1

Supplemental data Materials Antibodies: Anti-MET (cat# Sc-161), anti-HDAC4 (cat# Sc-11418) (Santa Cruz Biotech), anti-FOXP1 (cat# ab16645-100) (Abcam), anti-PARP-1 (cat# 9541), anti-Pim-1 (sc-13513), anti-caspase 3, 7 and 9 (cat# 9661) (Cell Signaling Technology), anti-Bcl2 (cat# sc-92), p53 (cat# sc-10914) and Mcl-1 (cat# sc-819) (Santa Cruz Biotech), anti-caspase 8 (#AM46T) from CalBichem, anti-caspase 10 (#14-6259) and anti-caspase 12 (14-6207) were from e-Bioscience, anti-Ku70 (cat# MS-329-P) (Labvision) and anti-GAPDH (cat# mAB 374) (Chemicon International) Primers The following primers were used for MET and FoxP1 mRNAs. MET-RTF: 5'-AAATACGGT CCTA TGGCTGGTGGC and MET-RTR: 5'-TGAA ATGGTTTGGGCTGGGG; FoxP1-RTF:5'-GCT TTTTATGGCTGTGAGACACG and FoxP1-RTR:5'-TTCTGGATGGCTGA ACCGTTAC. Pim-1-RTF: CCCAGCAAATAGCAGCCTTTC and Pim-1-RTR: GTTGTTCCTGTATCAAG CACTGTCC. The PCR products were 159 bp, 161 bp and 138 bp for MET, FoxP1 and Pim-1 respectively, and annealing temperature of primers for MET and FoxP1 was 52oC and 56.7oC for Pim-1. The following primers were used to amplify 3’-UTRs. MET-3'UTR-F: CAATGGTTT TTTCACTGCCTGAC and MET-3'UTR-R: AGCCAGGTGAAATCC ATCTTAGG; MET-deltamir1-#1-F: AACCTCCACCTCCCAGGCTC and MET-deltamir1#2-R: TTGAGCCTG GGAGGTGGAGGTTGC. Pim1-3'UTR-F: TCACTGTGGGTGGTGTTCGTG and Pim1-3'UTR-R: AAAAAGGGCAGGTGGCTCAGCG. Methods Immunohistochemistry-Immunohistochemical staining of the human primary tumor samples was performed on formalin-fixed, paraffin-embedded specimens using the Ventana Benchmark System (Ventana Medical Systems, Tuscon AZ) according to the manufacturer’s recommendations. Optimal detection of FoxP1, MET and HDAC4 required the antigen retrieval CC1 for 30 minutes and dilutions of antibodies 1:1000, 1:500, and 1:500 fold, respectively.

2

Table S1. miR-1 Expression in the lung cancer and matching lung tissues. Expression of miR-1 was determined in lung cancer and matching lung tissues of different origin by real-time RT-PCR using Taqman probes and primers. Expression of miR-1 was normalized to miR-199 and 18S rRNA. Each sample was analyzed in triplicate and the results are mean of 3 values ± S.D. Sample # Cancer type Gender Normal (2-dCt) Tumor (2-dCt) Normal (2-dCt) Tumor (2-dCt)

normalized to 18S rRNA normalized to miR-191

1 Non Small Cell carcinoma F 0.03613119 0.006601221 0.139660892 0.0559390672 Squamous cell carcinoma M 0.055368782 0.003270952 0.259714776 0.0227183213 Squamous cell carcinoma M 0.016107769 4.85555E-05 0.190782401 0.0122591274 Adenocarcinoma M 0.00535423 0.000209042 0.108067154 0.043585745 Large cell carcinoma F 0.021724357 0.001477188 0.117440344 0.0050482536 Adenocarcinoma M 0.022850585 0.001185835 0.325335464 0.0859713647 Adenocarcinoma M 0.006441893 1.31573E-05 0.439824538 0.0547878588 Squamous cell carcinoma M 0.038638428 0.00949413 0.275038961 0.0197774479 Squamous cell carcinoma F 0.00889041 0.000317389 0.101214119 0.0083732310 Adenocarcinoma F 0.020108938 0.003224725 0.169575541 0.01832554611 Non Small Cell carcinoma M 0.026098747 0.021181767 0.129408115 0.12327908812 Squamous cell carcinoma M 0.0067087 0.003091056 0.153893052 0.02748903413 Squamous cell carcinoma M 0.057505918 0.010657725 0.150240112 0.00991265314 Squamous cell carcinoma M 0.037111256 0.004062074 0.079214119 0.00973230215 Non Small Cell carcinoma F 0.017106102 0.020621594 0.238437681 0.08175236316 Bronchioloalveolar cell carcinoma F 0.006706212 0.002039235 0.120460893 0.039869732

