+ All Categories
Home > Documents > Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element...

Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element...

Date post: 18-Feb-2020
Category:
Upload: others
View: 5 times
Download: 0 times
Share this document with a friend
98
Supplementary Data Table S1. The Gene Id of FvLBD genes at NCBI . Name Gene Id (NCBI) FvLBD1A 101300227 FvLBD1B 101306463 FvLBD2 101295442 FvLBD4A 101304547 FvLBD6 101296679 FvLBD9 105350217 FvLBD12A 101315134 FvLBD12B 105353075 FvLBD15A 101298546 FvLBD15B 101300801 FvLBD18 101291664 FvLBD19 101291959 FvLBD20 101301743 FvLBD21 101311802 FvLBD22A 105351229 FvLBD22B 101308546 FvLBD22C 101308257 FvLBD24A 101312680 FvLBD24B 101297600 FvLBD25A 101303346 FvLBD25B 101313800 FvLBD27A 101311004 FvLBD27B 101301214 FvLBD29A 101304433 FvLBD29B 101304723 FvLBD33 101315294 FvLBD36A 101303362 FvLBD36B 105350270 FvLBD38A 101307625 FvLBD38B 101313940 FvLBD39 101309502 FvLBD41 101314484 FvLBD42 101291724
Transcript
Page 1: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Supplementary Data Table S1. The Gene Id of FvLBD genes at NCBI .

Name Gene Id (NCBI) FvLBD1A 101300227 FvLBD1B 101306463 FvLBD2 101295442 FvLBD4A 101304547 FvLBD6 101296679 FvLBD9 105350217 FvLBD12A 101315134 FvLBD12B 105353075 FvLBD15A 101298546 FvLBD15B 101300801 FvLBD18 101291664 FvLBD19 101291959 FvLBD20 101301743 FvLBD21 101311802 FvLBD22A 105351229 FvLBD22B 101308546 FvLBD22C 101308257 FvLBD24A 101312680 FvLBD24B 101297600 FvLBD25A 101303346 FvLBD25B 101313800 FvLBD27A 101311004 FvLBD27B 101301214 FvLBD29A 101304433 FvLBD29B 101304723 FvLBD33 101315294 FvLBD36A 101303362 FvLBD36B 105350270 FvLBD38A 101307625 FvLBD38B 101313940 FvLBD39 101309502 FvLBD41 101314484 FvLBD42 101291724

Page 2: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Table S2. The cis-element(s) identified in the promoter regions of FvLBD genes.

Site Name Organism Position Strand Matrix score. sequence function

gene25294 5UTR Py-rich stretch

Lycopersicon esculentum 715 - 9 TTTCTTCTCT cis-acting element conferring

high transcription levels

5UTR Py-rich stretch

Lycopersicon esculentum 1139 - 9 TTTCTTCTCT cis-acting element conferring

high transcription levels

5UTR Py-rich stretch

Lycopersicon esculentum 720 - 9 TTTCTTCTCT cis-acting element conferring

high transcription levels

AAAC-motif Spinacia oleracea 1418 + 11 CAACAAAAACCT light responsive element

ACE Petroselinum crispum 436 + 10 ACTACGTTGG cis-acting element involved in light responsiveness

ARE Zea mays 188 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1011 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ATC-motif Spinacia oleracea 1096 - 8 AGTAATCT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1306 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 27 - 7 TTTCAAA light responsive element Box I Pisum sativum 1152 + 7 TTTCAAA light responsive element

Page 3: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Box I Pisum sativum 683 + 7 TTTCAAA light responsive element Box I Pisum sativum 1199 + 7 TTTCAAA light responsive element

Box-W1 Petroselinum crispum 956 + 6 TTGACC fungal elicitor responsive element

Box-W1 Petroselinum crispum 1364 + 6 TTGACC fungal elicitor responsive element

CAT-box Arabidopsis thaliana 594 + 6 GCCACT cis-acting regulatory element related to meristem expression

CGTCA-motif Hordeum vulgare 1354 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

DRE Arabidopsis thaliana 670 + 9 TACCGACAT "cis-acting element involved in

dehydration, low-temp, salt stresses

ELI-box3 Brassica oleracea 188 + 9 AAACCAATT elicitor-responsive element ERE Dianthus caryophyllus 27 - 8 ATTTCAAA ethylene-responsive element ERE Dianthus caryophyllus 1198 + 8 ATTTCAAA ethylene-responsive element ERE Dianthus caryophyllus 1151 + 8 ATTTCAAA ethylene-responsive element

GAG-motif Spinacia oleracea 1439 - 7 AGAGATG part of a light responsive element

GARE-motif Brassica oleracea 1 + 7 TCTGTTG gibberellin-responsive element GARE-motif Brassica oleracea 639 + 7 TCTGTTG gibberellin-responsive element

GATA-motif Arabidopsis thaliana 890 - 10 AAGATAAGATT part of a light responsive element

GATA-motif Arabidopsis thaliana 945 - 7 GATAGGA part of a light responsive element

GCN4_motif Oryza sativa 257 + 7 CAAGCCA cis-regulatory element involved in endosperm expression

Page 4: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

GCN4_motif Oryza sativa 565 + 7 TGTGTCA cis-regulatory element involved in endosperm expression

GT1-motif Arabidopsis thaliana 470 - 6 GGTTAA light responsive element GT1-motif Arabidopsis thaliana 736 + 6 GGTTAA light responsive element

HSE Brassica oleracea 1050 + 9 AGAAAATTCG cis-acting element involved in heat stress responsiveness

HSE Brassica oleracea 1213 - 10 AAAAAATTTC cis-acting element involved in heat stress responsiveness

HSE Brassica oleracea 1146 + 9 AAAAAATTTC cis-acting element involved in heat stress responsiveness

I-box Solanum tuberosum 742 + 10 TATTATCTAGA part of a light responsive element

MBS Arabidopsis thaliana 1295 - 6 TAACTG MYB binding site involved in drought-inducibility

MBSI Petunia hybrida 521 + 10.5 aaaAaaC(G/C)GTTA MYB binding site involved in flavonoid biosynthetic genes

regulation

MRE Petroselinum crispum 472 + 7 AACCTAA MYB binding site involved in light responsiveness

MRE Petroselinum crispum 1266 + 7 AACCTAA MYB binding site involved in light responsiveness

MSA-like Catharanthus roseus 23 - 9 TCAAACGGT cis-acting element involved in cell cycle regulation

O2-site Zea mays 74 + 9 GATGACATGG cis-acting regulatory element involved in zein metabolism

regulation

O2-site Zea mays 601 - 9 GATGATGTGG cis-acting regulatory element involved in zein metabolism

regulation

Page 5: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

O2-site Zea mays 228 - 9 GATGACATGA cis-acting regulatory element involved in zein metabolism

regulation

O2-site Zea mays 1433 - 8 GATGA(C/T)(A/G)TG(A/G)

cis-acting regulatory element involved in zein metabolism

regulation

Skn-1_motif Oryza sativa 232 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1165 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 552 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1291 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5 CC(G/A)CCC light responsive element

TC-rich repeats Nicotiana tabacum 1047 - 9 ATTTTCTTCA cis-acting element involved in defense and stress responsiveness

TC-rich repeats Nicotiana tabacum 1141 - 9 ATTTTCTTCA cis-acting element involved in defense and stress responsiveness

TCT-motif Arabidopsis thaliana 892 + 6 TCTTAC part of a light responsive element

Page 6: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TGA-box Glycine max 1354 + 8 TGACGTAA part of an auxin-responsive element

TGACG-motif Hordeum vulgare 1354 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

circadian

Lycopersicon esculentum 160 + 9 CAAAGATATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 1313 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene23226

ABRE Arabidopsis thaliana 1020 + 6 TACGTG cis-acting element involved in the abscisic acid responsiveness

ACE Petroselinum crispum 941 - 9 AAAACGTTTA cis-acting element involved in light responsiveness

ATCT-motif Zea mays 321 + 9 AATCTGATCG part of a conserved DNA module involved in light responsiveness

ATCT-motif Pisum sativum 338 - 9 AATCTAATCC part of a conserved DNA module involved in light responsiveness

ATGCAAAT motif Oryza sativa 91 + 8 ATACAAAT cis-acting regulatory element associated to the TGAGTCA

motif

ATGCAAAT motif Oryza sativa 108 + 8 ATACAAAT cis-acting regulatory element associated to the TGAGTCA

motif

Page 7: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Box 4 Petroselinum crispum 1258 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1365 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

CAT-box Arabidopsis thaliana 646 - 6 GCCACT cis-acting regulatory element related to meristem expression

CGTCA-motif Hordeum vulgare 684 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

CGTCA-motif Hordeum vulgare 1346 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

G-Box Antirrhinum majus 1020 - 6 CACGTA cis-acting regulatory element involved in light responsiveness

G-box Daucus carota 1020 + 6 TACGTG cis-acting regulatory element involved in light responsiveness

G-box Zea mays 1110 - 6 CACGAC cis-acting regulatory element involved in light responsiveness

GAG-motif Arabidopsis thaliana 631 + 7 AGAGAGT part of a light responsive element

GAG-motif Arabidopsis thaliana 1093 - 7 AGAGAGT part of a light responsive element

GARE-motif Brassica oleracea 281 - 7 AAACAGA gibberellin-responsive element GARE-motif Brassica oleracea 1038 + 7 AAACAGA gibberellin-responsive element

GCN4_motif Oryza sativa 748 + 7 CAAGCCA cis-regulatory element involved in endosperm expression

GT1-motif Arabidopsis thaliana 948 - 6 GGTTAA light responsive element

Page 8: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

GT1-motif Arabidopsis thaliana 1479 - 6 GGTTAA light responsive element GT1-motif Avena sativa 1478 - 7 GGTTAAT light responsive element

HSE Brassica oleracea 78 + 9 AGAAAATTCG cis-acting element involved in heat stress responsiveness

HSE Brassica oleracea 1161 - 9 AAAAAATTTC cis-acting element involved in heat stress responsiveness

LTR Hordeum vulgare 711 - 6 CCGAAA cis-acting element involved in low-temperature responsiveness

MRE Petroselinum crispum 950 + 7 AACCTAA MYB binding site involved in light responsiveness

Skn-1_motif Oryza sativa 53 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 902 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 538 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1456 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 105 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 799 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Page 9: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TC-rich repeats Nicotiana tabacum 1163 + 9 ATTTTCTTCA cis-acting element involved in defense and stress responsiveness

TCT-motif Arabidopsis thaliana 481 + 6 TCTTAC part of a light responsive element

TCT-motif Arabidopsis thaliana 553 + 6 TCTTAC part of a light responsive elemen

TGACG-motif Hordeum vulgare 684 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

TGACG-motif Hordeum vulgare 1346 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

WUN-motif Brassica oleracea 833 + 9 AAATTTCCT wound-responsive element

circadian

Lycopersicon esculentum 909 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene17794 Site Name Organism Position Strand Matrix

score. sequence function

ABRE Arabidopsis thaliana 781 - 7 TACGGTC cis-acting element involved in the abscisic acid responsiveness

ARE Zea mays 464 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

CATT-motif Zea mays 590 + 6 GCATTC part of a light responsive element

Page 10: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

CGTCA-motif Hordeum vulgare 696 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

CGTCA-motif Hordeum vulgare 1392 + 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

GAG-motif Arabidopsis thaliana 808 + 7 AGAGAGT part of a light responsive element

GATA-motif Arabidopsis thaliana 1448 - 7 GATAGGA part of a light responsive element

GCN4_motif Oryza sativa 14 - 7 CAAGCCA cis-regulatory element involved in endosperm expression

HSE Brassica oleracea 98 - 9 AAAAAATTTC cis-acting element involved in heat stress responsiveness

HSE Brassica oleracea 1264 + 9 AAAAAATTTC cis-acting element involved in heat stress responsiveness

LTR Hordeum vulgare 1127 - 6 CCGAAA cis-acting element involved in low-temperature responsiveness

LTR Hordeum vulgare 1133 - 6 CCGAAA cis-acting element involved in low-temperature responsiveness

MBS Zea mays 780 - 6 CGGTCA MYB Binding Site

MBS Arabidopsis thaliana 882 - 6 CAACTG MYB binding site involved in drought-inducibility

MRE Petroselinum crispum 850 - 7 AACCTAA MYB binding site involved in light responsiveness

Page 11: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

O2-site Zea mays 986 - 9 GATGATATGG cis-acting regulatory element involved in zein metabolism

regulation P-box Oryza sativa 286 - 7 CCTTTTG gibberellin-responsive element

Skn-1_motif Oryza sativa 73 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 341 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 206 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1393 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

TATC-box Oryza sativa 1451 + 7 TATCCCA cis-acting element involved in gibberellin-responsiveness

TC-rich repeats Nicotiana tabacum 28 - 9 ATTTTCTTCA cis-acting element involved in defense and stress responsiveness

TC-rich repeats Nicotiana tabacum 884 - 9 ATTCTCTAAC cis-acting element involved in defense and stress responsiveness

TCA-element Nicotiana tabacum 262 + 9 CCATCTTTTT cis-acting element involved in salicylic acid responsiveness

