 90 to 120 DAS, both in healthy and diseased plants. It was also found that there was significant difference in the reducing sugar content in genotypes, type of leaf (healthy and diseased) and their interaction.

At 90 DAS, DCH-32 recorded maximum non-reducing sugar content in healthy (5.376 mg/g of fresh weight) and Bunny Bt in diseased condition (3.603 mg/g fresh weight) which resulted in significant differences over all the genotypes. MRC-7351 Bt recorded significantly least non-reducing sugar content in both healthy (3.076 mg/g fresh weight) and diseased condition (2.080 mg/g fresh weight).

Table 7: Effect of Alternaria leaf blight on reducing sugar content in Bt and non-Bt genotypes of cotton

Reducing sugar (mg/g fresh weight)

Genotypes

90 DAS 120 DAS

Healthy Diseased

Per cent decrease

over healthy

Healthy Diseased

Per cent decrease

over healthy


Mean 4.908 3.272 33.33 3.533 2.367 33.00


Mean 3.843 2.801 27.11 2.934 2.171 26.02


21.70 14.39 16.95 8.29

Grand mean 4.376 3.037 3.234 2.269


Genotypes (G) 0.058 0.231 0.044 0.175 Diseased (D) 0.033 0..133 0.023 0.090 G x D 0.085 0.339 0.061 0.245


Table 8: Effect of Alternaria leaf blight on non-reducing sugar content in Bt and non-Bt genotypes of cotton

Non-reducing sugar (mg/g fresh weight)

Genotypes

90 DAS 120 DAS

Healthy Diseased

Per cent decrease

over healthy

Healthy Diseased

Per cent decrease

over healthy


Mean 4.097 2.780 32.14 1.985 1.316 33.70


Mean 4.695 2.613 58.84 1.390 0.956 31.22


14.59 6.00 29.98 27.36

Grand mean 4.396 2.697 1.688 1.136




Table 9: Effect of Alternaria leaf blight on gossypol content in Bt and non-Bt genotypes of cotton

Gossypol (mg/g fresh weight)

Genotypes

90 DAS 120 DAS

Healthy Diseased

Per cent increase

over healthy

Healthy Diseased

Per cent increase

over healthy

Bunny Bt 92.00 95.33 86.00 89.33

MRC-7351 Bt 60.50 66.03 54.50 60.00

RCH-2 Bt 81.33 93.00 75.33 87.00

Mean 77.94 84.79 8.78 71.93 78.77 9.51

Abhadita 82.67 90.67 76.67 84.67

Jayadhar 91.33 101.67 85.30 95.30

DCH-32 80.67 83.67 74.67 77.67

Mean 84.89 92.00 8.37 78.88 85.88 8.87

Per cent increase over Bt

8.19 7.84 8.81 8.28

Grand mean 81.42 88.40 75.41 82.33


Genotypes (G) 0.902 3.607 0.875 3.500

Diseased (D) 0.520 2.080 0.506 2.023

G x D 1.270 5.090 1.240 4.960


Healthy genotypes recorded highest mean non-reducing sugar content (4.396 mg/g fresh weight) when compared with diseased genotypes (2.697 mg/g fresh weight). Nevertheless, the mean non-reducing sugar content of healthy genotypes differed significantly superior over the diseased genotypes.

The per cent decrease in the mean non-reducing sugar content was more in the non-Bt genotypes in both healthy (14.59%) and diseased (6.01%) genotypes. In addition, decrease in the per cent mean non reducing sugar content in the diseased condition was more in non-Bt (58.84%) compared to Bt genotypes (32.14%).

At 120 DAS, RCH-2 Bt recorded maximum non-reducing sugar content in healthy (2.156 mg/g fresh weight) and diseased condition (1.533 mg/g fresh weight) and differed significantly superior over other genotypes. Least non-reducing sugar content were recorded in DCH-32 (1.166 mg/g fresh weight) in healthy and Jayadhar (0.720 mg/g fresh weight) in diseased condition. Diseased plants of six genotypes recorded mean minimum non-reducing sugar content (1.136 mg/g fresh weight) and differed significantly less over the mean non-reducing sugar content of healthy plants (1.688 mg/g fresh weight).

Also, the per cent mean non-reducing sugar content decreased in non-Bt genotypes in healthy (29.98%) and in diseased condition (27.36%). Further, the mean per cent of non-reducing sugar content decreased at diseased condition in both non-Bt (31.22%) and Bt genotypes (33.70%).

4.2.6 Gossypol

The results of gossypol content recorded at different crop growth stages of non-Bt and Bt cotton under the influence of A. macrospora is depicted in Table 9. There was decrease in the gossypol content from 90 to 120 DAS, both in healthy and diseased plants. It was found that there was significant difference in the gossypol content in genotypes, type of leaf (healthy and diseased) and their interaction.

At 90 DAS, among the six genotypes, Bunny Bt and Jayadhar recorded highest gossypol content in both healthy (92.00 and 91.33 mg/g fresh weight, respectively) and diseased condition (95.33 and 101.67 mg/g fresh weight, respectively) and differed significantly over other genotypes. There was increase in the gossypol content in diseased genotypes compared to healthy genotypes in both non-Bt and Bt genotypes. All the genotypes under healthy recorded minimum mean gossypol content (81.42 mg/g fresh weight) and differed significantly over the diseased genotypes (88.40 mg/g fresh weight).

The per cent increase in the mean gossypol content was more in the non-Bt genotypes in both healthy and diseased conditions (8.19% and 7.84%, respectively) than the Bt genotypes. Irrespective of non-Bt or Bt genotypes, there was increase in gossypol content in diseased condition. In non-Bt genotypes, the mean per cent decrease in gossypol content was less compared to Bt genotypes (8.37% and 8.78%, respectively).

At 120 DAS, Bunny Bt and Jayadhar recorded highest gossypol content in both healthy (86.00 and 85.33 mg/g fresh weight, respectively) and diseased condition (89.33 and 95.33 mg/g fresh weight, respectively) and differences were significantly superior over other genotypes. There was an increasing trend in the gossypol content in diseased genotypes compared to healthy genotypes irrespective of either non-Bt or Bt genotypes. All the six genotypes under diseased condition recorded maximum mean gossypol content (82.33 mg/g fresh weight) and differed significantly when compared to healthy genotypes (75.41 mg/g fresh weight).

The per cent increase in the mean gossypol content was more in the non-Bt genotypes in both healthy and diseased conditions (8.81% and 8.28%, respectively) than the Bt genotypes. The mean per cent decrease in gossypol content was less in non-Bt (8.87%) compared to Bt genotypes (9.51%).



The isolates collected during survey from the northern Karnataka were grown on PDA (Plate 4). The isolates were subjected to various morphological variability tests as mentioned in "Material and methods" and the results are presented hereunder. Table 10a showed that, conidia of different isolates were septated by 1-2 vertical and 4-6 horizontal septa. The isolates, A3, A6 and A10 showed

maximum horizontal septa of 6 followed by 5 horizontal septa in isolates, A1 and A5. Whereas minimum horizontal septa (4) was observed in the isolates, A4 and A8. The isolates, A5 and A8 showed maximum of 2 vertical septa and isolates, A1, A3, A4, A6 and A10 showed minimum of 1 vertical septa.

The isolates, A1, A6 and A4 showed maximum size of 49.38 x 12.82 µm, 48.24 x 15.79 µm and 47.95 x

15.26 µm, respectively. The least size of the conidia (21.97x 13.02 µm) was observed in isolate, A8. By comparing with Alternaria macrospora structural figure described by Ellis M.B. revealed that out of 7 isolates, only two isolates viz., A5 and A8 showed complete resemblance with Alternaria macrospora and other isolates viz., A1, A3, A4, A6 and A10 showed no resemblance with Alternaria macrospora morphologically.

Results in Table 10b revealed that isolate A2 showed 6 horizontal and 1 vertical septa, whereas isolates, A7 and A9 showed 5 horizontal and 2 vertical septa. Maximum conidial size (33.29 x

12.54 µm) was observed in isolate, A2, whereas isolate, A7 showed minimum conidial size of 21.5 x

6.87 µm. Isolate, A9 showed conidial size of 30.22 x 7.4 µm. When the isolates were compared with Alternaria alternata structural figure described by Ellis M.B., all the three isolates viz., A2, A7 and A9 showed complete resemblance morphologically (Plate 5).


4.3.2.1 Effect of incubation period on dry mycelial weight of Alternaria macrospora

The present investigation was carried out inorder to know the number of days required for maximum growth of the fungus by monitoring the dry mycelial weight and the results are presented in Table 11.

There was significant difference among the incubation periods. The dry mycelial weight of Alternaria macrospora gradually increased (36.53 mg) from third day of inoculation and reached maximum (287.31 mg) on sixteenth day. The data showed a declining trend from eighteenth day (275.90 mg) to thirtieth day (192.74 mg).

4.3.2.2 Effect of different solid media on the variability of isolates of Alternaria spp.

The ten isolates were studied for their cultural variability on different solid media viz., PDA, PCA, CDA, HEA, OMA, CMA, SDA and V8JA as described in "Material and Methods" and the data are presented in Table 12 and Plate 6.

The results revealed that there was significant difference between the isolates, media and their interaction effect. Isolate, A6 has recorded highest mean radial growth (81.57 mm), which was on par with A9 (80.94 mm), A7 (79.11 mm) and A4 (78.45 mm) isolates and were significantly superior over other isolates. Isolates, A10 (73.47 mm), A8 (70.58 mm), A5 (69.48 mm), A1 (69.2 mm) and A3 (68.08 mm) were next in order and were on par with each other. A2 isolate showed least mean radial growth (61.98 mm).

With respect to the different media concerned, HEA recorded significant highest radial growth (90 mm) in all the isolates and superior over other media followed by OMA (89.25 mm). SDA (80.43 mm), PCA (79.17 mm) were on par with each other. PDA recorded mean radial growth of 77.49 mm, whereas least radial growth was observed in V8JA (43.81 mm) followed by CMA (52.20 mm).

With respect to interaction effect, isolates A4 and A9 recorded maximum radial growth (90.00 mm) on both HEA and OMA.

The isolates grown on different media showed varied colony characters (Table 13a, b, c, d and e). The results revealed that isolates, A1, A2, A5, A7 and A9 showed grey colony colour on most of the media, whereas isolates, A3, A6, A8 and A10 showed both grey and black colour colonies. Only isolate, A3 produced black colour colony. The colony margin colour of the isolates varied from white to black. Isolates, A4, A6, A7 and A9 showed grey colony margin on most of the media, whereas isolates, A2, A8 and A10 shared colony margin colour of both grey and black. Isolates, A1, A3 and A5 showed white colony margin along with grey and black. The type of margin of the isolates varied from irregular to smooth. Irregular margin was seen predominantly in the isolates viz., A1, A3, A5, A6, A7 and A8, whereas smooth margin was in isolates, A9 and A10 showed smooth margin among the media tested. Isolates, A2 and A4 shared characters of both types of margin.

Different isolates showed varied mycelial growth characters from flat to raised. Isolates, A3

and A7 showed raised mycelial growth,whereas medium raised mycelial growth was observed in isolates, A1 and A8. Flat mycelial growth was observed in isolate, A9. Isolates, A2 and A5 showed both.

Table 10a: Morphological variability of isolates of Alternaria spp.

Sl. No.

Name of the isolate

Number of horizontal

septa

Number of vertical septa

Size of conidia

(Length x Breadth)

(µm)

Beak length (µm)

Overall length

of conidia

(µm)

Descriptions of Ellis M.B. regarding Alternaria macrospora Zimm.

