1

Supplemental Figure 1.Nine month old Sox2 EGFP/+ mouse tongue. Note Sox2 expression in fungiform papillae inanterior tongue (A), and vallate and foliate papillae in posterior tongue (B).

Supplemental Figure 2.Sox2 mutant phenotypes. Whole E14.5 embryos with genotype Sox2 EGFP/+ (left) andSox2EGFP/LP (right) (A). EGFP expression in anterior tongue of Sox2EGFP/+ and Sox2EGFP/LP

embryos at E14.5 (B, C) and E16.5 (D, E). Haematoxylin and eosin (H & E) stainedtongue sections of Sox2+/+ (F) and Sox2EGFP/LP (G) embryos at E16.5. BrdU labeling asshown in sections of tongues of Sox2 +/+ (H) and Sox2 EGFP/LP (I) embryos at E16.5. Sox2immunostaining of sections at E16.5 (J, K) and E18.5 (K, M). A reduction in the level ofSox2 expression is detected throughout the epithelium at E16.5. By E18.5 fungiformpapillae are no longer morphologically detected. Arrowheads show developingfungiform papillae.

Supplemental Figure 3.Palate phenotype in Sox2 mutant. EGFP expression in Sox2 EGFP/+ (A) and Sox2 EGFP/LP

(B) palates at P0. H&E stained sections of P0 Sox2 +/+ and Sox2 EGFP/LP palate (C, E).PGP9.5 immunostaining for nerve fibers in Sox2 +/+ and Sox2 EGFP/LP (D, F).

Supplemental Figure 4.

Gene expression analysis in intact tongues at E13.5 and P0(A) Comparison of expression of Wnt related genes between wild type E13.5 and P0intact tongues as determined from microarray analysis. Right hand panel shows foldchange between E13.5 and P0 tongues. (B) RT-PCR analysis for Sfrp2 andWnt6 in theintact tongue. PCR for actin is internal controlPrimers areWnt6 (ATGGATGCGCAGCACAAGCG, CGACGGGTCAGAGGCACAGG),Sfrp2 (GGTCGCTAGTCCACGATGCC, TGGGAAACTAGCATTGCAGC),

2

Supplemental Figure 5EGFP expression in tongues cultured for 2 days from E15.5 and E17.5 with NaCl (40mM) and LiCl (40 mM).

Supplemental Table 1.List of genes down- and up- regulated in Sox2 hypomorphic mutant tongues comparedwith wild type tongues (more than 2 fold). Array. Arrays were printed at the Duke Microarray Facility using an OmniGrid 300Arrayer. The arrays contain the Operon Mouse Genome Oligo Set Version 3.0(Operon, Huntsville, AL). A gene list of the array can be found athttp://microarray.genome.duke.edu/spotted-arrays/available-arrays. Probe Preparation and Microarray Hybridization. Total RNA (500 ng) from eachcondition and the reference (Universal Mouse Reference RNA, Stratagene) washybridized to oligo-dT primers at 65°C, and then incubated at 42°C for 2 hrs in thepresence of reverse transcriptase, Cy5 or Cy3-dUTP and Cy5 or Cy3-dCTP, and adeoxynucleotide mix. NaOH was used to destroy residual RNA. Cell line and referencecDNA were pooled, and mixed with 1X hybridization buffer (50% formamide, 5X SSC,and 0.1% SDS), COT-1 DNA, and poly-dA to limit nonspecific binding, and heated to95°C for 2 minutes. This mixture was pipetted onto a microarray slide and hybridizedovernight at 42°. The array was then washed at increasing stringencies, and scannedon a GenePix 4000B microarray scanner (Axon Instruments, Foster City, CA). Allprotocols are available in greater detail on the Duke Microarray Facility web site,http://microarray.genome.duke.edu/spotted-arrays/protocols. Data processing and statistical analysis. GENESPRING 6.1 program (AgilentTechnologies, Silicon Genetics, Redwood City, CA, USA), was used to perform dataanalysis. Mean polishing per chip and per gene was used to normalize each chip to itsmedian and each gene was normalized to its median. Based on the replicates of eachcondition, fold change and a t-test was performed. All raw data files and gene lists arefound at http://data.cgt.duke.edu/Hogan2.php.

E14.5

EGFP/LP

EGFP/+

S Figure 2.

S Figure 1.

