SUPPLEMENTARY DATA - Diabetes · Ca2+ Channel Blocker (L- and T-type) Efonidipine hydrochloride...

SUPPLEMENTARY DATA

©2019 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db19-0589/-/DC1

Mitochondrial uncoupling coordinated with PDH activation safely ameliorates hyperglycemia via promoting glucose oxidation Authors Haowen Jiang,1,2 Jia Jin,2,3 Yanan Duan,2 Zhifu Xie,1 Yufeng Li,1 Anhui Gao, 1 Min Gu, 1 Xinwen Zhang, 1 Chang Peng, 1 Chunmei Xia, 1 Tiancheng Dong, 1 Hui Li, 2 Lifang Yu, 2 Jie Tang, 2 Fan Yang, 2* Jingya Li, 1* Jia Li, 1* Affiliations 1State Key Laboratory of Drug Research, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, CAS, Shanghai, 201203, P. R. China 2Shanghai Engineering Research Center of Molecular Therapeutics and New Drug Development, East China Normal University, Shanghai, 200062, P. R. China 3School of Life Sciences, Zhejiang Sci-Tech University, Hangzhou 310018, P. R. China *Corresponding author: Fan Yang, Shanghai Engineering Research Center of Molecular Therapeutics and New Drug Development, East China Normal University, Shanghai; +86-21-62232764; [email protected]; Jingya Li, State Key Laboratory of Drug Research, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, CAS, Shanghai; +86-21-50801313; [email protected]; Jia Li, State Key Laboratory of Drug Research, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, CAS, Shanghai; +86-21-50801552; [email protected];

This PDF file includes: Supplementary Figure S1. DNP exhibits as a classical mitochondrial uncoupler that modulates glucose and lipid metabolism in vitro. Supplementary Figure S2. The effects of DNP combined with different compounds on OCR and ECAR in vitro. Supplementary Figure S3. The effects of DCA and DNP on phosphorylated PDH in vivo. Supplementary Figure S4. DNP combined with DCA does not influence the pharmacokinetics and tissue distribution by each other. Supplementary Figure S5. Identification of candidate compounds possessing the uncoupling and PDH activation action. Supplementary Figure S6. The effects of 6j on PDH activity and energy expenditure in vivo. Supplementary Figure S7. The effects of 6j on glycemic control and insulin sensitivity in HFD mice. Supplementary Figure S8. The effects of 6j on the expression and secretion of inflammatory cytokines in vivo. Supplementary Table S1. The sequences of siRNA. Supplementary Table S2. The sequences of primers for real-time PCR. Supplementary Table S3. Detection of OCR and ECAR following L6 myotubes treated with DNP or DNP combined with test compounds. Medicinal Chemistry Section

SUPPLEMENTARY DATA


Supplementary Figure S1. DNP exhibits as a classical mitochondrial uncoupler that modulates glucose and lipid metabolism in vitro. For A-D, the results were individually representative to fold of DMSO group of myotubes, hepatocytes or 3T3-L1 cells. DMSO groups were not shown in panels. (A-B) OCR (A) and ADP/ATP ratio (B) detected in myotubes, hepatocytes and 3T3-L1 cells. (C) Detection of lactate production from myotubes, hepatocytes and 3T3-L1 cells treated with DNP for 12 hours. (D) Fatty acid oxidation detected with 3H-labeled palmitate in myotubes, hepatocytes and 3T3-L1 cells incubated with DNP for 4 hours. (E) Glucose oxidation detected with 14C-labeled glucose in myotubes incubated with DNP for 4 hours. (F) Glucose uptake detected with 3H-labeled 2-deoxyglucose in myotubes incubated with DNP for 3 hours. * P

SUPPLEMENTARY DATA


Supplementary Figure S2. The effects of DNP combined with different compounds on OCR and ECAR in vitro. (A-B) The effects of DNP combined with etomoxir (Eto) on the OCR and ECAR in myotubes. (C-D) The effects of DNP combined with galloflavin (Gal) on the OCR and ECAR in myotubes. Fatty acid oxidation was calculated upon etomoxir challenge. (E) Maximal respiration and glycolysis in myotubes incubated with PDH activators (JX06 1.2 μM, Radicicol 2.5 μM and DCA 10 mM) and mitochondrial uncouplers (CCCP 1 μM, FCCP 1 μM and DNP 1.25 μM) or uncouplers alone. (F) Immunoblot analyses of phosphorylated Ser293-PDH in myotubes, hepatocytes and 3T3-L1 cells treated with DNP or DCA for 3 hours. n=3-4 for all groups. * P

SUPPLEMENTARY DATA


Supplementary Figure S3. The effects of DCA and DNP on phosphorylated PDH in vivo. Immunoblot analyses and quantification of phosphorylated Ser293-PDH in skeletal muscle, liver and iWAT in mice administration of DNP (10 mg/kg) and DCA (1 g/kg) individually or together in 1 hour and 4 hours. n=3 for all groups. ** P

SUPPLEMENTARY DATA


Supplementary Figure S4. DNP combined with DCA does not influence the pharmacokinetics and tissue distribution by each other. (A-D) Plasma concentration of DNP and DCA and the tissue/plasma ratio of DNP and DCA were detected in C57BL/6J mice administration of DNP (30 mg/kg) and DCA (1 g/kg) individually or together in 1 hour. n=3 for all groups. Statistical significance (P) was determined by Student’s t test. All error bars, s.e.m.