Resemblance towards


Zimm.


septa


Beak length Overall length (µm)

A1 Karlakatti 5 1 49.38 x 12.82 29.15 78.53 No Resemblance A3 Yamkanmardi 6 1 32.8 x 17.17 32.84 65.64 No Resemblance A4 Marewada 4 1 47.95 x 15.26 33.52 81.47 No Resemblance

A5 Unkal 5 2 28 x 12.31 63.02 91.02 4-9 1-5 Equal or twice the length of conidia

90-180 Complete

Resemblance A6 Chandanamatti 6 1 48.24 x 15.79 27.47 75.71 No Resemblance

A8 Saundatti 4 2 21.97 x 13.02 74.03 96 Complete

Resemblance A10 Jagalur 6 1 26.99 x 7.61 30.98 57.97 No Resemblance

Table 10b: Morphological variability of isolates of Alternaria spp.

Sl. No.

Name of the isolate


septa

Number of

vertical septa

Size of conidia

(Length x Breadth) (µm)

Beak length (µm)

Overall length

of conidia

(µm)

Descriptions of Ellis M.B. regarding Alternaria alternata (Fr.) Keissler

Resemblance towards

Alternaria alternata (Fr.)

Keissler


septa


Beak length Overall length (µm)

A2 Amminbhavi 6 1 33.29 x 12.54 26.37 56.37 Complete

Resemblance

A7 Haveri 5 2 21.5 x 6.87 25.32 46.82 1-8 0-4 Short or more than one

third the length of conidia 20-63

Complete Resemblance

A9 Gadag 5 2 30.22 x 7.4 24.04 56.26 Complete

Resemblance

Plate 4: Growth of ten isolates of Alternaria spp. on PDA

Plate 5: Morphological variability of ten isolates of Alternaria spp.

Table 11: Effect of incubation period on dry mycelial weight of Alternaria macrospora

Incubation period (days)

Mycelial dry weight (mg)

2 36.53

4 77.56

6 93.70

8 169.88

10 192.42

12 229.17

14 272.55

16 287.31

18 275.90

20 267.53

22 262.30

24 258.20

26 234.15

28 207.65

30 192.74

S. Em.± 0.57

CD at 1% 2.20

Table 12: Cultural variability of growth and sporulation of ten isolates of Alternaria spp. on different solid media

Sl. No.

Isolates Radial growth (mm)

Mean PDA PCA CDA HEA OMA CMA SDA V8JA

A1 Karlakatti 77.50 +++

63.77 ++

71.23 ++

90.00 ++++

82.50 +++

43.60 ++

82.50 ++

42.50 +++

69.20

A2 Amminbhavi 60.33 +++

82.50 ++++

65.00 +++

90.00 ++++

90.00 +++

25.00 +++

45.47 ++

37.50 +++

61.98

A3 Yamkanmardi 75.00 +++

61.00 +++

73.37 +++

90.00 +++

90.00 +++

34.27 +++

86.00 +++

35.00 ++

68.08

A4 Marewada 90.00 ++++

90.00 ++++

90.00 ++++

90.00 +++

90.00 +++

31.34 ++

90.00 ++++

56.27 ++

78.45

A5 Unkal 77.17 +++

73.33 +++

83.33 +++

90.00 ++++

90.00 +++

36.17 ++

71.27 ++

34.60 +++

69.48

A6 Chandanamatti 76.77 +++

84.83 +++

77.83 ++

90.00 +++

90.00 +++

65.83 +++

85.00 ++++

82.30 +++

81.57

A7 Haveri 81.27 +++

90.00 ++++

75.43 +++

90.00 ++++

90.00 ++++

83.83 +++

82.43 +++

39.92 +++

79.11

A8 Saundatti 73.33 +++

69.83 +++

75.33 +++

90.00 +++

90.00 ++++

44.33 +++

81.67 +++

40.17 +++

70.58

A9 Gadag 90.00 ++++

90.00 ++++

71.42 +++

90.00 +++

90.00 ++++

90.00 ++++

90.00 ++++

36.08 ++++

80.94

A10 Jagalur 73.50 +++

86.38 +++

56.46 ++

90.00 +++

90.00 +++

67.67 +++

90.00 ++++

33.77 +++

73.47

Mean 77.49 79.16 73.94 90.00 89.25 52.20 80.43 43.81 73.29

Isolates (I) Medias (M) I x M

S. Em.± 0.27 0.24 0.78

CD at 1% 1.09 0.97 3.09

++ : Moderate sporulation +++ : Good sporulation ++++ : Excellent sporulation PDA - Potato dextrose agar PCA – Potato carrot agar CDA – Czapeck’s dox agar HEA – Host extract agar OMA – Oat meal agar CMA – Corn meal agar SDA – Sabouraud’s dextrose agar V8JA – V-8 Juice agar

Plate 6: Cultural variability among the ten isolates of Alternaria spp.on different solid media

Table 13a: Cultural variability of ten isolates of Alternaria spp. with respect to colony colour

Media

Isolates PDA PCA CDA HEA OMA CMA SDA V8JA

Karlakatti Dark grey

Ashy Ashy Grayish black

Grey Black Dark grey

Black

Amminbhavi Grey Whitish

grey Grey Grayish black

Grayish black

Black Grey Grey

Yamkanmardi Grey Grey Grey Black Grey Black Grayish black

Black

Marewada Grayish black

Black Grayish black

Black Black Black Black Black

Unkal Black Grayish white Grey Grey Grey Grey

Grayish black

Black

Chandanamatti Black Whitish

grey Grey White Black Grey White Grey

Haveri Black Grey Grayish black

Grey Grey Grey Black Grey

Saundatti Grey Grey Ashy Grayish black

Grey Black Black Black

Gadag White Grey Grey White Grey Grey White White

Jagalur Grayish black

Grayish black

Grey Black Grey Black Black Grey

Media PDA - Potato dextrose agar PCA – Potato carrot agar CDA – Czapeck’s dox agar HEA – Host extract agar OMA – Oat meal agar CMA – Corn meal agar SDA – Sabouraud’s dextrose agar V8JA – V-8 Juice agar

Table 13b: Cultural variability of ten isolates of Alternaria spp. with respect to colony margin colour

Media


Karlakatti Grey Grey White Black White Black Grey Black

Amminbhavi Grey Grey Grey Black Grey Black Grey Black

Yamkanmardi White Grey Grey Black Black Black White Black

Marewada Black Grey Grey Black Grey Grey Black Grey

Unkal White White Grey Black Grey Black Grey Black

Chandanamatti Grey Grey Grey Grey Grey Grey Grey Black

Haveri Grey Grey Grey Grey Grey Black Black Black

Saundatti Grey Grey Grey Black White Black Grey Black

Gadag Grey Grey Grey Grey Grayish black

Grey Grey Grey

Jagalur Grey Grey Black Black Grey Black Black Grey


Table 13c: Cultural variability of ten isolates of Alternaria spp. with respect to type of margin

Media


Karlakatti Irregular Irregular Irregular Smooth Irregular Irregular Irregular Irregular

Amminbhavi Irregular Smooth Smooth Smooth Irregular Irregular Irregular Smooth

Yamkanmardi Irregular Irregular Irregular Irregular Irregular Irregular Irregular Irregular

Marewada Smooth Smooth Irregular Smooth Smooth Irregular Irregular Irregular

Unkal Irregular Irregular Smooth Irregular Irregular Irregular Irregular Irregular

Chandanamatti Smooth Irregular Irregular Smooth Irregular Irregular Irregular Irregular

Haveri Irregular Irregular Irregular Smooth Irregular Irregular Irregular Irregular

Saundatti Irregular Irregular Irregular Smooth Irregular Irregular Irregular Irregular

Gadag Smooth Smooth Smooth Smooth Smooth Smooth Smooth Irregular

Jagalur Irregular Irregular Smooth Smooth Smooth Irregular Smooth Smooth


Table 13d: Cultural variability of ten isolates of Alternaria spp. with respect to mycelial growth

Media


Karlakatti Medium raised

Medium raised

Medium raised

Medium raised

Medium raised

Distorted Flat Raised

Amminbhavi Raised Medium raised

Medium raised

Medium raised

Raised Distorted Raised Flat

Yamkanmardi Raised Medium raised

Raised Raised Raised Distorted Raised Flat

Marewada Flat Flat Medium raised

Raised Medium raised

Distorted Raised Raised

Unkal Medium raised

Raised Raised Raised Flat Distorted Raised Medium raised

Chandanamatti Flat Medium raised

Medium raised

Flat Medium raised

Distorted Raised Raised

Haveri Raised Flat Raised Raised Raised Distorted Raised Raised

Saundatti Medium raised

Medium raised

Medium raised

Medium raised

Medium raised

Distorted Flat Raised

Gadag Flat Flat Flat Flat Flat Distorted Flat Flat

Jagalur Medium raised

Flat Medium raised

Medium raised

Flat Distorted Flat Flat

Media

PDA - Potato dextrose agar PCA – Potato carrot agar CDA – Czapeck’s dox agar HEA – Host extract agar OMA – Oat meal agar CMA – Corn meal agar SDA – Sabouraud’s dextrose agar V8JA – V-8 Juice agar

Table 13e: Cultural variability of ten isolates of Alternaria spp. with respect to sectoring

Media

Isolates

PDA PCA CDA HEA OMA CMA SDA V8JA

Karlakatti Absent Absent Present Absent Present Present Absent Absent

Amminbhavi Absent Absent Absent Absent Absent Absent Absent Absent

Yamkanmardi Absent Absent Absent Absent Absent Absent Absent Absent

Marewada Absent Present Absent Present Absent Absent Absent Present

Unkal Absent Present Absent Absent Present Present Absent Present

Chandanamatti Absent Absent Absent Absent Absent Absent Absent Absent

Haveri Present Absent Absent Absent Absent Absent Absent Absent

Saundatti Absent Present Present Absent Present Present Absent Absent

Gadag Absent Absent Absent Absent Absent Absent Absent Present

Jagalur Absent Present Absent Absent Present Present Absent Absent

Media

PDA - Potato dextrose agar PCA – Potato carrot agar CDA – Czapeck’s dox agar HEA – Host extract agar OMA – Oat meal agar CMA – Corn meal agar SDA – Sabouraud’s dextrose agar V8JA – V-8 Juice agar

Plate 7: PCR amplification of ten isolates of Alternaria spp. by using ITS-1 and 4

