Home > Documents > SUPPLEMENTARY INFORMATION Single molecule analysis …...SUPPLEMENTARY INFORMATION Single molecule...

SUPPLEMENTARY INFORMATION Single molecule analysis …...SUPPLEMENTARY INFORMATION Single molecule...

Date post: 11-Jul-2020
Category:
Author: others
View: 0 times
Download: 0 times
Share this document with a friend
Embed Size (px)
of 22 /22
SUPPLEMENTARY INFORMATION Single molecule analysis reveals three phases of DNA degradation by an exonuclease Gwangrog Lee 1,2 , Jungmin Yoo 1 , Benjamin J. Leslie 1,2 and Taekjip Ha 1,2 1. Department of Physics and the Center for the Physics of Living Cells, University of Illinois at Urbana-Champaign, 1110 West Green Street, Urbana, Illinois 61801, USA. 2. Howard Hughes Medical Institute Nature Chemical Biology: doi:10.1038/nchembio.561
Transcript
  • SUPPLEMENTARY INFORMATION

    Single molecule analysis reveals three phases of DNA degradation by an

    exonuclease

    Gwangrog Lee1,2, Jungmin Yoo1, Benjamin J. Leslie1,2 and Taekjip Ha1,2

    1. Department of Physics and the Center for the Physics of Living Cells, University of

    Illinois at Urbana-Champaign, 1110 West Green Street, Urbana, Illinois 61801, USA.

    2. Howard Hughes Medical Institute

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • Supplementary Methods DNA substrate preparation: DNA strands used for single molecule FRET measurements were purchased from Integrated DNA Technologies (IDT). The 5’ strand of the extended construct used to probe the processive phase was constructed by ligating two pieces of strands at room temperature for 3 hours using the T4 ligase (#M0202) purchased from New England Biolabs, and purified by 15% PAGE gel. The sequence and modifications are shown below. Protein expression and purification: Commercially available λ exonuclease was used for all experiments except for the data shown in Fig. 4. According to the manufacturer, the protein is expressed as a maltose binding protein fusionand contains a Factor Xa cleavage site immediately upstream of the λ exonuclease protein, attained by cloning the λ exonuclease gene1 in-frame between XmnI and XbaI restriction sites in vector pMALc-2x (personal communication, New England BioLabs, Ipswich, MA, USA). For protein labeling experiments presented in Fig. 4, a modified λ exonuclease gene was synthesized and cloned into pMALc-2x at XmnI and XbaI restriction sites by Genscript (Piscataway, NJ, USA). This modified gene construct adds a 63 bp insert directly downstream of the XmnI restriction site, effectively fusing a 21 amino acid linker (GDSLSWLLRLLNLCTPSRSSG) to the N-terminus of the λ exonuclease protein (henceforth referred to as MBP-ybbR-λ exonuclease). This sequence contains the 12-amino acid (GDSLSWLLRLLN) ybbR protein labeling sequence reported by Walsh and Coworkers.2,3 The fusion plasmid construct was transformed into BL21-DE3 E. coli and expressed in 2L of LB supplemented with 2g/L glucose to suppress expression of amylases. Bacterial cultures were grown to an OD600 of 0.5, at which time IPTG was added at a final concentration of 0.3 mM. After shaking for 3.0 h at 37 °C, bacteria were harvested in a Sorvall SLA-3000 rotor at 5000 × g, resuspended in 20 mL buffer CB (50 mM Na Phosphate pH 8.0, 5 mM Tris, 300 mM NaCl, supplemented with EDTA-Free protease inhibitor cocktail [RPI Corp #P50900]) and lysed via sonication. Cell lysate was clarified by centrifugation for 30 min at 35,000 × g in a Sorvall SS-34 Rotor in a Sorvall RC-6 centrifuge. MBP-tagged λ exonuclease was purified according to NEB’s pMAL Protein Fusion & Purification System Manual (www.neb.com). Briefly, clarified bacterial lysates were diluted 2:1 in buffer CB, and batch incubated with 3.0 mL of amylose resin (NEB #E8021) for 30 min at 4 °C. After washing resin with 20 column volumes buffer CB (NaCl concentration 600 mM), MBP- λ exonuclease was eluted from the resin by washing with 15 mL buffer CB supplemented with 10 mM maltose. Eluted protein was >85% pure by coommassie-stained gel analysis; contamination was predominantly endogenous E. coli MBP. Protein samples were dialyzed and concentrated into buffer A (25 mM Tris, pH 8.0, 25 mM NaCl) using 400 µL Amicon concentrators (Millipore, 4 kDa MWCO). While this fusion is expressed with a Factor Xa cleavage site immediately upstream of the N-terminal tag, initial functional studies were performed on the uncleaved fusion protein. MBP-ybbR-λ