SUPPLEMENTARY DATA


Supplementary Figure S5. Identification of candidate compounds possessing the uncoupling and PDH activation actions. (A) Chemical structure of compound LGH00277. (B) Mitochondrial membrane potential detected in myotubes treated with LGH00277 for 40 min and then stained with JC-1 for another 20 min. (C) Detection of OCR of myotubes treated with LGH00277. (D) Detection of OCR and ECAR of myotubes treated with DMSO or compounds. The compounds without uncoupling activity was not shown. n=3-4 for all groups. (E) Immunoblot and quantification analyses of phosphorylated Ser293-PDH in myotubes treated with compound for 3 hours. For F, the results were individually representative to fold of DMSO treated group of OCR or lactate production. DMSO groups were not shown in panels. (F) Detection of OCR and lactate contents (12-hour incubated with compounds) in myotubes. n=3-4 for all groups. * P

SUPPLEMENTARY DATA


Supplementary Figure S6. The effects of 6j on PDH activity and energy expenditure in vivo. (A) Tissue distribution of 6j in db/db mice followed by an oral administration of 40 mg/kg 6j in 2 hours. (B) Immunoblot and quantification analyses of phosphorylated Ser293-PDH in iWAT, skeletal muscle and liver following treatment with 40 mg/kg 6j for 2 hours. n=3-4 for all groups. (C) Detection of EE, OCR, RER and locomotion activity in db/db mice at 8 hours post-administration of 40 mg/kg 6j by oral gavage. EE and OCR were calculated 2-8 hours post-administration. RER was calculated 1-8 hours post-administration. Activity was calculated 8 hours post-administration. n=6-8 for groups. * P

SUPPLEMENTARY DATA


Supplementary Figure S7. The effects of 6j on glycemic control and insulin sensitivity in HFD mice. For A-C, HFD mice were orally treated with 20 mg/kg 6j for 4 weeks. (A) Fasting blood glucose concentration was assessed in mice fasted for 6 hours. (B) Glucose tolerance (2 g/kg glucose, i.p.) was assessed in mice fasted for 6 hours at the 3rd week. (C) Insulin tolerance (0.75 U/kg glucose, i.p.) was assessed in mice fasted for 6 hours at the 4th week. * P

SUPPLEMENTARY DATA


Supplementary Figure S8. The effects of 6j on the expression and secretion of inflammatory cytokines in vivo. (A-B) The relative expression of inflammatory cytokines normalized to actin expression in liver and normalized to 18s in iWAT. (C) Detection of plasma TNFα. n=6-8 for all groups. * P

SUPPLEMENTARY DATA


Supplementary Table S1. The sequences of siRNA.

The target sequences for RNAi in the mouse hepatocytes PDH-target 1 5-CCTATCGAGCACATGGCTT-3 PDH-target 2 5 -CCGAGAGGCAACAAAGTTT-3

Two target sequences were transfected into hepatocytes together

Negative control 5-TTCTCCGAACGTGTCACGT-3 The target sequences for RNAi in the L6 myotubes PDH-target 1 5-TCATTTGCGAAATTACGGGAA-3 Negative control 5-GGAGGTGGTTGACTTTCATTT -3

SUPPLEMENTARY DATA


Supplementary Table S2. The sequences of primers for real-time PCR.

Forward (5’-3’) Reserve (5’-3’) Pdk1 ATCCCCCGATTCAGGTTCA CTCCCCGGTCACTCATCTT Pdk2 CGTTGTCCATGAAGCAGTTTCTA GCCGGAGGAAAGTGAATGAC Pdk3 CCGTCGCCACTGTCTATCAA TGCGCAGAAACATATAGGAAGTTT Pdk4 GGAAGTATCGACCCAAACTGTGA GGTCGCAGAGCATCTTTGC 18s GAGCGAAAGCATTTGCCAAG GGCATCGTTTATGGTCGGAA TNF-α CCGATGGGTTGTACCTTGTC GGCAGAGAGGAGGTTGACTTT NOS2 TTGCCCCTGGAAGTTTCTCTTC GGAGCCATTTTGGTGACTCTTAGG IL-1β GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT

IL-6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC F4/80 CTTTGGCTATGGGCTTCCAGTC GCAAGGGAGGACAGAGTTTATCGTG β-actin GGACTCCTATGTGGGTGACG CTTCTCCATGTCGTCCCAGT

SUPPLEMENTARY DATA


Supplementary Table S3. Detection of OCR and ECAR following L6 myotubes treated with DNP or DNP combined with test compounds

vs DMSO (without

DNP)

vs DNP (with DNP) Function Compounds Con. (μM)

OCR ECAR OCR ECAR Mitochondrial Na+/Ca2+ Exchange Activator CGP 37157 20 0.931 1.044 1.059 0.965

Ca2+ Channel Blocker (L- and T-type) Efonidipine hydrochloride monoethanolate 1 0.911 1.078 0.934 0.992 Ca2+ Channel Blocker (L-type) SR 33805 oxalate 10 1.029 1.029 1.061 0.953 Epithelial Na+ Channel Blocker Amiloride 100 1.025 0.866 0.993 0.877 Potassium Channels Activator Diazoxide 100 1.066 0.986 1.016 0.921

Chloride Channel Blocker Bumetanide 50 1.005 1.013 1.101 1.020 K+-ATP Channel Opener Y-26763 10 1.014 1.071 1.018 0.955

Mitochondrial Ca2+ Uniporter Activator Kaempferol 10 0.922 1.046 0.966 0.984

Ion

Cha

nnel

Mitochondrial Ca2+ uniporter Inhibitor Ruthenium red 40 0.987 1.000 1.103 0.940 Mitochondrial Complex I Inhibitor Berberine 20 0.722 1.043 0.590 1.020 Mitochondrial Complex I Inhibitor Metformin 2000 0.988 1.028 0.973 0.989 Mitochondrial Complex I Inhibitor Rosiglitazone 10 0.912 1.093 0.655 1.130 Mitochondrial Complex I Inhibitor Rotenone 1 0.521 1.114 0.363 1.115

Mitochondrial Complex III Inhibitor Antimycin 1 0.525 1.248 0.355 1.180 Mitochondrial Complex III Inhibitor Azoxystrobin 5 0.559 1.151 0.413 1.013

Mitochondrial Uncoupler FCCP 0.5 1.797 1.153 1.259 1.039 Mitochondrial Uncoupler ZJ001 20 1.144 1.078 1.075 0.973