Table 14: Genetic sequences of isolates

Isolates Sequences

A1

ATGGTTGCTTCTTCACGTCGCTGGCGGCGTCTGCTGTTGCAGCTCCAGCCCCTGCC

ATCACTCCTGCACCCAAGCCCGAGGTCGTGAAGCGTTCCAGCTGCACTTTTTCAG

GCTCCAACGGAGCTGCTGAGGCTTCCAAGTCACAGTCATTCTTTCCGACGTTGCC

GTCCCTTCAGGCACAACTTTGGACCTCTCTAGTCTGGCTACTACTGTCATCTTCGA

GGGTACCACCACCTGGGGCTACTCGGAATGGAAGGGTCCCCTTCTTGACATCCAA

GGAAAGAAGATCACTGTCAAGGGCGCCGAGGGATCTGTTCTCAACGGTGATGGT

GCTCGTTGGTGGGACGGTAAGGGTGGAAATGGTGGAAAGACCAAGCCCAAGTTC

TTCTCCGCTCACAAACTGACCGACTCCACCATCACCGGCATTACCATCAAGAACC

CTCCCGTCCAAGTCGTTAGTATCAACGGCTGCGATGGTCTTACCATTACAGACAT

GACTATTGATGCGTCCGACGGCGACAAGGACGAGCAGGGCCACAACACAGATGG

TTTCGATATTGGCTCCAGCAACAACGTCATCATTGATGGCGCTAAGGTTTACAAC

CAGGATGATTGCGTAGCTGTCAACTCAGGTACCGTAAGTAATGACATGAGATTGC

GGTATTCGCACCTACTAACAAGTCGGCTAGGAAATCACCTTCAAGAACGGCCTCT

GCTCCGGTGGACACGGTCTATCCATTGGCTCGGTTGGTGGTCGTGACGATAACAC

TGTCGACACTGTCACCTTCTCCAATTCCGAGGTCACCAAGTCTGTCAACGGTGTCC

GCGTCAAGGCTAAGGTTGGCACAACCGGCAAGATTAACAAAGTCACCTACGAAG

ATATTACTCTGTCTGAGATTTCCAAGTACGTTTTCTCAAAGTTTCACCCATTGCCA

AATTCTAATACGTTCCAGGTATGGCGTTCTTATTGAGCAGAACTACGATGGCGGT

GACCTTCACGGTGACGCGGACACTGGTGTCCCCACCGCCTTGACACCTGACAACG

TCACTGGTGGTGTTTCCAGCAGTGGCTACGACGTCGTTGTCACCTGTGGCAAAGG

CTCTTGCACAGGCTGGACCTGGACCGGTGTCGACGTTACTGTGGTAAGACCTATG

ACAAGTGCTCCAACGTGCCCAGCGTTACCAAGTGTTCGTAA

A2

GGCATCCAACTATGAGGCGGGCTGGATCTCTCGGGGTTACAGCCTTGCTGAATTA

TTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGG

ACAAACATAAACCTTTTGTAATTGCAATCAGCCTCAGTAACAAATTAATAATTAC

AACTTTCAAAAACGGAATCACTGGTTCCTGCCTTCAATAAAATCCCCCTCGAAAG

CCGAAAATCACTGTGAACTGCAAAAATTCATTAAATCATCCAAATCATTTGACGC

TCTTTGGCCCCTTTGTATTCCCAAAGGGTATTCCTTTCCAACCGCCATTTGCCCCC

CCAGCTTTACTTGGTGTTGGGCATCTTGTCTCTAACTTTCCTTGAAACTCCCCCTT

AAAATTATTGGCACCCTTCCTACTGGTTCCAAACCGCACCAAAAACCGCACTCTC

AATCACCA

A7

GATTGGGGAATCCCTACCCTGATCCGAGGTCAAAAGTTGAAAAAAAGGCTTAAT

GGATGCTAGACCTTTGCTGATAGAGAGTGCGACTTGTGCTGCGCTCCGAAACCAG

TAGGCCGGCTGCCAATTACTTTAAGGCG

A9

ATTTCTCCCCCACAAAAAGAAAAATGTGAACAACCTGATCCGAGGTCAAAGTTG

ACAAAAGGCTTAATGGATGCTAGACCTTTGCTGATAGAGAGTGCGACTTGTGCTG

CGCTCCGAAACCAGTAGGCCGGCTGCCAATTACTTTAAGGCGAGTCTCCAGCAAA

GCTAGAGACAAGACGCCCAACACCAAGCAAAGCTTGAGGGTACAAATGACGCTC

GAACAGGCATGCCCTTTGGAATACCAAAGGGCGCAATGTGCGTTCAAAGATTCG

ATGATTCACTGAATTCTGCAATTCACACTACTTATCGCATTTCGCTGCGTTCTTCA

TCGATGCCAGAACCAAAAGATCCGTTGTTGAAAGTTGTAATTATTAATTTGTTAC

TGACTCTGAGTGCAATTACAAAAAGTTTATGGTTGTCCCAGCGGCTGGGGTTCGA

ACCGAAGAAAAGTCAAATCCCCAAACACCAAGGGGTAACATTCCATTAGCCTTTT

TTCCACTTTTGGACCCCGAACCCGGTAGGAATTGCGGTGAAATTAACCAAAAAAA

AACACGGGGGAGAAGATT

Plate 8: Amplification of ten isolates of Alternaria spp. by using AmF and AmR primer

Plate 9: Amplification of isolates of Alternaria spp. by using Aa F2 and Aa F3 primer

raised and medium raised mycelial growth, whereas isolate, A10 showed both medium raised and flat mycelial growth. All the three characters viz., raised, medium raised and flat mycelial growth was observed in isolates, A4 and A6. With respect to media concerned, CMA media showed distorted growth in all isolates. Sectoring was absent in isolates, A2, A3, A6, A7 and A9 whereas, isolates, A1, A4, A5, A8 and A10 showed characters of both presence and absence of sectoring among the media tested.


The analysis of genetic variation in plant pathogen populations is an important prerequisite for understanding the evolution in the plant patho system. Polymerase chain reaction (PCR) based molecular markers are useful tools for detecting genetic variation within populations of phyto pathogens. Internal Transcribed Spacer (ITS) was used to detect the variation among the ten isolates of Alternaria spp. collected from different districts of northern Karnataka. ITS1 and ITS4 Universal, AmF and AmR and Aa F2 and Aa F3 primers obtained from Operon technologies, M/s Bangalore Genie, were used to determine molecular variability between the isolates.

4.3.3.1 Amplification of ITS1 and ITS4 region

The full length ITS rDNA region was amplified with ITS1 (5' TCC GTA GGT GAA CCT GCG G 3 ') and ITS 4 (5’ TCC TCC GCT TAT TGA TAT GC 3 ') primers for all ten isolates of Alternaria spp.

DNA amplicon was observed at the region of 560 bp with a concentration of around 150 ηg/µg. The amplified products were checked on 1% agarose gel electrophoresis (Plate 7). Then four representative isolates were selected based on variation in morphological characters and sent for sequencing for confirmed species level identification.

4.3.3.2 DNA sequencing

The DNA sequences of four isolates were compared using the bioinformatics tool of the National Centre for Bioinformatics (NCBI) blast programme. Based on sequence comparison, the identification of Alternaria spp. isolates were confirmed as one Alternaria macrospora, and three Alternaria alternata and accordingly phylogenetic tree was constructed. The sequences of the isolates are given in Table 14.

4.3.3.3 Amplification of AmF and AmR primer

The full length rDNA region was amplified with Alternaria macrospora specific primer for ten isolates of Alternaria spp. DNA amplicon was observed in all the ten isolates at the region of 442 bp.

The 10 µl amplified products were checked on 1% agarose gel electrophoresis by staining with ethidium bromide and viewed under UV light (Plate 8).

4.3.3.4 Amplification of Aa F2 and Aa R3 primer

For further confirmation, the full length rDNA region was amplified using Alternaria alternata specific primer for ten isolates of Alternaria spp. DNA amplicon was observed in only three isolates viz., A2, A7 and A9 at the region of 320 bp. The amplified products were further checked and confirmed on 1% agarose gel electrophoresis by staining with ethidium bromide and viewed under UV light (Plate 9).


The usage of chemicals is a common practice for the management of diseases like Alternaria leaf blight of Bt cotton, where in the resistant varieties are not available and epidemic is most expected when weather is congenial for disease development. Accordingly, in the present investigation, newer molecules of fungicides were evaluated both in vitro and in vivo as described in "Material and Methods" chapter.

4.4.1 In-vitro evaluation of fungicides

Systemic fungicides (two strobilurins, three triazoles and four combi products) which differed significantly with respect to fungicides, concentrations and their interactions were evaluated for their efficacy against Alternaria macrospora by poisoned food technique. The results are presented in Table 15 and Plate 10.

In the present study, it is clear that all the fungicides tested at all concentrations were significantly effective in reducing the mycelial growth of Alternaria macrospora. The inhibition of the growth over the control ranged from 65.12 per cent to 100.00 per cent irrespective of the.

Table 15: In-vitro evaluation of fungicides in inhibiting mycelial growth of


Treatments

Per cent inhibition of mycelial growth

Concentrations

Mean 0.05% 0.075% 0.1%

Pyraclostrobin 72.04

(58.09) *

80.19

(63.58)

84.93

(67.18)

77.72

(58.09)

Trifloxystrobin 70.56

(57.14)

76.67

(61.31)

80.53

(63.82)

70.19

(57.07)

Propiconazole 100

(90)

100

(90)

100

(90)

100

(90)

Tebuconazole 89.44

(71.04)

90.74

(72.31)

93.33

(75.05)

91.17

(72.80)

Hexaconazole 100

(90)

100

(90)

100

(90)

100

(90)

Carbendazim 25% + Mancozeb 50% 63.15

(52.63)

64.44

(52.63)

67.78

(55.42)

65.12

(53.82)

Pyraclostrobin 5% + Metiram 55% 81.85

(64.79)

84.44

(64.79)

85.93

(67.99)

84.07

(66.53)

Tebuconazole 50% + Trifloxystrobin 25% 84.07

(66.50)

90

(66.50)

100

(90)

91.36

(76.03)

Hexaconazole 4 %+ Zineb 68% 100

(90)

100

(90)

100

(90)

100

(90)

Mean 84.57

(71.13)

87.39

(73.22)

90.28

(76.61)

77.72

(58.09)

S. Em.± CD at 1%

Treatments (T) 0.43 1.71

Concentrations (C) 0.25 0.99

T x C 0.74 2.97

* Figures in parentheses indicates angular transformed values

Plate 10: In vitro evaluation of different fungicides

Table 16: Efficacy of fungicides against Alternaria leaf blight of cotton

Sl.

No. Treatment details

Percent

disease index

(PDI) at 105

DAS

Percent

decrease

over

control

(PDC)

Yield

(kg/ha)

B:C

ratio

T1 Trifloxystrobin 20.33

(26.80) * 42.46 1254.33 1.26

T2 Tebuconazole 50% + Trifloxystrobin 25% 18.00

(25.10) 49.05 1355.96 1.05

T3 Pyraclostrobin 23.67

(29.11) 33.00 1163.63 1.08

T4 Pyraclostrobin 5% + Metiram 55% 17.67

(24.85) 49.99 1412.90 1.59

T5 Kresoxim methyl 22.00

(27.97) 37.72 1199.35 1.18

T6 Tebuconazole 17.33

(24.60) 50.95 1453.87 1.61

T7 Propiconazole 15.67

(23.32) 55.65 1484.10 1.70

T8 Carbendazim 12 %+ Mancozeb 63% 18.33

(25.35) 48.12 1291.63 1.47

T9 Hexaconazole 14.33

(22.25) 59.44 1536.76 2.04

T10 Mancozeb 27.33

(31.52) 22.64 1078.13 1.46

T11 Control 35.33

(36.47) 814.00 1.22

S. Em.± 0.99 26.15

CD at 5% 2.93 77.15

* Figures in parentheses indicates angular transformed values

Plate 11: In vivo evaluation of new molecules against Alternaria leaf blight

concentrations. Hexaconazole, Propiconazole and Hexaconazole 4% + Zineb 68% recorded cent per cent inhibition at all the concentrations (0.05%, 0.075% and 0.1%) and were proved to be the most effective fungicides. The next best treatment was Tebuconazole 50% + Trifloxystrobin 25% (91.36%) which was on par with Tebuconazole (91.17%) whereas Carbendazim 25% + Mancozeb 50% was least effective in reducing the mycelial growth (65.12%). The effect of concentrations on A. macrospora, irrespective of chemicals were found significant and most effective at 0.1% concentration. With respect to concentrations concerned, maximum reduction of mycelial growth (90.28%) was observed at 0.1% concentration which was significantly superior over the rest of the concentrations. In case of interaction effect, Propiconazole (100.00%), Hexaconazole (100.00%) and Hexaconazole 4% + Zineb 68% (100.00%) at 0.05, 0.075 and 0.1 per cent were significantly superior over other treatment combinations.


This study was conducted to evaluate the efficacy of different systemic fungicides as foliar spray along with untreated control under natural field conditions, against Alternaria leaf blight of cotton during kharif 2013 and the results are presented in the Table 16 and Plate 11.