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • exonuclease was labeled using Sfp synthase and CoA-547 dye conjugate (NEB # P9302S & S9349S) in 500 µL 1X SFP buffer (50 mM Hepes pH 7.5, 10 mM MgCl2) containing 1 µM Sfp Synthase, 10 µM CoA-547, and 5 µM MBP-ybbR-λ exonuclease. The reaction mixture was gently agitated for 24 h at 4 °C in the dark. Unbound dye was removed through extensive washing with buffer A (25 mM Tris, pH 8.0, 25 mM NaCl) using 400 µL Amicon concentrators. A labeling yield of 17% was calculated by comparison of Abs280nm vs Abs566nm with an OD280 correction factor of 8%. Protein samples were maintained in buffer A at 4 °C and used in functional assays within 2 d. Degradation gel-assay: The 5’ degradation strand of the extended construct was labeled via the 3’ amino modification with Alexa488 mono NHS ester (Invitrogen): 5 nmoles of the oligo in 35 l of 50 mM sodium tetraborate buffer pH 8.5 was incubated with 50 nmoles of Alexa488 by shaking overnight at room temperature. The labeled oligonucleotides were first purified by ethanol precipitation to remove unreacted dyes and then further purified using denaturing PAGE. For a degradation reaction ~10 pmol of DNA was mixed with 60 pmol exo in 50 l buffer solution containing 67 mM glycine-KOH, 2.5 mM MgCl2, and 100 µg/ml BSA (pH 9.4). The sample was incubated for different time course in room temperature, and the reactions were stopped by adding 50 l of formamide. The reaction products were resolved on a 15% denaturing PAGE gel for Fig.S6 and a 18% native PAGE gel for Fig. S12, and were imaged using a fluorescence imager (Typhoon, GE science). 1. DNA construct: used in Fig.1 and Supplementary Fig.1 3’ strand: 5’-TGG CGA CGG CAG CGA GGCT/iCy5/GT TAA ATA TGG CGA TTC TCA /Cy3Sp/ -3’ 5’degradation strand: 5’-Phosphate-TGA GAA TCG CCA TAT TTA ACA GCCTCG CTG CCGTCG CCA /Biotin/ -3’ 2. Extended construct: Fig. 3 3’ strand: 5’-Biotin TGG CGA CGG CAG CGA GGC TTA ATT /iCy5/TGT TAA ATA TGG CGA TTC TC/iCy3/A CGC CAA CAT GTA ATT TAG GCA G -3’: (5’-Biotin TGG CGA CGG CAG CGA GGCTTA ATT /iCy5/TGT TAA ATAT -3’ plus 5’-Phosphate GGC GAT TCT C/iCy3/AC GCC AAC ATG TAATTT AGG CAG -3’) 5’degradation strand: 5’-5Phosphate CTG CCT AAA TTA CAT GTT GGC GTG AGA ATC GCC ATA TTT AAC AAA TTA AGC CTC GCT GCC GTC GCC A -3’ 3. Periodic mismatched construct: Fig.5b