TCA-element Brassica oleracea 440 + 9 CAGAAAAGGA cis-acting element involved in salicylic acid responsiveness

Page 12: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TCT-motif Arabidopsis thaliana 608 + 6 TCTTAC part of a light responsive element

TGA-box Glycine max 696 + 8 TGACGTAA part of an auxin-responsive element

TGA-element Brassica oleracea 729 - 6 AACGAC auxin-responsive element TGA-element Brassica oleracea 1495 + 6 AACGAC auxin-responsive element TGA-element Brassica oleracea 914 - 6 AACGAC auxin-responsive element

TGACG-motif Hordeum vulgare 696 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

TGACG-motif Hordeum vulgare 1392 - 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

chs-Unit 1 m1 Hordeum vulgare 1014 + 10 ACCTAACCCGC part of a light responsive element

circadian

Lycopersicon esculentum 11 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene20083 AE-box Arabidopsis thaliana 270 + 8 AGAAACAA part of a module for light

response

Box 4 Petroselinum crispum 1044 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 622 - 7 TTTCAAA light responsive element

CATT-motif Zea mays 392 - 6 GCATTC part of a light responsive element

CCAAT-box Hordeum vulgare 473 - 6 CAACGG MYBHv1 binding site CCAAT-box Hordeum vulgare 1071 + 6 CAACGG MYBHv1 binding site

Page 13: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

CGTCA-motif Hordeum vulgare 397 + 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

GA-motif Helianthus annuus 1353 - 8 AAAGATGA part of a light responsive element

GT1-motif Arabidopsis thaliana 453 + 6 GGTTAA light responsive element GT1-motif Arabidopsis thaliana 944 - 6 GGTTAA light responsive element GT1-motif Avena sativa 943 - 7 GGTTAAT light responsive element GT1-motif Arabidopsis thaliana 982 - 6 GGTTAA light responsive element

I-box Flaveria trinervia 631 + 10 cCATATCCAAT part of a light responsive element

I-box Glycine max 1154 - 9 GATAAGATA part of a light responsive element

MBS Arabidopsis thaliana 379 + 6 TAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 594 + 6 TAACTG MYB binding site involved in drought-inducibility

MRE Petroselinum crispum 984 + 7 AACCTAA MYB binding site involved in light responsiveness

Skn-1_motif Oryza sativa 125 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 815 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 719 + 5 CC(G/A)CCC light responsive element

TC-rich repeats Nicotiana tabacum 909 + 9 GTTTTCTTAC cis-acting element involved in defense and stress responsiveness

Page 14: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TCA-element Nicotiana tabacum 58 + 9 CCATCTTTTT cis-acting element involved in salicylic acid responsiveness

TCA-element Brassica oleracea 1393 - 9 GAGAAGAATA cis-acting element involved in salicylic acid responsiveness

TCA-element Nicotiana tabacum 1353 + 9 CCATCTTTTT cis-acting element involved in salicylic acid responsiveness

TCCC-motif Spinacia oleracea 835 + 7 TCTCCCT part of a light responsive element

TCCC-motif Spinacia oleracea 1451 + 7 TCTCCCT part of a light responsive element

TCT-motif Arabidopsis thaliana 642 + 6 TCTTAC part of a light responsive element

TCT-motif Arabidopsis thaliana 913 + 6 TCTTAC part of a light responsive element

TGACG-motif Hordeum vulgare 397 - 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

chs-CMA1a Daucus carota 217 + 8 TTACTTAA part of a light responsive element

circadian

Lycopersicon esculentum 674 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 1236 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene21541 ACE Petroselinum crispum 1400 + 9 GCGACGTACC cis-acting element involved in

light responsiveness

Page 15: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

ARE Zea mays 1104 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1189 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ATC-motif Spinacia oleracea 287 + 8 AGTAATCT part of a conserved DNA module involved in light responsiveness

ATCC-motif Pisum sativum 1474 - 8 CAATCCTC part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 116 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1390 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 764 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 269 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 931 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 532 + 7 TTTCAAA light responsive element CCAAT-box Hordeum vulgare 1081 - 6 CAACGG MYBHv1 binding site

Page 16: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

EIRE Nicotiana tabacum 1132 + 7 TTCGACC elicitor-responsive element EIRE Nicotiana tabacum 1253 - 7 TTCGACC elicitor-responsive element

G-Box Pisum sativum 1336 - 10 CACACATGGAA cis-acting regulatory element involved in light responsiveness

GAG-motif Spinacia oleracea 636 - 7 AGAGATG part of a light responsive element

Gap-box Arabidopsis thaliana 848 - 9.5 CAAATGAA(A/G)A part of a light responsive element

MBS Arabidopsis thaliana 572 - 6 TAACTG MYB binding site involved in drought-inducibility

O2-site Zea mays 1179 - 9 GATGACATGA cis-acting regulatory element involved in zein metabolism

regulation

Skn-1_motif Oryza sativa 953 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1455 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1183 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 541 + 5 CC(G/A)CCC light responsive element

TATC-box Oryza sativa 159 + 7 TATCCCA cis-acting element involved in gibberellin-responsiveness

TC-rich repeats Nicotiana tabacum 961 + 9 ATTTTCTTCA cis-acting element involved in defense and stress responsiveness

Page 17: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TCA-element Brassica oleracea 747 - 9 CAGAAAAGGA cis-acting element involved in salicylic acid responsiveness

TCA-element Brassica oleracea 865 + 9 CAGAAAAGGA cis-acting element involved in salicylic acid responsiveness

circadian

Lycopersicon esculentum 738 - 9 CAAAGATATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 1072 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene12646

ARE Zea mays 370 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1088 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ATCT-motif Zea mays 1275 + 9 AATCTGATCG part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1425 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 1325 - 7 TTTCAAA light responsive element

CAT-box Arabidopsis thaliana 286 + 6 GCCACT cis-acting regulatory element related to meristem expression

CATT-motif Zea mays 1023 + 6 GCATTC part of a light responsive element

Page 18: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

CGTCA-motif Hordeum vulgare 461 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

ELI-box3 Brassica oleracea 370 + 9 AAACCAATT elicitor-responsive element ELI-box3 Brassica oleracea 1085 - 9 AAACCAATT elicitor-responsive element

GAG-motif Hordeum vulgare 441 + 7 GGAGATG part of a light responsive element

GAG-motif Arabidopsis thaliana 1157 + 7 AGAGAGT part of a light responsive element

GC-motif Zea mays 482 - 7 GCCCCGG enhancer-like element involved in anoxic specific inducibility

GT1-motif Arabidopsis thaliana 41 - 6 GGTTAA light responsive element

I-box Arabidopsis thaliana 857 + 9 acGATAATC part of a light responsive element

I-box Larix laricina 1186 + 9 GTATAAGGCC part of a light responsive element

MBS Arabidopsis thaliana 316 + 6 CAACTG MYB binding site involved in drought-inducibility

P-box Oryza sativa 693 + 10 GCCTTTTGAGT gibberellin-responsive element Sp1 Zea mays 50 + 5.5 CC(G/A)CCC light responsive element TATCCAT/C-motif Oryza sativa 1142 - 7 TATCCAT TCT-motif Arabidopsis thaliana 295 - 6 TCTTAC part of a light responsive element

TGACG-motif Hordeum vulgare 461 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

circadian

Lycopersicon esculentum 1472 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

Page 19: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

gene28202

ARE Zea mays 84 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1475 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 808 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 496 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1169 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

AT1-motif Solanum tuberosum 92 - 11 ATTAATTTTACA part of a light responsive module

ATCC-motif Pisum sativum 452 - 8 CAATCCTC part of a conserved DNA module involved in light responsiveness

ATCT-motif Pisum sativum 1300 + 9 AATCTAATCC part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 43 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Page 20: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

CGTCA-motif Hordeum vulgare 613 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

CGTCA-motif Hordeum vulgare 1488 + 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

CGTCA-motif Hordeum vulgare 616 + 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

G-box Zea mays 1018 - 6 CACGAC cis-acting regulatory element involved in light responsiveness

G-box Zea mays 1061 - 6 CACGAC cis-acting regulatory element involved in light responsiveness

GAG-motif Spinacia oleracea 294 + 7 AGAGATG part of a light responsive element

GAG-motif Spinacia oleracea 1397 - 7 AGAGATG part of a light responsive element

GAG-motif Spinacia oleracea 591 + 7 AGAGATG part of a light responsive element

I-box Flaveria trinervia 550 + 7 GATATGG part of a light responsive element

MBS Arabidopsis thaliana 130 + 6 TAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 542 + 6 TAACTG MYB binding site involved in drought-inducibility

O2-site Zea mays 547 + 9 GATGATATGG cis-acting regulatory element involved in zein metabolism

regulation

Page 21: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Skn-1_motif Oryza sativa 23 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 926 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 617 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 612 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 763 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

TC-rich repeats Nicotiana tabacum 701 - 9 ATTCTCTAAC cis-acting element involved in defense and stress responsiveness

TCA-element Nicotiana tabacum 147 + 9 CCATCTTTTT cis-acting element involved in salicylic acid responsiveness

TCCC-motif Spinacia oleracea 975 + 7 TCTCCCT part of a light responsive element

TGA-element Brassica oleracea 1101 - 6 AACGAC auxin-responsive element

TGACG-motif Hordeum vulgare 613 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

TGACG-motif Hordeum vulgare 1488 - 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

Page 22: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TGACG-motif Hordeum vulgare 616 - 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

as1 Arabidopsis thaliana 613 + 8 TGACGTCA cis-acting regulatory element involved in the root-specific

expression

gene21039 AACA_motif Oryza sativa 385 - 11 TAACAAACTCCA involved in endosperm-specific

negative expression

ABRE Arabidopsis thaliana 1117 + 6 TACGTG cis-acting element involved in the abscisic acid responsiveness

ABRE Arabidopsis thaliana 1219 - 6 TACGTG cis-acting element involved in the abscisic acid responsiveness

ABRE Oryza sativa 1217 - 9 AGTACGTGGC cis-acting element involved in the abscisic acid responsiveness

AE-box Arabidopsis thaliana 10 + 8 AGAAACAT part of a module for light response

ARE Zea mays 97 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 945 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Page 23: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

ARE Zea mays 176 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 961 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ATCT-motif Arabidopsis thaliana 520 - 9 AATCTAATCT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 694 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1123 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1069 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

G-Box Pisum sativum 798 + 6 CACGTT cis-acting regulatory element involved in light responsiveness

G-Box Antirrhinum majus 1219 + 6 CACGTA cis-acting regulatory element involved in light responsiveness

G-Box Antirrhinum majus 1117 - 6 CACGTA cis-acting regulatory element involved in light responsiveness

G-box Brassica oleracea 798 - 8 TAAACGTG cis-acting regulatory element involved in light responsiveness

G-box Daucus carota 1219 - 6 TACGTG cis-acting regulatory element involved in light responsiveness

Page 24: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

G-box Daucus carota 1117 + 6 TACGTG cis-acting regulatory element involved in light responsiveness

GAG-motif Spinacia oleracea 818 - 7 AGAGATG part of a light responsive element

GAG-motif Arabidopsis thaliana 1224 - 7 AGAGAGT part of a light responsive element

HD-Zip 1 Arabidopsis thaliana 80 + 8.5 CAAT(A/T)ATTG element involved in

differentiation of the palisade mesophyll cells

HD-Zip 2 Arabidopsis thaliana 80 + 8 CAAT(G/C)ATTG element involved in the control of leaf morphology development

HSE Brassica oleracea 1011 - 9 AAAAAATTTC cis-acting element involved in heat stress responsiveness

I-box

Nicotiana plumbaginifolia 752 - 9 CTCTTATGCT part of a light responsive element

MBS Arabidopsis thaliana 1440 + 6 CAACTG MYB binding site involved in drought-inducibility

MNF1 Zea mays 420 + 7 GTGCCC(A/T)(A/T) light responsive element

Skn-1_motif Oryza sativa 700 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1063 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

TC-rich repeats Nicotiana tabacum 947 + 9 ATTTTCTTCA cis-acting element involved in defense and stress responsiveness

Page 25: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TC-rich repeats Nicotiana tabacum 1024 - 9 GTTTTCTTAC cis-acting element involved in defense and stress responsiveness

TGA-element Brassica oleracea 1031 + 6 AACGAC auxin-responsive element

circadian

Lycopersicon esculentum 495 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 965 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 542 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene21311

ABRE Arabidopsis thaliana 1018 - 6 CACGTG cis-acting element involved in the abscisic acid responsiveness

AE-box Arabidopsis thaliana 1305 + 8 AGAAACTT part of a module for light response

ARE Zea mays 1213 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ATGCAAAT motif Oryza sativa 185 - 8 ATACAAAT cis-acting regulatory element associated to the TGAGTCA

motif

Box 4 Petroselinum crispum 900 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 657 + 7 TTTCAAA light responsive element

G-Box Pisum sativum 1018 - 6 CACGTG cis-acting regulatory element involved in light responsiveness

Page 26: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

G-box Larix laricina 541 - 9 GACACGTAGT cis-acting regulatory element involved in light responsiveness