The results revealed that Hexaconazole recorded significantly lower per cent disease index (14.33) which was on par with Propiconazole (15.67). The next best treatment was Tebuconazole (17.33 PDI) and Pyraclostrobin 5% + Metiram 55% (17.67 PDI) followed by Tebuconazole 50% + Trifloxystrobin 25% (18.00 PDI) and Carbendazim 12% + Mancozeb 63% (18.33 PDI). Maximum per cent disease index was noticed in untreated check (35.33) followed by Mancozeb (27.33).

Out of different treatments carried out, the highest per cent decrease over control was shown by Hexaconazole (59.44) followed by Propiconazole (55.65), Tebuconazole (50.95), Pyraclostrobin 5% + Metiram 55% (49.99), Tebuconazole 50% + Trifloxystrobin 25% (49.05), Carbendazim 12% + Mancozeb 63% (48.12), Trifloxystrobin (42.46), Kresoxim methyl (37.72), Pyraclostrobin and least per cent decrease over control was shown by Mancozeb (22.64).

The seed cotton yield was significantly superior in all the treatments as compared to untreated check. Maximum yield was recorded in Hexaconazole (1536.76 kg/ha) followed by Propiconazole (1484.10 kg/ha), Tebuconazole (1453.87 kg/ha), Pyraclostrobin 5% + Metiram 55% (1412.90 kg/ha), Tebuconazole 50% + Trifloxystrobin 25% (1355.96 kg/ha), Carbendazim 12% + Mancozeb 63% (1291.63), Trifloxystrobin (1254.33 kg/ha), Kresoxim methyl (1199.35 kg/ha), Pyraclostrobin (1163.63 kg/ha) whereas, least quantity of yield was recorded in Mancozeb (1078.13 kg/ha).

The cost benefit ratio has been worked out for all treatments. The highest total returns was obtained in Hexaconazole (2.04) followed by Propiconazole (1.70), Tebuconazole (1.61). Whereas, the lowest total returns was obtained in Tebuconazole 50% + Trifloxystrobin 25% (1.05).

DISCUSSION Cotton (Gossypium spp.) plant belongs to genus Gossypium of the Malvaceae family, a large

family that includes baobab tree and bombax. The plant naturally is tropical or sub-tropical perennial tree that can grow upto 30 feet height in the wild, but has been domesticated to an annual shrub for commercial cultivation. Cotton has new world and old world ancestors, the most important cultivars belong to G. hirsutum which originated in Mexico and account for more than 95 per cent of world fiber production. The first place is occupied by cotton among cash crops as it guides the destiny of large section of the farming community as well as that of the flourishing textile industry.

The crop suffers from many fungal, bacterial, viral and nematode diseases. Among them, foliar diseases such as Alternaria leaf blight, bacterial blight, rust, grey mildew and vascular wilts contribute to a greater extent to the yield loss (Sharma et al., 2005). As this pathogen is gaining a major status in cotton growing belts of Karnataka, attempts were made to understand the Alternaria leaf blight of Bt cotton better. Hence the present investigations were carried out for survey of the disease to know the disease severity in different parts of northern Karnataka, biochemical changes in Bt and non-Bt genotypes, morphological, cultural and molecular variation of the fungus and evaluation of effective chemicals for management of Alternaria leaf blight of cotton.


In the present study, a roving survey was carried out during kharif 2013 in different parts of northern Karnataka to get the precise information about the incidence of Alternaria leaf blight. Further, isolates were used to study the variability within the species. This information is useful to identify the hot spots in northern Karnataka.

The data on survey revealed that, the disease was observed in regions of Dharwad, Haveri, Belgaum, Bagalkot, Gadag and Davangere districts. Maximum incidence of Alternaria leaf blight was observed in Dharwad (17.63%) followed by Belgaum (15.17%), Davangere (13.50%) and Gadag (13.00%) districts. But, minimum incidence was observed in Haveri (10.25%) district (Fig. 2a). At taluka level, maximum PDI was observed in Gokak taluk (22.00) of Belgaum district whereas, minimum PDI was observed in Savanur taluk (5.00) of Haveri district (Fig. 2b). Among different crop stages, maximum mean incidence was recorded in boll initiation stage (20.00%) whereas minimum mean incidence was recorded in seedling stage (11.17%). Among the genotypes, Bunny Bt and NAMCOT.612 were more susceptible to Alternaria blight (30.00%) whereas, Jakpot Bt was least susceptible (5.00 %). Wherever, places with favourable environmental conditions like high moisture and high temperature, enough inoculum potential and availability of susceptible hosts may be attributed to initiation of the disease. The highest disease severity was observed in fields of Timmapur (36.00%) village of Dharwad district whereas, least incidence was recorded in Mallur (5.00%) village of Haveri district. High disease severity was due to high relative humidity prevailed during the cropping period in Timmapur village. The results are in agreement with the findings of Hosagoudar et al. (2008); Chattannavar et al. (2009) and Chattannavar et al. (2011).

Such variation in disease severity could also be due to variability in the pathogen. Therefore, leaf samples with typical symptoms were collected from different locations and studied for the variability. The pathogen isolated from the infected material was identified as different Alternaria spp. based on its morphological, cultural and molecular studies. The pathogenicity of isolates of Alternaria spp. was proved by spraying spore suspension (10

6 spores/ml) on 30 days old Bunny Bt hybrid. The

Alternaria leaf blight symptoms were manifested on the leaf surface as minute brown spots, which were initially round later became round to irregular and expanded upto one cm diameter with purple margin around the spot having dry grey center. On older leaves, necrotic center of the spots were marked by pattern of concentric zonation. Later, several spots coalesced to form larger area of necrosis. Similar descriptions of the symptoms of Alternaria leaf blight of cotton were given by previous workers such as Ling and Juhwa (1941); Yoah Bashan (1984); Hosagoudar (2012) and Anil (2013).


In recent years, it is becoming increasingly evident that several natural and induced defense mechanisms operate in host plants against different diseases. One such defense mechanism is the

presence of certain compounds inhibitory to the pathogen. Sometimes, the host plant is induced to synthesize these compounds on infection. Analysis of physiological and biochemical factors in selected non-Bt and Bt cotton genotypes were carried out at two different growth stages to understand their role in resistance/susceptibility.

5.2.1 Chlorophyll content In the present findings, the chlorophyll 'a', chlorophyll 'b' and total chlorophyll content was more in Bt genotypes viz., RCH-2 Bt, MRC-7351 Bt and Bunny Bt than non-Bt genotypes viz., Jayadhar, Abhadita and DCH-32 (Fig. 3, 4 and 5). The study also revealed that, due to infection, the chlorophyll content under both the situation (healthy and diseased) decreased from 90 to 120 DAS. Such decrease in chlorophyll content due to infection has been reported in several host pathogen systems (Ellis et al., 1981; Vijaykumar and Rao, 1980 and Berguas and Reisener, 1985). The phenomenon of reduction of chlorophyll content has been reported by many workers attributing various reasons. Heath (1974) reported a change in the ultra structure of chloroplast in rusted cowpea leaves. Subramanyan et al. (1976) suggested inhibition of chlorophyll synthesis due to toxic metabolites produced by the invading rust pathogen in case of groundnut. The results were further supported by studies of Gaviyappanavar (2012), who in case of grey mildew disease of cotton, correlated the decrease in chlorophyll content with diseased condition.

5.2.2 Total phenol Phenols have been found to play an important role in determining resistance or susceptibility of a host to parasitic infection. High concentration causes an instant lethal action by a general tanning effect while, low concentration causes gradual effect on the cellular constituent of the parasite. If the concentration does not occur in toxic level, the inhibition will be obviously slow. Besides, the pathogen readily detoxify low concentrations of the toxicants rather than high concentrations (Dasgupta, 1988).

There is significant positive correlation between total phenol content and disease resistance. In this study, lower levels of phenols were observed in diseased plant at both the stages of all the six genotypes. The total phenol content under both the situations (healthy and infected) increased from 90 to 120 DAS (Fig. 6). This indicates that total phenol content in the leaves imparts resistance against the disease. Results of the experiment was further supported by Chakrabarty et al. (2002); Hosagoudar et al. (2008) and Hosagoudar and Chattannavar (2010).

The marked increase in phenolic content might be due to accumulation of phenolics from surrounding healthy tissues (Farkas and Kiraly, 1962 and Jayapal and Mahadevan, 1968). The variation in phenol content in different crop plants may be attributed to the unique characters of the phenolics compounds. Phenol molecule is constructed with lipophilic and hydrophilic proteins. Such molecule will be able to orient itself on oil water interface. Phenols, directly or indirectly interfere with several metabolic systems of an organism. The present findings infer that rapid accumulation of phenolic compounds occur in incompatible (resistant) host pathogen interaction than the compatible (susceptible).

5.2.3 Sugars Sugars acts as precursor for synthesis of phenolics, phytoalexins, lignin and cellulose which play an important role in defense mechanism of plants against invading pathogens.

In susceptible plants, disease development was more whereas, the mean sugar content comes down at later part of the crop growth. This indicated the utilization of these sugars by the invading pathogens for their nutrition. Such nutritional utilization of sugars by the invading pathogens have been reported earlier also by Krog et al. (1961). The disease reaction has been correlated with the sugar level in different crop plants. Generally, high levels of total sugars, reducing sugars and non-reducing sugars in the host plants are stated to be responsible for disease resistance. Difference in sugar level between resistant and susceptible genotypes was due to inherent character of the genotypes.

In the present investigation, the Bt cotton genotypes viz., RCH-2 Bt, MRC-7351 Bt and Bunny Bt exhibited more quantities of total sugar, reducing and non-reducing sugar content when compared with the non-Bt genotypes viz., Jayadhar, Abhadita and DCH-32. Sugars, under both the situations (healthy and infected) decreased from 90 to 120 DAS. Meanwhile, healthy leaves showed higher concentration than the diseased leaves (Fig. 7, 8 and 9). These results are in agreement with the findings of Ramdayal and Joshi (1968) ; Chakrabarty et al. (2002) ; Hosagoudar et al. (2008) and Hosagoudar and Chattannavar (2010).

Fig. 2a: Mean per cent disease index of Alternaria leaf blight in different districts of northern Karnataka during kharif 2013

Fig. 2b: Mean per cent disease index of Alternaria leaf blight in different talukas of northern Karnataka during kharif 2013

Fig. 3: Effect of Alternaria leaf blight on chlorophyll 'a' content in Bt and non-Bt genotypes of cotton

Fig. 4: Effect of Alternaria leaf blight on chlorophyll 'b' content in Bt and non-Bt genotypes of cotton

Fig. 5: Effect of Alternaria leaf blight on total chlorophyll content in Bt and non-Bt genotypes of cotton

Fig. 6: Effect of Alternaria leaf blight on total phenol content in Bt and non-Bt genotypes of cotton

5.2.4 Gossypol

Major antibiotic metabolites in cotton are condensed proanthocyanidins formed from (+) catechin and (+) gallocatechin, and terpinoid aldehydes formed from desoxyhemigossypol. These metabolites occur in specific cells or tissue of healthy plants, and the terpenoids are formed in different cells from the proanthocyanidins. Concentration of the metabolites increases under the stress of disease or pest invasion. The structure, quantity and localization of constitutive and infection-induced host metabolites, and the speed of their induced biosynthesis, in relation to the resistance of tissues and varieties to diseases and pests.

In the present findings, gossypol content decreased from 90 to 120 DAS (Fig. 10). Meanwhile, gossypol content was more in diseased leaves when compared to healthy leaves. Non-Bt genotypes recorded more gossypol content than Bt genotypes in both the situations (healthy and diseased) which was further supported by the findings of Bell and Stipanovic (1978) and Chakrabarty et al. (2002).



Ten different isolates of Alternaria spp. were collected to study the morphological variability from various cotton growing regions of northern Karnataka viz., Dharwad, Haveri, Belgaum, Bagalkot, Gadag and Davangere districts. Morphological study was conducted to assess the variation existing among the isolates and it is an important tool in identification and classification of fungi.

