Date post: | 13-Mar-2016 |
Category: |
Documents |
Upload: | yardley-johnston |
View: | 19 times |
Download: | 0 times |
Stuff to Do
Midterm Iquestions due 1/31
• Email me your question (with answers),– if you have the capability, mail complete questions,
figures, etc. and all,– if not, write questions, with instructions…i.e. in Figure 2
of x paper, blah, blah, blah,
• Friday afternoon, I’ll post the questions on the WEB page, on Monday, you’ll have time to work on them together, in class.
0 pts 5 ptsmemory only
memory + analysis
integration of information
Cycle SequencingChain Termination
…a DNA polymerase application. ddNTPs
Taq DNA Polymerase w/ Buffer Cycles = Polymerization until Taq hits ddNTP.
dNTPs
Template
Primer
dNTPs
dNTPs and ddNTPS(mixture)
Linked on Course WEB Page.
Cycle Sequence Tutor
…and an animation,http://www.dnalc.org/shockwave/cycseq.html
Disclaimer: this review is heavily biased toward the public sequencing consortium.
Hierarchical Clone-by-Clone Whole Genome Assembly
Map First: then sequence Sequence First: then map
Genome Sequencing Strategy #1
Clone-by Clone Approach
– Order clones along the genome, then sequence,
• not dependent on acceleration of sequencing capacity,
• not dependent on advanced computer analysis,
• not dependent on ‘as-of-yet’ sequencing technologies,
• “repeats” not as big a problem?
• heavy up-front demand for human labor.
Clone-by-Clone Ordered Approach
Online Primer: mapping
Genomic Libraries
…how many clones to cover a genome?
Plasmid E. coli up to 15 kb,
Phage E. coli up to 25 kb,
Cosmid E. coli up to 45 kb,
BAC E. coli 100-500 kb,
YAC Yeast 250-1000 kb.
Vectors(carry insert DNA)
plasmid/phage hybrid
Bacterial Artificial
Chromosome
Yeast Artificial Chromosome
Vector Host Inserts
Genomic Sequences and Coverage
N = ln(1 - .9999) ln(1 - v/2,900,000,000)
v = average vector insert size
p finding clone
genome size
plasmid (5 kb) = 5.3 x 106 phage (20 kb) = 1.3 x 106
BAC (125 kb) = 2.2 x 105
YAC (500 kb) = 27,000 clones
Clone-by-Clone Ordered Approach
Contigs(Contiguos Sequences)
Find overlapping ends…
…Restriction Fragment Length Polymorphisms (RFLPs).
…Sequence,
Clone 1
Clone 2
Sequence Contig
RFLP
Restriction enzymes cut
specific DNA…
…specifically,
Fragment lengths
provide clone
identification data.
Contigs(Contiguos Sequences)
Find overlapping ends…
Find the minimal Tilling Path,
- minimum set of overlapping clones that cover the genome.
Merge good pairs of reads into longer contigs…
Minimal Tilling Path
Fig. 2
Identify minimal overlapping clones.
Shotgun Sequence Each Clone
Bacterial Artificial ChromosomesBACs
• Universal Priming Sites,
– On the vector, flanking the genomic insert.
Shotgun(self-quiz)
~ 8x - 10x coverage:
To shotgun sequence 10,000 bp, you’d need 80k - 100k bp of sequence, or ~160 - ~180 sequencing reactions.
But, 10,000 bp, at 500 bp per sequencing reaction could be done in as few as 20 sequencing reactions.
Why Shotgun?
Contigs
QC
Structural Genomic Strategies #2
Whole Genome Assembly Approach:
– Sequence first, then order,
• dependent on advances in computer analysis and sequencing technologies,
• dependent on automated labor.
WGA
• Paired End Sequencing,
– sequence both ends of the vector insert, using vector derived primers,
• Maintain mate pair data.
insert
vector
5’
5’3’
3’
Read Pairs = Mate End Pairs
5’ read(543 bp)-atatgtatattgaattacatacatattattaatgcacatttttatccggagttgtggaccatagaaagacatattgactcctcaaagtaaattctgcatgttacattgaaatcataggctaaatttgagatgcactatttttagaaagtgtagagaaaaggacaggaagaaataagcgaaagctttggtaagccaccaaacctgattactggaagaaaagaaaaaagttccgagaatagagttagatcgctggtgagggttttaaatggaacacaacaatggttgttttagagtgtgttattcttttgtatttataccttctcataggtttcttgtaatacacgcttcttcctctctctccctctctcttatggcctcgtcttgaaagcgtcttgcatgctaagagaaggctttagagcaaggagagaagggagaagttgatttatacgtccatcggatatatcttctttttatatctgtctctcttttaaggaagaaaaatggcgactgaattctcgtgggatgaaatcaagaaagaaaatg...
...ggcttgaaatatttggggcaaacaagcttgaagagaaatcagagaacaagtttttgaaattcttggggttcatgtggaatcctctctcatgggttatggagtctgctgcaatcatggctattgttttagctaatggaggaggaaaggcgccggattggcaagattttatcggtattatggtgttgcttatcatcaactccaccataagtttcatcgaggagaacaatgctggcaatgccgctgctgctctcatggcaaatcttgcaccaaagactaaggtatgcaaatttctcaatacatatatataggtatgtattttctaaaaaggagagttatataacctatgtgtgaatgtaggtgttgagagatggtaaatggggggagcaagaggcttcaatcttggttccgggtgatttgataagcatcaaattgggtgacattgttcctgctgatgctcgtctcctcgaaggagatcctttaaaaattgaccaatctgctcttactggtgaatcccttccaaccaccaaacacccaggagat - 3’ read(540 bp)
Example Sequence Output(example: 5 kb insert)
…plus trace data files associated with these sequence runs.
- rest of insert (unsequenced, ~3.9 kb) -
WGA
Structural Genomic Strategies #3 (Hybrid)
Project Comparisons(NYT: 10/3/2002)
• Decoding the genome of Plasmodium falciparum, the most dangerous of the four single-cell parasites that cause malaria, took six years and cost about $20 million, paid for by the Wellcome Trust of London, the National Institutes of Health in Bethesda, Md., and other sources. Dr. Malcolm J. Gardner of the Institute for Genomic Research in Rockville, Md., led a large team of scientists there and at the Sanger Centre near Cambridge in England. Completion of the falciparum genome was first announced at a conference in Las Vegas in February.
• The genome of Anopheles gambiae, the primary carrier of the parasite, was begun more recently and took a mere 15 months even though its genome is far larger — some 278 million units of DNA encoding 14,000 genes compared with the parasite's 23 million units of DNA and 5,268 genes. The mosquito team was led by Dr. Robert A. Holt of Celera Genomics in Rockville. The $14 million cost was born by the National Institutes of Health, by Genoscope in France and other sources.
WGA
Hybrid
Wednesday
• Please read…Science 291: 1304-1315
• WGA,• Shotgun Sequencing,• Hybrid Approach.
Compartmentalized Shotgun Approach