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • 3’ strand: 5’-Biotin TGG CGA CGG CAG CGA GGC TTA ATT /iCy5/TGT TAA ATA TGG CGA TTC TC/iCy3/A CGC CAA CAT GTA ATT TAG GCA G -3’ 5’degradation strand: 5’-Phosphate CTG CCT AAATTA CAT GTT GGC GTT AGA CTC GAC ATC TTT GAC AAATTA AGC CTC GCT GCC GTC GCC A -3’ 4. 2 consecutive mismatches construct: Fig. 5c 3’ strand: 5’-Biotin TGG CGA CGG CAG CGA GGC TTA ATT /iCy5/TGT TAA ATA TGG CGA TTC TC/iCy3/A CGC CAA CAT GTA ATT TAG GCA G -3’ 5’degradation strand: 5’-Phosphate CTG CCT AAA TTA CAT GTT GGC GTG AGA ATC GCT TTA TTT AAC AAA TTA AGC CTC GCT GCC GTC GCC A -3’ 5. 3 consecutive mismatches construct: Fig. 5c 3’ loading strand: 5’-Biotin TGG CGA CGG CAG CGA GGC TTA ATT /iCy5/TGT TAA ATA TGG CGA TTC TC/iCy3/A CGC CAA CAT GTA ATT TAG GCA G -3’ 5’degradation strand: 5’-Phosphate CTG CCT AAA TTA CAT GTT GGC GTG AGA ATC GTT TTA TTT AAC AAA TTA AGC CTC GCT GCC GTC GCC A -3’ 6. 4 consecutive mismatches construct: Fig. 5c 3’ strand: 5’-Biotin TGG CGA CGG CAG CGA GGC TTA ATT /iCy5/TGT TAA ATA TGG CGA TTC TC/iCy3/A CGC CAA CAT GTA ATT TAG GCA G -3’ 5’ degradation strand: 5’-Phosphate CTG CCT AAA TTA CAT GTT GGC GTG AGA ATC GTT TAA TTT AAC AAA TTA AGC CTC GCT GCC GTC GCC A -3’ 7. 5 consecutive mismatches construct: Fig. 5c 3’ strand: 5’-Biotin TGG CGA CGG CAG CGA GGC TTA ATT /iCy5/TGT TAA ATA TGG CGA TTC TC/iCy3/A CGC CAA CAT GTA ATT TAG GCA G -3’ 5’ degradation strand: 5’-Phosphate CTG CCT AAA TTA CAT GTT GGC GTG AGA ATC GTT TAT TTT AAC AAA TTA AGC CTC GCT GCC GTC GCC A -3’

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • 8. Bubble construct: Fig.6a 3’ strand: 5’-Biotin-TGG CGA CGG CAG CGA GGC TTA ATT /iCy5/TGT TAA ATA TGG CGA TTC TC/iCy3/A CGC CAA CAT GTA ATT TAG GCA G -3’ 5’ degradation strand: 5’- Phosphate CTG CCT AAA TTA CAT GTT GGC GTT GTT AAA TAT GGC GAT TCT CAA TTA AGC CTC GCT GCC GTC GCC A -3’ 9. Pause construct: Fig. 6c 3’ strand: 5’-Biotin-TGG CGA CGG CAG CGA GGC TTA ATT /iCy5/GAG AAT CGC CAT ATT TAA CA/iCy3/A CGC CAA CAT GTA ATT TAG GCA G-3’ 5’degradation strand: 5’-5Phosphate CTG CCT AAA TTA CAT GTT GGC GTT GTT AAA TAT GGC GAT TCT CAA TTA AGC CTC GCT GCC GTC GCC A -3’ 10. Extended construct for gel assay: Supplementary Fig. 7 3’ strand: 5’-Biotin TGG CGA CGG CAG CGA GGC TTA ATT /iCy5/TGT TAA ATA TGG CGA TTC TC/iCy3/A CGC CAA CAT GTA ATT TAG GCA G -3’ 5’ degradation strand: 5’-5Phosphate CTG CCT AAA TTA CAT GTT GGC GTG AGA ATC GCC ATA TTT AAC AAA TTA AGC CTC GCT GCC GTC GCC A/Alexa488/ -3’ 11. Bubble construct for gel assay: Supplementary Fig. 12 3’ strand: 5’-Biotin TGG CGA CGG CAG CGA GGC TTA ATT ACA ATT TAT ACC GCT AAG AGA CGC CAA CAT GTA ATT TAG GCA G -3 5’degradation strand: 5’-5Phosphate CTG CCT AAA TTA CAT GTT GGC GTG AGA ATC GCC ATA TTT AAC AAA TTA AGC CTC GCT GCC GTC GCC A/Cy3/ -3’ 12. Fork construct for gel assay: Supplementary Fig. 12 3’ strand: 5’-Biotin TGG CGA CGG CAG CGA GGC TTA ATT ACA ATT TAT ACC GCT AAG AGA CGC CAA CAT GTA ATT TAG GCA G -3 5’degradation strand:

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • 5’-GAG AAT CGC CAT ATT TAA CAA ATT AAG CCT CGC TGC CGT CGC CA/Cy3/ -3’ MBP-ybbR- λ exonuclease gene sequence. The ybbR- λ exonuclease gene was cloned into pMALC-2x between XmnI and XbaI restriction sites. Ald6 sequence: CTGTGCACACCATCGCGG (encodes LCTPSR) ybbR S6 sequence: GGAGATTCTCTTTCGTGGCTGCTTAGGCTTTTGAAT (encodes GDSLSWLLRLLN) Ser-Ser-Gly spacer insert: AGCAGCGGC (encodes SSG) XmnI cut site/end of MBP gene: GGAAGGATTTCA MBP-ybbR- λ exonuclease Gene Sequence (verified by Genscript): Bases in BOLD represent the coding sequence for Ald6 and ybbR S6 protein tagging sequences and are joined to lambda exo by a 9-base sequence encoding Ser-Ser-Gly. Lambda exonuclease sequence in, lowercase, ends with TGA STOP inserted before XbaI restriction site (underlined). ATG……E_coli_malE_MBP…………GGAAGGATTTCAGGAGATTCTCTTTCGTGGCTGCTTAGGCTTTTGAATCTGTGCACACCATCGCGGAGCAGCGGCatgacaccggacattatcctgcagcgtaccgggatcgatgtgagagctgtcgaacagggggatgatgcgtggcacaaattacggctcggcgtcatcaccgcttcagaagttcacaacgtgatagcaaaaccccgctccggaaagaagtggcctgacatgaaaatgtcctacttccacaccctgcttgctgaggtttgcaccggtgtggctccggaagttaacgctaaagcactggcctggggaaaacagtacgagaacgacgccagaaccctgtttgaattcacttccggcgtgaatgttactgaatccccgatcatctatcgcgacgaaagtatgcgtaccgcctgctctcccgatggtttatgcagtgacggcaacggccttgaactgaaatgcccgtttacctcccgggatttcatgaagttccggctcggtggtttcgaggccataaagtcagcttacatggcccaggtgcagtacagcatgtgggtgacgcgaaaaaatgcctggtactttgccaactatgacccgcgtatgaagcgtgaaggcctgcattatgtcgtgattgagcgggatgaaaagtacatggcgagttttgacgagatcgtgccggagttcatcgaaaaaatggacgaggcactggctgaaattggttttgtatttggggagcaatggcgaTGATCTAGAGTCGACCTGCAG…