The isolates, A2, A3, A6 and A10 showed maximum horizontal septa (6) of conidia whereas, minimum horizontal septa (4) was observed in isolates, A4 and A8. Isolates, A1, A5, A7 and A9 showed

5 horizontal septa. The isolates, A1 and A6 showed maximum conidial size of 49.38 x 12.82 µm and

48.24 x 15.79 µm, respectively. The least size of the conidia (21.5 x 6.87 µm and 21.97x 13.02 µm) was observed in isolates, A7 and A8 respectively. The measurements recorded from all the isolates were compared with that of the structural figures given by Ellis (1971) with reference to Alternaria macrospora and Alternaria alternata. From the above study, it is clear that out of ten isolates collected, two isolates showed complete resemblance with Alternaria macrospora viz., A5 and A8, five isolates showed no resemblance with Alternaria macrospora viz., A1, A3, A4, A6 and A10 and the remaining three isolates viz., A2, A7 and A9 showed complete resemblance with Alternaria alternata morphologically which was supported by the findings of Anil (2013) who reported that out of 12 isolates, only four showed complete resemblance with Alternaria macrospora morphologically. These results are in agreement with the findings of Jadhav et al. (2011) and Ramegowda (2007).


5.3.2.1 Effect of incubation period on dry mycelial weight of Alternaria macrospora

It is very important to know the number of days required for maximum growth of the fungus which will be helpful for further studies. From the present study, it is clear that Alternaria macrospora requires sixteen days to attain maximum dry mycelial weight and later declines (Fig. 11). The decline in dry mycelial weight may be due to increase in cell death than the new cells formed. The result is in agreement with the findings of Padmanabhan and Narayanaswamy (1977) who reported that the maximum growth of Alternaria macrospora was attained fourteen days after incubation in Czapeck's dox medium.


Fungi secure food and energy from the substrate upon which they live in nature. In order to culture fungus in the laboratory, it is necessary to furnish essential elements and compounds in the medium for their growth and other life processes. All media are not equally good for all fungi, nor there can be a universal substrate or artificial medium upon which all fungi can grow. So, different media were tried for Alternaria macrospora and Alternaria alternata in the present investigation. The isolates exhibited variability in cultural characters such as radial growth, type of colony margin, colour of margin, mycelial growth, sectoring and sporulation in different solid media tested. The present study revealed that the isolates, A4 and A9 showed maximum radial growth (90 mm) on many of the media viz., PDA, PCA, HEA, OMA and SDA. Among the eight media tested, HEA and OMA showed maximum radial growth in all isolates (Fig. 12). Majority of the isolates showed moderate to excellent sporulation.

Fig. 7: Effect of Alternaria leaf blight on total sugar content in Bt and non-Bt genotypes of cotton

Fig. 8: Effect of Alternaria leaf blight on reducing sugar content in Bt and non-Bt genotypes of cotton

Fig. 9: Effect of Alternaria leaf blight on non-reducing sugar content in Bt and non-Bt genotypes of cotton

Fig. 10: Effect of Alternaria leaf blight on gossypol content in Bt and non-Bt genotypes of cotton

Fig. 11: Effect of incubation period on dry mycelial weight of Alternaria macrospora

Fig. 12: Cultural variability among the ten isolates of Alternaria spp. on different solid media

Most of the isolates viz., A1, A2, A5, A7 and A9 showed grey colony colour whereas isolate, A4 showed black colour and remaining isolates, A3, A6, A8 and A10 showed both colony colour. Grey colony margin colour was predominantly observed in most of the isolates viz., A4, A6, A7 and A9

whereas colony margin of both grey and black was observed in isolate, A8 and A10. Colony margin colour of white was also observed along with grey and black margin. Irregular colony margin was observed in isolates viz., A1, A3, A5, A6, A7 and A8 on most of the media whereas, smooth margin was observed in A9 and A10. Both irregular and smooth margin was observed in observed in isolates, A2 and A4. Among the media tested, HEA showed smooth colony margin in most of the isolates. Raised mycelial growth was observed mainly in A3, A4, A5 and A7, whereas medium raised mycelial growth was seen mainly in A1, A6 and A8. Flat mycelial growth was observed mainly in A9 and A10. With respect to media, CMA showed distorted mycelial growth. Sectoring was present in isolates viz., A1,

A4, A5, A8 and A10 whereas absent in isolates, A2, A3, A6, A7 and A9. Several workers observed diversity in cultural characteristics such as growth rate, type of growth, colony colour and sporulation among different isolates of Alternaria spp. infecting sesame, sunflower and cotton (Savitha, 2004; Mesta, 2006 and Ramegowda, 2007).


Polymerase chain reaction (PCR) based molecular markers are useful tools for detecting genetic variation within populations of phytopathogens. PCR amplification of Alternaria spp. with conserved primers ITS1 and ITS4 yielded an approx. 560 bp rDNA amplicon product. Based on sequence comparison, the identification of Alternaria spp. isolates were confirmed as one Alternaria macrospora and three Alternaria alternata. These results are in conformity with the reports of Kadam (2005) who studied that the amplified products of ITS region of 11 fungal species from different crops, including strains of R. solani, R. bataticola, A. macrospora and R. areola reported in the present study, ranged between 569-575 bp, coinciding with the sizes obtained from similar fungal pathogens from other strains of the same species. Molecular techniques, if not alone, can be used in conjunction with classical methods where the latter approaches can at least narrow pathogen diagnosis to genus level. Once genus is narrowed by morphology, symptomatology, host-specificity, etc., then PCR can be used to differentiate species (Chakrabarty et al., 2007).

Specific primers for Alternaria macrospora and Alternaria alternata were used for further confirmation. All the ten isolates' rDNA amplicon was observed at 442 bp and confirmed as Alternaria macrospora and three isolates' rDNA amplicon was observed at 320 bp and was confirmed as Alternaria alternata (Fig. 13).Isolates, A2, A7 and A9 showed amplification using both the primers. The results were further supported by findings of Kadam (2005) who reported that the primer pAmac however, was not specific to A. macrospora of cotton but supported amplification of the rDNA fragment from several species of Alternaria. Lack of adequate variability in nucleotide sequences in the ITS region of different species of Alternaria did not allow designing species-specific primers for A. macrospora (Chakrabarty et al., 2007). Hence AmF and AmR primer showed amplification to all the isolates.


5.4.1 In-vitro evaluation of fungicides

The use of fungicides has become an inevitable method in the management of plant diseases particularly in Bt cotton where in there are no resistant cultivars to Alternaria leaf blight. Evaluation of new molecules of fungicides is very much essential for the effective management of the disease. In the present study, fungicides mainly the triazole compounds viz., Tebuconazole, Hexaconazole and Propiconazole were evaluated along with strobilurins viz., Pyraclostrobin and Trifloxystrobin and combi products viz., Tebuconazole 50% + Trifloxystrobin 25%, Pyraclostrobin 5% + Metiram 55%, Carbendazim 25% + Mancozeb 50% and Hexaconazole 4% + Zineb 68%. All the triazole compounds and Hexaconazole 4% + Zineb 68% were found as effective fungicides in inhibiting mycelial growth of A. macrospora at all the concentrations (0.05%, 0.075% and 0.1%) (Fig. 14). The result was further supported by Arun Kumar (2008) who reported that Propiconazole and Hexaconazole was best at all concentrations (0.1%, 0.2% and 0.3%) which completely inhibited the mycelial growth. Efficacy of these fungicides were also reported by Mallikarjun (1996); Chattannavar et al. (2004); Mesta (2006); Surviliene and Dambrauskiene (2006).

1 – Karlakatti 2 – Amminbhavi 7 – Haveri 9 – Gadag

Fig. 13: Phylogenetic relationship based on ITS rDNA among isolates of Alternaria spp.

Fig. 14: In-vitro evaluation of fungicides in inhibiting mycelial growth of Alternaria macrospora

Fig. 15: Efficacy of fungicides against Alternaria leaf blight of cotton


Inorder to manage the most important disease of cotton, Alternaria leaf blight, management practices were taken up and also to know the effective chemical among the fungicides tested. In the present investigation, it is evident that all triazoles under study were found to be effective in controlling the disease, which in turn reflected on higher yield.

Among the triazoles, Hexaconazole recorded significantly lower per cent disease index (14.33) which was on par with Propiconazole (15.67). The next best treatment was Tebuconazole (17.33 PDI). The highest per cent disease index was recorded in Mancozeb (27.33) (Fig. 15).

The cotton yield was significantly superior in all the treatments as compared to untreated control. The results indicated that, all the triazoles under study have showed higher yield i.e., Hexaconazole (1536.76 kg/ha) followed by Propiconazole (1484.10 kg/ha) and Tebuconazole (1453.87 kg/ha). Next best treatments was viz., Pyraclostrobin 5% + Metiram 55% (1412.90 kg/ha) and Tebuconazole 50% + Trifloxystrobin 25% (1355.96 kg/ha). The lowest yield was obtained in Mancozeb (1078.13 kg/ha) but it was found significantly superior over untreated control (814.00 kg/ha).

The benefit cost ratio is an important parameter for recommendation of any treatment for successful control of the disease. In the present study, though the treatments containing two sprays of Hexaconazole, Propiconazole, Tebuconazole, Pyraclostrobin 5% + Metiram 55% and Tebuconazole 50% + Trifloxystrobin 25% gave significant control of the disease, maximum Cost Benefit ratio of 2.04 was realized in treatments containing two sprays of Hexaconazole (0.1%) followed by Propiconazole @ 0.1% (1.70) and Tebuconazole @ 0.1% (1.61). This clearly indicated that two sprays of Hexaconazole (0.1%) was more useful not only in reducing the cost of protection but also gave higher benefits as compared to other treatments and can be recommended for management of Alternaria leaf blight of cotton. Even though Mancozeb @ 0.25% (1.46) showed high per cent disease index (27.33) because of its low chemical cost and can be considered best when compared to Tebuconazole 50% + Trifloxystrobin 25% and Pyraclostrobin. Hosagoudar (2012) reported that the seed treatment (ST) of Vitavax power (0.3%) + foliar spray (FS) with Propiconazole (0.1%) significantly lowered Alternaria leaf blight per cent disease index (5.54) which was on par with ST of Vitavax power (0.3%) + FS with Tebuconazole (0.1%) (6.92) followed by ST of Vitavax power (0.3%) + FS with Hexaconazole (0.1%) (8.47). Similarly Chattannavar et al. (2004) observed that the new chemical Tebuconazole (Folicur) at 0.05 and 0.07 per cent was very effective against Alternaria leaf blight and grey mildew followed by Copper oxychloride. Shtienberg and Dreishpoun (1991) reported that Difenconazole @ 0.125 kg a.i./ha and Tebuconazole at 0.187 kg a.i./ha suppressed Alternaria leaf blight to a significant extent as compared to untreated plots.

Future line of work

1. Different Alternaria spp. infecting cotton need to be identified with specific primer.

2. Surveillance study need to be done to know the disease severity at different crop stages.

3. The molecular studies should be continued to identify different pathogens infecting cotton or other species infecting cotton.

4. To search for resistant genotypes with good agronomic practices.

5. An integrated approach for management of all foliar diseases including Alternaria leaf blight should be developed.

SUMMARY AND CONCLUSIONS

Cotton (Gossypium sp.) is a crop of warm climate and requires regular supply of water, either natural in the form of rainfall or assured through canals from above surface and/or from underground sources. About 55 per cent of the world cotton area is under irrigation and the balance is rainfed. Contrary to this, 70 per cent of the cotton cultivated area in India is under rainfed conditions. Water stressed seed or plant, will have poor growth leading to low yield as well as exposure to diseases. The low productivity of cotton is attributed to many factors, one of which is the losses due to diseases although insect pests continue to be a major production constraint. A large number of fungal, bacterial, viral and nematode diseases have been reported on cotton crop right from early stage to maturity. Among them, the economically important diseases include bacterial blight, Alternaria leaf blight, grey mildew, rust and vascular wilts which occur throughout the world. Among all these diseases, Alternaria leaf blight is considered as the major fungal foliar pathogen affecting cotton.

