Current Biology, Volume 23

Supplemental Information

Recruitment of UBPY and ESCRT Exchange

Drive HD-PTP-Dependent Sorting

of EGFR to the MVB Nazim Ali, Ling Zhang, Sandra Taylor, Alex Mironov, Sylvie Urbé, and Philip Woodman Supplemental information inventory The supplemental information contains: Supplemental Figure 1, related to Figure 1 Supplemental Figure 2, related to Figure 2 Supplemental Figure 3, related to Figure 3 Supplemental Figure 4, related to Figure 4 Supplemental Figure 5, related to Figure 6 Supplemental Figure 6, related to Figure 6 Supplemental Table 1 Supplemental Movie 1, related to Figure 1 (available online) Supplemental Movie 2, related to Figure 1 (available online) Supplemental Movie 3, related to Figure 1 (available online) Supplemental Movie 4, related to Figure 6 (available online) Supplemental Experimental Procedures Supplemental References

Figure S1, related to Figure 1. A: Tomogram of endosome from control cell; view of first section. See Movie S1 for tomogram and model. B: Western blot of HD-PTP knockdown, showing actin as a loading control. C: Tomogram of vacuolar endosomal region from HD-PTP depleted cell; view of first section. See Movie S2 for tomogram and model. D: Tomogram of tubulovesicular endosomal region from HD-PTP depleted cell; view of first section. See Movie S3 for tomogram and model. Scale bars for all tomograms = 200 nm. E: Western blot of EGFR showing levels are slightly reduced in HD-PTP depleted cells. F: EGFR was localized by immunofluorescence in control and HD-PTP depleted cells. Note the accumulation of EGFR on intracellular membranes upon HD-PTP depletion. Bar = 10 µm.

Figure S2, related to Figure 2. A: Directed Y2H with the indicated HD-PTP or Alix baits. B: Yeast cultures transformed with STAM2 prey and indicated baits were assayed for α-galactosidase. Means of triplicates +/- S.D. C: Yeast cultures transformed for STAM2 and as indicated were assayed for α-galactosidase. Means of triplicates +/- S.D. D: GST or GST-CHMP4B was incubated with or without WT or L/I-DD mutant His6-HD-PTP Bro1-V. Samples were IP’ed with anti-His and Coomassie stained. E: Y2H with the indicated baits and FL UBAP1 as prey. F: Lysates from HeLaM cells expressing HA-STAM2 and HD-PTP-myc were immunoprecipitated with anti-HA and probed for HA and myc. G: Top panel: the indicated point mutants of full-length HD-PTP were analysed by Y2H against STAM2 (note that the L/I-DD mutant is from a separate experiment). Bottom panel: the indicated HD-PTP mutants were analyzed against STAM2, or against TSG101 as a control.

Figure S3, related to Figure 3. Colour images and merge versions of Figure 3D. RPE cells were immunostained for endogenous Hrs (green) and HD-PTP (magenta). Bar = 10 µm.

Figure S4, related to Figure 4. A: Left; HeLaM cells were treated with the indicated HD-PTP siRNA oligos, and cell lysates blotted for Hrs or for tubulin as a control. Right; RPE cells treated with or without HD-PTP siRNA were blotted for Hrs or for tubulin as a control. B: Control or HD-PTP depleted cells were incubated for 8 h with or without 1 µM Iressa, then lyzed and analyzed by WB. Top: typical blot. Bottom: blots from 3 experiments were quantified, +/- SD, and normalised to control values. C: Control or HD-PTP kd HeLaM cells were incubated in serum-free medium for 8 h with or without Iressa. After washing out the drug, cells were pulse-chased with fluorescent EGF for 3 h. Cells were scored for the appearance of EGF in clusters, indicative of defective EGF trafficking. Values are from a single experiment [n = 400]). D: Membrane and cytosol fractions from control or HD-PTP depleted cells were analyzed by Western blot. TfR; transferrin receptor, used as a membrane marker. E: EGFR IPs from control or siRNA-treated cells were analyzed by Western blotting.