9 mo 9 mo

vallateaterior tongue

EGFP/LPEGFP/+

A B

C

A

B

D

F

H

E

G

I

EGFP/LPEGFP/+

EGFP/LP+/+

EGFP/LP+/+

E14.5

E14.5

E16.5

E16.5

E16.5

H&

EB

rdU

So

x2 D

IC

EGFP/LP+/+

So

x2 D

IC

EGFP/LP+/+

E16.5

E18.5

J K

L M

E15+2 NaCl E15+2 LiCl

S Figure 5.

EGFP/+ EGFP/LP

PGP9.5 DAPI

PGP9.5 DAPI

S Figure 3.

E17+2 NaCl E17+2 LiCl

D

A B

E

C

A B

D

C

F

Sfrp2Sfrp1

Wnt5bWnt5b

Frizzled8Frizzled2

Wnt6Dkk2Dkk1

b-cateninLef1

Wnt11Tcf7

Sox2Wnt10a

Frzb-1Wnt4Sfrp4

E13.5 P0

12.745.376.584.774.464.272.612.342.111.891.821.731.221.01-3.72-4.18-4.95-9.80

foldchangeA B

Wnt6

Sfrp2

E13

.5

P0

actin

S Figure 4.

H&E

H&E

Spplemental Table 1.Operon gene ID Common Genbank Fold Down P-valueM300002976 D14Ertd449e BC031854 10.12 0.207M300002563 2900070E19Rik; 2310004O13Rik AK050883 8.397 0.079M300005798 7.683 0.001M300004640 Clns1a AK031877 6.986 0.044M300003645 Krt2-17 X74784 5.797 0.133M200008934 Rdh12 AK020927 5.755 0.009M300003307 Ssfa1 AK004489 5.335 0.038M300000531 Adh7; Adh3; Adh4; Adh-3; Adt-1; U76732 5.273 0.015M300002605 Psmc1 D50696 4.717 0.005M300002392 Exoc7 BC028927 4.662 0.001M300005263 Nek6 AK089919 4.103 0.030M200005745 Hsj2 U53922 3.905 0.165M200004354 Nisch AF315344 3.881 0.022M200004466 Sqle D42048 3.808 0.144M300002251 Txndc7 BC006865 3.624 0.002M300020127 3.525 0.314M200001801 Sox2; Sox-2 X94127 3.521 0.003M200005428 Drap1 AK087456 3.429 0.046M200004302 Sdha BC011301 3.399 0.004M300002252 Txndc7 BC006865 3.352 0.029M300002390 Ankfy1 AB011370 3.315 0.062M200011939 1500032L24Rik BC028457 3.306 0.150M300004384 Capn1 AF084459 3.269 0.006M200005429 Rpp21 AK002780 3.261 0.032M200006585 3.232 0.059M200005658 Dnajd1 BC027509 3.198 0.111M200004803 Cd44 J05163 3.171 0.203M300003598 Dscr1 AK010696 3.161 0.072M300003448 Mcm4 U89402 3.147 0.112M200008049 Ovol1 AF134805 3.1 0.027M200002267 Adprtl2 AF072521 3.021 0.135M200004502 Ebpl AK019963 3 0.067M200012034 2310057H16Rik BC008225 2.99 0.080M300003230 E430025E21Rik BC031364 2.99 0.194M200000141 Ada BC002075 2.981 0.032M200003615 Ccnh; 6330408H09Rik X82441 2.981 0.042M300003426 Cd47 BC012667 2.975 0.125M300002589 2.942 0.125M200004845 Pdcd6 X14938 2.884 0.006M200013997 Minpp1 AF046908 2.861 0.129M300003037 1110008L20Rik BC031172 2.838 0.065M300002210 Rps27a BC002108 2.808 0.090M300002207 Rtn4 AK003859 2.805 0.022M200005854 2700061N24Rik AK012465 2.757 0.027M200005809 Flna BC004061 2.741 0.093M200000852 Psmb7 AK012613 2.726 0.115M200013784 Mrps23 AK014375 2.721 0.028