The present investigation includes the survey for incidence of Alternaria leaf blight of cotton in northern Karnataka, physiological and biochemical changes, morphological, cultural and molecular variability studies among the different isolates collected and chemical management of Alternaria blight in both in vitro and in vivo condition.

A survey carried out during kharif 2013 revealed the incidence of the Alternaria leaf blight of cotton in Dharwad, Haveri, Belgaum, Bagalkot, Gadag and Davangere districts of northern Karnataka. The maximum per cent disease index of Alternaria blight was recorded in Dharwad (17.63) followed by Belgaum (15.17), Davangere (13.50) and Gadag (13.00) districts whereas minimum was recorded at Haveri (10.25) district.

Physiological and biochemical studies included chlorophyll 'a', chlorophyll 'b' and total chlorophyll content, total phenol content, total sugar, reducing sugar, non-reducing sugar and gossypol content on non-Bt genotypes viz., Jayadhar, Abhadita and DCH-32 and Bt genotypes viz., RCH-2 Bt, MRC-7351 Bt and Bunny Bt under both healthy and diseased condition. All the test genotypes were found to be susceptible. The results indicated that Bt genotypes recorded higher amount of chlorophyll 'a', chlorophyll 'b' and total chlorophyll, total sugar, reducing sugar and non-reducing sugar content and lower amount of total phenol and gossypol content when compared to non-Bt genotypes.

Further, there was decrease in chlorophyll 'a', chlorophyll 'b' and total chlorophyll, total sugar, reducing sugar and non-reducing sugar and gossypol content from 90 DAS to 120 DAS whereas, total phenol content increased from 90 DAS to 120 DAS. This indicates that total phenol content in the leaves imparts resistance against the disease.

Morphological variability study of ten isolates was done in order to know the variability among the size of conidia, number of vertical and horizontal septa, beak length and also length and breadth of conidia. The above recorded measurements were compared with the Alternaria macrospora and Alternaria alternata structural figure given by Ellis (1971) to identify the different Alternaria spp. Among the ten isolates, two resembled with Alternaria macrospora, five showed no resemblance with Alternaria macrospora and three isolates resembled with Alternaria alternata morphologically.

Cultural variability among the ten isolates were studied by growing on PDA to know the number of days required to attain maximum dry mycelial weight and also to find the difference in colony character among them. Important characters like diameter of radial growth, type of colony margin, colour of margin, mycelial growth, sectoring and sporulation were recorded. Sixteen days was required for Alternaria macrospora to attain maximum dry mycelial weight. Among the ten isolates, A6 recorded maximum mean radial growth (90 mm) on the media viz., PDA, PCA, HEA, OMA and SDA. Among the eight media tested, HEA and OMA showed maximum radial growth in all the ten isolates. Majority of the isolates showed moderate to excellent sporulation. Most of the isolates viz., A1, A2, A5, A7 and A9 showed grey colony colour. Isolates, A3, A6, A8 and A10 showed grey and black colony whereas, isolate, A4 showed black colony colour. Grey colony margin colour was predominantly observed in most of the isolates viz., A2, A4, A6, A7, A8, A9 and A10. Colony margin of black and white was also observed in isolates, A1, A3 and A5. Irregular colony margin was observed in isolates viz., A1, A3, A5, A6, A7 and A8 on most of the media whereas smooth margin was observed in A9 and A10. Isolates, A2 and A4 showed both irregular and smooth colonies. Among the medias, HEA showed smooth colony margin on most of the isolates. Raised mycelial growth was mainly observed in A2, A3, A5 and A7, whereas medium raised mycelial growth were seen mainly in A1 and A10. Flat mycelial growth was observed mainly in A9 and A10. Isolates, A4 and A6 showed all the mycelial growth

characters. Sectoring was present in isolates viz., A1, A4, A5, A8 and A10 whereas, absent in isolates viz., A2, A3, A6, A7 and A9.

The inoculation study conducted to know the transmission property of all the ten isolates revealed that the pathogen got transmitted to cotton crop.

The PCR amplification and sequencing of ITS rDNA region of fungus was best molecular tool for identification of different Alternaria spp. All the ten isolates showed rDNA amplicon at 560 bp. Specific primers for Alternaria macrospora and Alternaria alternata showed rDNA amplicon of all the ten and three isolates at 442 bp and 320 bp, respectively but sequence results revealed that three isolates viz., A2, A7 and A9 got blasted as Alternaria alternata in NCBI blast programme. It was further confirmed by using Alternaria alternata specific primer (AaF2 and AaF3) and the three isolates viz., A2, A7 and A9 were confirmed as Alternaria alternata (320 bp).

In in-vitro evaluation of systemic fungicides, Hexaconazole, Propiconazole and Hexaconazole 4% + Zineb 68% showed cent per cent inhibition at all the concentrations (0.05%, 0.075% and 0.1%). In field management of Alternaria blight of cotton, Hexaconazole @ 0.1% showed best disease control and high yield. Next best were Propiconazole and Tebuconazole.

Overall, the study revealed that the maximum disease severity was recorded in Dharwad, Belgaum and Davangere district. The results indicate that Bt genotypes recorded higher amount of chlorophyll 'a', chlorophyll 'b', total chlorophyll, total sugar, reducing sugar and non-reducing sugar content but lower amount of total phenol and gossypol content when compared to non-Bt genotypes. Further, there was decrease in total chlorophyll, total sugar, reducing sugar and non-reducing sugar and gossypol content from 90 DAS to 120 DAS whereas, total phenol content increased from 90 DAS to 120 DAS. Based on morphological characterization, it is clear that among the ten isolates, two isolates resembled Alternaria macrospora, five showed no resemblance to Alternaria macrospora and three resembled Alternaria alternata. In cultural variability studies, all the isolates showed differences among each other with respect to every characters. All the ten isolates got transmitted or showed symptom on cotton plant. According to molecular variability analysis, sequencing result revealed that one was Alternaria macrospora and three were Alternaria alternata. When specific primers were used, all ten got amplified to Alternaria macrospora primer (AmF and AmR, 442 bp) but sequence results revealed that three isolates viz., A2, A7 and A9 got blasted as Alternaria alternata in NCBI blast programme. It was further confirmed by using Alternaria alternata specific primer (AaF2 and AaF3) and all the three isolates were confirmed as Alternaria alternata (320 bp). In chemical management of Alternaria blight of cotton, Hexaconazole, Propiconazole and Hexaconazole 4% + Zineb 68% showed cent per cent inhibition at all the concentrations (0.05%, 0.075% and 0.1%) and Hexaconazole @ 0.1% showed best disease control and high yield in field condition.

REFERENCES

Anil, G. H., 2013, Studies on leaf blight of Bt cotton caused by Alternaria spp. M. Sc. (Agri.) Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

Anonymous, 2005, Ann. Rep. of the AICCIP (2005-06), CICR, Coimbatore, pp. 1-3.

Anonymous, 2011, All India Coordinated Cotton Improvement Project (AICCIP). Ann. Rep., 2010-11.

Anonymous, 2012, Agricultural Statistics at a Glance, Ministry of Agriculture.

Arnon, D. I., 1949, Copper enzyme isolated chloroplasts, polyphenol oxidase in Beta vulgaris. Physiol., 24: 1-15.

Arun Kumar, G. S., 2008, Studies on leaf blight of chrysanthemum caused by Alternaria alternata (Fr.) Keissler. M. Sc. (Agri.) Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

Arunakumara, K. T., 2006, Studies on Alternaria solani (Ellis and Martin) Jones and Grout causing early blight of tomato. M. Sc. (Agri.) Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

Ashok, B. S., 2005, Bt cotton prone to diseases says Indian study. An online article; www. financialexpress. com.

Ashtaputre, S. A., 1992, Studies on late leaf spot of groundnut caused by Phaeoisariopsis personata (Berk and Curt.). M. Sc.(Agri.) Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

Bashan, Y., 1986, Phenols in cotton seedlings resistant and susceptible to Alternaria macrospora. J. Phytopath., 116: 1-10.

Bashi, E., Sachs, Y. and Rotem, J., 1983, Relation between disease and yield in cotton field affected by Alternaria macrospora. Phytoparasitica, 11: 89-97.

Bateman, D. F. and Millar, R. L., 1966, Pectic enzymes in tissue degradation. Ann. Rev. Phytopath., 4: 119-146.

Bell, A. A. and Stipanovic, R. D., 1978, Biochemistry of disease and pest resistance in cotton. Mycopathologia, 65: 91-106.

Benagi, V. I., 1995, Epidemiology and management of late leaf spot of groundnut (Arachis hypogea) caused by Phaeoisariopsis personata (Berk and Curt.) V. Arx. Ph. D. (Agri.)Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

Berguas, R. and Reisener, H. J., 1985, Changes in photosynthesis of wheat plants infected with wheat stem rust. Phytopath Zeitschrift., 112: 165-172.

Bhargava, P. K. and Khare, M. N., 1988, Factors influencing mechanism of resistance in Alternaria leaf blight of chickpea. Indian Phytopath., 41: 363-366.

Bhaskaran, R. and Shanmugam, N., 1973, Preliminary studies on the efficacy of aureofungin-sol against foliar diseases of cotton. Hindustan Antibiotics Bull., 15 (4): 145-146.

Bhatia, I. S., Uppal, D. S. and Bajaj, K. C., 1972, Study of phenolic contents of resistant and susceptible varieties of tomato Lycopersicum esculantum in relation to early blight disease. Indian Phytopath., 25: 231-235.

Bhullar, B. S., Bajaj, K. L. and Bhatia, I. S., 1972, Studies on phenols of the resistant and susceptible varieties of chillies in relation to anthracnose disease. Phytopath Zeitschrift, 75: 236-240.

Chakrabarty, P. K., Chavhan, R. L., Sable, S. V., Narwade, A. V., Monga, D. and Khadi, B. M., 2007, Development of sensitive molecular diagnostic tools for detection of economically important fungal pathogens of cotton. Invited paper presented In: World Cotton Res. Conf.-4.

Chakrabarty, P. K., Mukewar, P. M., Sheo raj and Sravan Kumar, V., 2002, Biochemical factors governing resistance in diploid cotton against grey mildew. Indian Phytopath., 55 (2): 140-146.

Chandrashekar, M. and Ball, M. C., 1980, Leaf blight of gray mangrove in Australia caused by Alternaria alternata. Trans. Bri. Mycol. Soc., 75: 413-418.

Chattannavar, S. N., Hosagoudar, G. N., Ammajamma, R. and Ashtaputre, S. A., 2009, Survey for diseases of Bt cotton in North Karnataka. J. Cotton Res. Dev., 23 (1): 156-158.

Chattannavar, S. N., Hosagoudar, G. N. and Ashtaputre, S. A., 2010, Chemical and biological management of major foliar diseases of cotton. Karnataka J. Agric. Sci., 23 (4): 599-601.

Chattannavar, S. N., Hosagoudar, G. N. and Ashtaputre, S. A., 2011, Distribution of major foliar diseases of Bt cotton in North Karnataka. Karnataka J. Agric. Sci., 24 (4): 581-582.

Chattannavar, S. N., Sharamila, A. S., Patil, S. B. and Khadi, B. M., 2004, Reaction of Bt cotton genotypes to foliar diseases. Inter. Symp. Strat. Sust. Cotton Prod. – A Global Vision 3, Crop Prod., 23-25 November 2004, Univ. Agric. Sci., Dharwad, Karnataka (India), pp. 353-354.