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • Supplementary Results a b

    0 5 10 15 20 25 30

    0.00.20.40.60.81.0

    FRE

    T

    Time / s

    0 5 10 15 20 25 30

    0

    250

    500

    750

    1000

    Inte

    nsity

    0.0 0.2 0.4 0.6 0.8 1.00

    300

    600

    900

    # of

    mol

    ecul

    es

    FRET

    0.0 0.2 0.4 0.6 0.8 1.00

    300

    600

    900

    c

    0 20 40 60 80

    0.00.20.40.60.81.0

    FRE

    T

    Time / s

    0 20 40 60 80

    0200400600800

    10001200

    Inte

    nsity

    Supplementary Figure S1. exo dissociates from the DNA after the degradation reaction. The reaction was performed using the standard construct (used for Fig. 1c) and 12 nM exo. a, An example of single molecule FRET time traces where the enzyme is still bound to DNA after the reaction. b, An example of single molecule FRET time traces where the enzyme dissociates from the DNA right after the reaction, resulting in a FRET shift from ~0.9 to ~0.7 at 25 s. c, Single molecule FRET histograms before (upper panel) and after the reaction (lower panel). While the major population shows a peak at FRET=0.7, likely representing the degradation product after protein dissociation, a minority subpopulation at ~0.9 FRET is also seen exo is still likely bound to the DNA.

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • Binding time

    0.6 nM 6 nM

    12 nM 60 nM 120 nM

    0 20 40 60 80 100 1200

    5

    10

    15

    20

    25

    # of

    mol

    ecul

    es

    Time (s)0 2 4 6 8 10 12 14 16 18

    0

    20

    40

    60

    80

    100

    # of

    mol

    ecul

    es

    Time (s)

    0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.00

    20

    40

    60

    80

    100

    # of

    mol

    ecul

    es

    Time (s)0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4

    0

    10

    20

    30

    40

    50

    # of

    mol

    ecul

    es

    Time (s)0.0 0.2 0.4 0.6 0.8 1.0 1.2 1.4

    0

    5

    10

    15

    20

    25

    # of

    mol

    ecul

    es

    Time (s)

    Supplementary Figure S2. Distributions of the binding time, defined as the time between protein addition and the first moment of increase in the overall fluorescence signal, as a function of protein concentration.

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • Initiation time

    0 20 40 60 80 100 1200

    30

    60

    90

    120

    # of

    mol

    ecul

    es

    Time (s)0 3 6 9 12 15 18 21 24 27 30

    0

    20

    40

    60

    80

    100

    120

    # of

    mol

    ecul

    es

    Time (s)

    0 2 4 6 8 100

    20

    40

    60

    80

    100

    # of

    mol

    ecul

    es

    Time (s)0 1 2 3 4 5 6 7 8

    0

    10

    20

    30

    40

    # of

    mol

    ecul

    es

    Time (s)0 1 2 3 4 5

    0

    20

    40

    60

    80

    100

    # of

    mol

    ecul

    es

    Time (s)

    0.6 nM 6 nM

    12 nM 60 nM 120 nM

    Supplementary Figure S3. Distributions of the initiation time, defined as the time between the initial protein binding (detected via a jump in the overall fluorescence signal) and the beginning of DNA degradation (detected via FRET increase) as a function of protein concentration.

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • Degradation time

    0 30 60 90 120 150 180 2100

    10

    20

    30

    40

    50

    60

    # of

    mol

    ecul

    es

    Time (s)

    0 4 8 12 16 20 240

    10

    20

    30

    40

    # of

    mol

    ecul

    es

    Time (s)

    0 40 80 120 160 2000

    5

    10

    15

    # of

    mol

    ecul

    es

    Time (s)

    0 2 4 6 8 10 12 140

    5

    10

    15

    20

    25

    30

    35

    40

    # of

    mol

    ecul

    es

    Time (s)0 2 4 6 8 10 12

    0

    10

    20

    30

    40

    50

    60

    70

    # of

    mol

    ecul

    es

    Time (s)

    12 nM 60 nM 120 nM

    0.6 nM 6 nM

    Supplementary Figure S4. Distributions of the degradation time, defined as the time duration during which FERT increases from the minimum to the maximum values, as a function of protein concentration.