G-box Arabidopsis thaliana 1018 - 6 CACGTG cis-acting regulatory element involved in light responsiveness

G-box Zea mays 944 - 9 GACATGTGGT cis-acting regulatory element involved in light responsiveness

GT1-motif Solanum tuberosum 1186 - 10 ATGGTGGTTGG light responsive element

I-box Flaveria trinervia 290 + 7 GATATGG part of a light responsive element

MBS Arabidopsis thaliana 99 + 6 TAACTG MYB binding site involved in drought-inducibility

P-box Oryza sativa 660 - 7 CCTTTTG gibberellin-responsive element

Skn-1_motif Oryza sativa 51 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 110 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 74 + 5 CC(G/A)CCC light responsive element

TC-rich repeats Nicotiana tabacum 222 + 9 GTTTTCTTAC cis-acting element involved in defense and stress responsiveness

TCCC-motif Spinacia oleracea 1448 + 7 TCTCCCT part of a light responsive element

TCT-motif Arabidopsis thaliana 1013 + 6 TCTTAC part of a light responsive element

circadian

Lycopersicon esculentum 494 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

Page 27: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

gene28137

ARE Zea mays 286 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 628 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 306 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Box 4 Petroselinum crispum 421 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 340 + 7 TTTCAAA light responsive element

CAT-box Arabidopsis thaliana 1196 + 6 GCCACT cis-acting regulatory element related to meristem expression

CATT-motif Zea mays 117 + 6 GCATTC part of a light responsive element

CGTCA-motif Hordeum vulgare 1044 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

EIRE Nicotiana tabacum 1493 - 7 TTCGACC elicitor-responsive element ELI-box3 Brassica oleracea 628 + 9 AAACCAATT elicitor-responsive element

GA-motif Helianthus annuus 907 - 8 AAAGATGA part of a light responsive element

GCN4_motif Oryza sativa 170 - 7 TGAGTCA cis-regulatory element involved in endosperm expression

GCN4_motif Oryza sativa 640 - 7 TGAGTCA cis-regulatory element involved in endosperm expression

Page 28: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

GT1-motif Solanum tuberosum 561 - 10 ATGGTGGTTGG light responsive element

MBS Arabidopsis thaliana 960 - 6 CAACTG MYB binding site involved in drought-inducibility

Skn-1_motif Oryza sativa 169 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1368 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 906 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 349 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1135 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

TC-rich repeats Nicotiana tabacum 63 + 9 ATTCTCTAAC cis-acting element involved in defense and stress responsiveness

TCT-motif Arabidopsis thaliana 248 - 6 TCTTAC part of a light responsive element

TGACG-motif Hordeum vulgare 1044 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

as-2-box Nicotiana tabacum 1068 - 9 GATAatGATG involved in shoot-specific

expression and light responsiveness

Page 29: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

circadian

Lycopersicon esculentum 566 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene19355

ABRE Hordeum vulgare 903 - 9 GCAACGTGTC cis-acting element involved in the abscisic acid responsiveness

AE-box Arabidopsis thaliana 207 - 8 AGAAACAA part of a module for light response

ARE Zea mays 193 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1297 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ATCT-motif Arabidopsis thaliana 84 + 9 AATCTAATCT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 443 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1357 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 736 - 7 TTTCAAA light responsive element Box I Pisum sativum 805 + 7 TTTCAAA light responsive element

Box-W1 Petroselinum crispum 110 - 6 TTGACC fungal elicitor responsive element

EIRE Nicotiana tabacum 910 + 7 TTCGACC elicitor-responsive element

Page 30: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

G-Box Pisum sativum 905 + 6 CACGTT cis-acting regulatory element involved in light responsiveness

G-box Arabidopsis thaliana 491 + 10 TCCTCGTGGCA cis-acting regulatory element involved in light responsiveness

G-box Zea mays 1387 + 6 CACGAC cis-acting regulatory element involved in light responsiveness

G-box Zea mays 905 + 6 CACGTT cis-acting regulatory element involved in light responsiveness

GA-motif Helianthus annuus 299 - 8 AAAGATGA part of a light responsive element

GAG-motif Spinacia oleracea 829 + 7 AGAGATG part of a light responsive element

GAG-motif Hordeum vulgare 835 + 7 GGAGATG part of a light responsive element

GARE-motif Brassica oleracea 150 - 7 TCTGTTG gibberellin-responsive element

GATA-motif Arabidopsis thaliana 130 + 7 GATAGGA part of a light responsive element

GT1-motif Avena sativa 689 - 7 GGTTAAT light responsive element GT1-motif Avena sativa 1281 - 7 GGTTAAT light responsive element GT1-motif Solanum tuberosum 1238 - 9 GTGTGTGAA light responsive element GT1-motif Arabidopsis thaliana 1282 - 6 GGTTAA light responsive element GT1-motif Arabidopsis thaliana 690 - 6 GGTTAA light responsive element GT1-motif Arabidopsis thaliana 1250 - 6 GGTTAA light responsive element

HSE Brassica oleracea 101 + 9 AGAAAATTCG cis-acting element involved in heat stress responsiveness

I-box Arabidopsis thaliana 380 - 9 GATAAGGGT part of a light responsive element

I-box Triticum aestivum 382 - 8 AGATAAGG part of a light responsive element

Page 31: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

MBS Zea mays 109 + 6 CGGTCA MYB Binding Site

O2-site Zea mays 117 - 9 GATGATGTGG cis-acting regulatory element involved in zein metabolism

regulation

Skn-1_motif Oryza sativa 800 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 1346 + 5 CC(G/A)CCC light responsive element

TCA-element Brassica oleracea 306 - 9 CAGAAAAGGA cis-acting element involved in salicylic acid responsiveness

TCA-element Brassica oleracea 1178 - 9 GAGAAGAATA cis-acting element involved in salicylic acid responsiveness

TCA-element Brassica oleracea 1171 - 9 TCAGAAGAGG cis-acting element involved in salicylic acid responsiveness

TCA-element Nicotiana tabacum 1332 + 9 CCATCTTTTT cis-acting element involved in salicylic acid responsiveness

TCT-motif Arabidopsis thaliana 459 - 6 TCTTAC part of a light responsive element

TCT-motif Arabidopsis thaliana 675 - 6 TCTTAC part of a light responsive element

as-2-box Nicotiana tabacum 318 + 9 GATAatGATG involved in shoot-specific

expression and light responsiveness

as-2-box Nicotiana tabacum 1375 - 9 GATAatGATG involved in shoot-specific

expression and light responsiveness

as-2-box Nicotiana tabacum 1372 - 9 GATAatGATG involved in shoot-specific

expression and light responsiveness

Page 32: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

circadian

Lycopersicon esculentum 179 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 1427 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 421 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 1445 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 185 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 480 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene19356

ABRE Arabidopsis thaliana 570 - 6 TACGTG cis-acting element involved in the abscisic acid responsiveness

ARE Zea mays 623 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1189 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 822 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic inductio

Box 4 Petroselinum crispum 121 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Page 33: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Box 4 Petroselinum crispum 1366 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1088 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 800 + 7 TTTCAAA light responsive element

Box-W1 Petroselinum crispum 1263 + 6 TTGACC fungal elicitor responsive element

CATT-motif Zea mays 66 - 6 GCATTC part of a light responsive element

CCGTCC-box Arabidopsis thaliana 214 + 6 CCGTCC cis-acting regulatory element related to meristem specific

activation

CCGTCC-box Arabidopsis thaliana 275 + 6 CCGTCC cis-acting regulatory element related to meristem specific

activation

CCGTCC-box Arabidopsis thaliana 224 + 6 CCGTCC cis-acting regulatory element related to meristem specific

activation

CCGTCC-box Arabidopsis thaliana 280 + 6 CCGTCC cis-acting regulatory element related to meristem specific

activation

CCGTCC-box Arabidopsis thaliana 219 + 6 CCGTCC cis-acting regulatory element related to meristem specific

activation

CCGTCC-box Arabidopsis thaliana 246 - 6 CCGTCC cis-acting regulatory element related to meristem specific

activation

Page 34: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

CGTCA-motif Hordeum vulgare 792 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

ERE Dianthus caryophyllus 799 + 8 ATTTCAAA ethylene-responsive element

G-Box Antirrhinum majus 570 + 6 CACGTA cis-acting regulatory element involved in light responsiveness

G-box Daucus carota 570 - 6 TACGTG cis-acting regulatory element involved in light responsiveness

G-box Zea mays 793 - 6 CACGTC cis-acting regulatory element involved in light responsiveness

GA-motif Arabidopsis thaliana 544 + 8 ATAGATAA part of a light responsive element

GA-motif Glycine max 1424 + 8 AAGGAAGA part of a light responsive element

GAG-motif Hordeum vulgare 308 + 7 GGAGATG part of a light responsive element

GAG-motif Arabidopsis thaliana 1322 - 7 AGAGAGT part of a light responsive element

GAG-motif Spinacia oleracea 782 - 7 AGAGATG part of a light responsive element

HSE Brassica oleracea 150 + 9 AAAAAATTTC cis-acting element involved in heat stress responsiveness

LTR Hordeum vulgare 241 - 6 CCGAAA cis-acting element involved in low-temperature responsiveness

LTR Hordeum vulgare 531 - 6 CCGAAA cis-acting element involved in low-temperature responsiveness

Page 35: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

MBS Arabidopsis thaliana 458 + 6 CAACTG MYB binding site involved in drought-inducibility

MBS Zea mays 1386 + 6 CGGTCA MYB Binding Site

MBS Arabidopsis thaliana 500 + 6 TAACTG MYB binding site involved in drought-inducibility

MNF1 Zea mays 287 + 6.5 GTGCCC(A/T)(A/T) light responsive element

MRE Petroselinum crispum 993 + 7 AACCTAA MYB binding site involved in light responsiveness

O2-site Zea mays 790 + 9 GTTGACGTGA cis-acting regulatory element involved in zein metabolism

regulation

Skn-1_motif Oryza sativa 556 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1388 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 592 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 1353 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 858 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 854 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1275 + 5.5 CC(G/A)CCC light responsive element

TATC-box Oryza sativa 1175 - 7 TATCCCA cis-acting element involved in gibberellin-responsiveness

TC-rich repeats Nicotiana tabacum 949 - 9 GTTTTCTTAC cis-acting element involved in defense and stress responsiveness

Page 36: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TCA-element Brassica oleracea 1419 + 9 CAGAAAAGGA cis-acting element involved in salicylic acid responsiveness

TCCC-motif Spinacia oleracea 884 + 7 TCTCCCT part of a light responsive element

TCCC-motif Spinacia oleracea 1328 + 7 TCTCCCT part of a light responsive element

TCCC-motif Spinacia oleracea 1055 + 7 TCTCCCT part of a light responsive element

TCCC-motif Spinacia oleracea 1375 + 7 TCTCCCT part of a light responsive element

TCT-motif Arabidopsis thaliana 949 - 6 TCTTAC part of a light responsive element

TGACG-motif Hordeum vulgare 792 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

circadian

Lycopersicon esculentum 458 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene24461

ABRE Hordeum vulgare 1252 - 9 CGCACGTGTC cis-acting element involved in the abscisic acid responsiveness

ABRE Arabidopsis thaliana 1254 - 6 CACGTG cis-acting element involved in the abscisic acid responsiveness

AE-box Arabidopsis thaliana 88 - 8 AGAAACAA part of a module for light response

AE-box Arabidopsis thaliana 760 - 8 AGAAACAT part of a module for light response

Page 37: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

ARE Zea mays 325 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

AT-rich sequence Pisum sativum 68 - 9 TAAAATACT element for maximal elicitor-mediated activation (2copies)

ATGCAAAT motif Oryza sativa 1072 + 8 ATACAAAT cis-acting regulatory element associated to the TGAGTCA

motif Box I Pisum sativum 201 - 7 TTTCAAA light responsive element

CAT-box Arabidopsis thaliana 863 + 6 GCCACT cis-acting regulatory element related to meristem expression

CATT-motif Zea mays 669 - 6 GCATTC part of a light responsive element

CCAAT-box Hordeum vulgare 1063 + 6 CAACGG MYBHv1 binding site CCAAT-box Hordeum vulgare 1353 + 6 CAACGG MYBHv1 binding site

CGTCA-motif Hordeum vulgare 482 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

G-Box Pisum sativum 1254 - 6 CACGTG cis-acting regulatory element involved in light responsiveness

G-box Zea mays 183 + 6 CACGAC cis-acting regulatory element involved in light responsiveness

G-box Arabidopsis thaliana 1254 - 6 CACGTG cis-acting regulatory element involved in light responsiveness

G-box Zea mays 392 - 6 CACGAC cis-acting regulatory element involved in light responsiveness

GAG-motif Spinacia oleracea 984 + 7 AGAGATG part of a light responsive element

Page 38: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

GAG-motif Spinacia oleracea 1451 - 7 AGAGATG part of a light responsive element

GARE-motif Brassica oleracea 224 - 7 AAACAGA gibberellin-responsive element GARE-motif Brassica oleracea 922 + 7 AAACAGA gibberellin-responsive element GARE-motif Brassica oleracea 272 + 7 AAACAGA gibberellin-responsive element