M200015212 4921537D05Rik AK015007 2.72 0.147M300000938 2.702 0.369M300003249 2.694 0.000M300000710 Cs BC029754 2.685 0.068M200000608 Ube2e3 BC011477 2.679 0.138M200002043 Mcm6 D86726 2.673 0.029M300004176 Tcerg1 AB023485 2.672 0.066M200006362 BC018399 BC018399 2.671 0.061M200014486 2310058N18Rik AK009986 2.656 0.136M200012019 Ifrd2 BC037434 2.64 0.041M300001833 Katna1 BC009136 2.638 0.314M300000502 Akt2 U22445 2.626 0.090M300020911 2.62 0.001M200006017 Ap3d1 AB004305 2.617 0.106M300009302 D17Wsu155e AK012257 2.614 0.130M200000609 Arf4 D87901 2.613 0.222M200008372 S100a6 BC003832 2.603 0.000M200006916 Ifi30 AF290973 2.593 0.112M300016134 2.591 0.070M200002468 Alad X13752 2.583 0.201M200003146 Vcl; 9430097D22 L13299 2.571 0.138M300003219 4921531G14Rik BC004716 2.559 0.139M300004937 2.539 0.026M300004213 Atp9b AF155913 2.524 0.061M300003308 Pmm1 AF007267 2.512 0.005M200000693 Hn1 BC003758 2.504 0.001M200000786 Ndufb8 AK010177 2.498 0.016M200000982 Sdc1 AF134897 2.493 0.154M300004505 Cpn1 BC014692 2.479 0.023M300005012 Dtymk; Tmk; CDC8; TMPK; TYPK; mtmk; D10Ertd203eS82852 2.476 0.079M300002427 5530600A18Rik BC023133 2.475 0.018M300004468 2.462 0.198M200001015 Tk1; Tk-1; D530002A18Rik M22581 2.446 0.009M300002788 Ddx46 BC026492 2.444 0.150M200009758 Cyb561 BC006732 2.441 0.248M200003357 Cspg6 AF047601 2.428 0.027M200004877 Usp33 BC005506 2.425 0.028M300004174 Lars BC006060 2.423 0.063M200003576 Crcp BC012676 2.418 0.009M200005955 Dek AK007546 2.416 0.077M200004763 2810439N09Rik BC011220 2.415 0.209M300004439 Arl3 AF143241 2.414 0.009M300002773 2.412 0.083M200003566 Cct8 Z37164 2.411 0.115M200012478 D19Ertd703e AK035236 2.397 0.082M300002682 Siva AF033112 2.397 0.094M300005102 Rassf5 AF053959 2.385 0.218M300000140 Snapap AK080718 2.367 0.129M200013755 Gtpbp4 AK011580 2.363 0.054

M200005739 4931428D14Rik BC005731 2.359 0.014M300004369 Cfl1 D00472 2.358 0.002M300002418 0610010K14Rik AK003842 2.345 0.080M200009305 Gna12 M57618 2.341 0.003M300017222 2.339 0.299M200000803 Ech1 AF030343 2.328 0.055M300005501 Cat M29394 2.326 0.003M200011974 Col4a2; Col4a-2; MGC7371 X02899 2.323 0.235M200008014 Adsl U20225 2.308 0.045M200014074 Hagh BC019817 2.303 0.137M200005659 Rnf130 AF171875 2.302 0.132M200000746 Calr M92988 2.3 0.091M300002291 2.297 0.076M200015367 Mrpl21 AK020739 2.296 0.128M300001153 Pgam1 BC005661 2.292 0.163M300000937 Crlf1 AK019030 2.291 0.002M300002147 Hnrpab; CBF-A; Cgbfa L36663 2.291 0.021M200012670 2.288 0.048M200014605 2210016F16Rik AK008736 2.288 0.000M200004908 Ddx54 AF319547 2.285 0.133M300002641 Coq6 BC024135 2.277 0.013M200001438 Prpf8 AB047391 2.275 0.012M200006016 Fetub AJ242927 2.271 0.055M300003688 Hbb-b2 V00722 2.265 0.091M200008247 Tubb3 AK012528 2.258 0.008M300002522 1810035L17Rik AJ293625 2.252 0.127M200001252 Drg1 D10715 2.25 0.080M200002767 Slc16a1 AF058055 2.25 0.057M200001782 Gart U01023 2.243 0.023M300000427 Ixl BC023192 2.243 0.027M200000875 Prkcd AB011812 2.238 0.198M200009885 Smyd2 AK003853 2.235 0.015M300000787 Crip1 AA016512 2.232 0.028M300004438 Trim8 AF220035 2.227 0.190M300002550 Timm10 AF150101 2.225 0.138M200007814 Pold2 Z72486 2.221 0.023M300003269 Syngr1 AK010442 2.209 0.167M200006253 0710007A14Rik AK019158 2.208 0.009M200005509 Mrpl28 AK046544 2.204 0.067M200008834 Ap4s1 AK005283 2.203 0.115M200015939 2810021B07Rik AK030630 2.196 0.050M200004260 Atp6ap1 AB031290 2.195 0.146M200012082 9230117N10Rik BC003847 2.181 0.080M300000921 Rhoa AF178961 2.181 0.327M200004593 5730526G10Rik AF307777 2.177 0.172M200005773 2010003J03Rik BC024640 2.176 0.025M200004783 1110001J03Rik AK003231 2.175 0.117M300022103 Flnb BC003959 2.174 0.018M300001376 Magi1 BC031194 2.168 0.082