Figure S5, related to Figure 5. A: Myc-CHMPs were translated in wheat germ lysates, then blotted for anti-myc or anti-CHMP4B. B: Untreated HD-PTP-myc cells, or cells transfected with either GFP alone or with GFP and HA-STAM2 were subjected to a PLA analysis using a combination of anti-myc and anti-CHMP4B, and PLA product was counted. For transfected samples, PLA product was counted in GFP-expressing cells. Means +/- SD from 3 experiments, 100 cells counted for each, to illustrate inter-experimental variation. Mann-Whitney test used for statistics. C: Control or HD-PTP depleted cells were pulsed with EGF as indicated and EGFR was IP’ed. IPs were blotted for EGFR (top), or for ubiquitin-protein conjugates using FK2 antibody (bottom). The control IP is from control cells treated with EGF for 15 min. D: Control HeLaM cells, or cells depleted of HD-PTP or Hrs, were immunoblotted as indicated. E: EGFR was immunoprecipitated from control or Hrs depleted HeLaM cells and analyzed for UBPY. Left; total lysates. Right; IPs. F: The experiment shown in Figure 5D was also blotted for GST. The asterisk points to GST-CHMP4 degradation products. G: HD-PTP provides a platform for ESCRT exchange on EGFR. Recruitment of CHMP4B and UBPY to HD-PTP (solid lines) displaces STAM2 (broken line) from HD-PTP. In conjunction, STAM2 binding facilitates UBPY-dependent deubiquitination of EGFR, ensuring release of ESCRT-0 from EGFR in favour of ESCRT-III.

Figure S6, related to Figure 6. A: WB from control or UBPY depleted HeLaM cells for UBPY or for actin. B: Control or UBPY depleted HeLaM cells were pulse-chased with Alexa488-EGF for 3 h and stained for EGFR. C: As above, but stained with FK2 antibody. D: HD-PTP depleted HeLaM cells were pulse-chased with Alexa488-EGF for 3 h and stained with FK2 antibody. Bars = 10 µm. E: Stills from Movie S4, showing cross sections through a complex endosome consisting of a large vacuole (V) and connected early MVBs (large arrow). The large vacuole contains a few large inclusions, as well as many ILVs, the majority of which are closely associated with the limiting membrane. The linked endosomes have abundant ILVs. Most anti-EGFR-gold is clustered close to the limiting membranes, though some ILVs are also gold-labelled. Note the presence of fiducial (marker) gold particles on the top section. Bar = 200 nm.

Table S1. Anti-EGFR-gold particle distribution after UBPY or HD-PTP

depletion.

Control, HD-PTP or UBPY depleted cells were incubated with α-EGFR-gold and stimulated with EGF for 30 or 180 minutes, then chemically fixed and processed for thin-section EM. Compartments were classified by morphology, and gold particles were scored over each of these as a percentage of total labelling over the cell (SD in brackets). The indicated numbers of cells (shown in bold, brackets) were from a single experiment (control and HD-PTP knock-down) or from 2 experiments (UBPY knock-down). EE = early endosome; vacuolar, electron translucent endosome with internal vesicles; LE = late endosome; electron dense vacuole with internal vesicles. LM; limiting membrane, ves; vesicle, tub; tubule. Statistical significance was determined for the presence of anti-EGFR-gold in compartment categories: *; p < 0.01, ✝; p < 0.02 vs control sample at same time-point.

Compartment Control

30 min (5)

HD-PTP

30 min (5)

UBPY

30 min (9)

Control

3 hr (5)

HD-PTP

3 hr (5)

UBPY

3 hr (10)

Ves/tub 2.3(4.3) 14.2(15.6)✝ 7.0(5.2) 0(0) 4.4(6.2) 6.5(6.4)

EE/MVB (LM)

EE/MVB (ILV)

7.9(7.6)

25.6(16.4)

14.8(11.3)

4.9(3.3)*

36.3(19.1)

22.8(10.7)

1.0(1.5)

7.8(11.5)

3.2(5.1)

2.1(3.4)

3.1(3.1)

8.7(13.0)

LE/MVB (LM)

LE/MVB (ILV)

6.8(6.0)

52.9(20.6)

0.2(0.4)*

1.4(3.2)*

3.4(6.1)

4.4(3.8)*

0.9(1.2)

39.0(22.0)

0.5(1.2)

10.3(15.9)✝

2.7(2.1)