Mito

chon

dria

l OX

PHO

S M

odul

ator

Mitochondrial ATPase Inhibitor Oligomycin 2 0.583 1.186 0.707 1.124 Non-Competitive NADH-ubiquinone Oxidoreductase

Inhibitor Aureothin 10 0.572 1.261 0.368 1.047

NAD(P)H-quinone Oxidoreductase 2 Activator CB 1954 50 1.053 0.972 1.047 0.910

5-Lipoxygenase Inhibitor BW-B 70C 50 0.866 1.094 0.558 0.979

Mitochondrial Oxidoreductases Inhibitor Ebselen 50 0.844 0.981 0.938 1.029 Lipoxygenase Inhibitor 5,8,11-Eicosatriynoic acid 4 1.049 1.008 1.060 0.946

NADPH-cytochrome C Reductase Inhibitor Lawsone 20 1.079 1.045 1.011 1.030

Oxi

dord

euct

ase

MAO Inhibitor Deprenyl 2 1.003 1.079 1.049 1.015 PKC Activator Flecainide 21 0.995 0.992 1.053 0.983 PKC Activator 1-Oleoyl-2-acetyl-glycerol 5 0.873 1.052 0.578 1.019 PDKs Inhibitor DCA 5000 0.899 0.855 0.921 0.880

Non-selective Kinase Inhibitor Staurosporine 1 1.015 1.085 1.030 1.051

Enzy

me

Tran

sfer

ase

Sirt1 Inhibitor Nicotinamide 1000 1.040 1.117 0.967 1.088

SUPPLEMENTARY DATA


AMPK Activator and ACL Inhibitor ETC-1002 50 0.884 1.051 0.872 1.074 Acyl-CoA:cholesterol acyltransferase (ACAT)

Inhibitor Sandoz 58-035 5 0.987 1.073 0.916 1.069

CPT-1 Inhibitor Etomoxir 40 0.819 1.144 0.700 1.069 PKC Inibitor 1-Hexadecyl-2-O-methyl-glycerol 5 0.980 1.005 0.675 0.988

Mitochondrial Pyruvate Carriers Inhibitor UK5099 2 1.009 0.935 0.941 0.942 PKC Inibitor 1-Hexadecyl-2-arachidonoyl-glycerol 5 1.026 0.986 1.094 1.009 PKC Inibitor TMB-8 Hydrochloride 50 1.042 1.029 1.107 1.025

Glutaminase GLS1 Inhibitor BPTES 3 0.998 1.012 1.096 0.981 Na+-K+ -ATPase Inhibitor Ouabain 10 0.977 1.052 0.620 0.950

Ecto-ATPase Inhibitor ARL 67156 trisodium salt 50 0.995 0.999 0.925 1.055 ER Ca2+ ATPase Inhibitor 2,5-Ditertbutylhydroquinone 10 1.029 1.045 0.997 0.986

Hyd

rola

se

Serine Protease Inhibitor Tosyl-Phe-CMK (TPCK) 50 0.865 0.892 0.752 0.901 Fatty Acid Biosynthesis Inhibitor Cerulenin 22 0.833 1.047 0.458 0.940

Synt

het

ase

Glutamine Synthetase Inhibitor Aminophosphonobutyric acid 50 0.939 1.004 0.949 1.010

Apoptosis Inducer Gossypol 10 1.840 1.076 0.777 0.865

Apo

pto

sis

Apoptosis Inhibitor Salvianolic acid B 50 0.894 0.918 1.084 0.908 Anti-ischemic and Antioxidant MCI-186 20 0.944 1.055 1.091 0.993

Antioxidant and Antiinflammatory Guaiazulene 10 1.009 1.093 0.966 1.081

Ant

ioxi

datio

n

Antioxidant Cryptopine 10 0.969 1.129 0.955 1.062 Mitochondrial Permeability Transition Pore Inducer Betulinic acid 20 1.012 1.050 1.007 0.957 Mitochondrial Permeability Pore Opening Inhibitor Decylubiquinone 10 1.028 1.054 1.006 0.944

MPT

P

Mitochondrial Permeability Transition Pore Inhibitor BBMP 10 0.978 1.075 1.075 1.098 Ligand for Glial Mitochondrial Benzodiazepine

Receptors N,N-Dihexyl-2-(4-fluorophenyl)indole-3-

acetamide 40 1.048 1.066 0.932 1.109

Ligand for Mitochondrial DBI Receptors FGIN-1-43 10 0.976 0.996 1.079 0.953 Key precursor in purine metabolism Inosione 2000 1.090 1.009 1.084 0.954

Potent Ihibition of Mitochondrial NADH Squamolone 20 0.950 1.097 0.905 1.068 Fatty Acid Inhibitor In Blood Vessles Trimetazidine Dihydrochloride 10 0.981 1.090 1.106 1.028

Effecting Respiration Nitrofurantoin 10 0.945 1.050 0.849 1.022 PGC-1 α Transactivator ZLN005 10 0.986 1.064 0.907 1.015

