www.sciencemag.org/cgi/content/full/science.1249252/DC1 Supplementary Materials for Total Synthesis of a Functional Designer Eukaryotic Chromosome Narayana Annaluru, Héloïse Muller, Leslie A. Mitchell, Sivaprakash Ramalingam, Giovanni Stracquadanio, Sarah M. Richardson, Jessica S. Dymond, Zheng Kuang, Lisa Z. Scheifele, Eric M. Cooper, Yizhi Cai, Karen Zeller, Neta Agmon, Jeffrey S. Han, Michalis Hadjithomas, Jennifer Tullman, Katrina Caravelli, Kimberly Cirelli, Zheyuan Guo, Viktoriya London, Apurva Yeluru, Sindurathy Murugan, Karthikeyan Kandavelou, Nicolas Agier, Gilles Fischer, Kun Yang, J. Andrew Martin, Murat Bilgel, Pavlo Bohutski, Kristin M. Boulier, Brian J. Capaldo, Joy Chang, Kristie Charoen, Woo Jin Choi, Peter Deng, James E. DiCarlo, Judy Doong, Jessilyn Dunn, Jason I. Feinberg, Christopher Fernandez, Charlotte E. Floria, David Gladowski, Pasha Hadidi, Isabel Ishizuka, Javaneh Jabbari, Calvin Y. L. Lau, Pablo A. Lee, Sean Li, Denise Lin, Matthias E. Linder, Jonathan Ling, Jaime Liu, Jonathan Liu, Mariya London, Henry Ma, Jessica Mao, Jessica E. McDade, Alexandra McMillan, Aaron M. Moore, Won Chan Oh, Yu Ouyang, Ruchi Patel, Marina Paul, Laura C. Paulsen, Judy Qiu, Alex Rhee, Matthew G. Rubashkin, Ina Y. Soh, Nathaniel E. Sotuyo, Venkatesh Srinivas, Allison Suarez, Andy Wong, Remus Wong, Wei Rose Xie, Yijie Xu, Allen T. Yu, Romain Koszul, Joel S. Bader, Jef D. Boeke,* Srinivasan Chandrasegaran* *Corresponding author. E-mail: [email protected] (J.D.B.); [email protected] (S.C.) Published 27 March 2014 on Science Express DOI: 10.1126/science.1249252 This PDF file includes: Materials and Methods Supplementary Text Figs. S1 to S19 Tables S1 to S9 References
Total Synthesis of a Functional Designer Eukaryotic Chromosome
Narayana Annaluru, Héloïse Muller, Leslie A. Mitchell, Sivaprakash Ramalingam, Giovanni Stracquadanio, Sarah M. Richardson, Jessica S. Dymond, Zheng Kuang, Lisa
Z. Scheifele, Eric M. Cooper, Yizhi Cai, Karen Zeller, Neta Agmon, Jeffrey S. Han, Michalis Hadjithomas, Jennifer Tullman, Katrina Caravelli, Kimberly Cirelli, Zheyuan
Guo, Viktoriya London, Apurva Yeluru, Sindurathy Murugan, Karthikeyan Kandavelou, Nicolas Agier, Gilles Fischer, Kun Yang, J. Andrew Martin, Murat Bilgel, Pavlo
Bohutski, Kristin M. Boulier, Brian J. Capaldo, Joy Chang, Kristie Charoen, Woo Jin Choi, Peter Deng, James E. DiCarlo, Judy Doong, Jessilyn Dunn, Jason I. Feinberg, Christopher Fernandez, Charlotte E. Floria, David Gladowski, Pasha Hadidi, Isabel
Ishizuka, Javaneh Jabbari, Calvin Y. L. Lau, Pablo A. Lee, Sean Li, Denise Lin, Matthias E. Linder, Jonathan Ling, Jaime Liu, Jonathan Liu, Mariya London, Henry Ma, Jessica Mao, Jessica E. McDade, Alexandra McMillan, Aaron M. Moore, Won Chan Oh, Yu
Ouyang, Ruchi Patel, Marina Paul, Laura C. Paulsen, Judy Qiu, Alex Rhee, Matthew G. Rubashkin, Ina Y. Soh, Nathaniel E. Sotuyo, Venkatesh Srinivas, Allison Suarez, Andy
Wong, Remus Wong, Wei Rose Xie, Yijie Xu, Allen T. Yu, Romain Koszul, Joel S. Bader, Jef D. Boeke,* Srinivasan Chandrasegaran*
Published 27 March 2014 on Science Express DOI: 10.1126/science.1249252
This PDF file includes:
Materials and Methods Supplementary Text Figs. S1 to S19 Tables S1 to S9 References
Supporting Online Material for
Total Synthesis of a Functional Designer Eukaryotic Chromosome Narayana Annaluru†, Héloïse Muller†, Leslie A. Mitchell, Sivaprakash Ramalingam, Giovanni Stracquadanio, Sarah M. Richardson, Jessica S. Dymond, Zheng Kuang, Lisa Z. Scheifele, Eric M. Cooper, Yizhi Cai, Karen Zeller, Neta Agmon, Jeffrey S. Han, Michalis Hadjithomas, Jennifer Tullman, Katrina Caravelli‡, Kimberly Cirelli‡, Zheyuan Guo‡, Viktoriya London‡, Apurva Yeluru‡, Sindurathy Murugan, Karthikeyan Kandavelou, Nicolas Agier, Gilles Fischer, Kun Yang, J. Andrew Martin, Murat Bilgel‡, Pavlo Bohutski‡, Kristin M. Boulier‡, Brian J. Capaldo‡, Joy Chang‡, Kristie Charoen‡, Woo Jin Choi‡, Peter Deng‡, James E. DiCarlo‡, Judy Doong‡, Jessilyn Dunn‡, Jason I. Feinberg‡, Christopher Fernandez‡, Charlotte E. Floria‡, David Gladowski‡, Pasha Hadidi‡, Isabel Ishizuka‡, Javaneh Jabbari‡, Calvin Y.L. Lau‡, Pablo A. Lee‡, Sean Li‡, Denise Lin‡, Matthias E. Linder‡, Jonathan Ling‡, Jaime Liu‡, Jonathan Liu‡, Mariya London‡, Henry Ma‡, Jessica Mao‡, Jessica E. McDade‡, Alexandra McMillan‡, Aaron M. Moore‡, Won Chan Oh‡, Yu Ouyang‡, Ruchi Patel‡, Marina Paul‡, Laura C. Paulsen‡, Judy Qiu‡, Alex Rhee‡, Matthew G. Rubashkin‡, Ina Y. Soh‡, Nathaniel E. Sotuyo‡, Venkatesh Srinivas‡, Allison Suarez‡, Andy Wong‡, Remus Wong‡, Wei Rose Xie‡, Yijie Xu‡, Allen T. Yu‡, Romain Koszul, Joel S. Bader, Jef D. Boeke* and Srinivasan Chandrasegaran*
†These authors contributed equally to this work. ‡Build-A-Genome course students. *Corresponding authors ([email protected]; [email protected]) This PDF file includes: Materials and Methods References Figures S1 to S18 Tables S1 to S9
Supporting Online Material
Table of Contents
Section Page Supplementary Text 4
Figure S1. Map of synIII with common ORF names. 16 Figure S2. Map of synIII with systematic ORF names. 18 Figure S3. Hierarchy and nomenclature for synIII. 19 Figure S4. Schematic diagram of USER and Gibson isothermal assembly methods. 20 Figure S5. PCRTag analysis of synIII gDNA. 21 Figure S6. PCRTag analysis of wild-type gDNA (BY4742). 22 Figure S7. Incorporation of the synthetic version of YCP4 into synIII. 23 Figure S8. Karyotypic analysis of synIII and intermediate assembly strains by pulsed- field gel electrophoresis.
24
Figure S9. Validation of the left and right arm telomere ends of synIII. 25 Figure S10. Growth curves for wild type (BY4742) and synIII strains in absence of estradiol induction.
26
Figure S11. Colony sizes of wild type (BY4742) and synIII strains at different temperatures and on various media types.
27
Figure S12. SynIII strain cell morphology. 29 Figure S13. Transcript profiling of wild-type (BY4742) and synIII strains. 30 Figure S14. ChIPseq analysis of synIII strain. 31 Figure S15. Replication origins of synIII. 33 Figure S16. Conditional genome instability (SCRaMbLE) of synIII strain. 35 Figure S17. SUP61 essential tRNA complementation by a synthetic tRNA gene. 36 Figure S18. SCRaMbLE leads to a gain of mating type a behavior in synIII heterozygous diploids.