GCN4_motif Oryza sativa 564 + 7 TGTGTCA cis-regulatory element involved in endosperm expression

GCN4_motif Oryza sativa 1142 - 7 TGAGTCA cis-regulatory element involved in endosperm expression

HD-Zip 1 Arabidopsis thaliana 537 + 8 CAAT(A/T)ATTG element involved in

differentiation of the palisade mesophyll cells

HD-Zip 2 Arabidopsis thaliana 537 + 8.5 CAAT(G/C)ATTG element involved in the control of leaf morphology development

I-box

Nicotiana plumbaginifolia 1224 + 9 CTCTTATGCT part of a light responsive element

MBS Arabidopsis thaliana 1260 - 6 CAACTG MYB binding site involved in drought-inducibility

MNF1 Zea mays 1083 + 7 GTGCCC(A/T)(A/T) light responsive element

O2-site Zea mays 1296 - 9 GATGACATGG cis-acting regulatory element involved in zein metabolism

regulation P-box Oryza sativa 263 + 7 CCTTTTG gibberellin-responsive element

Skn-1_motif Oryza sativa 26 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Page 39: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Skn-1_motif Oryza sativa 1141 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 481 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

TC-rich repeats Nicotiana tabacum 240 + 9 ATTTTCTTCA cis-acting element involved in defense and stress responsiveness

TC-rich repeats Nicotiana tabacum 544 - 9 ATTTTCTTCA cis-acting element involved in defense and stress responsiveness

TCA-element Nicotiana tabacum 428 + 9 CCATCTTTTT cis-acting element involved in salicylic acid responsiveness

TCA-element Nicotiana tabacum 982 - 9 CCATCTTTTT cis-acting element involved in salicylic acid responsiveness

TCCC-motif Spinacia oleracea 664 - 7 TCTCCCT part of a light responsive element

TGACG-motif Hordeum vulgare 482 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

as-2-box Nicotiana tabacum 548 + 9 GATAatGATG involved in shoot-specific

expression and light responsiveness

gene21008

ABRE Hordeum vulgare 278 - 9 CCGCGTAGGC cis-acting element involved in the abscisic acid responsiveness

Page 40: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

ACE Petroselinum crispum 237 - 9 CTAACGTATT cis-acting element involved in light responsiveness

ARE Zea mays 182 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1210 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 849 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

AT1-motif Solanum tuberosum 1389 - 13 AATTATTTTTTATT part of a light responsive module

ATCT-motif Arabidopsis thaliana 1117 + 9 AATCTAATCT part of a conserved DNA module involved in light responsiveness

ATGCAAAT motif Oryza sativa 723 - 8 ATACAAAT cis-acting regulatory element associated to the TGAGTCA

motif

Box 4 Petroselinum crispum 288 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 362 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 299 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Page 41: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Box 4 Petroselinum crispum 1303 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box-W1 Petroselinum crispum 679 - 6 TTGACC fungal elicitor responsive element

GA-motif Helianthus annuus 790 - 8 AAAGATGA part of a light responsive element

GAG-motif Hordeum vulgare 1191 - 7 GGAGATG part of a light responsive element

GARE-motif Brassica oleracea 710 - 7 AAACAGA gibberellin-responsive element

GCN4_motif Oryza sativa 843 - 7 TGTGTCA cis-regulatory element involved in endosperm expression

Gap-box Arabidopsis thaliana 1107 + 9.5 CAAATGAA(A/G)A part of a light responsive element

I-box Flaveria trinervia 1190 + 10 cCATATCCAAT part of a light responsive element

LTR Hordeum vulgare 1421 + 6 CCGAAA cis-acting element involved in low-temperature responsiveness

MBS Zea mays 678 + 6 CGGTCA MYB Binding Site

MBS Arabidopsis thaliana 981 - 6 CAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 936 - 6 CAACTG MYB binding site involved in drought-inducibility

Skn-1_motif Oryza sativa 127 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Page 42: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Skn-1_motif Oryza sativa 587 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 256 - 5.5 CC(G/A)CCC light responsive element Sp1 Oryza sativa 1186 - 6 GGGCGG light responsive element

TCA-element Brassica oleracea 66 - 9 GAGAAGAATA cis-acting element involved in salicylic acid responsiveness

TCA-element Nicotiana tabacum 768 + 9 CCATCTTTTT cis-acting element involved in salicylic acid responsiveness

TCCC-motif Spinacia oleracea 1358 - 7 TCTCCCT part of a light responsive element

TCT-motif Arabidopsis thaliana 1285 - 6 TCTTAC part of a light responsive element

TGA-element Brassica oleracea 645 + 6 AACGAC auxin-responsive element

circadian

Lycopersicon esculentum 306 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 848 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 557 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene23043

ABRE Oryza sativa 1260 - 11 GACACGTACGT cis-acting element involved in the abscisic acid responsiveness

ABRE Arabidopsis thaliana 1263 + 6 TACGTG cis-acting element involved in the abscisic acid responsiveness

Page 43: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

ABRE Hordeum vulgare 1261 + 9 CGCACGTGTC cis-acting element involved in the abscisic acid responsiveness

ACE Petroselinum crispum 1261 - 9 GACACGTATG cis-acting element involved in light responsiveness

ARE Zea mays 155 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1493 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1486 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Box-W1 Petroselinum crispum 777 - 6 TTGACC fungal elicitor responsive element

CGTCA-motif Hordeum vulgare 899 + 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

G-Box Antirrhinum majus 1263 - 6 CACGTA cis-acting regulatory element involved in light responsiveness

G-box Zea mays 731 + 6 CACGAC cis-acting regulatory element involved in light responsiveness

G-box Daucus carota 1263 + 6 TACGTG cis-acting regulatory element involved in light responsiveness

G-box Oryza sativa 1262 + 7 GTACGTG cis-acting regulatory element involved in light responsiveness

GAG-motif Spinacia oleracea 1284 - 7 AGAGATG part of a light responsive element

Page 44: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

GAG-motif Hordeum vulgare 1321 - 7 GGAGATG part of a light responsive element

GARE-motif Brassica oleracea 1113 + 7 AAACAGA gibberellin-responsive element

GC-motif Zea mays 1437 + 6 CCCCCG enhancer-like element involved in anoxic specific inducibility

GT1-motif Arabidopsis thaliana 1185 - 6 GGTTAA light responsive element

I-box Flaveria trinervia 996 - 7 GATATGG part of a light responsive element

LTR Hordeum vulgare 736 + 6 CCGAAA cis-acting element involved in low-temperature responsiveness

MBS Arabidopsis thaliana 1246 + 6 TAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 1255 - 6 TAACTG MYB binding site involved in drought-inducibility

Sp1 Zea mays 1174 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1434 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 1274 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1224 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 1304 + 5 CC(G/A)CCC light responsive elemen

TC-rich repeats Nicotiana tabacum 1086 + 9 GTTTTCTTAC cis-acting element involved in defense and stress responsiveness

TCA-element Brassica oleracea 521 - 9 TCAGAAGAGG cis-acting element involved in salicylic acid responsiveness

TCCC-motif Spinacia oleracea 1323 + 7 TCTCCCT part of a light responsive element

TCT-motif Arabidopsis thaliana 410 - 6 TCTTAC part of a light responsive element

Page 45: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TGACG-motif Hordeum vulgare 899 - 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

TGG-motif Gossypium hirsutum 566 + 8 GGTTGCCA part of a light responsive element

as-2-box Nicotiana tabacum 1386 - 9 GATAatGATG involved in shoot-specific

expression and light responsiveness

gene02697

ABRE Arabidopsis thaliana 1382 - 6 TACGTG cis-acting element involved in the abscisic acid responsiveness

AE-box Arabidopsis thaliana 258 + 8 AGAAACAA part of a module for light response

AT-rich element Glycine max 135 + 10 ATAGAAATCAA binding site of AT-rich DNA binding protein (ATBP-1)

ATGCAAAT motif Oryza sativa 129 + 8 ATACAAAT cis-acting regulatory element associated to the TGAGTCA

motif

Box 4 Petroselinum crispum 668 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

CATT-motif Zea mays 602 + 6 GCATTC part of a light responsive element

CATT-motif Zea mays 870 - 6 GCATTC part of a light responsive element

G-Box Antirrhinum majus 1382 + 6 CACGTA cis-acting regulatory element involved in light responsiveness

Page 46: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

G-box Daucus carota 1382 - 6 TACGTG cis-acting regulatory element involved in light responsiveness

GA-motif Helianthus annuus 459 - 8 AAAGATGA part of a light responsive element

GAG-motif Arabidopsis thaliana 1038 - 7 AGAGAGT part of a light responsive element

GAG-motif Spinacia oleracea 1221 + 7 AGAGATG part of a light responsive element

GT1-motif Solanum tuberosum 345 - 8 AATCCACA light responsive element

I-box Flaveria trinervia 197 - 7 GATATGG part of a light responsive element

I-box Flaveria trinervia 1444 - 7 GATATGG part of a light responsive element

LAMP-element Pisum sativum 463 + 8 CTTTATCA part of a light responsive element

LTR Hordeum vulgare 1357 + 6 CCGAAA cis-acting element involved in low-temperature responsiveness

O2-site Zea mays 1224 + 9 GATGACATGA cis-acting regulatory element involved in zein metabolism

regulation

Skn-1_motif Oryza sativa 86 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 672 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Page 47: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Skn-1_motif Oryza sativa 470 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1225 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 356 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 725 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 544 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

TCA-element Brassica oleracea 217 - 9 CAGAAAAGGA cis-acting element involved in salicylic acid responsiveness

TCA-element Brassica oleracea 1413 - 9 GAGAAGAATA cis-acting element involved in salicylic acid responsiveness

TCT-motif Arabidopsis thaliana 889 - 6 TCTTAC part of a light responsive element

as-2-box Nicotiana tabacum 460 - 9 GATAatGATG involved in shoot-specific

expression and light responsiveness

circadian

Lycopersicon esculentum 111 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene02696

Page 48: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

AE-box Arabidopsis thaliana 1233 - 8 AGAAACAA part of a module for light response

ARE Zea mays 136 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1296 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 801 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ATCT-motif Zea mays 194 + 9 AATCTGATCG part of a conserved DNA module involved in light responsiveness

ATCT-motif Arabidopsis thaliana 410 - 9 AATCTAATCT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 335 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 1310 - 7 TTTCAAA light responsive element Box III Pisum sativum 946 - 9 CATTTACACT protein binding site

CAT-box Arabidopsis thaliana 306 - 6 GCCACT cis-acting regulatory element related to meristem expression

CATT-motif Zea mays 458 - 6 GCATTC part of a light responsive element

ERE Dianthus caryophyllus 1310 - 8 ATTTCAAA ethylene-responsive element

GAG-motif Hordeum vulgare 100 + 7 GGAGATG part of a light responsive element

Page 49: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

GATA-motif Pisum sativum 1180 - 7 GATAGGG part of a light responsive element

GC-motif Zea mays 621 - 6 CCCCCG enhancer-like element involved in anoxic specific inducibility

GC-motif Zea mays 1103 + 6 CCCCCG enhancer-like element involved in anoxic specific inducibility

GT1-motif Arabidopsis thaliana 31 + 6 GGTTAA light responsive element GT1-motif Solanum tuberosum 501 + 10 ATGGTGGTTGG light responsive element

I-box Zea mays 1180 - 7 GATAGGG part of a light responsive element

I-box Flaveria trinervia 1364 + 10 cCATATCCAAT part of a light responsive element

MBS Arabidopsis thaliana 533 + 6 CAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 1336 - 6 TAACTG MYB binding site involved in drought-inducibility

MBS Zea mays 1107 + 6 CGGTCA MYB Binding Site P-box Oryza sativa 1114 + 7 CCTTTTG gibberellin-responsive element

Skn-1_motif Oryza sativa 255 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1109 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 757 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 66 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 858 - 5.5 CC(G/A)CCC light responsive element

Page 50: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Sp1 Oryza sativa 845 - 6 GGGCGG light responsive element

TC-rich repeats Nicotiana tabacum 224 - 9 ATTCTCTAAC cis-acting element involved in defense and stress responsiveness

TC-rich repeats Nicotiana tabacum 1467 + 10 ATTCTCTAAC cis-acting element involved in defense and stress responsiveness

TGA-element Brassica oleracea 899 + 6 AACGAC auxin-responsive element

circadian

Lycopersicon esculentum 193 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 1197 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 1177 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene26806 3-AF1 binding site Solanum tuberosum 51 + 10 AAGAGATATTT light responsive element

ABRE Arabidopsis thaliana 582 - 7 TACGGTC cis-acting element involved in the abscisic acid responsiveness

ABRE Arabidopsis thaliana 1460 + 6 TACGTG cis-acting element involved in the abscisic acid responsiveness

AE-box Arabidopsis thaliana 985 - 8 AGAAACTT part of a module for light response

ARE Zea mays 891 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Page 51: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