Oth

ers

Oth

ers

Antidiabetic Actin 3-C11 10 0.995 1.094 0.927 1.025

SUPPLEMENTARY DATA


Medicinal Chemistry Section Chemistry. The target N-(1,3-dioxoisoindolin-5-yl)benzamides (5b, 5c, 6a-6b, 6d-6n) were prepared utilizing the synthetic routes as illustrated in Scheme 1, exemplified by compound 5j and 6j. Compound 3 was prepared starting from commercially available isoindoline-1,3-dione (1) in two steps according to published procedures, which in turn underwent selective reduction to give corresponding 5-amino-2-pentylisoindoline-1,3-dione (4). Compound 4 was next reacted with 4-chloro-2-methoxybenzoyl chloride under basic condition to give amide 5j. Demethylation reaction in the presence of BBr3 in CH2Cl2 provided phenol 6j. The conversion of the starting materials was monitored by thin-layer chromatography (TLC) or by high performance liquid chromatography (HPLC) coupled to an ultraviolet (UV) detector and to electrospray ionization mass spectrometry (ESI-MS) analysis. The new compounds were isolated by column chromatography or recrystallized to obtain pure products. All final products were fully characterized by NMR spectroscopy (1H and 13C) and high resolution mass spectrometry (HRMS). The purities of all compounds were determined by HPLC-UV to be at least 95% (see Experimental Section). Scheme 1. Synthesis of 6ja

aReagents and conditions: (a) HNO3(c), H2SO4(c), 65%; (b) 1-bromopentame, KI, DMF, reflux, 68%; (c) SnCl2·2H2O, EtOH, reflux, 90%; (d) 4-chloro-2-methoxybenzoyl chloride, pyridine, CH2Cl2, 0ºC to rt, 91%; (e) BBr3, CH2Cl2, 0ºC to rt, 91%.

SUPPLEMENTARY DATA


Compound R’ R

5b 4-Cl-2-OCH3-C6H3 (CH2)2CH(CH3)2

5c C6H5 (CH2)2CH(CH3)2

6a 5-Cl-2-OH-C6H3 (CH2)2CH(CH3)2

6b 4-Cl-2-OH-C6H3 (CH2)2CH(CH3)2

6d 3-OH-C6H4 (CH2)2CH(CH3)2

6e 2-OH-C6H4 (CH2)2CH(CH3)2

6f 5-Cl-2-OH-C6H3 (CH2)3CH3

6g 5-Cl-2-OH-C6H3 (CH2)5CH3

6h 5-Cl-2-OH-C6H3 (CH2)15CH3

6i 2-OH-C6H4 (CH2)4CH3

6j 4-Cl-2-OH-C6H3 (CH2)4CH3

6k 4-CH3-2-OH-C6H3 CH2CH(CH3)2

6l 4-Cl-2-OH-C6H3 (CH2)3CH3

6m 2,4,5-OH-C6H2 (CH2)5CH3

6n 3,4-OH-C6H3 (CH2)5CH3

EXPERIMENTAL. Commercially available chemicals were used without further purification. All products were characterized by their NMR and MS spectra. 1H NMR and 13C NMR spectra were obtained on Bruker Avance 400 or 500 instruments at 400/100 MHz or 500/125 MHz, respectively. Chemical shifts are reported in parts per million (ppm, δ) downfield from tetramethylsilane as the internal standard. Proton coupling patterns are described as broad (br), singlet (s), doublet (d), triplet (t), multiplet (m). The high-resolution mass spectra were recorded on a Bruker ESI-TOF high-resolution mass spectrometer. Melting points (uncorrected) were determined using a SGWX-4B micro melting point apparatus. Yields were not optimized. 5-Nitroisoindoline-1,3-dione (2). Fuming nitric acid (24 mL) was added to 140 mL of concentrated sulfuric acid in a beaker, and the mixture was cooled in an ice bath. As soon as the temperature of the mixed acids reached to 12°C, 20.00 g (135.93 mmol) of phthalimide was stirred in as rapidly as possible while the temperature of the nitrating mixture was kept between 10°C and 15°C. The reaction mixture was allowed to warm to room temperature in the ice bath as the ice melts, and left overnight. The clear, pale yellow solution was poured slowly with vigorous stirring onto 450 g of cracked ice, and the temperature of this mixture must not rise above 20°C. The crude nitration product was filtered through