37
Table S1. SynIII minichunk plasmids. 38 Table S2. Summary of eleven iterative one-step assemblies and replacements of native chromosome III with synthetic fragments needed to construct synIII
43
Table S3. Yeast strains used in this study. 44 Table S4. Sequence variants in the synIII chromosome. 46 Table S5. Wild type and synthetic PCRTags and the expected size of the amplicons. 47 Table S6. SynIII restriction sites that were removed. 60 Table S7. SynIII restriction site “landmarks” that were added. 63 Table S8. PCRTags for non-essential segments analysis. 65 Table S9. Replication origins in native chromosome III (from SGD) and synIII. 67 References 68
4
Supplementary Text Expanded Materials and Methods SynIII Design Yeast chromosome III (12) that is well studied and characterized genetically (27-30), was redesigned extensively based on the version of III available as of [01/12/2006] on SGD; which is from S288C-derived strains (31). SynIII was produced in silico using the genome editing suite BioStudio (manuscript in preparation; chromosome version chr03.3_41). Systematic edits introduced globally to native III include TAG/TAA stop-codon replacements, PCRTag watermark sequences and insertion of loxPsym sites (Figures S1 and S2). Once completed genome-wide in the final Sc2.0 strain, elimination of all TAG stop codons by recoding to TAA will free the TAG codon for future genetic code expansion and could serve as a mechanism of reproductive isolation and control (32). Sc2.0 design principles prioritize a wild-type phenotype and a high level of fitness despite the incorporated modifications; synIII has a sequence alteration approximately every 500 bp, ~2.5% of total sequence is altered, and carries 98 loxPsym sites. The design principles used to guide introduction of changes were: (i) The change should confer a (near) wild-type phenotype and fitness; (ii) The synthetic chromosome should lack destabilizing elements such as tRNA genes or transposons; and (iii) The synthetic chromosome should incorporate genetic flexibility to facilitate future studies Designed synIII comprises 272,907 bp, a ~13.8 % overall reduction in size from native III. Ten transfer RNA genes, 21 Ty elements and/or derived long terminal repeats (LTRs), the silent mating loci HML (3,967 bp) and HMR (4,818 bp), and subtelomeric sequences lying to the left of YCL073C (6,099 bp) and the right of YCR098C (16,880 bp) were removed. The auxotrophic marker LEU2 (1,095 bp) was removed to serve as a selectable marker during assembly. The telomeres were specified by a designer “universal telomere cap” (UTC) comprising 305 bp of T(G)1-3 sequence. Systematic edits introduced globally to native III include TAG/TAA stop-codon replacements, PCRTag sequences and insertion of loxPsym sites (Figures S1 and S2). PCRTags are short pairs of recoded sequences unique to either the wild-type or synthetic genome, used to verify both introduction of synthetic sequence and removal of native sequence using PCR. We inserted loxPsym sites 3 bp after each nonessential gene stop codon and at major genomic landmarks, such as sites of LTR and tRNA deletion or flanking the centromere (Figures S1& S2 and Supplementary Text). Overall, the synIII designed sequence has a total of 5,410 bp base changes (PCRTags, RE sites, stop codon changes, etc) compared to the native yeast III and is shorter than the native sequence by 43,710 bp owing to the removal of 47,841 bp, inclusion of 99 loxPsym sites (3,366 bp) and added strategically positioned restriction enzyme (RE) sites. Native III encodes seven intron-containing protein-coding genes; introns from these genes were systematically removed in synIII. A single copy tRNA gene on III, SUP61, encoding tRNASer (CGA) is essential and therefore was encoded in trans on a centromeric plasmid allowing deletion of the gene (32). Version control Each editing step was assigned a new version number to enable rollbacks in case of errors made during the design process. A systematic nomenclatural hierarchy was developed to name all DNA elements used in the project (see Hierarchy and nomenclature). The versions consisted of
5
three “global edits” named chr3.0_00 (wild-type) through chr3.3_00, which are as follows: global edit 1: insert loxPsym sites 3 bp downstream of the stop codon of all nonessential genes; global edit 2: exchange TAG stop codons for TAA (Stop codon swapping); global edit 3: insert PCRTags. “Global” genome editing was performed using custom scripts that eventually were incorporated into the genome editing application “BioStudio” (manuscript in preparation). Subsequently, “local editing” versions were generated (i.e. modifications made to chr 3 only) starting with chr3.3_01 and ending with chr3.3_41. [Dymond et al. 2010, (2) for the underlying design rules of the global edits]. Version chr3.3_42 represents the actual physical version of the sequence. After these global edit steps the left and right arms of native chr III were subdivided into contiguous sequence blocks of approximately 10 kb, and each of these 10 kb “chunks” was bounded by rare-cutting restriction enzyme sites (Fig. S1 and S2). Recoding to create or eliminate restriction sites (Table S6, S7) was