ARE Zea mays 1249 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

AT-rich sequence Pisum sativum 1203 + 9 TAAAATACT element for maximal elicitor-mediated activation (2copies)

Box I Pisum sativum 1317 - 7 TTTCAAA light responsive element Box I Pisum sativum 1390 - 7 TTTCAAA light responsive element

Box II Solanum tuberosum 83 - 9 TGGTAATAA part of a light responsive element

Box-W1 Petroselinum crispum 451 - 6 TTGACC fungal elicitor responsive element

G-Box Triticum aestivum 500 - 10 TCCACATGGCA cis-acting regulatory element involved in light responsiveness

G-Box Antirrhinum majus 1460 - 6 CACGTA cis-acting regulatory element involved in light responsiveness

G-box Solanum tuberosum 502 - 7 CACATGG cis-acting regulatory element involved in light responsiveness

G-box Daucus carota 1460 + 6 TACGTG cis-acting regulatory element involved in light responsiveness

G-box Oryza sativa 1459 + 7 GTACGTG cis-acting regulatory element involved in light responsiveness

GA-motif Helianthus annuus 848 - 8 AAAGATGA part of a light responsive element

GARE-motif Brassica oleracea 470 - 7 TCTGTTG gibberellin-responsive element

GATA-motif Solanum tuberosum 529 + 9 AAGGATAAGG part of a light responsive element

GT1-motif Arabidopsis thaliana 282 - 6 GGTTAA light responsive element GT1-motif Avena sativa 544 - 7 GGTTAAT light responsive element GT1-motif Solanum tuberosum 303 + 9 GTGTGTGAA light responsive element

Page 52: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

GT1-motif Arabidopsis thaliana 545 - 6 GGTTAA light responsive element

HSE Brassica oleracea 932 + 9 AAAAAATTTC cis-acting element involved in heat stress responsiveness

HSE Brassica oleracea 1445 - 9 AAAAAATTTC cis-acting element involved in heat stress responsiveness

I-box Flaveria trinervia 728 + 7 GATATGG part of a light responsive element

L-box Petroselinum crispum 1458 - 10 TCTCACCTACC part of a light responsive element

LTR Hordeum vulgare 318 - 6 CCGAAA cis-acting element involved in low-temperature responsiveness

MSA-like Catharanthus roseus 959 - 9 (T/C)C(T/C)AACGG(T/C)(T/C)A

cis-acting element involved in cell cycle regulation

MSA-like Catharanthus roseus 1328 - 9 (T/C)C(T/C)AACGG(T/C)(T/C)A

cis-acting element involved in cell cycle regulation

MSA-like Catharanthus roseus 1115 - 9 (T/C)C(T/C)AACGG(T/C)(T/C)A

cis-acting element involved in cell cycle regulation

Skn-1_motif Oryza sativa 389 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 847 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 604 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 429 - 5.5 CC(G/A)CCC light responsive element

Page 53: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TC-rich repeats Nicotiana tabacum 1072 - 9 GTTTTCTTAC cis-acting element involved in defense and stress responsiveness

TCT-motif Arabidopsis thaliana 176 - 6 TCTTAC part of a light responsive element

TCT-motif Arabidopsis thaliana 538 - 6 TCTTAC part of a light responsive element

chs-Unit 1 m1 Hordeum vulgare 515 + 10 ACCTAACCCGC part of a light responsive element

gene13324 AE-box Arabidopsis thaliana 1194 - 8 AGAAACTT part of a module for light

response

ARE Zea mays 1185 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1395 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1203 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ATGCAAAT motif Oryza sativa 1209 + 8 ATACAAAT cis-acting regulatory element associated to the TGAGTCA

motif

Box 4 Petroselinum crispum 349 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 180 + 7 TTTCAAA light responsive element

Page 54: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Box I Pisum sativum 1241 - 7 TTTCAAA light responsive element Box I Pisum sativum 207 - 7 TTTCAAA light responsive element Box I Pisum sativum 1309 + 7 TTTCAAA light responsive element

CATT-motif Zea mays 588 - 6 GCATTC part of a light responsive element

CCAAT-box Hordeum vulgare 1328 - 6 CAACGG MYBHv1 binding site ERE Dianthus caryophyllus 207 - 8 ATTTCAAA ethylene-responsive element ERE Dianthus caryophyllus 1308 + 8 ATTTCAAA ethylene-responsive element ERE Dianthus caryophyllus 1241 - 8 ATTTCAAA ethylene-responsive element

G-Box Pisum sativum 124 + 6 CACGTT cis-acting regulatory element involved in light responsiveness

G-box Zea mays 124 + 6 CACGTT cis-acting regulatory element involved in light responsiveness

GT1-motif Avena sativa 372 + 7 GGTTAAT light responsive element

HSE Brassica oleracea 1333 - 9 AGAAAATTCG cis-acting element involved in heat stress responsiveness

I-box Flaveria trinervia 1345 - 7 GATATGG part of a light responsive element

LAMP-element Pisum sativum 144 - 8 CTTTATCA part of a light responsive element

MBS Zea mays 116 + 6 CGGTCA MYB Binding Site

MSA-like Catharanthus roseus 1325 - 9 (T/C)C(T/C)AACGG(T/C)(T/C)A

cis-acting element involved in cell cycle regulation

RY-element Helianthus annuus 135 + 8 CATGCATG cis-acting regulatory element

involved in seed-specific regulation

Skn-1_motif Oryza sativa 133 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Page 55: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TC-rich repeats Nicotiana tabacum 1144 + 9 ATTTTCTCCA cis-acting element involved in defense and stress responsiveness

TCCC-motif Spinacia oleracea 69 + 7 TCTCCCT part of a light responsive element

TCT-motif Arabidopsis thaliana 729 + 6 TCTTAC part of a light responsive element

TCT-motif Arabidopsis thaliana 1233 - 6 TCTTAC part of a light responsive element

as-2-box Nicotiana tabacum 233 + 9 GATAatGATG involved in shoot-specific

expression and light responsiveness

circadian

Lycopersicon esculentum 201 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 537 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 333 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 1454 - 9 CAAAGATATC cis-acting regulatory element

involved in circadian control

gene28478 AE-box Arabidopsis thaliana 998 + 8 AGAAACTT part of a module for light

response

AE-box Arabidopsis thaliana 1388 + 8 AGAAACTT part of a module for light response

ARE Zea mays 1395 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Page 56: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

ATCT-motif Zea mays 970 - 9 AATCTGATCG part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 1155 + 7 TTTCAAA light responsive element Box I Pisum sativum 1198 - 7 TTTCAAA light responsive element

Box II Solanum tuberosum 1427 + 9 TGGTAATAA part of a light responsive element

CAT-box Arabidopsis thaliana 352 + 6 GCCACT cis-acting regulatory element related to meristem expression

ERE Dianthus caryophyllus 1198 - 8 ATTTCAAA ethylene-responsive element

GA-motif Arabidopsis thaliana 48 + 8 ATAGATAA part of a light responsive element

GAG-motif Spinacia oleracea 4 - 7 AGAGATG part of a light responsive element

GAG-motif Arabidopsis thaliana 242 - 7 AGAGAGT part of a light responsive element

GARE-motif Brassica oleracea 677 - 7 AAACAGA gibberellin-responsive element

GCN4_motif Oryza sativa 1240 + 7 TGTGTCA cis-regulatory element involved in endosperm expression

L-box

Lycopersicon esculentum 1202 + 11 AAATTAACCAAC part of a light responsive element

MBS Arabidopsis thaliana 658 + 6 TAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 904 + 6 TAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 788 + 6 CAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 1148 - 6 CAACTG MYB binding site involved in drought-inducibility

Page 57: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

O2-site Zea mays 595 - 9 GATGATATGG cis-acting regulatory element involved in zein metabolism

regulation

Skn-1_motif Oryza sativa 197 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1053 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 832 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1243 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 1215 - 5.5 CC(G/A)CCC light responsive element

TC-rich repeats Nicotiana tabacum 334 + 9 GTTTTCTTAC cis-acting element involved in defense and stress responsiveness

TC-rich repeats Nicotiana tabacum 1107 - 9 GTTTTCTTAC cis-acting element involved in defense and stress responsiveness

TCA-element Brassica oleracea 719 - 9 CAGAAAAGGA cis-acting element involved in salicylic acid responsiveness

TCA-element Brassica oleracea 1420 + 9 TCAGAAGAGG cis-acting element involved in salicylic acid responsiveness

TCCC-motif Spinacia oleracea 8 + 7 TCTCCCT part of a light responsive element

Page 58: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TCCC-motif Spinacia oleracea 378 + 7 TCTCCCT part of a light responsive element

TCT-motif Arabidopsis thaliana 338 + 6 TCTTAC part of a light responsive element

circadian

Lycopersicon esculentum 1472 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene31797 AE-box Arabidopsis thaliana 586 + 8 AGAAACAT part of a module for light

response

AE-box Arabidopsis thaliana 1254 + 8 AGAAACTT part of a module for light response

AE-box Arabidopsis thaliana 1167 - 8 AGAAACAT part of a module for light response

ARE Zea mays 619 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1336 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1006 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1409 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Box I Pisum sativum 1343 - 7 TTTCAAA light responsive element ELI-box3 Brassica oleracea 1336 + 9 AAACCAATT elicitor-responsive element

Page 59: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

GA-motif Glycine max 125 + 8 AAGGAAGA part of a light responsive element

GA-motif Arabidopsis thaliana 957 + 8 ATAGATAA part of a light responsive element

GARE-motif Brassica oleracea 949 + 7 AAACAGA gibberellin-responsive element

GATT-motif Triticum aestivum 323 + 11 CTGCAGATTTCT part of a light responsive element

GT1-motif Arabidopsis thaliana 1442 - 6 GGTTAA light responsive element

I-box Gossypium hirsutum 1318 + 10 AAGATAAGGCT part of a light responsive element

LTR Hordeum vulgare 1446 + 6 CCGAAA cis-acting element involved in low-temperature responsiveness

O2-site Zea mays 574 - 9 GATGACATGG cis-acting regulatory element involved in zein metabolism

regulation

RY-element Helianthus annuus 623 + 8 CATGCATG cis-acting regulatory element

involved in seed-specific regulation

Skn-1_motif Oryza sativa 178 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 417 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 184 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Page 60: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Skn-1_motif Oryza sativa 842 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 296 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 347 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 385 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 701 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 702 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 703 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 704 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 705 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 706 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 707 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 708 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 709 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 710 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 711 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 712 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 713 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 714 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 715 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 716 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 717 - 5 CC(G/A)CCC light responsive element

TCCC-motif Spinacia oleracea 343 + 7 TCTCCCT part of a light responsive element

TCCC-motif Spinacia oleracea 381 + 7 TCTCCCT part of a light responsive element

TCT-motif Arabidopsis thaliana 1061 - 6 TCTTAC part of a light responsive element

Page 61: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TCT-motif Arabidopsis thaliana 1416 + 6 TCTTAC part of a light responsive element

WUN-motif Brassica oleracea 1389 + 9 TCATTACGAA wound-responsive element

gene09561

ABRE Arabidopsis thaliana 1125 - 6 TACGTG cis-acting element involved in the abscisic acid responsiveness

ARE Zea mays 1142 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1466 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1214 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1490 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1196 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1472 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1350 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Page 62: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

ATCT-motif Zea mays 453 + 9 AATCTGATCG part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 758 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

CATT-motif Zea mays 196 - 6 GCATTC part of a light responsive element

CATT-motif Zea mays 327 - 6 GCATTC part of a light responsive element

CATT-motif Zea mays 239 + 6 GCATTC part of a light responsive element

CGTCA-motif Hordeum vulgare 651 + 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

G-Box Antirrhinum majus 1125 + 6 CACGTA cis-acting regulatory element involved in light responsiveness

G-box Daucus carota 1125 - 6 TACGTG cis-acting regulatory element involved in light responsiveness

GA-motif Glycine max 1388 - 8 AAGGAAGA part of a light responsive element

GARE-motif Brassica oleracea 211 - 7 TCTGTTG gibberellin-responsive element

GCN4_motif Oryza sativa 889 + 7 TGAGTCA cis-regulatory element involved in endosperm expression

LAMP-element Spinacia oleracea 1469 + 9 CCAAAACCA part of a light responsive element

LAMP-element Spinacia oleracea 1487 + 9 CCAAAACCA part of a light responsive element

Page 63: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

LTR Hordeum vulgare 1461 + 6 CCGAAA cis-acting element involved in low-temperature responsiveness

MBS Zea mays 1 + 6 CGGTCA MYB Binding Site

MBS Arabidopsis thaliana 369 - 6 TAACTG MYB binding site involved in drought-inducibility

MNF1 Zea mays 121 - 6.5 GTGCCC(A/T)(A/T) light responsive element

MNF1 Zea mays 1266 + 7 GTGCCC(A/T)(A/T) light responsive element

P-box Oryza sativa 1310 - 7 CCTTTTG gibberellin-responsive element

Skn-1_motif Oryza sativa 3 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1054 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 892 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1246 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

TGACG-motif Hordeum vulgare 651 - 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

chs-CMA2a Hordeum vulgare 993 + 8 GCAATTCC part of a light responsive element

Page 64: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

circadian

Lycopersicon esculentum 343 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 994 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 452 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene01286