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • 0 20 40 60 80 100 120 1400

    25

    50

    75

    100

    125

    150#

    of m

    olec

    ules

    Time (s)0 20 40 60 80 100 120

    0

    40

    80

    120

    160

    200

    # of

    mol

    ecul

    es

    Time (s)

    Pause time

    0 2 4 6 8 10 12 14 160

    20

    40

    60

    80

    100

    # of

    mol

    ecul

    es

    Time (s)0 1 2 3 4 5 6

    0

    5

    10

    15

    20

    25

    30

    35

    40

    45

    # of

    mol

    ecul

    es

    Time (s)0 1 2 3 4

    0

    20

    40

    60

    80

    100

    # of

    mol

    ecul

    es

    Time (s)

    12 nM 60 nM 120 nM

    0.6 nM 6 nM

    Supplementary Figure S5. Distributions of the pause dwell time as a function of protein concentration.

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • b c

    18nt

    ~4-5nt

    0 1 3 5 10 3 0 min

    duplex single strand

    18nt

    0 1 3 5 10 mina

    5’ 3’Phosphate

    Supplementary Figure S6. The fluorescent labeling of the DNA does not have a detectable effect on the activity of exonuclease. a, DNA substrate originally used for single molecule data of the main Fig. 3 was tested for a gel-based degradation assay. The 3’ strand was originally labeled with Cy3 and Cy5, and the 5’ degradation strand was newly labeled with Alexa 488 at the 3’ end to detect the degradation of the 5’ strand by gel. b-c, We simultaneously visualized the degradation of both the 5’ and 3’ strands (b and c, respectively), using a fluorescence gel imager, after subjecting the DNA to the enzyme (120 nM) for 0, 1, 3, 5 and 10 min. The 5’ strand in the duplex form was degraded efficiently in less than 3 min (see the time course of the duplex in b). As expected, the 5’ strand alone, without the 3’ strand, was not degraded efficiently (see the time course of the single strand in b). The data recapitulate the known function of lambda exonuclease very well:

    (1) The entire DNA, except for the final 4-5 nt, can be degraded processively by the enzyme. Otherwise, there would have been a significant amount of intermediate length products.

    (2) The enzyme is not efficient in degrading a single stranded DNA.

    Also note that the 3’ strand was not degraded efficiently even though it was part of the duplex likely because its 5’ end is not phosphorylated, a requirement for efficient engagement by the enzyme and is specifically recognized. The reaction condition is described in Methods of the Supplementary information.

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • 0 50 100 150 200 250 3000

    5

    10

    15

    20

    25

    30

    35

    # of

    mol

    ecul

    es

    Time (s)

    0 1 0 2 0 3 0 4 00 .00 .20 .40 .60 .81 .0

    FRE

    TIn

    tens

    ity

    0 1 0 2 0 3 0 4 00

    2 0 04 0 06 0 08 0 0

    0 5 0 1 0 0 1 5 0 2 0 00 .00 .20 .40 .60 .81 .0

    FRE

    TIn

    tens

    ity

    0 5 0 1 0 0 1 5 0 2 0 00

    2 0 04 0 06 0 08 0 0

    0 20 40 60 800

    10

    20

    30

    40

    # of

    mol

    ecul

    es

    Time (s)

    0 10 20 30 400

    10

    20

    30

    40

    50

    # of

    mol

    ecul

    es

    Time (s)

    a

    c

    e

    b

    d

    f

    1.2nM 1.2nM

    12nM

    12nM

    120nM

    120nM

    0 1 0 2 0 3 0 4 0 5 00 .00 .20 .40 .60 .81 .0

    FRE

    TIn

    tens

    ity

    T im e (s )

    0 1 0 2 0 3 0 4 0 5 00

    2 0 04 0 06 0 08 0 0

    Injectiondelay

    delay

    delay

    g

    First 23 bpFirst 20 bp

    0 20 40 60 80 100 120

    020406080

    100120140

    Rea

    ctio

    n tim

    e (s

    )