SUPPLEMENTARY DATA


cloth on a Buchner funnel, using suction, and the mass was pressed as dry as possible. The cake was removed and stirred vigorously with ice water (200 mL). The solid was filtered; the cake was removed and stirred again with ice water (200 mL). This washing was repeated four times. This material was purified by crystallization from 200 mL of 95% ethyl alcohol to give 16.98 g product as a white solid. Yield 65%; melting point 195°C; 1H NMR (400 MHz, CDCl3) δ, 8.70 (s, 1H), 8.65 (d, J = 8.1 Hz, 1H), 8.09 (d, J = 8.1 Hz, 1H), 7.98 (br s, 1H). 2-Pentyl-5-nitroisoindoline-1,3-dione (3). In a flask was placed 10.00 g (52.05 mmol) of 2 and 4.50 g (32.56 mmol) of anhydrous potassium carbonate, 1.20 g of potassium iodide, 11.00 g (72.82 mmol) of dry 1-bromopentane and 100 mL of N,N-dimethylformamide were added. Under a reflux condenser bearing a drying tube, the mixture was heated at 135-145°C for 1.25 h. The cooled reaction mixture was poured into 500 mL of cold water, using another 250 mL of water to wash out the flask. After collecting the solid, it was washed with successive 200 mL portions of water, 2% sodium hydroxide solution and water. The product was recrystallized by dissolving it in a slight excess of 95% ethanol (100 mL) to give 9.28 g of product as a white solid. Yield 68%; 1H NMR (400 MHz, CDCl3) δ 8.65 (s, 1H), 8.59 (d, J = 8.1 Hz, 1H), 8.04 (d, J = 8.1 Hz, 1H), 3.74 (t, J = 7.3 Hz, 2H), 1.78-1.63 (m, 2H), 1.43-1.26 (m, 4H), 0.90 (t, J = 6.9 Hz, 3H). 5-Amino-2-pentylisoindoline-1,3-dione (4). In a flask, a mixture of compound 3 (7.90 g, 30.12 mmol), SnCl2·2H2O (27.10 g, 120.01 mmol) and ethanol (25 mL) was stirred at 78°C for 4h. The cooled reaction mixture was adjusted pH to 8 by potassium carbonate, and then filtered through cloth on a Buchner funnel, using suction, and the mass is pressed as dry as possible and washed with water 2 times. The crude product was extracted by ethyl acetate, dried over magnesium sulfate and distilled ethyl acetate in vacuum to give 6.30 g of product as a white solid. Yield 90%; 1H NMR (400 MHz, CDCl3) δ 7.59 (d, J = 8.1 Hz, 1H), 7.03 (s, 1H), 6.81 (d, J = 8.1 Hz, 1H), 4.37 (s, 2H), 3.61 (t, J = 7.3 Hz, 2H), 1.73-1.54 (m, 2H), 1.42-1.22 (m, 4H), 0.88 (t, J = 6.7 Hz, 3H). 4-Chloro-N-(1,3-dioxo-2-pentylisoindolin-5-yl)-2-methoxybenzamide (5j). Pyridine (0.59 g, 7.46 mmol) was added to a mixture of CH2Cl2 (10 mL), 4-chloro-2-methoxybenzoyl chloride (0.53 g, 2.58 mmol) and 4 (0.6 g, 2.58 mmol) in a 50 mL flame under a nitrogen atmosphere, and the mixture was cooled in an ice bath. As the Pyridine had all been added, the reaction mixture was allowed to warm to room temperature in the ice bath as the ice melts, and reacted for 12 h. The dichloromethane had been removed by distilling in vacuum. The 5% HCl (10 mL) was poured onto mixture and the mixture was filtered through cloth on a Buchner funnel. This material is purified by crystallization from 10 mL of 95% ethanol and obtained 0.94 g of the target compound as a white crystal. Yield, 91%; melting point 181-182°C; 1H NMR (500 MHz, CDCl3) δ 10.00 (s, 1H) , 8.20 (d, J = 8.5 Hz, 1H), 8.08 (d, J = 8.0 Hz, 1H), 8.02 (s, 1H), 7.79 (d, J = 8.0 Hz, 1H), 7.12 (d, J = 8.5 Hz, 1H), 7.04 (s, 1H), 4.11 (s, 3H), 3.65 (t, J = 7.0 Hz, 2H), 1.83-1.62 (m, 2H), 1.37-1.33 (m, 4H), 0.89 (t, J = 7.0 Hz, 3H); 13C NMR (125 MHz, CDCl3) δ 168.03, 168.00, 162.51, 157.49, 143.49, 139.79, 133.86, 133.70, 126.90, 124.31, 124.30, 122.27, 119.46, 114.47, 112.36, 56.79, 38.08, 28.96, 28.28, 22.24, 13.92; HRMS (ESI): calcd for C21H22ClN2O4 [M+H]+, 401.1263; found, 401.1265. 4-Chloro-N-(1,3-dioxo-2-pentylisoindolin-5-yl)-2-hydroxybenzamide (6j). Compound 5j (0.12 g, 0.30 mmol) was dissolved in methylene chloride (5 mL) in a conical flask, and the flask was placed in an acetone-dry ice bath at -80°C. The flask was fitted with an air condenser. A solution of 0.25 mg (1 M) of boron tribromide in methylene chloride (0.5 mL), was added carefully to the stirred solution through the condenser. When the addition was complete, a calcium chloride tube was fitted to the top of the air condenser in order to protect the reaction mixture from moisture. As the solution of boron tribromide was added, a white precipitate was formed. The reaction mixture was allowed to room temperature overnight with stirring, when a clear, brownish yellow solution was obtained. The reaction mixture was then hydrolyzed by careful shaking with 10 mL of water, thus precipitating a white solid which was dissolved by the addition of 10 mL of ethyl acetate, then washed with water and extracted with ethyl acetate three times, and the extract was dried over anhydrous magnesium sulfate. On removal of the