3

Table S2: Expression of miR-1 in various lung cancer cell lines Expression of miR-1 was determined in lung cell lines of different origin that include Adenocarcinoma, NSCLC (non small cell lung cancer), and SCLC (small cell lung cancer). Each sample was analyzed in triplicate and the results are mean of 3 values ± S.D. Cells Relative Expression Cells Relative expression (2-∆Ct) (2-∆Ct) NSCLC Bronchial epithelial cells H1155 0.0000150±0.000003 BEAS-2B 0.00638364±0.00023 H2049 Not detectable H2172 Not detectable H1299 0.00008±0.000005 SCLC Adenocarcinoma H82 0.000036±0.000002 H23 0.00016±0.00006 H211 Not detectable H522 0.0001±0.000002 H719 0.000043± 0.0000012 H1781 0.00014±0.000038 H792 0.00022± 0.000046 H2009 Not detectable H841 0.000017±0.000008 H2086 Not detectable H865 0.000073± 0.00002 A549 0.000013±0.000008 N417 0.0017±0.00046

4

Supplemental Figure Legends Fig. S1. Serum response factor is upregulated in human primary lung cancer. RT-PCR analysis of miR-1 in DNAse 1 treated RNA of tumor (T) and matching normal (N) tissues. Upper panel: Ethidium bromide stained gel. Lower panel: Quantitative representation of the data using Box- whisker plot. A horizontal line in each box represents the median value of SRF mRNA normalized to 18S rRNA in each group. Box denotes 25th and 75th percentile range of scores whereas whiskers represent the highest and lowest values. Fig. S2. Growth rate of BEAS-2B normal epithelial cells depleted of endogenous miR-1. A, B. Growth of cells transfected with anti-miR-1or control RNAs was measured by MTT assay beginning 48 hr post transfection (0 hr) and measuring every 24 hr thereafter. The optical density at 570 nm at 0 hr was assigned a value of 1. The results are mean of 3 independent experiments ± S.D. C. miR-1 level was measured by real-time RT-PCR and the data was normalized to 18S rRNA. Fig. S3. Immunohistochemcal analysis showed up regulation of MET, FoxP1 and HDAC4 in primary human lung cancer. Tissue sections were subjected to IHC analysis with specific antibodies. Each of the normal tissues shown was from areas of histopathologically normal lung adjacent to the lung carcinoma. FoxP1, MET and HDAC4 antigens (red) are evident in most of the malignant cells of the lung. Blue counter stain identifies the cell bodies.

5

6

7

8

Cell line Pim1/18S rRNA x1000

H23 10.38035792H522 5.64034842H2009 0.850147034H2086 47.03896086H792 5.839254877H28 3.933420117H2052 14.08203848H290 1.288581944H513 15.95331446H1977 9.752582413H2172 19.64083398H2049 33.03181377H865 4.97875245H719 49.03650612H1781 0.011725427H841 22.56139368H211 3.644660123H1155 152.8300347N417 0.449310376A549 7.139308205H1299 8.085834708BEAS-2B 0.949858347

Table S3. Expression of Pim-1 in lung cancer cell lines. Total RNA from cells was subjected to real-time RT-PCR analysis of Pim-1 and 18 S rRNA.