only permitted within coding regions and was performed using GeneDesign (13). Subsequent rounds of local editing were performed to precisely delete introns, delete silent cassette information, delete tRNA genes and transposon sequences (regions lying between tRNAs and transposons or between clusters of transposon sequences were also deleted), removed LEU2 sequence and adjacent sequences removed in the construction of designer deletion leu20 (33), flanked the CEN3 sequence with loxPsym sites, and deleted repetitive subtelomeric sequences. With the exception of intron deletions, deletions were accompanied by insertion of a loxPsym site. All genes distal to GIT1 on the right arm were deleted, as very similar sequences to these are found in other telomeres. Moreover all these genes are absent from ring chromosome III, which reportedly has no growth defect (34). Special design features used in synIII Several design alterations were required to synthesize synIII. Unlike the previously designed synIXR, synthesized as a circular chromosome (2), synIII was designed to be linear and thus requires telomeres. A UTC was designed that could define each chromosome end, with T(G)1-3 exposed to serve as a telomere seed sequence. The UTCs used at each end of synIII are identical but in opposite orientations and specify precisely structured telomeres. Secondly, unlike chromosome IXR, native III encodes seven intron-containing protein-coding genes. These seven introns were systematically removed following the rules of RNA splicing, in the hope that it will be possible to eventually assemble a version of Sc2.0 lacking introns altogether. Finally, a single copy tRNA gene on III, SUP61, encoding tRNASer (CGA) is known to be essential based on genetic studies, as it alone decodes UCG codons (32). Consistent with prior work, deletion of this tRNA from the genome was impossible; we initially encoded it in trans on a centromeric plasmid. The synthetic SUP61S tRNA gene design consisted of the S. cerevisiae tRNA coding region (less its 18-bp intron) flanked by sequences from the corresponding tRNA locus in Eremothecium (Ashbya) gossypii. Universal Telomere Cap (UTC) Design A 305 bp UTC1 sequence conforming to the consensus (C1-3A)n, was designed by randomly concatenating sequences conforming to the consensus in silico. The UTC1 sequence was flanked by a NotI site on the centromere proximal end and a BsaI site on the centromere distal end. Cleavage with BsaI releases the telomere end with a 4 bp 5’ overhang within the (C1-3A)n
6
sequence, providing a telomere seed sequence that can be extended by telomerase. This insert was synthesized and cloned into plasmid pUC19 to form pUTC1. Synthetic SUP61S Design The essential SUP61 gene was converted to a synthetic version SUP61S by removing the intron, and then, to avoid introducing S. cerevisiae repetitive sequences (such as LTR and Ty sequences), substituting sequences (500 bp 5´ and 20 bp 3´) flanking the corresponding isoacceptor tRNA from Eremothecium gossypii, a related species that retains a high degree of synteny with S. cerevisiae. The E. gossypii sequence was chosen in part because it lacks recognizable transposable element derived sequences, unlike native S. cerevisiae tRNA flanking regions. Furthermore, although the E. gossypii primary DNA sequence is distinct, there exists recognizable synteny with S. cerevisiae chromosomes and promoter and terminator sequences have been shown to function well in S. cerevisiae (35, 36). This synthetic SUP61S plasmid, tagged with the HIS3 selectable marker, was introduced prior to the step in which the native tRNA would have been deleted by incorporation of the relevant synIII segment (Table S1). As expected, although the CEN plasmid could readily be lost by nonselective growth prior to swapping in the SUP61-less fragment, once that portion of synIII had been introduced, the SUP61S plasmid became essential. Hierarchy and Nomenclature Hierarchy and an example A diagram of the hierarchy from oligonucleotide to intact chromosome is shown in Fig. S3. A Sample name for a specific BB, 3L.3_23.B2.07 and an oligonucleotide (o) within it are shown. The chromosome arm is IIIL – hence 3L. Chromosome versions The version in the example is 3_23 (global version 3, chromosome-specific version 23). Version 3_41 is the final version merging two separate designs originally made for the left and right arms separately. Thus it represents the “designed” version. Note that version 3_42 represents the experimentally determined sequence from strain HMSY011. Chunks and BBs The chunk number is B2. B is the ~30 kb “megachunk” and 2 is the second of three ~10 kb chunks in B. The Building Block (BB) is 07. There are typically 10-18 BBs per ~10 kb chunk. The oligo number is 07. This is the 7th oligo in BB11. A typical BB has 18 oligos. The small letter “o” indicates oligonucleotide. Nomenclature for BB clones 3L.3_23.B2.07.c05: This is the 5th clone (“c”) picked for BB07 in chunk B2 on the left arm of chromosome III. Nomenclature for systematic Sanger sequencing reads 3L.3_23.B2.07.c05.f1 for the forward read 3L.3_23.B2.07.c05.r1 for the reverse read Subsequent re-sequencing reads are labeled f2, etc.