SUPPLEMENTARY DATA


ethyl acetate under reduced pressure, a brownish yellow oil remained which soon crystallized to give 0.11g of product as an off-white solid. Yield, 91%; melting point 192-193°C; 1H NMR (400 MHz, CDCl3) δ 11.77 (s, 1H), 8.49 (s, 1H), 8.13 (s, 1H), 8.05 (d, J = 7.9 Hz, 1H), 7.86 (d, J = 8.0 Hz, 1H), 7.60 (d, J = 8.4 Hz, 1H), 7.08 (s, 1H), 6.94 (d, J = 8.3 Hz, 1H), 3.66 (t, J = 6.9 Hz, 2H), 1.67-1.63 (m, 2H), 1.31(br s, 4H), 0.88 (t, J = 6.3 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 168.04, 167.87, 167.76, 162.62, 142.19, 141.14, 133.77, 127.85, 126.78, 125.06, 124.49, 119.80, 119.22, 115.20, 112.73, 38.28, 28.96, 28.31, 22.28, 13.93; HRMS (ESI): calcd for C20H19ClN2NaO4 [M+Na]+, 409.0931; found, 409.0918. 4-Chloro-N-(2-isopentyl-1,3-dioxoisoindolin-5-yl)-2-methoxybenzamide (5b). Following the same procedures as for the preparation of compound 5j, compound 5b was obtained from 2 in three steps with yield of 74%, 80%, 83%, respectively; melting point 188-189°C; 1H NMR (500 MHz, CDCl3) δ10.01 (s, 1H), 8.21 (d, J = 8.5 Hz, 1H), 8.10 (d, J = 8.1 Hz, 1H), 8.03 (s, 1H), 7.80 (d, J = 8.1 Hz, 1H), 7.14 (d, J = 8.5 Hz, 1H), 7.05 (s, 1H), 4.11 (s, 3H), 3.69 (t, J = 7.4 Hz, 2H), 1.64-1.54 (m, 3H), 0.97 (d, J = 6.4 Hz, 6H); 13C NMR (125 MHz, CDCl3) δ 168.13(2C), 162.66, 157.65, 143.64, 139.94, 134.01, 133.88, 127.08, 124.44 (2C), 122.42, 119.62, 114.61, 112.51, 56.95, 37.45, 36.70, 26.07, 22.50(2C); HRMS (ESI): calcd for C21H21ClN2NaO4 [M+Na]+, 423.1088; found, 423.1104. N-(2-isopentyl-1,3-dioxoisoindolin-5-yl)benzamide (5c). Following the same procedures as for the preparation of compound 5j, compound 5c was obtained from 2 in three steps with yield of 74%, 80%, 91%, respectively; mp 169-170°C; 1H NMR (400 MHz, CDCl3) δ 8.64 (s, 1H), 8.16 (d, J = 8.2 Hz, 1H), 8.13 (s, 1H), 7.92 (d, J = 7.8 Hz, 2H), 7.79 (d, J = 8.1 Hz, 1H), 7.57 (t, J = 7.2 Hz, 1H), 7.48 (t, J = 7.5 Hz, 2H), 3.64 (t, J = 7.1 Hz, 2H), 1.59-1.48 (m, 3H), 0.93 (d, J = 5.9 Hz, 6H); 13C NMR (100 MHz, CDCl3) δ 168.28, 168.08, 166.18, 143.75, 134.18, 133.79, 132.61, 129.03 (2C), 127.41(2C), 127.14, 124.52, 124.41, 114.62, 37.41, 36.71, 25.99, 22.46 (2C); HRMS (ESI): calcd for C20H20N2NaO3 [M+Na]+, 359.1372; found, 359.1360. 5-Chloro-2-hydroxy-N-(2-isopentyl-1,3-dioxoisoindolin-5-yl)benzamide (6a). Following the same procedures as for the preparation of compound 6j, compound 6a was obtained from 2 in four steps with yield of 74%, 80%, 85%, 41%, respectively; melting point 187-188°C; 1H NMR (400 MHz, DMSO-d6) δ 11.47 (br s, 1H), 10.81 (s, 1H), 8.29 (s, 1H), 8.03 (d, J = 8.0 Hz, 1H), 7.86-7.84 (m, 2H), 7.48 (d, J = 7.6 Hz, 1H), 7.04 (d, J = 8.8 Hz, 1H), 3.58 (t, J = 7.0 Hz, 2H), 1.59-1.46 (m, 3H), 0.92 (d, J = 6.3 Hz, 6H); 13C NMR (100 MHz, DMSO-d6) δ 168.07, 167.93, 165.55, 156.76, 144.24, 133.53, 133.46, 129.16, 126.57, 124.99, 124.53, 123.09, 121.00, 119.50, 114.44, 37.26, 36.28, 25.73, 22.69(2C). HRMS (ESI): calcd for C20H19ClN2NaO4 [M+Na]+, 409.0931; found, 409.0921. 4-Chloro-2-hydroxy-N-(2-isopentyl-1,3-dioxoisoindolin-5-yl)benzamide (6b). Following the same procedures as for the preparation of compound 6j, compound 6b was obtain from 2 in four steps with yield of 74%, 80%, 83%, 62%, respectively; melting point 192-194°C; 1H NMR (400 MHz, DMSO-d6) δ 11.74 (br, 1H), 10.75 (s, 1H), 8.29 (s, 1H), 8.02 (dd, J = 8.2, 1.5 Hz, 1H), 7.87 (d, J = 8.3 Hz, 1H), 7.83 (d, J = 8.2 Hz, 1H), 7.05-7.03 (m, 2H), 3.57 (t, J = 7.2 Hz, 2H), 1.58-1.45 (m, 3H), 0.91 (d, J = 6.4 Hz, 6H); 13C NMR (100 MHz, DMSO-d6) δ 167.52, 167.37, 165.44, 158.17, 143.72, 137.51, 132.93, 131.17, 126.05, 124.53, 123.92, 119.33, 117.83, 116.66, 114.00, 36.76, 35.78, 25.25, 22.15(2C); HRMS (ESI): calcd for C20H19ClN2NaO4 [M+Na]+, 409.0931; found, 409.0941. 3-Hydroxy-N-(2-isopentyl-1,3-dioxoisoindolin-5-yl)benzamide (6d). Following the same procedures as for the preparation of compound 6j, compound 6d was obtained from 2 in four steps with yield of 74%, 80%, 90%, 40%, respectively; melting point 201-205°C; 1H NMR (400 MHz, DMSO-d6) δ 10.72 (s, 1H), 9.85 (s, 1H), 8.35 (s, 1H), 8.14 (d, J = 8.2 Hz, 1H), 7.85 (d, J = 8.1 Hz, 1H), 7.43-7.36 (m, 3H), 7.03 (d, J = 7.7 Hz, 1H), 3.57 (t, J = 6.8 Hz, 2H), 1.58-1.45 (m, 3H), 0.92 (d, J = 6.1 Hz, 6H); 13C NMR (100 MHz, DMSO-d6) δ 167.64, 167.47, 166.15, 157.41, 144.71, 135.57, 132.85, 129.52, 125.59, 124.11, 123.88, 119.02, 118.35, 114.62, 113.74, 36.77, 35.73, 25.24, 22.16(2C); MS (ESI): calcd for C20H20N2NaO4 [M+Na]+, 375.1321; found, 375.1322. 2-Hydroxy-N-(2-isopentyl-1,3-dioxoisoindolin-5-yl)benzamide (6e). Following the same procedures