35.6(24.6)

Lys (lumen) 4.4(9.9) 0.1(0.2) 0 51.2(27.7) 3.1(6.9)* 21.9(19.5)*

Cluster: ves/tub - 8.6(3.7) 3.0(4.6) - 7.1(7.3) 2.1(3.9)

Cluster: vac (LM)

Cluster vac (ILV)

-

-

38.2(12.7)

17.6(14.2)

9.8(9.5)

13.4(16.2)

- 37.2(28.6)

32.1(23.8)

11.0(18.0)

8.5(10.7)

All: ILV/lumen 82.9(7.6) 24.0(13.4)* 40.6(12.4)* 98.1(2.9) 47.6(29.6)* 74.6(23.0)✝

Total gold 1564 1208 575 1950 573 1838

Supplemental Experimental Procedures Antibodies

Rabbit anti-Hrs was raised using GST-Hrs as immunogen. Rabbit anti-STAM2 was

generated using the peptide CPVAQQHTNYHQQPLL as immunogen. Custom

antibodies were generated by Eurogentec, Southampton, UK, and affinity purified

against immunogens. Anti-EGFR antibody, MAb 108, was purified from supernatants

of the hybridoma cell line HB-9764 (ATCC). The following commercial antibodies

were used: Mouse: anti-Hrs, FK2 anti-ubiquitin (Enzo Life Sciences); anti-myc clone

4A6 (Millipore); anti-HA (Covance); anti-TSG101 (Abcam); anti-EEA1 (BD

Biosciences); anti-TfR (Zymed); anti-tubulin (Keith Gull, University of Oxford); anti-

His6 (Sigma). Rabbit: anti-EGFR (Fitzgerald or Proteintech); anti-HD-PTP, anti-

CHMP4B (Proteintech); anti-UBPY, anti-actin (Sigma); Goat; anti-GST (GE

Healthcare). Fluorescent secondary antibodies were from Jackson ImmunoResearch

Laboratories (PA, USA). HRP conjugated secondary antibodies were from Jackson

Immunoresearch (anti-mouse) or DAKO (anti-rabbit).

DNA manipulations and constructs

Mammalian constructs

The full length HA-tagged L202D, I206D mutation in human HD-PTP has been

described previously [1]. The full length WT HD-PTP (bearing non-coding mutations

to make it resistant to siRNA) was generated by amplifying the insert from HA-

tagged HD-PTP to introduce EcoRV sites at both 5’ and 3’ends, and this was cloned

into the EcoRV site of pCDNA5 (Invitrogen; modified to include a C-terminal myc

tag between the EcoRV and XhoI sites). The CHMP4B ORF was cloned into the

same vector.

Four point mutations were introduced into the proposed STAM2-binding regions of

WT HD-PTP, using PCR-based mutagenesis with Herculase II polymerase (Agilent)

using the following primers:

P716A and P717A (site A): Forward; 5'- AGC TGA AGA AGA AGG CTG CTC

CAC GGC CCA CAG 3'; reverse 5'- CTG TGG GCC GTG GAG CAG CCT TCT

TCT TCA GCT 3'

P728A and R730A (site B): Forward; 5'- AAA GCC GCT GCT GGC TCG CGC

TGA GGA GAG TGA G 3' ; reverse 5' CTC ACT CTC CTC AGC GCG AGC CAG

CAG CGG CTT T 3'

HA-tagged mouse STAM2, as well as STAM2(DSH3) and STAM2(L176A/S177A),

were as described [2, 3].

Bacterial expression constructs

GST-UBPY was expressed as described [4]. GST-CHMP4B and His6-HD-PTP(Bro1-

V) (including point mutations in HD-PTP) were expressed as described [1, 5].