M300002356 Smarcd2 BC005732 2.166 0.006M300004599 Pa2g4 X84789 2.162 0.013M200016255 2310075G12Rik BC026740 2.153 0.136M300018816 AK017437 2.148 0.054M200014977 Hells AF155210 2.145 0.000M300001299 2.139 0.058M200001138 Fbp2 D42083 2.137 0.013M300002304 Bcap29 BC021661 2.136 0.065M200006403 Igfbp3 X81581 2.131 0.006M300009978 Krt1-17 M13805 2.129 0.000M200002883 Twsg1 AF295097 2.128 0.213M200005750 Nxn X92750 2.128 0.102M200013502 4933424M23Rik BC022918 2.127 0.258M300003143 Dhrs4 AK018788 2.126 0.087M200004024 Tcn2 BC003720 2.121 0.010M200013797 Pnpt1 AJ507387 2.119 0.019M300002717 2.116 0.002M300005451 Ssrp1; T160; Hmgox; Hmg1-rs1; Hmgi-rs3S50213 2.115 0.047M200000373 Lig1 U19604 2.113 0.023M200012098 D15Ertd366e BC031490 2.112 0.008M200000378 Hspa4 D85904 2.111 0.023M200006673 Bnip3l AF067395 2.109 0.125M200007940 Slc25a25 BC019978 2.108 0.163M200002575 Hr Z32675 2.106 0.008M300003631 Lass5 AK010241 2.102 0.120M300005796 2.099 0.234M200013866 0610037P05Rik BC011300 2.091 0.111M300002228 Cnot8 AK075727 2.091 0.154M200000690 Msx2; Hox8; Hox-8; Hox8.1 M38576 2.09 0.212M300004621 Nab2 U47543 2.087 0.015M200001100 Bcl7c BC005673 2.085 0.080M300005205 2.081 0.148M200004942 3110004H13Rik BC019685 2.072 0.009M200001430 Faf1 U39643 2.069 0.281M200006018 Lrp10 AB042200 2.058 0.124M200007973 Eppb9 BC008113 2.057 0.005M200002582 AK016897 2.052 0.248M200002560 Banf1 BC003709 2.05 0.022M200004059 Itgb4 BC006632 2.05 0.007M300002617 Otub2 AK006469 2.046 0.115M300011568 Olfml2b BC025654 2.046 0.058M200012027 5730592L21Rik AK017880 2.041 0.070NM_019870 2.041 0.132M300004378 Htatip AF528195 2.04 0.252M300004417 Eif3s10 X17373 2.037 0.174M200004046 Arl2 AK011366 2.036 0.065M300000570 Hnrpc; Hnrnpc; Hnrpc1; Hnrpc2; hnRNPC1; hnRNPC2; hnrnp-C; D14Wsu171eAK019958 2.036 0.091M200001588 Wnt7b M89802 2.035 0.058M200007721 Tdrd3 BC005670 2.034 0.025

M200000251 Grp58 M73329 2.033 0.049M200000687 Serf1 BC028510 2.031 0.061M300002250 Sypl; Pphn; Pan I; D12Ertd446e AF081501 2.031 0.092M200007795 Leprel2 BC016431 2.03 0.003M200008035 Nipsnap3a BC019505 2.03 0.160M200002751 Akt2 U22445 2.028 0.112M300002875 Ptcd2 AK004502 2.024 0.032M300002107 2.021 0.033M200016297 2700085E05Rik AK012569 2.02 0.031M200012129 Mina AK007810 2.016 0.039M200005345 Mrpl36 BC009166 2.015 0.063M200006531 Actl6a BC001994 2.015 0.349M200006728 Sfrs7 BC025529 2.015 0.012M300001768 H13 BC034217 2.015 0.111M300017008 2.012 0.164M300008009 Galnt2 BC007172 2.009 0.055M300001124 2.003 0.142