SUPPLEMENTARY DATA


as for the preparation of compound 6j, compound 6e was obtained from 2 in four steps with yield of 74%, 80%, 91%, 90%, respectively; melting point 170-171°C; 1H NMR (400 MHz, DMSO-d6) δ 11.37 (s, 1H), 10.79 (s, 1H), 8.32 (s, 1H), 8.04 (d, J = 8.1 Hz, 1H), 7.89 (d, J = 7.8 Hz, 1H), 7.85 (d, J = 8.1 Hz, 1H), 7.45 (t, J = 7.7 Hz, 1H), 7.03-6.97 (m, 2H), 3.58 (t, J = 7.1 Hz, 2H), 1.59-1.46 (m, 3H), 0.92 (d, J = 6.3 Hz, 6H); 13C NMR (100 MHz, DMSO-d6) δ 167.55, 167.40, 166.60, 157.71, 143.87, 133.77, 132.95, 129.43, 125.98, 124.57, 123.92, 119.16, 118.19, 117.11, 114.07, 36.77, 35.77, 25.25, 22.15(2C); HRMS (ESI): calcd for C20H20N2NaO4 [M+Na]+, 375.1321; found, 375.1324. N-(2-butyl-1,3-dioxoisoindolin-5-yl)-5-chloro-2-hydroxybenzamide (6f). Following the same procedures as for the preparation of compound 6j, compound 6f was obtained from 2 in four steps with yield of 70%, 85%, 91%, 40%, respectively; melting point 189-190°C; 1H NMR (400 MHz, CDCl3) δ 11.44 (s, 1H), 8.50 (s, 1H), 8.16 (s, 1H), 8.03 (d, J = 8.0 Hz, 1H), 7.86 (d, J = 8.1 Hz, 1H), 7.64 (s, 1H), 7.43 (d, J = 8.8 Hz, 1H), 7.02 (d, J = 8.9 Hz, 1H), 3.68 (t, J = 7.2 Hz, 2H), 1.68-1.62 (m, 2H), 1.38-1.29 (m, 2H), 0.93 (t, J = 7.3 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 168.14, 167.93, 167.55, 160.50, 142.27, 135.35, 133.96, 128.17, 125.61, 125.28, 124.60, 124.22, 120.80, 115.45, 115.36, 38.21, 30.79, 20.22, 13.75; HRMS (ESI): calcd for C19H17ClN2NaO4 [M+Na]+, 395.0775; found, 395.0787. 5-Chloro-N-(2-hexyl-1,3-dioxoisoindolin-5-yl)-2-hydroxybenzamide (6g). Following the same procedures as for the preparation of compound 6j, compound 6g was obtained from 2 in four steps with yield of 72%, 85%, 85%, 94%, respectively; melting point 163-166°C; 1H NMR (400 MHz, CDCl3) δ 11.47 (br s, 1H), 8.81 (s, 1H), 8.16 (s, 1H), 8.11 (d, J = 8.1 Hz, 1H), 7.84 (d, J = 8.1 Hz, 1H), 7.72 (s, 1H), 7.41 (d, J = 8.6 Hz, 1H), 7.01 (d, J = 8.9 Hz, 1H), 3.66 (t, J = 7.3 Hz, 2H), 1.62-1.60 (m, 2H), 1.26 (s, 6H), 0.84 (t, J = 6.0 Hz, 3H). 13C NMR (100 MHz, CDCl3) δ 168.26, 167.93, 167.58, 160.47, 142.38, 135.31, 133.91, 128.09, 125.73, 125.32, 124.62, 124.21, 120.76, 115.47, 115.42, 38.48, 31.49, 28.72, 26.66, 22.64, 14.11; HRMS (ESI): calcd for C21H21ClN2NaO4 [M+Na]+, 423.1088; found, 423.1093. 5-Chloro-N-(2-hexadecyl-1,3-dioxoisoindolin-5-yl)-2-hydroxybenzamide (6h). Following the same procedures as for the preparation of compound 6j, compound 6h was obtained from 2 in four steps with yield of 58%, 75%, 80%, 94%, respectively; melting point 166-168°C; 1H NMR (400 MHz, CDCl3) δ 11.50 (br, 1H), 8.61-8.60 (m, 1H), 8.16 (s, 1H), 8.05 (d, J = 7.9 Hz, 1H), 7.86 (d, J = 8.1 Hz, 1H), 7.67 (s, 1H), 7.43 (d, J = 8.7 Hz, 1H), 7.02 (d, J = 8.9 Hz, 1H), 3.67 (t, J = 7.3 Hz, 2H), 1.65-1.62 (m, 2H), 1.28-1.23 (m, 26H), 0.88 (t, J = 6.5 Hz, 3H); 13C NMR (100 MHz, CDCl3) δ 168.25, 167.92, 167.56, 160.46, 142.37, 135.30, 133.92, 128.09, 125.74, 125.30, 124.61, 124.21, 120.76, 115.46, 115.43, 38.49, 32.07, 29.84(3C), 29.80(2C), 29.78, 29.71, 29.64, 29.50, 29.33, 28.76, 27.02, 22.83, 14.25; HRMS (ESI): calcd for C31H41ClN2NaO4 [M+Na]+, 563.2653; found, 563.2687. N-(1,3-dioxo-2-pentylisoindolin-5-yl)-2-hydroxybenzamide (6i). Following the same procedures as for the preparation of compound 6j, compound 6i was obtained from 4 in two steps with yield of 87% and 80%, respectively; melting point 156-157°C; 1H NMR (400 MHz, DMSO-d6) δ 11.38 (s, 1H), 10.79 (s, 1H), 8.32 (s, 1H), 8.04 (d, J = 8.1 Hz, 1H), 7.89 (d, J = 7.8 Hz, 1H), 7.85 (d, J = 8.1 Hz, 1H), 7.45 (t, J = 7.7 Hz, 1H), 7.03-6.96 (m, 2H), 3.55 (t, J = 7.0 Hz, 2H), 1.62-1.55 (m, 2H), 1.34-1.23 (m, 4H), 0.85 (t, J = 7.0 Hz, 3H); 13C NMR (100 MHz, DMSO-d6) δ 167.61, 167.46, 166.60, 157.66, 143.88, 133.75, 132.93, 129.44, 125.96, 124.60, 123.95, 119.17, 118.26, 117.10, 114.09, 37.33, 28.38, 27.56, 21.61, 13.73; HRMS (ESI): calcd for C20H20N2NaO4 [M+Na]+, 375.1321; found, 375.1309. 2-Hydroxy-N-(2-isobutyl-1,3-dioxoisoindolin-5-yl)-4-methylbenzamide (6k). Following the same procedures as for the preparation of compound 6j, compound 6k was obtained from 2 in four steps with yield of 70%, 80%, 91%, 90%, respectively; melting point 209-211°C; 1H NMR (400 MHz, DMSO-d6) δ 11.53 (s, 1H), 10.72 (s, 1H), 8.31 (s, 1H), 8.04 (d, J = 8.1 Hz, 1H), 7.85 (d, J = 7.9 Hz, 2H), 6.82 (s 1H), 6.81 (d, J = 8.9 Hz, 1H), 3.38 (d, J = 6.9 Hz, 2H), 2.31 (s, 3H), 2.05-1.95 (m, 1H), 0.87 (d, J = 6.5 Hz, 6H); 13C NMR (100 MHz, DMSO-d6) δ 167.77, 167.60, 166.85, 158.39, 144.68, 143.86, 132.75, 129.19, 125.78, 124.69, 123.91, 120.18, 117.39, 114.50, 114.19, 44.72, 27.39, 21.06, 19.91(2C); HRMS (ESI): calcd for C20H20N2NaO4 [M+Na]+, 375.1321; found, 375.1321. N-(2-butyl-1,3-dioxoisoindolin-5-yl)-4-chloro-2-hydroxybenzamide (6l). Following the same