    Protein concentration (nM)

    Supplementary Figure S7. Degradation time of the 23 nt upstream region, extended ahead of the two fluorescent dyes, shows a concentration-dependent delay (the same DNA used in the main Fig.3). a, c, e., Representative single molecule FRET time traces at different protein concentrations. b,d,f., Corresponding histograms of the delay time. Average delay times (or degradation times for the first 23 nt) are 138 ± 5.2 at 1.2 nM, 16.4 ± 1.1 at 12 nM, and 12.2 ± 0.6 at 120 nM (mean ± s.e.). g., Comparison of the total degradation times for the first 20 bp for the substrate used in the main Fig.1 and the degradation time for the first 23 bp for the substrate used for the main Fig.3. The total degradation time for the first 20 bp is obtained by summing the binding time, initiation time and degradation time. The two curves show similar protein concentration dependence and their absolute values are also similar. Therefore, we conclude that the distributive degradation phase originally observed using the standard construct used for main Figs. 1 and 2 cannot be due to the 3’ end labeling of the 3’ strand by a fluorophores.

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • 0 1 2 3 40

    20

    40

    60

    80

    100

    120

    140

    160

    Cou

    nt

    Time (s)0 1 2 3 4

    0

    10

    20

    30

    40

    50

    60

    70

    Cou

    ntTime (s)

    a b

    Supplementary Figure S8. The time spent in the paused states accounts for most of the differences in the apparent reaction rate between processive and distributive phases. (a) Histogram of the degradation time in the processive mode. (b) Histogram of the degradation time in the distributive phase after pauses have been removed.

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • 1 2 3 4 5 6 70

    5

    10

    15

    20

    25

    # of

    mol

    ecul

    es

    Time (s)0 5 10 15 20 25 300.0

    0.2

    0.4

    0.6

    0.8

    1.0Time (s)

    FRET

    Time (s)

    FRET

    0 5 10 15 20 25 300.0

    0.2

    0.4

    0.6

    0.8

    1.0

    0 1 2 3 4 50

    20

    40

    60

    80

    # of

    mol

    ecul

    es

    Time (s)

    a

    c

    b

    d

    Supplementary Figure S9. A comparison of degradation time between intact and sparsely mismatched constructs. (a-b) Exemplary FRET-time trace and its histogram obtained from the intact construct (inset in main Fig. 3a). (c-d) Exemplary FRET-time trace and its histogram obtained from the sparsely mismatched construct (first inset in main Fig. 5a).

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • 20 t = ~1 second 15t + 5 tmismatch = ~ 2 second

    t t tmismatch

    tmismatch = ~5 t

    a b

    Supplementary Figure S10. Degradation rate at single mismatch sites is ~ 5 times slower than that at intact ones. (a-b) exo digested a duplex of 20 bp in ~ 1 s whereas it digested the same length DNA but with 5 single bp mismatches located every 4 bp in ~ 2 s, suggesting a 5 times slower rate of digestion for a mismatched nucleotide compared to a basepaired nucleotide.

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • 0.0 0.2 0.4 0.6 0.8 1.00

    100

    200

    300

    400

    500

    600

    # of

    mol

    ecul

    es

    FRET

    0.0 0.2 0.4 0.6 0.8 1.00

    200

    400

    600

    800

    1000

    Supplementary Figure S11. FRET histograms after 2 min degradation reaction for an intact DNA (upper panel) and a DNA with 18 nt bubble with the 20 bp region between two fluorescent dyes (low panel). The comparison suggests that the degradation activity of exo decreases significantly when acting on a bubble structure.