7
SynIII synthesis and assembly The designed synIII chromosome sequence was divided into 367 BBs with an average size of 0.75 kb, of which 133 BBs corresponded to synIIIL, including a single BB [3L.3_23. D3.10] spanning CEN3; 234 BBs encoded synIIIR. At the next higher level of organization, the synIII chromosome was divided into 127 minichunks, ranging from ~2-4 kb in size, of which 43 minichunks corresponded to synIIIL, 83 minichunks corresponded to synIIIR, and one minichunk, encoded by pNA044, spanned the centromere CEN3 (Table S1). Each minichunk consisted of 3 to 5 BBs with a single BB overlap specified for adjacent minichunks. The wet-bench workflow consisted of three major stages: 1) The 750 bp building blocks (BBs) were produced starting from overlapping 60- to 79-mer oligonucleotides designed to have compatible melting temperatures using GeneDesign (13) and assembled using standard polymerase chain assembly methods (14). All BBs were verified by sequencing (17). This critical step produced most of the starting material for the project and was carried out by undergraduate students in the Build-A-Genome class at Johns Hopkins University (Fig. 2A). 2) The 133 synIIIL (+ CEN) BBs were assembled into 44 overlapping minichunks of ~2-4 kb using one of two methods: (i) Uracil Specific Excision Reaction (USER) (16) or (ii) the “Gibson” isothermal assembly reaction (19) with a 40 bp overlap between adjoining BBs. The 234 synIIIR BBs were assembled into 83 overlapping DNA minichunks of ~2-4 kb in size using either the isothermal assembly reaction or by direct homologous recombination in yeast (Fig. 2B) (18, 19). The minichunks were also verified by sequencing. 3) All adjacent minichunks for synIII were designed to overlap one another by one BB, thus enabling further assembly in vivo by homologous recombination in yeast (20, 21). Using an average of 12 minichunks and alternating selectable markers in each experiment, the native sequence of S. cerevisiae III was systematically replaced by its synIII counterpart in eleven successive rounds of transformation (Table S2). The iterative replacement of native genomic segments of III with pools of overlapping synthetic DNA minichunks encoding alternating genetic markers enabled the total synthesis of the first functional designer eukaryotic chromosome, synIII, in vivo in yeast (Fig. 2C). Synthesizing Building Blocks (BBs) from Oligonucleotides The first step of the synthesis process, referred to as “templateless” PCR (T-PCR), involves assembling ~18 overlapping oligonucleotides that comprise the ~750 bp building block (BB), a method also known as polymerase chain assembly. Oligonucleotides in these reactions serve as both template and primers; the product appears as a smear when examined by agarose gel electrophoresis. The desired full-length ~750 bp BB is obtained by the “finish” PCR (F-PCR), using a dilution of the T-PCR product as template and the two outermost 5’ and 3’ primers (15, 39). Problematic BBs were assembled using a “touchdown” PCR protocol in the F-PCR step, in which successively lower annealing temperatures are used during each cycle in the early phase of the PCR. Lowering the extension temperature of the reaction from 72°C to 68°C helps to amplify through A-T rich templates that are less stable at the higher temperature. Each full-length ~750 bp BB was ligated to the pGEM-T vector (Promega), which allows for blue-white screening when transformed to E. coli. Twelve to twenty-four white colonies per BB were analyzed for insert size by colony PCRs, using the T7 and SP6 priming sites available within the pGEM-T vector, and 18 full-length inserts were sequenced, which yielded at least one with the desired sequence. 338 BBs were produced by undergraduate students in the Build-A-Genome class, while the remaining 29 BBs were purchased from commercial vendors (GeneArt,
8
Regensburg, Germany; Celtek Genes, Nashville TN; and Epoch Life Science, Missouri City, TX). Sequence Verification of BBs by CloneQC CloneQC software that performs quality control on the sequenced clones is available as a free webserver (http://cloneqc.org) and as BSD-licensed source code. This software allows analysis of user-specified DNA reference sequences. CloneQC was used internally as an integral component of the Build-A-Genome course to analyze the sequences of BBs (38). Assembly of 2-4 kb Minichunks Three different assembly methods were used to make the 127 minichunks needed for the construction of the synIII chromosome: 1) USER assembly (31 minichunks); 2) Isothermal assembly (57 minichunks); and 3) Yeast assembly (39 minichunks). A brief description of each method is given below. USER Assembly USER method was used to assemble 31 synIIIL minichunks both in vitro (using Phusion polymerase/Taq ligase (New England Biolabs, Beverley, MA)) and in vivo (using E. coli) (Fig. S4). A detailed protocol for USER fusion assembly reaction is described elsewhere (16). Gibson Isothermal Assembly The isothermal assembly technique with 40 bp overlap between adjoining BBs was used to generate several synIIIR 2-4 kb minichunks using a blend of three enzymes (T5 exonuclease (Epicentre, Madison, WI), Phusion DNA polymerase (New England Biolabs, Beverley, MA) and Taq DNA ligase (New England Biolabs) in a single step assembly reaction (Fig. S4) (17). The enzyme reagent mix (readily stored at -20°C) was combined with overlapping BBs and vector; the reaction was incubated at 50°C for 15 min. A detailed protocol for the “Gibson” isothermal assembly reaction is described in detail elsewhere (40). Yeast Assembly Alternatively, we used a yeast-based