Operon gene ID Common Genbank Fold Up P-valueM300014793 Rps8 AK012562 5.650 0.494M300008320 Acpp AF210243 4.587 0.310M300006414 AK031675 4.167 0.035M200000809 S100a9; p14; Cagb; GAGB; L1Ag; BEE22; MRP14; 60B8AgAJ250496 3.425 0.037M300012920 Krtap6-1 D86419 3.215 0.136M300007712 Dsip1 AF201289 3.185 0.075M300013455 S100a18 AY027660 2.907 0.094M300012915 Krtap6-1 D86420 2.865 0.194M300016138 2.793 0.009M300013536 2.770 0.247M200014435 Krtap16-8 AK003281 2.740 0.185M300004310 2.732 0.050M200003787 Acpp AF210243 2.725 0.241M200008788 2310036D22Rik AK009646 2.725 0.084M200001112 Pdgfra M57683 2.695 0.008M300015689 2.695 0.083M300016347 2.625 0.087M300008087 Fez1 BC029629 2.577 0.039M300009294 2.571 0.002M300015463 Actc1; Actc-1 M26774 2.558 0.184M200013362 Vmd2l1 BC031186 2.532 0.071M300009693 2.532 0.037M300020104 AK008862 2.525 0.072M300021114 9130413I22Rik AB041651 2.519 0.574M300008111 Arpp19 W66839 2.506 0.532M300021159 2.506 0.202M300021927 2.488 0.008M200000352 Fmo1 BC011229 2.457 0.073

M300014272 2.445 0.299M300008633 Myh2 BC008538 2.421 0.329M200004804 Rtn2 AF038539 2.410 0.101M300014460 2.387 0.178M200014500 1110055J05Rik AK003518 2.375 0.122M200010001 Sprrl3 AK008643 2.347 0.003M200002465 Krtap6-1 D86420 2.326 0.159M200004118 Car12 BC031385 2.304 0.125M200005834 Enpp2 BC003264 2.294 0.061M200015455 Txnip BC011212 2.294 0.092M200007718 Atp2a1 BC036292 2.288 0.354M300012113 2.283 0.068M300020942 2.273 0.132M200002241 A030009H04Rik AB041807 2.252 0.060M200013335 ACTA1 U02285 2.247 0.267M200013392 Krtap21-1 AK003736 2.247 0.328M300011074 1700090G07Rik AK018916 2.242 0.109M200001714 Chi3l1 X93035 2.227 0.205M200012744 Defb6 AB063109 2.203 0.021M300008535 2.193 0.078M300011537 2310047C17Rik BC028439 2.174 0.049M300010694 2310038K02Rik BC026444 2.169 0.300M300013487 1110055J05Rik AK003518 2.165 0.073M200013810 Sprrl5 AK003951 2.146 0.067M300013788 2600011C06Rik BC010792 2.137 0.139M300015464 Actc1; Actc-1 M26774 2.114 0.270M200008296 Gcnt1 D87332 2.110 0.038M200016211 Agtr2 U11073 2.110 0.075M300008720 2.105 0.042M300015802 B230315M08Rik AF251704 2.105 0.179M200005167 Gjb6; Cx30; D14Bwg0506e Z70023 2.101 0.021M200004986 Pr1 AJ272046 2.088 0.266M200009258 Nrf1 AK006956 2.045 0.047M300010365 2.033 0.060M300018220 2.028 0.009M300019304 2.024 0.101M200007706 1810008K03Rik BC025169 2.020 0.034M300000237 2810003C17Rik AK045539 2.008 0.048M300013346 Capn6 Y12582 2.008 0.033M300016065 2.008 0.054M200011800 1110031B11Rik AK003998 2.004 0.165M200015986 Sprrl2 AK003412 2.004 0.074M200003223 Hal L07645 1.988 0.014M300017618 1.972 0.012M300022283 1.969 0.007M200015169 Serpinb7 AF105328 1.961 0.236M300007001 Slc6a6 AF020194 1.957 0.062M300020845 X05165 1.957 0.142