ABRE Arabidopsis thaliana 491 + 6 TACGTG cis-acting element involved in the abscisic acid responsiveness

AE-box Arabidopsis thaliana 1153 + 8 AGAAACAA part of a module for light response

ARE Zea mays 620 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1339 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ATCT-motif Pisum sativum 1300 + 9 AATCTAATCC part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 208 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

CATT-motif Zea mays 1480 - 6 GCATTC part of a light responsive element

Page 65: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

CGTCA-motif Hordeum vulgare 235 + 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

CGTCA-motif Hordeum vulgare 654 + 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

G-Box Antirrhinum majus 491 - 6 CACGTA cis-acting regulatory element involved in light responsiveness

G-Box Pisum sativum 1058 + 6 CACGTT cis-acting regulatory element involved in light responsiveness

G-Box Pisum sativum 1001 + 6 CACGTT cis-acting regulatory element involved in light responsiveness

G-box Brassica oleracea 490 - 9 TAACACGTAG cis-acting regulatory element involved in light responsiveness

G-box Zea mays 1001 + 6 CACGTT cis-acting regulatory element involved in light responsiveness

G-box Daucus carota 491 + 6 TACGTG cis-acting regulatory element involved in light responsiveness

G-box Zea mays 1058 + 6 CACGTT cis-acting regulatory element involved in light responsiveness

GA-motif Glycine max 140 + 8 AAGGAAGA part of a light responsive element

GAG-motif Spinacia oleracea 1376 - 7 AGAGATG part of a light responsive element

GARE-motif Brassica oleracea 927 - 7 TCTGTTG gibberellin-responsive element

GCN4_motif Oryza sativa 1343 + 7 CAAGCCA cis-regulatory element involved in endosperm expression

HSE Brassica oleracea 304 + 9 AGAAAATTCG cis-acting element involved in heat stress responsiveness

Page 66: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

I-box Flaveria trinervia 589 - 7 GATATGG part of a light responsive element

I-box Arabidopsis thaliana 809 - 9 GATAAGGGT part of a light responsive element

LAMP-element Pisum sativum 1007 - 8 CTTTATCA part of a light responsive element

MBS Arabidopsis thaliana 171 - 6 CAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 1201 + 6 CAACTG MYB binding site involved in drought-inducibility

MNF1 Zea mays 1124 - 7 GTGCCC(A/T)(A/T) light responsive element

Skn-1_motif Oryza sativa 236 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1032 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 969 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1217 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 150 - 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1094 - 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 161 - 5.5 CC(G/A)CCC light responsive element

TATC-box Oryza sativa 814 + 7 TATCCCA cis-acting element involved in gibberellin-responsiveness

Page 67: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TCA-element Nicotiana tabacum 1375 + 9 CCATCTTTTT cis-acting element involved in salicylic acid responsiveness

TGACG-motif Hordeum vulgare 235 - 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

TGACG-motif Hordeum vulgare 654 - 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

chs-CMA1a Daucus carota 737 - 8 TTACTTAA part of a light responsive element

chs-CMA2a Petroselinum crispum 402 - 8 TCACTTGA part of a light responsive element

gene08253

ARE Zea mays 289 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1449 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 390 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Box 4 Petroselinum crispum 539 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1313 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Page 68: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Box 4 Petroselinum crispum 1189 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1471 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

CATT-motif Zea mays 1406 - 6 GCATTC part of a light responsive element

G-Box Pisum sativum 1198 - 6 CACGTT cis-acting regulatory element involved in light responsiveness

G-box Zea mays 50 + 6 CACGTC cis-acting regulatory element involved in light responsiveness

G-box Zea mays 1198 - 6 CACGTT cis-acting regulatory element involved in light responsiveness

G-box Brassica oleracea 55 - 9 TAACACGTAG cis-acting regulatory element involved in light responsiveness

GARE-motif Brassica oleracea 468 - 7 TCTGTTG gibberellin-responsive element

GC-motif Zea mays 824 - 7 GCCCCGG enhancer-like element involved in anoxic specific inducibility

O2-site Zea mays 1485 - 9 GATGATGTGG cis-acting regulatory element involved in zein metabolism

regulation

Skn-1_motif Oryza sativa 16 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 731 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Page 69: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Skn-1_motif Oryza sativa 277 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Oryza sativa 827 + 6 GGGCGG light responsive element

TC-rich repeats Nicotiana tabacum 1138 - 9 ATTTTCTCCA cis-acting element involved in defense and stress responsiveness

TCA-element Nicotiana tabacum 595 + 9 CCATCTTTTT cis-acting element involved in salicylic acid responsiveness

circadian

Lycopersicon esculentum 2 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 1167 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene08254

ABRE Arabidopsis thaliana 485 - 6 TACGTG cis-acting element involved in the abscisic acid responsiveness

ABRE Hordeum vulgare 827 - 9 CGTACGTGCA cis-acting element involved in the abscisic acid responsiveness

AE-box Arabidopsis thaliana 625 - 8 AGAAACTT part of a module for light response

ARE Zea mays 392 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 709 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Page 70: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

AT1-motif Solanum tuberosum 814 + 11 ATTAATTTTACA part of a light responsive module

ATCT-motif Arabidopsis thaliana 20 - 9 AATCTAATCT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 677 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 912 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 814 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1489 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box-W1 Petroselinum crispum 282 - 6 TTGACC fungal elicitor responsive element

CCAAT-box Hordeum vulgare 979 - 6 CAACGG MYBHv1 binding site

G-Box Antirrhinum majus 485 + 6 CACGTA cis-acting regulatory element involved in light responsiveness

G-box Zea mays 146 - 9 GACATGTGGT cis-acting regulatory element involved in light responsiveness

G-box Daucus carota 485 - 6 TACGTG cis-acting regulatory element involved in light responsiveness

GAG-motif Arabidopsis thaliana 927 - 7 AGAGAGT part of a light responsive element

Page 71: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

GAG-motif Spinacia oleracea 1464 + 7 AGAGATG part of a light responsive element

GAG-motif Arabidopsis thaliana 1094 - 7 AGAGAGT part of a light responsive element

GARE-motif Brassica oleracea 346 + 7 AAACAGA gibberellin-responsive element

GATA-motif Solanum tuberosum 87 - 9 AAGGATAAGG part of a light responsive element

GATA-motif Arabidopsis thaliana 1430 + 7 GATAGGA part of a light responsive element

GC-motif Zea mays 53 + 6 CCCCCG enhancer-like element involved in anoxic specific inducibility

Gap-box Arabidopsis thaliana 862 - 9.5 CAAATGAA(A/G)A part of a light responsive element

MBS Arabidopsis thaliana 180 + 6 TAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 202 + 6 TAACTG MYB binding site involved in drought-inducibility

Skn-1_motif Oryza sativa 791 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1027 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 901 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1345 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Page 72: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TC-rich repeats Nicotiana tabacum 130 + 9 ATTTTCTTCA cis-acting element involved in defense and stress responsiveness

TC-rich repeats Nicotiana tabacum 160 + 9 ATTTTCTCCA cis-acting element involved in defense and stress responsiveness

WUN-motif Brassica oleracea 1173 + 9 TCATTACGAA wound-responsive element

circadian

Lycopersicon esculentum 98 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

circadian

Lycopersicon esculentum 496 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene26330 ACE Petroselinum crispum 1057 - 9 CTAACGTATT cis-acting element involved in

light responsiveness

ARE Zea mays 1405 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ATC-motif Spinacia oleracea 769 + 8 AGTAATCT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1294 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 208 - 7 TTTCAAA light responsive element

Box-W1 Petroselinum crispum 1090 + 6 TTGACC fungal elicitor responsive element

CAT-box Arabidopsis thaliana 274 - 6 GCCACT cis-acting regulatory element related to meristem expression

Page 73: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

CAT-box Arabidopsis thaliana 1072 + 6 GCCACT cis-acting regulatory element related to meristem expression

CAT-box Arabidopsis thaliana 959 + 6 GCCACT cis-acting regulatory element related to meristem expression

CATT-motif Zea mays 56 + 6 GCATTC part of a light responsive element

CCGTCC-box Arabidopsis thaliana 11 + 6 CCGTCC cis-acting regulatory element related to meristem specific

activation

CGTCA-motif Hordeum vulgare 140 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

G-Box Pisum sativum 1009 - 10 CACACATGGAA cis-acting regulatory element involved in light responsiveness

GA-motif Helianthus annuus 1135 - 8 AAAGATGA part of a light responsive element

GAG-motif Hordeum vulgare 569 + 7 GGAGATG part of a light responsive element

GAG-motif Arabidopsis thaliana 1253 + 7 AGAGAGT part of a light responsive element

GATA-motif Pisum sativum 1176 - 7 GATAGGG part of a light responsive element

GCN4_motif Oryza sativa 401 + 7 TGAGTCA cis-regulatory element involved in endosperm expression

GCN4_motif Oryza sativa 711 + 7 CAAGCCA cis-regulatory element involved in endosperm expression

HSE Brassica oleracea 211 - 9 AAAAAATTTC cis-acting element involved in heat stress responsiveness

Page 74: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

I-box Solanum tuberosum 292 + 9 TGATAATGT part of a light responsive element

I-box Helianthus annuus 1206 + 10 atGATAAGGTC part of a light responsive element

I-box Helianthus annuus 1166 + 10 atGATAAGGTC part of a light responsive element

I-box Larix laricina 1033 + 9 GTATAAGGCC part of a light responsive element

I-box Zea mays 1176 - 7 GATAGGG part of a light responsive element

MBS Arabidopsis thaliana 243 - 6 CAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 903 + 6 CAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 802 - 6 CAACTG MYB binding site involved in drought-inducibility

TATC-box Oryza sativa 183 - 7 TATCCCA cis-acting element involved in gibberellin-responsiveness

TATC-box Oryza sativa 1031 - 7 TATCCCA cis-acting element involved in gibberellin-responsiveness

TGACG-motif Hordeum vulgare 140 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

TGG-motif Helianthus annuus 1426 - 9 TGGTGGCTA part of a light responsive element

as-2-box Nicotiana tabacum 1159 + 9 GATAatGATG involved in shoot-specific

expression and light responsiveness

Page 75: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

as-2-box Nicotiana tabacum 1199 + 9 GATAatGATG involved in shoot-specific

expression and light responsiveness

circadian

Lycopersicon esculentum 808 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene24088

ARE Zea mays 545 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1065 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 675 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1403 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ATGCAAAT motif Oryza sativa 1370 - 8 ATACAAAT cis-acting regulatory element associated to the TGAGTCA

motif

Box 4 Petroselinum crispum 173 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box III Pisum sativum 964 - 9 CATTTACACT protein binding site CCAAT-box Hordeum vulgare 197 + 6 CAACGG MYBHv1 binding site CCAAT-box Hordeum vulgare 226 + 6 CAACGG MYBHv1 binding site

Page 76: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

CGTCA-motif Hordeum vulgare 30 + 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

CGTCA-motif Hordeum vulgare 1017 + 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

CGTCA-motif Hordeum vulgare 475 + 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

CGTCA-motif Hordeum vulgare 262 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

CGTCA-motif Hordeum vulgare 885 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

GARE-motif Brassica oleracea 392 + 7 TCTGTTG gibberellin-responsive element GARE-motif Brassica oleracea 539 - 7 AAACAGA gibberellin-responsive element GT1-motif Solanum tuberosum 729 - 8 AATCCACA light responsive element

HSE Brassica oleracea 312 - 9 AGAAAATTCG cis-acting element involved in heat stress responsiveness

MBS Zea mays 200 + 6 CGGTCA MYB Binding Site

MNF1 Zea mays 134 - 6.5 GTGCCC(A/T)(A/T) light responsive element

MSA-like Catharanthus roseus 195 + 9 TCCAACGGT cis-acting element involved in cell cycle regulation

Skn-1_motif Oryza sativa 31 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Page 77: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Skn-1_motif Oryza sativa 476 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 494 + 5 CC(G/A)CCC light responsive element

TGA-box Glycine max 27 - 8 TGACGTAA part of an auxin-responsive element

TGACG-motif Hordeum vulgare 30 - 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

TGACG-motif Hordeum vulgare 1017 - 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

TGACG-motif Hordeum vulgare 475 - 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

TGACG-motif Hordeum vulgare 262 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

TGACG-motif Hordeum vulgare 885 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

circadian

Lycopersicon esculentum 1378 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene30401 3-AF1 binding site Solanum tuberosum 1130 - 10 TAAGAGAGGAA light responsive element

ARE Zea mays 63 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Page 78: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

ARE Zea mays 1105 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 651 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 610 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 714 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Box 4 Petroselinum crispum 143 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1401 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box-W1 Petroselinum crispum 982 - 6 TTGACC fungal elicitor responsive element

CCAAT-box Hordeum vulgare 1201 + 6 CAACGG MYBHv1 binding site

CGTCA-motif Hordeum vulgare 1357 + 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