Chattannavar, S. N., Srikant Kulkarni and Khadi, B. M., 2006, Chemical control of Alternaria blight of cotton. J. Cotton Res. Dev., 20 (1): 125-126.

Chauhan, M. S., Yadav, J. P. S. and Benniwal, J., 1997, Field resistance of cotton to Myrothecium leaf spot and Alternaria leaf spot (A. macrospora) diseases. J. Cotton Res. Dev., 11:196-205.

Chopra, B. L. and Sharma, J. R., 1975, A note on the method to determine the intensity of Alternaria leaf spot on cotton. J. Cotton Res., 13: 427-428.

Dasgupta, M. K., 1988, Principles of Plant Pathology, Published by Allied Publishers Private Limited, pp. 470-500.

Dastur, R. H., Asana, R. D., Sawhney, K., Sikka, S. M., Vasudeva, R. S., Khan, Q., Rao, U. P. and Sethi, B. L., 1960, Cotton in India : A Monograph, 2: 164-172.

David, J. C., 1988, Alternaria gossypina. CMI description of pathogenic fungi and bacteria. No. 593. CAB International Mycological Institute, Kew, UK.

Desai, S. A., 1979, Studies on Alternaria leaf and twig blight of cotton in Karnataka. M. Sc. (Agri.) Thesis, Univ. Agric. Sci., Bangalore, Karnataka (India).

Ellis, M. B., 1971, Dematiaceous Hypomycetes, Commonwealth mycological institute, Kew, Surrey, England, pp. 495-496.

Ellis, M. A., Ferree, D. D. and Spring, D. E., 1981, Photosynthesis, transpiration and carbohydrate content of apple leaves infected with Podosphaera leucotricha Kunze. Exlev. Phytopath., 71: 92-395.

Farkas, G. L. and Kiraly, Z., 1962, Role of phenolic compounds in the physiology of plant diseases and disease resistance. Phytopath Zeitschrift, 44: 105-150.

Gaddanakeri, M. and Srikant Kulkarni, 1998, Physiological studies on Alternaria alternata (Pr.) Keissler. A casual agent of leaf blight of turmeric. Karnataka J. Agric. Sci., 11 (3): 684-686.

Gaviyappanavar, R. S., 2012, Studies on grey mildew of cotton caused by Ramularia areola Atk and its management. M. Sc. (Agri.) Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

Gholve, V. M., Jogdand, S. M., Jagtap, G. P. and Dey, U., 2012, In-vitro evaluation of fungicides, bioagents and aqueous leaf extracts against Alternaria leaf blight of cotton. Scientific J. Veter. Adv., 1 (1): 12-21.

Gulhane, V. A. and Gurjar, A. A., 2011, Detection of diseases on cotton leaves and its possible diagnosis. Int. J. Image Proc., (IJIP), 5 (5): 590-598.

Gupta, S. K., Prakashkumar, Yadav, T. B. and Sharan, G. S., 1984, Changes in phenolic compounds, sugars and total nitrogen in relation to Alternaria leaf blight in Indian mustard. Haryana Agric. Univ. J. Res., 14: 535-537.

Hanumanthaiah, B., 1976, Studies on leaf spot disease of redgram (Cajanus cajan (L.) Millsp.) caused by Alternaria tenuissima (Fr.) Wiltshire in Karnataka. M. Sc. (Agri.) Thesis, Univ. Agric. Sci., Bangalore, Karnataka (India).

Harlapur, S. I., Chattannavar, S. N., Wali, M. C. and Kulkarni, M. S., 2004, Cotton disease problems in Ghataprabha left bank canal command region of Karnataka. Inter. Symp. Strat. Sust. Cotton Prod. – A Global Vision 3, Crop Prod., 23-25 November 2004, Univ. Agric. Sci., Dharwad, Karnataka (India), pp. 362-363.

Hawksworth, D. L., Suttan, B. C. and Ainsworth, G. C., 1983, Ainsworth and Bisbys Dictionary of the fungi. VII Ed. Commonwealth. Mycol. Inst., Kew, Surrey, England., p. 445.

Heath, M. C., 1974, Chloroplast ultrastructure and ethylene production of senescing and rust infected cowpea leaves. Canadian J. Bot., 52: 2591-2597.

Henson, J. M. and French, R., 1993, The polymerase chain reaction and plant disease diagnosis. Ann. Rev. Phytopath., 31: 81-109.

Hillocks, R. J., 1991, Alternaria leaf spot of cotton with special reference to Zimbabwe. Trop. Pest Managt., 37: 124-128.

Hiscos, J. D. and Israelstan, G. F., 1979, A method for extraction of chlorophyll from leaf tissue without maceration. Canadian J. Bot., 57: 1330-1334.

Hitchings, J., 1984, The economics of cotton cultivation: Supply and demand for 1980-1990, World Bank Working Paper 618, Washington D.C.

Hopkins, J. C. F., 1931, Alternaria gossypina (Thum) Comb. Nov. causing a leaf spot and boll rot of cotton. Trans. Brit. Mycol. Soc., 16: 134-145.

Horsfall, J. G. and Diamond, A. E., 1957, Interaction of tissue sugar, growth substances and disease susceptibility. Zpflanzekrankh Pflenzenschutz., 64: 415-421.

Hosagoudar, G. N., 2012, Epidemiology and management of leaf spot of cotton caused by Alternaria spp. Ph. D. (Agri.) Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

Hosagoudar, G. N. and Chattannavar, S. N., 2010, Biochemical studies in Bt and non Bt cotton genotypes against foliar diseases. J. Cotton Res. Dev., 24 (2): 237-242.

Hosagoudar, G. N. and Chattannavar, S. N., 2014, Integrated disease management of Alternaria leaf spot on Bt cotton through fungicides. J. Cotton Res. Dev., 28 (1): 120-124.

Hosagoudar G. N., Chattannavar, S. N. and Srikant kulkarni, 2008, Biochemical studies in Bt and Non-Bt cotton genotypes against Alternaria blight disease (Alternaria macrospora Zimm.). Karnataka J. Agric. Sci., 21 (1): 70-73.

Hosagoudar, G. N., Chattannavar, S. N. and Srikant Kulkarni, 2008, Survey for foliar diseases of Bt cotton. Karnataka J. Agric. Sci., 21 (1): 139-140.

Jadhav, B. M., Perane, R. R., Kale, A. A. and Pawar, N. B., 2011, Morphological, pathological and molecular variability among Alternaria macrospora isolates causing leaf blight of cotton. Indian Phytopath., 64 (3): 152-156.

Jaypal, R. and Mahadevan, A., 1968, Biochemical changes in banana leaves in response of leaf spot pathogen. Indian Phytopath., 21: 43-48.

Jones, G. H., 1928, An Alternaria disease of cotton plant. Ann. Bot., 42: 935-947.

Kadam, B. P., 2005, Characterization of molecular variability among some species of Alternaria that cause economically important diseases of crop plants and development of molecular diagnostic tools. M. Sc. (Agri.) Thesis, Mah. Agric. Univ., Parbhani (India).

Kamble, P. U., Ramaiah, M. and Patil, D. V., 2000, Efficacy of fungicides in controlling leaf spot disease of tomato caused by Alternaria alternata (F.) Kessiler. J. Soils and Crops, 10: 36-38.

Kaur, J. and Dhillon, M., 1990, Biochemical alterations in groundnut (Arachis hypogea L.) induced by Cercosporidium personata (Berk. and Curt.) Deighton. Indian J. Myc. Pl. path., 19: 151-156.

Kiraly, Z. and Farkas, G. L., 1962, Relation between phenol metabolism and stem rust resistance in wheat. Phytopath., 52: 657-664.

Kiran, H. R., Dhingra, Mehta, N. and Sangwan, M. S., 2003, Effect of culture filtrate of Alternaria brassicae on biochemical constituents of calli of Brassicas. J. Mycol. Pl. Path., 33 (1): 51-55.

Kirkham, D. S., 1957, Studies on the significance of polyphenolic host metabolites in the nutrition of Venturia inequalis and Venturia pirina. J. Gen. Microbiol., 17: 120-134.

Klement, Y. and Goodman, R. N., 1967, The hypersensitive reaction to infection by bacterial plant pathogens. Ann. Rev. Phytopath., 5: 17-44.

Kollar, A., Seemuller, E., Bonnet, F., Saillard, C. and Bove, J. M., 1990, Isolation of the DNA of various plant pathogenic mycoplasma like organisums from infected plants. Phytopathol., 80: 233-237.

Kotasthane, S. R. and Agrawal, S. C., 1970, Efficacy of four seed protectants for the control of bacterial blight of cotton. Pest Articles and News Summaries, 16: 334-335.

Krog, N. E., Tourneau, D. L. and Hart, H., 1961, The sugar content of wheat leaves infected with stem rust. Phytopath., 51: 75-77.

Kuc, J., 1966, Resistance of plants to infectious agents. Ann. Rev. Microbiol., 20: 337-370.

Kulkarni, N. K., 1998, Studies on early blight of potato (Solanum tuberosum L) caused by Alternaria solani (Ellis and Martin) Jones and Grout. M. Sc. (Agri.) Thesis, Univ. Agric. Sci., Bangalore, Karnataka (India).

Lakhtaria, P., Kapadiya, M. D. and Khanapara, 2011, Management of foliar diseases of cotton through chemical fungicides. J. Mycol. Pl. Path., 41 (1): 152-153.

Ling, L. and Juhwa, Y., 1941, Stem blight of cotton caused by Alternaria macrospora Zimm. Phytopath., 31: 664-671.

Mahabaleshwarappa, K. B., 1981, Studies on leaf spot of safflower (Carthamus tinctorius Linn) caused by Alternaria carthami choudhary. M. Sc. (Agri.) Thesis, Univ. Agric. Sci., Bangalore, Karnataka (India).

Malli, P. C., Udayburman and Iodha, S., 2000, Effect of planting dates and development of mungbean yellow mosaic virus on biochemical constituents of mothbean genotypes. Indian Phytopath., 53 (4): 379-383.

Mallikarjun, G., 1996, Studies on Alternaria alternata (Fr.) Keissler a causal agent of leaf blight of turmeric (Curcuma longa L.). M. Sc. (Agri.) Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

Martin, R. R., James, D. and Levesque, C. A., 2000, Impacts of molecular diagnostic technologies on plant disease management. Ann. Rev. Phytopath., 38: 207-39.

Mathur, S. B. and Sarbhoy, A. K., 1977, Physiological studies on Alternaria alternata from sugarbeet. Indian Phytopath., 30: 384-387.

Mayee, C. D. and Mukewar, P. A., 2007, Loss-inducing diseases of cotton and their management. In : Cotton in Andhra Pradesh (eds : Rao, NGP, Appa Rao and Siddique E. A.). Farm and Rural Science Foundation and ANGRAU, Hyderabad, pp, 348.

Mesta, R. K., 2006, Epidemiology and management of Alternaria blight of sunflower caused by Alternaria helianthi (hansf.) Tubaki and Nishihara. Ph. D. (Agri.) Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

Naik, M. K., Savitha, A. S., Prasad, P. S. and Lokesh, R., 2006, Alternaria sp. diversity, dominance, survival and pathogenic strategies in tropical agriculture. Paper presented In: Nation. Sem. on New Frontiers in Pl. Path., held by Indian Society of Mycology and Plant Pathology, at Kuvempu University Shimoga, 28 (20) : p39.

Nandagopal, N., 1995, Morpho-physiological, histopathological and biochemical changes in Triticum durum Desf. varieties of wheat infected by Exserohilum hawaiiensis (Bugni Court.)

Subram and Jain Ex. MB. Ellis - a causal agent of leaf blight. M. Sc. (Agri.) Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

Narayanan, N. N., Baisakh, N., Vera Cruz, C. M., Gnanamanickam, S. S., Datta, K. and Datta, S. K., 2002, Molecular breeding for the development of blast and bacterial blight resistance in rice cv. IR50. Crop Sci., 42: 2072-2079.