Yeast Two-Hybrid constructs

Human STAM2 in pGADT7: This was generated from a human STAM2 in the

pGBKT7 vector. The STAM2 sequence used in this vector was obtained from a

cDNA library of HEK293T cells using the following primers: Forward: 5’

CATGGAGGCCGAATTCATGCCTTTGTTCACCGCCAACC 3’, Reverse: 5’

GGATCCCCGGGAATTCCTAAAGGAGAGGCTGCTGATGG 3’

The human STAM2 was then sub-cloned into the pGADT7 vector using the following

primers: Forward: 5'-CGGGATCCAGATGCCTTTGTTC-3' and Reverse: 5'-

GAGGATCCTCTAAAGGAGAG-3'. The human STAM2 clone gave identical

results to earlier experiments where the mouse HA-tagged construct was used as a

template to amplify a full length mouse clone to sub-clone into pGADT7 prey vector,

with these primers: Forward: 5'-CGGGATCCAGATGCCTTTGTTC-3' and Reverse:

5'-GAGGATCCTCTAAAGGAGAG-3'.

The following HD-PTP Bro1V and Alix Bro1V constructs were cloned into the

EcoRI site of pGBKT7 bait, using the Clontech In-Fusion method, as previously

described [5]. These primers were used to obtain HD-PTP Bro1 (In-Fusion cloning

method): Forward: 5'-

CATGGAGGCCGAATTCATGGAGGCCGTGCCCCGCATGCCCATG-3' and

Reverse: 5'-GGATCCCCGGGAATTCTTATACCAGTTTGGCAAAGATGTCAGG-

3'

And for the HD-PTP V domain (In-Fusion cloning method): Forward: 5'-

CATGGAGGCCGAATTCCCCATGGCTGCCCACGAGGCCTCGTC-3' and

Reverse: 5'-GGATCCCCGGGAATTCTTACTTCTTCAGCTCCCTGTCCAGGAG-

3'

An existing HD-PTP construct containing point mutations at L202D/I206D[1], was

amplified (In-Fusion cloning method) using the following primers: Forward: 5'-

CATGGAGGCCGAATTCATGGAGGCCGTGCCCCGCATGCCCATG-3', Reverse:

5'-GGATCCCCGGGAATTCTTACTTCTTCAGCTCCCTGTCCAGGAG-3'. The

same primers were used to clone the F678D Bro1V construct, which was generated in

the lab using the following mutagenesis primers:

Forward: 5’-CAGCAGGCCAGGGACGACTACGCAGATCTG-3’ and reverse: 5’-

CTCCAGATCTGCGTAGTCGTCCCTGCCCTC-3’.

Full length HD-PTP was taken as an EcoRI fragment from HA-tagged pCDNA3.1 [1]

and was subcloned into EcoRI cut pGBT9 bait, to improve yeast growth and

expression of FL HD-PTP. UBAP1 was cloned into pGADT7 as described [5].

CHMP4B was cloned into in pACT2.2 prey (to improve yeast growth and

expression), using the Clontech In-Fusion method and the following primers:

Forward; 5'-GGA GGC CAG TGA ATT CAT GTC GGT GTT CGG G-3', reverse;

5'-CCA CCC GGG AGG AAT TCT TAC ATG GAT CCA GC-3'. The full length

L202D, I206D mutation in human HD-PTP has been described previously [5]. This

was subcloned into yeast prey vector pGBT9 using the following primers: Forward:

5’-TGT ATC GCC GGA ATT CAT GGA GGC CGT GCC CC-3’ and reverse: 5’-

GGA TCC CCG GGA ATT CTC AGG TCT TGT TGA GTG TCC-3’.

Potential STAM2 SH3-binding peptides in HD-PTP were identified using SH3

Hunter [6]. Conventional mutagenesis of the proposed STAM-binding region in full

length wild-type HD-PTP and L/I-D/D HD-PTP:

P716A: Forward: 5’- AGCTGAAGAAGAAGGCTCCGCCACGGCCCACAG-3’ ;

reverse 5’- CTGTGGGCCGTGGCGGAGCCTTCTTCTTCAGCT-3’

P716A,P717A: Forward; 5’-

AGCTGAAGAAGAAGGCTGCTCCACGGCCCACAG-3’; reverse 5’-

CTGTGGGCCGTGGAGCAGCCTTCTTCTTCAGCT-3’

In-Fusion mutagenesis, via shuttle vector pSP73 (Promega):

P717A: Forward; 5’- AAG AAG CCG GCT CCA CGG CCC ACA GCC CCA-3’

Reverse; 5’- AGC CGG CTT CTT CTT CAG CTC CCT GTC CAG-3’