DRE Arabidopsis thaliana 386 - 9 TACCGACAT "cis-acting element involved in

dehydration, low-temp, salt stresse

G-Box Pisum sativum 885 - 6 CACGTT cis-acting regulatory element involved in light responsiveness

Page 79: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

G-Box Pisum sativum 1271 + 6 CACGTT cis-acting regulatory element involved in light responsiveness

G-box Zea mays 885 - 6 CACGTT cis-acting regulatory element involved in light responsiveness

G-box Zea mays 1271 + 6 CACGTT cis-acting regulatory element involved in light responsiveness

GA-motif Arabidopsis thaliana 892 - 8 ATAGATAA part of a light responsive element

GAG-motif Arabidopsis thaliana 1141 - 7 AGAGAGT part of a light responsive element

GARE-motif Brassica oleracea 865 - 7 AAACAGA gibberellin-responsive element

GATA-motif Pisum sativum 1475 - 7 GATAGGG part of a light responsive element

I-box Zea mays 1475 - 7 GATAGGG part of a light responsive element

MBS Zea mays 106 + 6 CGGTCA MYB Binding Site

MBS Arabidopsis thaliana 511 - 6 CAACTG MYB binding site involved in drought-inducibility

MRE Petroselinum crispum 216 - 7 AACCTAA MYB binding site involved in light responsiveness

TC-rich repeats Nicotiana tabacum 730 - 9 ATTTTCTTCA cis-acting element involved in defense and stress responsiveness

TCA-element Brassica oleracea 324 - 9 TCAGAAGAGG cis-acting element involved in salicylic acid responsiveness

TCA-element Brassica oleracea 1174 - 9 GAGAAGAATA cis-acting element involved in salicylic acid responsiveness

TCA-element Brassica oleracea 1163 - 9 GAGAAGAATA cis-acting element involved in salicylic acid responsiveness

Page 80: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TCT-motif Arabidopsis thaliana 1015 + 6 TCTTAC part of a light responsive element

TGA-element Brassica oleracea 159 - 6 AACGAC auxin-responsive element

TGACG-motif Hordeum vulgare 1357 - 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

WUN-motif Brassica oleracea 247 - 9 TCATTACGAA wound-responsive element

as-2-box Nicotiana tabacum 1369 - 9 GATAatGATG involved in shoot-specific

expression and light responsiveness

as-2-box Nicotiana tabacum 1378 - 9 GATAatGATG involved in shoot-specific

expression and light responsiveness

rbcS-CMA7a Zea mays 1286 - 9 GGCGATAAGG part of a light responsive element

gene05722 A-box Petroselinum crispum 1246 + 6 CCGTCC cis-acting regulatory element

ARE Zea mays 1440 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Box 4 Petroselinum crispum 861 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 1465 - 7 TTTCAAA light responsive element CCAAT-box Hordeum vulgare 1084 + 6 CAACGG MYBHv1 binding site

CCGTCC-box Arabidopsis thaliana 1246 + 6 CCGTCC cis-acting regulatory element related to meristem specific

activation

Page 81: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

CGTCA-motif Hordeum vulgare 819 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

CGTCA-motif Hordeum vulgare 944 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

ERE Dianthus caryophyllus 1465 - 8 ATTTCAAA ethylene-responsive element

GAG-motif Arabidopsis thaliana 1328 - 7 AGAGAGT part of a light responsive element

GCN4_motif Oryza sativa 31 - 7 TGAGTCA cis-regulatory element involved in endosperm expression

GT1-motif Avena sativa 1158 - 7 GGTTAAT light responsive element GT1-motif Solanum tuberosum 1387 + 8 AATCCACA light responsive element GT1-motif Arabidopsis thaliana 1159 - 6 GGTTAA light responsive element

Gap-box Arabidopsis thaliana 1023 + 9 AAATGGAGA part of a light responsive element

HSE Brassica oleracea 729 - 9 AAAAAATTTC cis-acting element involved in heat stress responsiveness

HSE Brassica oleracea 788 - 9 AGAAAATTCG cis-acting element involved in heat stress responsiveness

I-box Triticum aestivum 1258 - 9 aAGATAAGA part of a light responsive element

I-box Solanum tuberosum 1474 + 10 TATTATCTAGA part of a light responsive element

LTR Hordeum vulgare 1236 + 6 CCGAAA cis-acting element involved in low-temperature responsiveness

MNF1 Zea mays 1302 - 6.5 GTGCCC(A/T)(A/T) light responsive element

Page 82: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

MRE Petroselinum crispum 654 - 7 AACCTAA MYB binding site involved in light responsiveness

MSA-like Catharanthus roseus 1082 + 9 TCCAACGGT cis-acting element involved in cell cycle regulation

O2-site Zea mays 23 - 9 GATGACATGA cis-acting regulatory element involved in zein metabolism

regulation

O2-site Zea mays 539 + 9 GATGACATGA cis-acting regulatory element involved in zein metabolism

regulation

O2-site Zea mays 351 + 9 GATGATATGG cis-acting regulatory element involved in zein metabolism

regulation

O2-site Zea mays 108 - 9 GATGATGTGG cis-acting regulatory element involved in zein metabolism

regulation

O2-site Zea mays 517 + 9 GATGACATGA cis-acting regulatory element involved in zein metabolism

regulation

Skn-1_motif Oryza sativa 27 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 545 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 311 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Page 83: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Skn-1_motif Oryza sativa 687 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 30 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 526 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 1130 + 5 CC(G/A)CCC light responsive element

TC-rich repeats Nicotiana tabacum 706 + 9 ATTTTCTTCA cis-acting element involved in defense and stress responsiveness

TC-rich repeats Nicotiana tabacum 1026 - 9 ATTTTCTTCA cis-acting element involved in defense and stress responsiveness

TC-rich repeats Nicotiana tabacum 791 + 9 ATTTTCTTCA cis-acting element involved in defense and stress responsiveness

TCCC-motif Spinacia oleracea 376 - 7 TCTCCCT part of a light responsive element

TCT-motif Arabidopsis thaliana 245 - 6 TCTTAC part of a light responsive element

TCT-motif Arabidopsis thaliana 1418 + 6 TCTTAC part of a light responsive element

TGACG-motif Hordeum vulgare 819 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

Page 84: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TGACG-motif Hordeum vulgare 944 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

as-2-box Nicotiana tabacum 664 + 9 GATAatGATG involved in shoot-specific

expression and light responsiveness

circadian

Lycopersicon esculentum 1381 + 9 CAAAGATATC cis-acting regulatory element

involved in circadian control

gene25541 ACE Petroselinum crispum 566 + 9 AAAACGTTTA cis-acting element involved in

light responsiveness

Box 4 Petroselinum crispum 17 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1486 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 1071 - 7 TTTCAAA light responsive element

CAT-box Arabidopsis thaliana 35 + 6 GCCACT cis-acting regulatory element related to meristem expression

CCAAT-box Hordeum vulgare 754 - 6 CAACGG MYBHv1 binding site CCAAT-box Hordeum vulgare 1444 - 6 CAACGG MYBHv1 binding site

CCGTCC-box Arabidopsis thaliana 1440 + 6 CCGTCC cis-acting regulatory element related to meristem specific

activation ERE Dianthus caryophyllus 1071 - 8 ATTTCAAA ethylene-responsive element GARE-motif Brassica oleracea 657 + 7 AAACAGA gibberellin-responsive element

Page 85: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

GATA-motif Arabidopsis thaliana 864 - 7 GATAGGA part of a light responsive element

GT1-motif Arabidopsis thaliana 888 - 6 GGTTAA light responsive element GT1-motif Avena sativa 1234 - 7 GGTTAAT light responsive element GT1-motif Arabidopsis thaliana 898 - 6 GGTTAA light responsive element GT1-motif Arabidopsis thaliana 1235 - 6 GGTTAA light responsive element

HSE Brassica oleracea 1002 + 9 AAAAAATTTC cis-acting element involved in heat stress responsiveness

I-box Solanum tuberosum 683 - 10 TATTATCTAGA part of a light responsive element

O2-site Zea mays 1384 - 10 GATGATGTGG cis-acting regulatory element involved in zein metabolism

regulation

Skn-1_motif Oryza sativa 502 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1221 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 965 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

TC-rich repeats Nicotiana tabacum 329 - 9 ATTCTCTAAC cis-acting element involved in defense and stress responsiveness

TCT-motif Arabidopsis thaliana 1298 + 6 TCTTAC part of a light responsive element

WUN-motif Brassica oleracea 1005 + 9 AAATTTCCT wound-responsive element

Page 86: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

as-2-box Nicotiana tabacum 1416 - 9 GATAatGATG involved in shoot-specific

expression and light responsiveness

circadian

Lycopersicon esculentum 861 + 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

gene02557

ARE Zea mays 191 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ATCT-motif Arabidopsis thaliana 304 - 9 AATCTAATCT part of a conserved DNA module involved in light responsiveness

ATCT-motif Arabidopsis thaliana 1457 - 9 AATCTAATCT part of a conserved DNA module involved in light responsiveness

AuxRR-core Nicotiana tabacum 464 + 7 GGTCCAT cis-acting regulatory element involved in auxin responsiveness

Box 4 Petroselinum crispum 590 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 658 - 7 TTTCAAA light responsive element CCAAT-box Hordeum vulgare 1108 + 6 CAACGG MYBHv1 binding site CCAAT-box Hordeum vulgare 1140 + 6 CAACGG MYBHv1 binding site

CCGTCC-box Arabidopsis thaliana 1490 - 6 CCGTCC cis-acting regulatory element related to meristem specific

activation

Page 87: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

CGTCA-motif Hordeum vulgare 1265 + 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

G-box Zea mays 991 - 6 CACGTC cis-acting regulatory element involved in light responsiveness

G-box Zea mays 1234 - 6 CACGAC cis-acting regulatory element involved in light responsiveness

G-box Solanum tuberosum 1226 - 7 CACATGG cis-acting regulatory element involved in light responsiveness

GAG-motif Arabidopsis thaliana 1344 - 7 AGAGAGT part of a light responsive element

GAG-motif Arabidopsis thaliana 1378 - 7 AGAGAGT part of a light responsive element

GAG-motif Arabidopsis thaliana 1370 - 7 AGAGAGT part of a light responsive element

GARE-motif Brassica oleracea 1363 - 7 AAACAGA gibberellin-responsive element

GATT-motif Triticum aestivum 1035 - 11 CTGCAGATTTCT part of a light responsive element

GCN4_motif Oryza sativa 83 + 7 TGTGTCA cis-regulatory element involved in endosperm expression

GCN4_motif Oryza sativa 1309 - 7 TGTGTCA cis-regulatory element involved in endosperm expression

GT1-motif Arabidopsis thaliana 702 - 6 GGTTAA light responsive element GT1-motif Arabidopsis thaliana 1298 + 6 GGTTAA light responsive element GT1-motif Arabidopsis thaliana 1112 + 6 GGTTAA light responsive element

HD-Zip 1 Arabidopsis thaliana 603 + 8.5 CAAT(A/T)ATTG element involved in

differentiation of the palisade mesophyll cells

Page 88: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

HD-Zip 2 Arabidopsis thaliana 603 + 8 CAAT(G/C)ATTG element involved in the control of leaf morphology development

HSE Brassica oleracea 1415 + 9 AAAAAATTTC cis-acting element involved in heat stress responsiveness

MBS Arabidopsis thaliana 633 + 6 TAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 1002 - 6 CAACTG MYB binding site involved in drought-inducibility

MRE Petroselinum crispum 1460 - 7 AACCTAA MYB binding site involved in light responsiveness

MSA-like Catharanthus roseus 1106 + 9 TCCAACGGT cis-acting element involved in cell cycle regulation

Pc-CMA2a Spinacia oleracea 11 - 12 CAACCAATGAAAA part of a light responsive element

Skn-1_motif Oryza sativa 967 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

TCA-element Nicotiana tabacum 239 - 9 CCATCTTTTT cis-acting element involved in salicylic acid responsiveness

TGA-element Brassica oleracea 36 + 6 AACGAC auxin-responsive element TGA-element Brassica oleracea 1432 + 6 AACGAC auxin-responsive element TGA-element Brassica oleracea 800 + 6 AACGAC auxin-responsive element

TGACG-motif Hordeum vulgare 1265 - 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

circadian

Lycopersicon esculentum 1458 - 6 CAANNNNATC cis-acting regulatory element

involved in circadian control

Page 89: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

gene10300 A-box Petroselinum crispum 973 + 6 CCGTCC cis-acting regulatory element A-box Petroselinum crispum 978 + 6 CCGTCC cis-acting regulatory element

ABRE Arabidopsis thaliana 534 + 6 TACGTG cis-acting element involved in the abscisic acid responsiveness

ABRE Oryza sativa 852 - 9 GCCGCGTGGC cis-acting element involved in the abscisic acid responsiveness

ACE Petroselinum hortense 1245 + 7 ACGTGGA cis-acting element involved in light responsiveness

ARE Zea mays 634 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1402 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1290 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1420 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 775 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1408 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Page 90: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

ARE Zea mays 1396 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 714 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1251 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Box I Pisum sativum 215 - 7 TTTCAAA light responsive element