homologous recombination based DNA assembly (Fig. 2B). It can efficiently assemble 3 to 5 BBs and a shuttle vector (pJHU2) with 40 bp terminal overlaps in a single transformation event. This approach is fully compatible with fragments that have been made for Gibson assembly. A detailed protocol for the yeast assembly reaction is described in detail elsewhere (21, 41). Plasmid Isolation from Yeast Cells were harvested from 3 ml overnight culture in YPD and resuspended in 250 µl of buffer P1 (QIAprep miniprep kit). After addition of 100 µl of glass beads, cells were broken by vortexing for 5 minutes. Following this treatment, plasmids were isolated using the standard alkaline lysis and a Qiagen miniprep spin column to isolate the DNA. Aliquots of the shuttle plasmid were used to transform E. coli. See Muller et al. (2012) for full description of this protocol (21). Direct Replacement of Native Chromosome III with Synthetic Minichunks in Yeast All consecutive minichunks were designed to have overlap by one BB to enable further assembly and replacement of native S. cerevisiae DNA in vivo by homologous recombination. This
9
iterative replacement strategy is likely to be limited to organisms with an efficient HR repair mechanism. Equimolar amounts (~ 70 fmol each) of four to twenty-seven overlapping minichunks were co-transformed into yeast, along with a linker composed of an auxotrophic marker (URA3 or LEU2) fused to the “right end” terminal minichunk (Fig. 2), as well as a sequence of about 1000 bp of the native chromosome sequences adjacent to the right end-most minichunk introduced (Fig. 2), using a modified version of the yeast LiOAc transformation protocol. The protocol was modified as follows to improve transformation efficiency: Following heat shock, cells were centrifuged at 4000 rpm for 5 min, washed in 5 mM CaCl2 and incubated at RT for 10 min. Cells were centrifuged at 4000 rpm for 5 min, then resuspended in water and plated on the appropriate selective medium. The penultimate transformation involved selection on SC–URA medium, and 5-FOA resistance selection was used in the final step yielding a final synthetic chromosome lacking a selectable marker. Complete set of PCRTags analyses of synIII and wild type strains. Upon completion of synIII, as well as at each of the intermediate construction steps, PCRTag analysis (Table S5) revealed the presence of synIII synthetic PCRTags and absence of native PCRTags, excepting a single PCRTag, YCR004c.1 (Fig. S5). As expected, PCRTag analysis of the wild type (BY4742), showed the presence of only wild type and no synthetic PCRTags (Fig. S6). We were able to subsequently incorporate the synthetic version of YCP4 (YCR004c) into synIII by first deleting the native gene from the otherwise synthetic chromosome and then incorporating the synthetic version of YCR004c (Fig. S7). Yeast Colony PCR for Rapid Screening of WT and SYN PCRTags Yeast cells from single colonies were resuspended in 5 µL of 20 mM NaOH and heated at 95°C for 5 min in a thermocycler prior to adding regular PCR mix and performing PCR cycles. A detailed protocol for yeast colony PCR for PCRTag screening can be found elsewhere (21). Yeast Genomic DNA Preparation for PCRTags Analysis Yeast cells were isolated from 100 μL of saturated overnight culture by spinning at 2000 rpm for 2 min in a centrifuge at RT. The yeast pellet was resuspended in 200 μL breaking buffer (50 mM Tris pH8, 100 mM NaCl, 1% SDS, 2% TX100, and 1 mM EDTA). (Alternatively, resuspended cells were scooped with a sterile stick directly from a plate, in a 1.5 mL microfuge tube containing 200 μL breaking buffer). An equal volume of glass beads (Sigma G8772) and 200 μL of Phenol-Chloroform-Isoamyl alcohol (PCI) (25:24:1) were added and vortexed for ~10 min at RT and then centrifuged at 15000 rpm for 10 min. 75 μL of the top, aqueous layer, was transferred to a labeled microfuge tube containing 1 mL 100% ethanol and then inverted 5 times, and centrifuged for 20 min at 4°C. The supernatant was discarded and the DNA pellet washed by adding 500 μL of 70% ethanol, centrifuged at RT for 5 min. The genomic DNA was air-dried at RT and then resuspended in 50 μL 10 mM Tris (pH 7.4) buffer, and stored at −20°C. For each 5 μL PCR reaction, 0.1 μL of genomic DNA was used as template. PCRTags Analysis Reaction Conditions Amplification of PCRTags was performed using GoTaq Hot Start Polymerase (Promega, Madison, WI), 400 nM each of forward and reverse primers, and either BY4741 or synIII genomic DNA in a 5 µL final reaction volume. Touchdown PCR was performed as follows: 95°C/3 min, 20 cycles of (95°C /30 sec, 64°C /20 sec/-0.3°C /cycle, 72°C /30 sec), followed by
10
15 cycles of (95°C /30 sec, 58°C /20 sec, 72°C /30 sec) and a final extension of 72°C /5 min. Detection of PCRTags was performed by diluting samples to 25 µL in H2O and using a Caliper LabChip GXII (Perkin Elmer, Waltham, MA) and the HT DNA 5K LabChip Kit, Version 2. Virtual gel images were generated using LabChip GX software version 4.0.1418.0. Yeast Genomic DNA Preparation for DNA Sequencing Yeast cells were isolated from 2 mL overnight culture by spinning at 3000 rpm in a centrifuge. The yeast pellet was resuspended in 200 μL breaking buffer. An equal volume of glass beads (Sigma G8772) and 200 μL of PCI were added and then vortexed. 