PCR products for in vitro translation experiments

Full length STAM2 mRNA was generated by PCR from STAM2 in pGADT7. The

STAM2 GAT 260-416 fragment was generated by PCR with a T7 promoter and

Kozak consensus included in the forward primer:

5’-TTAATACGACTCACTATAGGGAGACCCAAGCTTCCACCATGTT

AAACATAGAGACTGAGGCAGC-3' ;

Reverse primer: 5'-TTATCAGCTTTGGGCAACAGTTACTTG-3'

Cell Culture and transfection

HeLa cells, or a derived cell line, HeLaM, were grown in DMEM supplemented with

1% NEAA, 10% Foetal Calf Serum (HyClone; Perbio) and 1% Pen-Strep. hTERT

RPE-1 (RPE) cells were grown in DMEM:Ham’s F12 (50:50) containing the above

supplements and 0.01 mg/ml hygromycin B. Doxycycline inducible HD-PTP/myc

stable cell lines were generated using host Hela-FRT cells (Stephen Taylor,

University of Manchester) and the Flp-In System (Invitrogen). Briefly, cells were co-

transfected with HD-PTP-myc and the pOG44 recombinase plasmids using JetPei

(QBiogene) and selected for approximately two weeks following Invitrogen’s

protocol. Transient transfections were performed using Lipofectamine 2000

(Invitrogen). Transfection with siRNA was performed using Interferin (QBiogene).

For siRNA, the HD-PTP, and TSG101 oligonucleotides have been described and

validated previously [5, 7] (HD-PTP: GCAAACAGCGGAUGAGCAA; TSG101:

CGAUGGCAGUUCCAGGGAA). UBPY was depleted using Dharmacon OnTarget

Plus oligonucleotide number 8 (CCACUAGCAUCCACAAGUA), and similar

findings were also obtained using oligonucleotide numbers 7

(CCACUAGCAUCCACAAGUA) and 9 (CAGAUUAGAUCGUGAUGAG). Hrs

was depleted using a pooled Dharmacon OnTarget Plus Smartpool. A non-targeting

siRNA (Dharmacon) was used for controls. Knockdown efficiency was assessed by

Western blotting. EGF was from Sigma and was used at 100 ng/ml in Optimem

(Gibco) containing 0.2% BSA.

Yeast two hybrid analysis

Yeast two-hybrid screening was performed by Hybrigenics, S.A., Paris, France

(http://www.hybrigenics-services.com). The coding sequences for amino acids 1-714

of the human HD-PTP/PTPN23 protein (GenBank accession number gi: 110681717)

was PCR-amplified and cloned into pB27 as a C-terminal fusion to LexA (N-LexA-

HD-PTP-C). The construct was checked by sequencing and used as a bait to screen a

random-primed human placenta cDNA library constructed into pP6 as previously

described [5]. 55.4 million clones (5.5-fold the complexity of the library) were

screened using a mating approach with Y187 (matα) and L40DGal4 (mata) yeast

strains as previously described [8]. His+ colonies were selected on a medium lacking

tryptophan, leucine and histidine. The prey fragments of the positive clones were

amplified by PCR and sequenced at their 5’ and 3’ junctions.

1

Interactions were further tested using the Clontech “Matchmaker Gold” system

(Clontech) as described previously [5]. The following modifications were

incorporated to allow yeast growth and expression of all constructs, including FL HD-

PTP and CHMP4b. Transformants into the Y2H Gold strain of yeast were grown on

DDO plates (deficient in tryptophan and leucine) with 0.4% D+ Glucose and 1% D+

Galactose. Transformant colonies were inoculated into 2.5 ml liquid DDO media in

triplicate (per condition) in 2% D+ Glucose and grown for 24-48 hours. A 10µl

inoculating loop was used to transfer some of each liquid culture to a square on a

DDO and QDO (additionally deficient in histidine and adenine) plates, with 0.4% D+

Glucose and 1% D+ Galactose. Identical data were obtained using human or mouse

STAM2 clones.