Naveenkumar, S., Saxena, R. P., Patak, S. P. and Chauhan, S. K. S., 2001, Management of Alternaria leaf disease of tomato. Indian Phytopath., 54: 508.

Nelson, N., 1944, A photometric adaptation of Somogyi method for determination of glucose. J. Biol. Chem., 153: 375-378.

Nene, Y. L., Thapliyal, P. N., 1993, Evaluation of fungicides In: Fungicides in Pl. Disease Control (3rd

Ed.), Oxford, IBH Pub. Co., New Delhi, p. 331.

Nosberger, J., Geiger, H. H. and Struik, P. C., 2001, Crop Sci.: Progress and Prospects, CABI publishing, New York.

Padmanabhan, P. and Narayanasamy, P., 1976, Fungicidal control of leaf spot disease of cotton caused by Alternaria macrospore Zimm. Madras Agric. J., 63: 271-273.

Padmanabhan, P. and Narayanaswamy, P., 1977, Growth studies of Alternaria macrospora Zimm. an incitant of leaf spot disease of cotton. Madras Agric. J., 64: 258-261.

Panse, V. G. and Sukhatme, P. V., 1985, Statistical Methods for Agril. Workers, Indian Council of Agricultural Research Publication, New Delhi, p. 359.

Papavizas, G. C., 1973, Status of biological control of soil borne plant pathogens. Soil Biol. Biochem., 5: 709.

Patel, V. A. and Vaishnav, M. U., 1987, Biochemical changes in rust infected leaves of groundnut. Indian J. Mycol. Pl. Path., 16: 305-306.

Percival, E. and Kohel, R. J., 1990, Distribution, collection and evaluation of Gossypium. Adv. Agron., 44: 225-228.

Prasad, Y., 2002, Studies on variability, pre and post harvest management of early blight (Alternaria solani (Eu. and Martin) Jones and Groat) of tomato. M. Sc. (Agri.) Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

Pridham, J. B., 1965, Low molecular weight compounds in higher plants. Ann. Rev. Pl. Physiol., 16: 18-36.

Rajendar, J., Pushpavathi, B., Prasad, M. S. L. and Naresh, 2013, Cultural, morphological and pathogenic characterization of isolates of Alternaria helianthi causing sunflower blight. Indian J. Pl. Prot., 41 (1): 76-84.

Ramdayal and Joshi, M. M., 1968, Post infection changes in the sugar content of leaf spot infected barley. Indian Phytopath., 21: 221-222.

Ramegowda, G., 2007, Disease scenario in Bt cotton with special reference to Alternaria leaf spot. M. Sc. (Agri.) Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

Rane, M. S. and Patel, M. K., 1956, Diseases of cotton in Bombay-I. Alternaria leaf spot. Indian Phytopath., 9: 106-113.

Rathore, P. S., 2005, Tech. and Managt. of Field Crop Prod., Agrobios (India) Publishers Jodhpur.

Raut, N. K., 1990, Association of different species of Alternaria and effect of NPK fertilization and mineral plant nutrition on the development of Alternaria blight of cotton. Indian Phytopath., 43: 309.

Ravichandra, N. G., Sathyamoorthy, A. S. and Balakrishnan, V., 1994, Evaluation of iprodione (Rovrol 50 WP) in controlling early blight of tomato (Alternaria solani). Pestology, 18: 5-6.

Roopa, R. S., 2012, Epidemiology and management of early blight of tomato caused by Alternaria solani (Ellis and Martin) Jones and Grout. M. Sc. (Agri.) Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

Rotem, J., Blickle, W. and Kranz, J., 1989, Effect of environment and host on sporulation of Alternaria macrospora in cotton. Phytopath., 79: 263-266.

Rotem, J., Wendt, U. and Kranz, J., 1988, The effect of sunlight on symptom expression of Alternaria alternata on cotton. Pl. Path., 37: 12-15.

Sandhya, H. M., 1996, Etiology, survival and management of leaf blight of Geranium. M. Sc. (Agri.) Thesis, Univ. Agric. Sci. Bangalore, Karnataka (India).

Savanur, R. D., 1984, Studies on leaf spot of cotton caused by Alternaria macrospora Zimm. M. Sc. (Agri.) Thesis, Uni. Agric. Sci. Bangalore, Karnataka (India).

Savitha, A. S., 2004, Variability and toxin studies of Alternaria spp., the incitant of blight of sesame caused by Alternaria sesami. M. Sc. (Agri.) Thesis, Univ. Agric. Sci., Dharwad, Karnataka (India).

Schaad, N. W. and Frederick, R. D., 2002, Real – time PCR and its application for rapid plant disease diagnostics. Canadian J. Pl. Path., 24: 250-258.

Shahin, E. A. and Shepherd, J. F., 1979, An efficient technique for inducing profuse sporulation of Alternaria spp. Phytopath., 69: 618-620.

Sharma, O. P., Bambawale, O. M., Dhandapani, A., Tanwar, R. K., Bhosle, B. B., Lavekar, R. C. and Rathod, K. S., 2005, Assessment of severity of important diseases of rainfed Bt transgenic cotton in southern Maharashtra. Indian Phytopath., 58: 483-485.

Shekharappa, G., 1999, Studies on foliar diseases of sesame. M. Sc. (Agri.) Thesis, Univ. Agric. Sci. Dharwad, Karnataka (India).

Sheo Raj., 1988, Grading for cotton disease, CICR, Nagpur. Bull., pp. 1-7.

Shtienberg, D. and Dreishpoun, J., 1991, Suppression of Alternaria leaf spot in pima cotton by systemic fungicides. Crop Prot., 10: 381-385.

Snedecor, V. G. and Cochran, W. G., 1967, Statistical Methods, 6th Ed., Oxford and IBH Publishing

Company, Calcutta. under the conditions of Tashkent region. Uzbekistan, pp. 324-330.

Srinivasan, K. V., 1994, Cotton Dis., Indian Society for Cotton Improvement. Bombay, pp, 156-164.

Subramanyan, P., Ramagopal, P., Malakondaiah, N. and Reddy, M. N., 1976, Physiological changes in rust infected groundnut leaves. Phytopath Zeitschrift., 87: 107-113.

Surviliene, E. and Dambrauskiene, E., 2006, Effect of different active ingredients of fungicides on Alternaria spp. grown in vitro. Agron. Res., 4 (Special issue): 403-406.

Tomiyama, K., 1963, The physiological and biochemistry of disease resistance of plants. Ann. Rev. Phytopath., 1: 295-318.

Toriyama, K., 1972, Breeding for resistance to major diseases in Japan. In : Pl. Breed. Pest and Dis. Mgt., London., pp. 110-115.

Uppal, B. N., Patel, M. K., Kamat, M. M., 1935, The fungi of Bombay Dept. of Agric., Bull. No. 176, p. 28.

Vasudeva, R. S., 1960, Dis. of Cotton in India : A Monograph (Dastur, R. H., Asana, R. D., Sawhney, K., Sikka, S. M., Vasudeva, R. S., Khan, Q., Rao, V. P., Sethi, B. L., Eds.), 2: 164-216.

Vijaykumar, C. S. K. and Rao, A. S., 1980, Physiological changes in Alternaria infected wheat leaves. Phytopath Zeitschrift., 98: 76-83.

Vincent, J. M., 1947, Distortion of fungal hyphae in presence of certain inhibitors. Nature, 159: 239-241.

Walker, J. C. and Link, K. P., 1935, Toxicity of phenolic compounds to certain onion bulb parasites. Botanical Gazette, 96: 468-484.

Ward, E., Foster, S. F., Fraaije, A. B. and Mccartney, H. A., 2004, Plant pathogen diagnostics : immunological and nucleic acid-based approaches. Ann. Appl. Biol., 145: 1-16.

Watkins, G. M., 1981, In: G. M. Watkins Ed., Compendium of Cotton Dis., Am. Phytopathological Society, pp. 2-10.

Wheeler, B. E. J., 1969, An Introduction of Plant Disease, John Wiley and Sons Ltd., London, p. 301.

Wood, K. R., 1972, The development of lesions in plant diseases. Indian Phytopath., 25: 17-28.

Woodward, J. E., Wheeler, T. A. and Boman, R. K., 2007, Occurrence of Alternaria stem blight and leaf spot of cotton in West Texas, Texas A&M university system lubbock, tx. kew Surrey, England, p. 680.

Yoah, B., 1984, Transmission of Alternaria macrospora in cotton seeds. J. Phytopath., 110: 110-118.

Appendix I: Rainfall data at Agricultural Research Station, Dharwad Farm, Dharwad, Karnataka

Months Normal Rainfall

(mm) 2013 Rainfall

(mm)

January 2.18 -

February 2.42 3.8

March 7.44 29.4

April 45.63 13

May 68.82 127

June 126.3 79.2

July 133.55 121.9

August 103.79 86

September 115.93 131.2

October 119.05 146.8

November 33.95 -

December - -

Total 759.06 738.3

Appendix II: Cost of fungicides

Particulars Cost (Rs)

Trifloxystrobin 4666 per kg

Tebuconazole 50% + Trifloxystrobin 25% 5740 per kg

Pyraclostrobin 3480 per kg

Pyraclostrobin 5% + Metiram 55% 1470 per kg

Kresoxim methyl 4400 per liter

Tebuconazole 1644 per liter

Propiconazole 1400 per liter

Carbendazim 12 %+ Mancozeb 63% 692 per kg

Hexaconazole 668 per liter

Mancozeb 400 per kg

STUDIES ON VARIABILITY AND MANAGEMENT OF Alternaria spp. CAUSING LEAF BLIGHT OF COTTON

SANGEETHA K. D. 2014 Dr. S. A. ASHTAPUTRE

Major Advisor

ABSTRACT

Cotton is one of the most ancient and important commercial crops next only to food grains. A survey carried out during kharif 2013 revealed the maximum incidence of Alternaria leaf blight of cotton in Dharwad. Among different crop stages, maximum mean incidence was recorded in boll initiation stage. Bunny Bt and NAMCOT.612 were more susceptible to Alternaria blight. Bt genotypes recorded higher amount of chlorophyll 'a', chlorophyll 'b' and total chlorophyll, total sugar, reducing sugar and non-reducing sugar content and lower amount of total phenol and gossypol content when compared to non-Bt genotypes. Among the ten isolates, two resembled with Alternaria macrospora, five showed no resemblance with Alternaria macrospora and three isolates resembled with Alternaria alternata morphologically with conidial measurements described by Ellis M. B. Sixteen days was required for Alternaria macrospora to attain maximum dry mycelial weight. Among the ten isolates, Chandanamatti (A6) recorded maximum mean radial growth. Majority of the isolates showed moderate to excellent sporulation and irregular grey colonies. Raised mycelial growth was mainly observed in A2, A3, A5 and A7, whereas medium raised mycelial growth were seen mainly in A1 and A10. Sectoring was present in isolates viz., A1, A4, A5, A8 and A10. The inoculation study conducted to know the transmission property of all the ten isolates revealed that the pathogen got transmitted to cotton crop. Specific primers for Alternaria macrospora and Alternaria alternata showed rDNA amplicon of all the ten and three isolates at 442 bp and 320 bp, respectively. In in-vitro evaluation of systemic fungicides, Hexaconazole, Propiconazole and Hexaconazole 4% + Zineb 68% showed cent per cent inhibition at all the concentrations (0.05%, 0.075% and 0.1%). In field evaluation, Hexaconazole @ 0.1% showed best disease control with high yield (1536.76 kg/ha).

Date post:	29-Jun-2020
Category:	Documents
Upload:	others
View:	1 times
Download:	1 times

STUDIES ON VARIABILITY AND MANAGEMENT OF Alternaria … · STUDIES ON VARIABILITY AND MANAGEMENT OF...

Documents