200 μL of TE pH 8 (10 mM Tris pH 8, 1 mM EDTA pH8), mixed thoroughly and then centrifuged at 15000 rpm at 4oC for 10 min. The aqueous layer was transferred to another microfuge tube and 4 μL of RNAse A (10 mg/mL) was added and incubated at 37˚C for 1 h. 400 μL PCI was added to the reaction mixture, vortexed for 1 min and then centrifuged at 15000 rpm at 4˚C for 10 min. The aqueous layer was transferred to another tube. The genomic DNA was precipitated by adding ~35 μL 3M NH4OAc and 1 mL ethanol (−20oC) and kept at −80˚C for 1 h. The DNA was pelleted by spinning at 15000 rpm at RT for 20 min. The precipitate was then washed with 500 μL 70% ethanol and dried at 50˚C for 5 min. The genomic DNA was then resuspended in 25 μL TE pH 8. RNA Isolation from Yeast for RNA Sequencing A single yeast colony was grown in a 10 mL culture in YPD until the OD600 was 0.8 to 1.2. The cells were pelleted by spinning at 2000 rpm at RT for 5 min. The pellet was resuspended in 0.5 mL of RNAse-free water (DEPC water) and transferred to a microfuge tube. The cells were pelleted again by spinning briefly and discarding the supernatant. The cells were resuspended in 300 µL RNA lysis buffer (0.5 M NaCl, 0.2 M Tris-HCl [pH 7.5], 10 mM EDTA). 200 µL glass beads and 300 µL PCI was then added to the cells and vortexed twice for 1 min. The cells were kept on ice for 1 min between vortexes. Centrifuge at 15000 rpm at RT for 1 min. The aqueous layer (~300 µL) was then transferred into another microfuge tube; an equal amount of PCI was added, mixed well and centrifuged at 15000 rpm at RT for 4 min. The aqueous layer was then extracted with an equal volume of chloroform. The RNA was precipitated by adding 600 µL of 100% ethanol and incubating the tube at −80˚C for 1 h or overnight. The RNA was pelleted by centrifuging at 15000 rpm at 4˚C for 15 min. The RNA pellet was then washed with 500 µL of 70% ethanol, air-dried and then resuspended in 20 µL DEPC water. Nucleotide Sequence Analysis of synIII Single-end whole genome sequencing of strain HMSY011 was performed using an Illumina HiSeq using TruSeq preparations kits; 195,598,768 raw reads were obtained and used for downstream analysis. A set of high-quality reads was created from the raw data by removing adapters using TRIMMOMATIC and then quality filtering; reads with average quality less than Phred score 15, containing “N”s were filtered out, reducing the initial set of reads by ~1%. Filtered reads were mapped using BOWTIE2 with default sensitivity settings; a reference genome was constructed starting with the sequence for strain BY4742, in which chromosome III had been replaced with the synthetic version. 97.83% of reads were mapable; 81.28% map uniquely to the genome whereas 16.55% mapped to > 1 region. The average fold coverage on chromosome III was 554X with a standard deviation of 55.3 (window size: 500 bp), a minimum
11
of 372X and a maximum of 816X, characterized by a skewness of -0.348 and kurtosis of 0.888, resulting in a good fit with the expected normal coverage distribution. Base changes and short indels relative to the designed reference synIII chromosome sequence where detected using UNIFIEDGENOTYPER of the Genome Analysis Toolkit (GATK) using standard parameters; large deletions were detected by checking depth of coverage at each location. The final sequence has three synonymous changes, three frameshifts, two non-synonymous coding changes and one change not in a coding region, 277 bp from the YCR042C gene (Table S4); furthermore, a loxPsym site was lost at position 59583. RNA-Seq Analysis of synIII Single-end non-strand-specific RNA-seq of the synIII stain (HMSY011) and BY4742 were performed using Illumina MiSeq and standard TruSeq preparations kits. Total counts of 100 bp single-end reads were 84,859,272 for the wild type strain and 105,038,509 for the synIII strain. Adapters and low quality were trimmed using TRIMMOMATIC (42), reducing the read count by about 2.5%. Reads were mapped using TOPHAT (43) to the reference S. cerevisiae BY4742 genome. For each gene, read counts were computed using HTSEQ (44) and analyzed for differential expression using DESEQ (45), with standard parameters and following the no replicates scenario. For each gene, we obtained a raw p-value and adjusted p-value using the standard Benjamini–Hochberg procedure. Genes were assessed for statistical significance by rejecting the null hypothesis if the adjusted p-value was <0.01 and if the raw p-value fell below the threshold of the 5% Family Wise Error Rate (FWER) after Bonferroni correction (threshold=7.02eX10-06). We obtained two genes with a significant change in expression: HSP30 on the synIII chromosome (p-value=1.76X10-06, p-adjusted=0.00132, log2 fold change=-4.25) and PCL1 on chromosome XIV (p-value=4.63X10-06, p-adjusted=0.00313, log2 fold change=4.05). SCRaMbLE Yeast cells were transformed with the URA3-tagged plasmid pLM158 expressing the Cre-EBD fusion protein under the control of the SCW11 promoter (2, 46) into wild-type and synIII strains, and plated on SC–Ura to select for the plasmid. Isolated colonies were inoculated into 5 mL SC–Ura for overnight culture at 30°C. Cultures were diluted to an OD600 of 0.1 in 200 mL SC–Ura plus or minus estradiol to a final concentration of 1 µM (Sigma E2257). As ethanol is used as a solvent for the stock solution of estradiol (10 mM), the same volume of ethanol 100% (20 μL) was added to the control cultures minus estradiol. Samples were taken before induction (T0) and at various time points after induction, adjusted to an OD600 of 0.1, and then 5 µL of 10-fold serially diluted cultures were spotted onto SC–Ura or YPD plates. OD600 of cultures was recorded over 48h of induction. Cell Morphology Cells were grown to mid-log phase in synthetic complete medium with 2% dextrose at 30°C. DIC Images were collected using a Zeiss Microscope Axioskop 2 mot Plus (63X) with a Zeiss AxioCam HRc Camera.