Immunofluorescence and Imaging

Pulse-chase experiments using Alexa488-EGF were performed as described, in which

EGF was pulsed for 3 min at 37°C and chased in unlabelled medium [5]. For EGFR,

EEA1 and FK2 labelling, cells were fixed in 3% formaldehyde and quenched with

glycine, then permeabilized for 3 min in PBS containing 0.1% Triton X-100. For

mouse anti-Hrs and rabbit anti-HD-PTP, cells were fixed in methanol at -20°C.

Fluorescence was examined using a 60 x 1.4 NA Plan Apo objective on an Olympus

IX70 microscope equipped for optical sectioning (Deltavision; Applied Precision).

For each sample a z-series at 0.2 µm intervals was captured using a CoolSnap HQ

camera (Roper Scientific). Images were processed using constrained iterative

deconvolution, and deconvolved image stacks were projected (SoftWorx; Applied

Precision). All images were opened as 16-bit grey-scale images and scaled using

linear transformations in ImageJ, then converted to 24-bit RGB files in PhotoShop

CS. Some experiments were imaged on an Olympus BX60 upright microscope fitted

with a 60 x 1.4 NA Plan Apo objective and CoolSnap ES camera, and 12-bit images

captured using MetaVue software.

Electron Microscopy

For EM pulse-chase analysis, 18 nm colloidal gold particles were conjugated to

affinity-purified anti-EGFR antibody, MAb 108. Cells were incubated with gold

conjugates in serum-free DMEM buffered with 20 mM Hepes and containing 1%

(w/v) BSA (binding medium) for 90 min at 4°C in order to allow antibody binding to

surface EGFR [9]. Cells were washed, stimulated with 100 ng/ml EGF and incubated

at 37°C for 30 min. Cells were then washed with fresh DMEM, trypsinized, and

centrifuged to form a cell pellet. The pellet was carefully resuspended in a small

amount of culture medium (~ 200 µl) to form a cell paste, and samples processed for

high pressure freezing by adapting the method of Leunissen et al. [10]. The cell paste

was quickly filled into copper tubes (Leica) with an inner diameter of 600 µm, and

then both ends of the tubes were sealed. The sealed tubes were then dropped into

liquid ethane and quickly transferred to liquid nitrogen. Here, the tubes were cut open

to expose the cells. Samples were transferred into freshly prepared freeze substitution

(FS) solution (2% OsO4, 0.05% glutaraldehyde and 0.15% H2O in acetone), cooled to

below -90°C in a Leica AFS2 FS apparatus (Leica). The FS programme was: -90°C

for 48 to 72 h; raising from -90°C to -60°C over 12 to 18 h; -60°C for 18 h; raising

from -60°C to -30°C over 12 h, -30°C for 24 h; raising to 4°C over 12 h, maintaining

at 4°C for 4~12 h (the solution is sealed in order to avoid evaporation). Finally, the

solution was replaced by room temperature acetone. Cells were subsequently scraped

off the copper tubes and collected in plastic tubes. These cells were infiltrated with

resin and embedded in resin blocks. These prepared blocks were either cut into

ultrathin sections (~70 nm) for routine EM or into thick sections (200~300 nm) for

electron tomography. Ultrathin serial sections were observed with an FEI Tecnai 12

Biotwin at 100kV. Images were taken using an integrated Orius SC1000 (model 832)

Gatan CCD camera (Gatan Inc.) using DigitalMicrograph software (Gatan Inc.). Gold

counting was performed using Image J (NIH) and employing the Cell Count plug-in

(Kurt de Vos). For analysis of ultrathin sections, control and HD-PTP depleted

samples were generated from 3 independent experiments, and each sample was

sectioned with randomized direction and depth. Two cells were randomly picked from

each section for analysis.

To generate samples for routine epon sectioning, cells were fixed for 15 min by

adding 3μM CaCl2, 4% formaldehyde, 0.15M sucrose, 0.1M cacodylate and 0.125%

glutaraldehyde into culture medium with a 1:1 ratio. Fixed cells were treated with

reduced OsO4 for 1 hour and then embedded in resin. Polymerised resin blocks were

cut as described and sections were examined using FEI BioTWIN. Cells were

randomly picked from the sections to be imaged for further analysis. For control and

HD-PTP depleted samples, 5 cells were selected from a single experiment. For UBPY

depleted samples, cells were selected from two experiments.