SUPPLEMENTARY DATA


procedures as for the preparation of compound 6j, compound 6l was obtained from 2 in four steps with yield of 70%, 85%, 91%, 80%, respectively; melting point 213-214°C; 1H NMR (400 MHz, DMSO-d6) δ 11.76 (br, 1H), 10.72 (d, J = 4.1 Hz, 1H), 8.26 (s, 1H), 8.00 (s, 1H), 7.87-7.81 (m, 2H), 7.03 (br s, 2H), 3.54 (br s, 2H), 1.57-1.54 (m, 2H), 1.31-1.25 (m, 2H), 0.89 (t, J = 7.1 Hz, 3H); 13C NMR (100 MHz, DMSO-d6) δ 167.57, 167.42, 165.45, 158.13, 143.73, 137.51, 132.92, 131.18, 126.04, 124.54, 123.94, 119.34, 117.92, 116.65, 114.01, 37.08, 30.00, 19.46, 13.41; HRMS (ESI): calcd for C19H17ClN2NaO4 [M+Na]+, 395.0775; found, 395.0770. N-(2-hexyl-1,3-dioxoisoindolin-5-yl)-2,4,5-trihydroxybenzamide (6m). Following the same procedures as for the preparation of compound 6j, compound 6m was obtained from 2 in four steps with yield of 72%, 85%, 80%, 85%, respectively; melting point 253-255°C; 1H NMR (400 MHz, DMSO-d6) δ 11.29 (s, 1H), 10.62 (s, 1H), 10.03 (br s, 1H), 8.69 (br s, 1H), 8.32 (s, 1H), 7.99 (d, J = 8.2 Hz, 1H), 7.83 (d, J = 8.2 Hz, 1H), 7.41 (s, 1H), 6.42 (s, 1H), 3.55 (t, J = 7.0 Hz, 2H), 1.58-1.56 (m, 2H), 1.27 (br s, 6H), 0.85 (t, J = 7.0 Hz, 3H); 13C NMR (100 MHz, DMSO-d6) δ 167.72, 167.56, 166.54, 153.06, 151.82, 144.20, 138.48, 132.95, 125.51, 124.45, 123.98, 115.06, 113.97, 107.01, 103.50, 37.34, 30.73, 27.86, 25.87, 21.92, 13.84; HRMS (ESI): calcd for C21H22N2NaO6 [M+Na]+, 421.1376; found, 421.1391. N-(2-hexyl-1,3-dioxoisoindolin-5-yl)-3,4-dihydroxybenzamide (6n). Following the same procedures as for the preparation of compound 6j, compound 6n was obtained from 2 in four steps with yield of 72%, 85%, 85%, 90%, respectively; melting point 178-179°C; 1H NMR (400 MHz, DMSO-d6) δ 10.47 (s, 1H), 9.71 (s, 1H), 9.29 (s, 1H), 8.35 (s, 1H), 8.12 (d, J = 8.3 Hz, 1H), 7.83 (d, J = 8.2 Hz, 1H), 7.43-7.39 (m, 2H), 6.86 (d, J = 8.2 Hz, 1H), 3.55 (t, J = 7.0 Hz, 2H), 1.60-1.56 (m, 2H), 1.36-1.17 (m, 6H), 0.86 (t, J = 6.2 Hz, 3H); 13C NMR (100 MHz, DMSO-d6) δ 167.76, 167.57, 165.78, 149.48, 145.13, 145.07, 132.84, 125.18, 125.03, 123.97, 123.85, 120.04, 115.53, 114.97, 113.66, 37.31, 30.70, 27.85, 25.86, 21.89, 13.79; HRMS (ESI): calcd for C21H22N2NaO5 [M+Na]+, 405.1426; found, 405.1442.

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 5b

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 5b

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 5b

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 5c

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 5c

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 5c

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 6a

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 6a

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 6a

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 6b

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 6b

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 6b

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 6d

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 6d

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 6d

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 6e

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 6e

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 6e

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 6f

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 6f

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 6f

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 6g

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 6g

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 6g

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 6h

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 6h

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 6h

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 6i

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 6i

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 6i

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 6j

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 6j

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 6j

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 6k

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 6k

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 6k

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 6l

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 6l

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 6l

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 6m

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 6m

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 6m

SUPPLEMENTARY DATA


The 1H NMR spectrum of compound 6n

SUPPLEMENTARY DATA


The 13C NMR spectrum of compound 6n

SUPPLEMENTARY DATA


The high resolution mass spectrum (ESI) of compound 6n

Date post:	19-Oct-2020
Category:	Documents
Upload:	others
View:	0 times
Download:	0 times

SUPPLEMENTARY DATA - Diabetes · Ca2+ Channel Blocker (L- and T-type) Efonidipine hydrochloride...

Documents