CAT-box Arabidopsis thaliana 519 + 6 GCCACT cis-acting regulatory element related to meristem expression

CAT-box Arabidopsis thaliana 990 - 6 GCCACT cis-acting regulatory element related to meristem expression

CCGTCC-box Arabidopsis thaliana 973 + 6 CCGTCC cis-acting regulatory element related to meristem specific

activation

CCGTCC-box Arabidopsis thaliana 978 + 6 CCGTCC cis-acting regulatory element related to meristem specific

activation

CGTCA-motif Hordeum vulgare 407 - 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

CGTCA-motif Hordeum vulgare 1129 + 5 CGTCA cis-acting regulatory element

involved in the MeJA-responsiveness

EIRE Nicotiana tabacum 821 + 7 TTCGACC elicitor-responsive element

G-Box Pisum sativum 55 - 10 CACACATGGAA cis-acting regulatory element involved in light responsiveness

Page 91: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

G-Box Pisum sativum 843 - 6 CACGTT cis-acting regulatory element involved in light responsiveness

G-Box Antirrhinum majus 534 - 6 CACGTA cis-acting regulatory element involved in light responsiveness

G-Box Pisum sativum 1244 - 6 CACGTT cis-acting regulatory element involved in light responsiveness

G-box Zea mays 408 - 6 CACGTC cis-acting regulatory element involved in light responsiveness

G-box Zea mays 1244 - 6 CACGTT cis-acting regulatory element involved in light responsiveness

G-box Daucus carota 534 + 6 TACGTG cis-acting regulatory element involved in light responsiveness

G-box Oryza sativa 533 + 7 GTACGTG cis-acting regulatory element involved in light responsiveness

G-box Zea mays 843 - 6 CACGTT cis-acting regulatory element involved in light responsiveness

GAG-motif Arabidopsis thaliana 361 - 7 AGAGAGT part of a light responsive element

GAG-motif Arabidopsis thaliana 1440 - 7 AGAGAGT part of a light responsive element

GAG-motif Arabidopsis thaliana 569 + 7 AGAGAGT part of a light responsive element

GC-motif Zea mays 562 + 7 GCCCCGG enhancer-like element involved in anoxic specific inducibility

I-box

Nicotiana plumbaginifolia 488 - 9 CTCTTATGCT part of a light responsive element

LAMP-element Spinacia oleracea 631 + 9 CCAAAACCA part of a light responsive element

Page 92: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

LAMP-element Spinacia oleracea 1417 + 9 CCAAAACCA part of a light responsive element

LAMP-element Spinacia oleracea 1399 + 9 CCAAAACCA part of a light responsive element

LAMP-element Spinacia oleracea 1393 + 9 CCAAAACCA part of a light responsive element

LAMP-element Spinacia oleracea 1405 + 9 CCAAAACCA part of a light responsive element

LTR Hordeum vulgare 710 + 6 CCGAAA cis-acting element involved in low-temperature responsiveness

MBS Arabidopsis thaliana 502 + 6 CAACTG MYB binding site involved in drought-inducibility

MBS Zea mays 805 + 6 CGGTCA MYB Binding Site

MBS Arabidopsis thaliana 606 - 6 CAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 1477 + 6 CAACTG MYB binding site involved in drought-inducibility

Skn-1_motif Oryza sativa 807 + 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 1095 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Sp1 Zea mays 916 + 5 CC(G/A)CCC light responsive element

TATC-box Oryza sativa 690 + 7 TATCCCA cis-acting element involved in gibberellin-responsiveness

Page 93: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

TC-rich repeats Nicotiana tabacum 1274 - 9 ATTTTCTCCA cis-acting element involved in defense and stress responsiveness

TGACG-motif Hordeum vulgare 407 + 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

TGACG-motif Hordeum vulgare 1129 - 5 TGACG cis-acting regulatory element

involved in the MeJA-responsiveness

gene03741

ABRE Arabidopsis thaliana 222 - 6 TACGTG cis-acting element involved in the abscisic acid responsiveness

ABRE Arabidopsis thaliana 1016 + 7 TACGGTC cis-acting element involved in the abscisic acid responsiveness

ACE Petroselinum hortense 220 - 7 ACGTGGA cis-acting element involved in light responsiveness

ARE Zea mays 41 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1303 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 748 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

Page 94: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

ARE Zea mays 189 - 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

ARE Zea mays 1171 + 6 TGGTTT cis-acting regulatory element

essential for the anaerobic induction

AT-rich element Glycine max 689 - 10 ATAGAAATCAA binding site of AT-rich DNA binding protein (ATBP-1)

Box 4 Petroselinum crispum 138 + 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box 4 Petroselinum crispum 1455 - 6 ATTAAT part of a conserved DNA module involved in light responsiveness

Box I Pisum sativum 655 + 7 TTTCAAA light responsive element Box I Pisum sativum 1486 - 7 TTTCAAA light responsive element Box I Pisum sativum 1306 + 7 TTTCAAA light responsive element

Box-W1 Petroselinum crispum 73 - 6 TTGACC fungal elicitor responsive element

Box-W1 Petroselinum crispum 1019 - 6 TTGACC fungal elicitor responsive element

Box-W1 Petroselinum crispum 522 + 6 TTGACC fungal elicitor responsive element

ERE Dianthus caryophyllus 654 + 8 ATTTCAAA ethylene-responsive element

G-Box Antirrhinum majus 222 + 6 CACGTA cis-acting regulatory element involved in light responsiveness

G-box Daucus carota 222 - 6 TACGTG cis-acting regulatory element involved in light responsiveness

Page 95: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

GAG-motif Arabidopsis thaliana 203 - 7 AGAGAGT part of a light responsive element

GAG-motif Arabidopsis thaliana 1008 + 7 AGAGAGT part of a light responsive element

GC-motif Zea mays 875 + 6 CCCCCG enhancer-like element involved in anoxic specific inducibility

MBS Arabidopsis thaliana 45 - 6 TAACTG MYB binding site involved in drought-inducibility

MBS Arabidopsis thaliana 1332 + 6 CAACTG MYB binding site involved in drought-inducibility

MBS Zea mays 1018 + 6 CGGTCA MYB Binding Site MBS Zea mays 523 - 6 CGGTCA MYB Binding Site

MBS Arabidopsis thaliana 1139 - 6 CAACTG MYB binding site involved in drought-inducibility

P-box Oryza sativa 1022 - 7 CCTTTTG gibberellin-responsive element

Skn-1_motif Oryza sativa 26 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

Skn-1_motif Oryza sativa 437 - 5 GTCAT cis-acting regulatory element

required for endosperm expression

TC-rich repeats Nicotiana tabacum 386 - 9 GTTTTCTTAC cis-acting element involved in defense and stress responsiveness

TC-rich repeats Nicotiana tabacum 1028 + 9 GTTTTCTTAC cis-acting element involved in defense and stress responsiveness

TCA-element Brassica oleracea 90 - 9 CAGAAAAGGA cis-acting element involved in salicylic acid responsiveness

Page 97: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

Table S3. List of primers used in this study.

Gene Name Primers Primer Sequence (5' to 3')

FvLBD1A 25294-qRT-F1 GTGAGTGACCTTCAAGCACA

25294-qRT-R1 AGGAAGCTCAAGTTGGTCTG

FvLBD1B 23226-qRT-F2 GAGCAGATGCAGTGAGCAGC

23226-qRT-R1 TCGAGTATGGTTGCTGCTGC

FvLBD2 17794-qRT-F1 GAGGAGGATGGGTTCAGTGG

17794-qRT-R1 GATGGCCACTTCATCAATAG

FvLBD4A 20083-qRT-F1 CTGGCTCTGGCTCAGGCTGAG

20083-qRT-R1 CCAAGCTGCTATGGTCCATC

FvLBD4B 30046-qRT-F1 CTCAACTGGCCATCGCACAAG

30046-qRT-R1 GCCTGATCTACCACCATATC

FvLBD6 21541-qRT-F1 GTACCACCACTGGCATTGGC

21541-qRT-R1 GCAGCAGCCCTAGGTTGCTG

FvLBD9 12646-qRT-F1 CGTGGACACAATTACCGACC

12646-qRT-R1 CGTCTCTATGTTCCATGCCAG

FvLBD12A 28202-qRT-F2 CTGTGAGCAGCTTGGTGTAC

28202-qRT-R1 CTACTGAGGTACTGTGGAATG

FvLBD12B 21039-qRT-F2 CAGTGAGCAGTCTAGTGTATG

21039-qRT-R1 GTCATGGATTACATTGCTAG

FvLBD15A 21311-qRT-F1 CAAGCGGAGCTCAATACTGTG

21311-qRT-R1 CGCTGTTGGGTTGAGTGTAC

FvLBD15B 28137-qRT-F1 CTTCATGCTGTCAGGACAGAA

28137-qRT-R1 GAGGAACAGCCGGTAGTGATG

FvLBD16 08250-qRT-F1 CATGCTTACAAGCACAATTG

08250-qRT-R1 TCTCCTGCATATAGTTGATAG

FvLBD18 19355-qRT-F1 GCTAATCGCGCAACCTCAACTC

19355-qRT-R1 GCCTGTGGAGCAGTTCACGAGC

FvLBD19 19356-qRT-F1 CTATGTTCAGGCTCGTCTTG

19356-qRT-R1 ACTTGGAGATCTCCATCATC

FvLBD20 24461-qRT-F1 CAAGGGTATGGATGGTTCAG

24461-qRT-R1 GAGTCGTCGTTCCACCAGTC

FvLBD21 21008-qRT-F2 GGACACCGTAAGTTCACTCG

21008-qRT-R1 CAGTTGAGCTCTGACTGAAG

FvLBD22A 23043-qRT-F1 GTCGTCATTGCATATCAAGC

23043-qRT-R1 CATGATCCTGATGATGATGATG

FvLBD22B 02697-qRT-F1 GCAGCTCAAGATTGCCGAGG

02697-qRT-R1 CTGAATTGATTCGACATCATG

FvLBD22C 02696-qRT-F2 CAGCAATGTGCTGACCTAAG

02696-qRT-R2 CTTGTCGAATTCGCTGACCA

FvLBD24A 26806-qRT-F1 GCTGCAGACACTCTGTATTA

26806-qRT-R2 CTGAGTCTGCCCAACAATGG

FvLBD24B 13324-qRT-F2 CATTGCAACCGTATCTCCGAGC

Page 98: Supplementary Data Name Gene Id (NCBI) FvLBD1AZea mays 575 + 5 CC(G/A)CCC light responsive element Sp1 Zea mays 1038 + 5.5 CC(G/A)CCC light responsive element Sp1 Zea mays 798 + 5

13324-qRT-R1 TCATGAACTTGATCAGTACTC

FvLBD25A 28478-qRT-F1 CAGATAGGGATATGTGGACAG

28478-qRT-R1 CTGCACTTCGAGACGGTGAC

FvLBD25B 31797-qRT-F1 CTATGCTTGCAATGAGATCA

31797-qRT-R1 TGATCAACATTCCATGGAAG

FvLBD27A 09561-qRT-F1 GACACTAGCCATGGGATCAG

09561-qRT-R1 GTAAGACTGAAGCATGCTGC

FvLBD27B 01286-qRT-F1 GTCGATGCTGTGGCAGTTCA

01286-qRT-R1 ATGTTCTAACGATTGCGTAC

FvLBD29A 08253-qRT-F1 GTGGAACAGCATCATACCAT

08253-qRT-R1 ATCCACATCCCGATCATAATG

FvLBD29B 08254-qRT-F1 GCACAACTAGCTTCAGCCAA

08254-qRT-R1 GTGATCATACTGCATACTCG

FvLBD33 26330-qRT-F2 GCTTGTGGAAGTTCTGAAGG

26330-qRT-R1 GCGATGGAAGGGTCATTCAAC

FvLBD36A 24088-qRT-F2 GGTCATCATCAGCTGAGGT

24088-qRT-R1 CCTTATGCGGCAGCAGCTGCG

FvLBD36B 30401-qRT-F1 CAGCAGCAGCAGATGTTCGAG

30401-qRT-R1 GCTGCCGCAGCTTGCATCTG

FvLBD38A 05722-qRT-F1 GCTGACGGGACTGTCTGTAC

05722-qRT-R1 GTCAACCTCAGGTCCAGATC

FvLBD38B 25541-qRT-F2 GAACGGAGCGACAGGGCTTC

25541-qRT-R2 CTACGCAACTCCGACGATGC

FvLBD39 02557-qRT-F1 CAGAGGCTCATGCGGAATTC

02557-qRT-R1 CCACCGCTAGTAGTCATGAC

FvLBD41 10300-qRT-F1 GCCAACGTAGACGGCGACAG

10300-qRT-R1 CGTGCGGTGCACGTGATGAC

FvLBD42 03741-qRT-F1 CTCCTGTGACATACGCCACG

03741-qRT-R1 CGGTTTGCCCTGGTTCATCT

FvGADPH GADPH-qRT-F1 CAGAAGACTGTTGATGGACC

GADPH-qRT-F1 GCAGCCTTAATCTGGTCATAG


Recommended