Electron Tomography

Section thickness was approximately 300 nm for all tomograms. Grids with thick

sections were coated with 10 nm gold particles (fiducial gold) on both sides before

imaging to provide reference points for generating tomograms. Coated grids were

dried and then imaged using a Tecnai G2 Polara TEM. The specimen holder was tilted

using 1° or 1.5° steps, and images of the sample area at tilt angles from between -60°

to -65° and +60° to +65° were taken. Image data from a second tilting axis was

collected after rotating the sample for 90°. Collected images were subsequently

processed using IMOD software package (Boulder Laboratory for 3-D Electron

Microscopy of Cells, University of Colorado, US) to generate final tomogram(s).

Statistical analysis

For quantitative analysis of Duolink experiments, data from 3 independent replicates

were obtained. For each experiment, the number of reaction product foci was counted

over each of 100 cells for each sample, using a x20 objective on a BX-60 microscope

(Olympus). Product from a blank sample, lacking one of the primary antibody pairs,

was subtracted from all values. Mean values for each 100-cell sample were

calculated, and these values from the 3 experiments were combined to generate a

mean and SD, which was used to show inter-experimental errors on figure panels. The

Mann-Whitney test was applied to values obtained from all 300 cells. Student’s T-test

was used to provide statistics for His6-HD-PTP(Bro1-V) binding experiments. For

comparative pulse-chase experiments (Figure 6B and Table S1) a one way Anova was

applied after testing for normality of data.

Supplemental References

1. Doyotte, A., Mironov, A., McKenzie, E., and Woodman, P. (2008). The Bro1-related protein HD-PTP/PTPN23 is required for endosomal cargo sorting and multivesicular body morphogenesis. Proc. Natl. Acad. Sci. USA 105, 6308–6313.

2. McCullough, J., Row, P. E., Lorenzo, O., Doherty, M., Beynon, R., Clague, M. J., and Urbe, S. (2006). Activation of the Endosome-Associated Ubiquitin Isopeptidase AMSH by STAM, a Component of the Multivesicular Body-Sorting Machinery. Curr. Biol. 16, 160.

3. McCullough, J., Clague, M. J., and Urbe, S. (2004). AMSH is an endosome-associated ubiquitin isopeptidase. J. Cell Biol. 166, 487–492.

4. Row, P. E., Liu, H., Hayes, S., Welchman, R., Charalabous, P., Hofmann, K., Clague, M. J., Sanderson, C. M., and Urbe, S. (2007). The MIT Domain of UBPY Constitutes a CHMP Binding and Endosomal Localization Signal Required for Efficient Epidermal Growth Factor Receptor Degradation. J. Biol. Chem. 282, 30929–30937.

5. Stefani, F., Zhang, L., Taylor, S., Donovan, J., Rollinson, S., Doyotte, A., Brownhill, K., Bennion, J., Pickering-Brown, S., and Woodman, P. (2011). UBAP1 Is a Component of an Endosome-Specific ESCRT-I Complex that Is Essential for MVB Sorting. Curr. Biol. 21, 1245–1250.

6. Ferraro, E., Peluso, D., Via, A., Ausiello, G., and Helmer-Citterich, M. (2007). SH3-Hunter: discovery of SH3 domain interaction sites in proteins. Nuc. Acid. Res. 35, W451–W454.

7. Doyotte, A., Russell, M. R. G., Hopkins, C. R., and Woodman, P. G. (2005). Depletion of TSG101 forms a mammalian `Class E' compartment: a multicisternal early endosome with multiple sorting defects. J. Cell. Sci. 118, 3003–3017.

8. Fromont-Racine, M., Rain, J.-C., and Legrain, P. (1997). Toward a functional analysis of the yeast genome through exhaustive two-hybrid screens. Nat Genet 16, 277–282.

9. Futter, C. E., Pearse, A., Hewlett, L. J., and Hopkins, C. R. (1996). Multivesicular endosomes containing internalized EGF-EGF receptor complexes mature and then fuse with lysosomes. J. Cell Biol. 132, 1011–1023.

10. Leunissen, J. L. M., and Yi, H. (2009). Self-pressurized rapid freezing (SPRF): a novel cryofixation method for specimen preparation in electron microscopy. J. Microsc. 235, 25–35.