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • 0 1 2 0 1 2 0 min

    ~4-5nts

    B

    5’P

    A

    5’P

    5’

    44nts23 nts

    20 nts

    24 nts

    67 nts 44 nts

    bubble

    duplex

    Supplementary Figure S12. A DNA bubble causes a degradation arrest. The degradation assay was performed using an intact duplex and a bubbled duplex with 20 nt mismatches. The duplex was efficiently degraded while the bubbled duplex was not. We made a fork duplex mimicking the degradation product as shown in B (rightmost) and ran it in the lane 7 to compare with the reaction product. The forked duplex indeed migrated more slowly compared to the substrate itself. Therefore, we can rule out the possibility that the slower migrating species is due to the protein bound form. Interestingly, the forked duplex migrated slightly faster than the reaction product, and this suggests that the final 1 or 2 base pairs in the duplex before the bubble probably melts before degradation, giving rise to a product of 45 or 46 nt in length. The result is very consistent with degradation arrest caused by the bubble we proposed based on the single molecule data. The reaction condition is described in Methods of the Supplementary information.

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • 0 10 20 30 40

    0.00.20.40.60.81.0

    FRET

    Time (s)

    0 10 20 30 40

    0

    300

    600

    900

    Inte

    nsity

    Supplementary Figure S13. exo can take a backward motion in the processive phase but very infrequently. The extended construct was used as in the main Fig. 3. Less than 0.2% of observed molecules showed this behavior.

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • -5 0 5 10 15 20 25 30 35

    0

    100

    200

    300

    400

    500

    Inte

    nsity

    Time

    12 nM

    -5 0 5 10 15 20 25 30 35

    0

    100

    200

    300

    400In

    tens

    ity

    Time

    120 nM

    0 10 20 30 40 50 60

    0

    400

    800

    1200

    1600

    Inte

    nsity

    Time

    120 pM

    0 5 10 15 20 25 30 35

    0

    400

    800

    1200

    1600

    Inte

    nsity

    Time

    1.2 nM

    a

    dc

    b

    Supplementary Figure S14. Fluorometer measurements on various concentrations of exonuclease (marked in black on each panel). 1L of 8 M DNA was mixed in a cuvette with 199 L of the reaction buffer containing exo at four different concentrations, 67mM glycine-KOH, 2.5mM MgCl2, and 50µg/ml BSA (pH 9.4). The sample was excited at 540 nm, and fluorescence emissions for Cy3 and Cy5 were collected at 565 and 670, respectively, using a Varian Eclipse fluorospectrophotometer. DNA construct was the same as the one used in Fig. 1 and 2. Green and red traces were Cy3 and Cy5 intensities, respectively. Upon degradation the intensity of donor increased while that of acceptor decreased because of the FRET increase resulting from the decrease of distance between the two fluorophores. The rate of degradation increased with increasing protein concentration. Because of ensemble averaging, initiation and degradation phases were not detected

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • Concentrations Initiation time Pause dwell time 0.6nM 7.9 sec 30.8 sec 6nM 3.6 sec 23.8 sec

    12nM 1.9 sec 3.6 sec 60nM 1.6 sec 1.3 sec 120nM 1.6 sec 0.9 sec

    Supplementary Table S1. A comparison between the initiation time and the pause dwell time. Although the pause time is similar to the initiation time at high protein concentrations, they are significantly different at low protein concentrations. This suggests it is more difficult to load a functional enzyme complex if there is a 3’ ssDNA overhang at low protein concentrations.

    Nature Chemical Biology: doi:10.1038/nchembio.561

  • Supplementary References 1. Little, J. W. Lambda exonuclease. Gene Amplif. Anal. 2, 135-145 (1981). 2. Yin, J. et al. Genetically encoded short peptide tag for versatile protein labeling by

    Sfp phosphopantetheinyl transferase. Proceedings of the National Academy of Sciences of the United States of America 102, 15815-15820 (2005).

    3. Yin, J., Lin, A. J., Golan, D. E. & Walsh, C. T. Site-specific protein labeling by Sfp phosphopantetheinyl transferase. Nature Protocols 1, 280-285 (2006).

    Nature Chemical Biology: doi:10.1038/nchembio.561


Recommended