12
Pulsed Field Gels Chromosome-sized DNAs were prepared as described elsewhere (22) . Identity of the chromosomes was inferred from the known molecular karyotype of WT (BY4742) that was run on the same gel. Samples were run on a 1.0% agarose gel in 0.5x TBE (pH 8.0) for 24 h at 14°C on a CHEF apparatus. The voltage was 6 V/cm, at an angle of 120° and 60-120 s switch time ramped over 24 h. Southern Blot Probe Preparation Probes were prepared using the Prime-It II kit (Stratagene), and hybridized using Ultrahyb hybridization solution (Ambion) according to manufacturer’s instructions. SUP61S Integration SUP61S essential tRNA complementation was done in two steps: First, synIII/III heterozygous diploid strains (yLM108 to yLM117) with SUP61S in HIS3 vector pRS413 were constructed. Second, the colonies were screened for the loss of HIS3-plasmid (yLM098 to yLM107), and transformed with SUP61S flanked by 500-bp homologous HO genomic sequences to integrate the donor at the HO locus to generate NAY002 to NAY011 strains (Fig. S17). Synthetic YCP4S Integration into synIII strain PCRTags analysis revealed that the synthetic version of YCP4 (YCP4S) was not originally assimilated into the synIII strain HMSY011, which was confirmed by sequencing of synIII. However, we were able to subsequently incorporate YCP4S by first deleting native YCP4 and then incorporating YCP4S. This was done in two steps: First, we deleted YCP4 by integrating URA3 at the native YCP4 locus; Second, we removed URA3 by incorporating YCP4S at this locus (Strain - NAY001), using 5-FOA medium to screen for the loss of URA3 (Fig. S7). Serial dilution assay on various types of media Wild type (BY4742), synIIIL (yLM043), and synIII (yLM197) strains were grown overnight in rich medium (YPD) at 30°C with rotation. Cultures were serially diluted in 10-fold increments in water and plated onto each type of medium. All drugs (methyl methanosulfate (MMS; defective DNA repair) (Sigma, 129925), benomyl (Aldrich, 381586; microtubule inhibitor), camptothecin (Sigma, C9911; topoisomerase inhibitor), hydroxyurea (HU; defective DNA replication) (Sigma, H8627)) were mixed into YPD, except 6-azauracil (6-AU; Sigma, A1757; defective transcription elongation), which was mixed into synthetic complete (SC) medium containing 2% dextrose. YPGE (respiratory defects) was prepared with 2% glycercol and 2% ethanol. High and low pH plates (9.0 and 4.0; vacuole formation defects) were prepared using NaOH and HCl in YPD, respectively. Sorbitol plates (osmotic stress) were prepared by adding the appropriate quantity of sorbitol (Sigma, S1876) to YPD. For hydrogen peroxide (Fluka, 88597; oxidative stress) and cycloheximide (Sigma C7698; defective protein synthesis), overnight cultures were treated for 2 hours in drug, harvested by centrifugation and resuspended in water prior to plating the serial dilutions on YPD. Plates were incubated at 30°C, unless otherwise indicated in Fig. S11B, for 2 days (YPD, camptothecin, 6-azauracil, benomyl, pH4.0, pH9.0, cycloheximide, hydrogen peroxide) or 3 days (sorbitol, YPGE, HU, MMS). Subculture
13
Six single synIII strain (yLM197) colonies were inoculated in 5 mL of YPD. After 24 hours, 5 µL of overnight culture was transferred to 5 mL of fresh YPD. This experiment was continued for 10 days to get 120 generations. Then cells were plated on YPD plates to get single colonies. Five single colonies were picked from each of six “mother clones” to inoculate 3 mL culture of YPD and next day gDNA prep was carried for all the 30 clones. PCRTag analysis (Table S8) was carried out to monitor the presence of 58 presumed non-essential segments (i.e. segments lacking known essential genes) flanked by loxPsym sites. All the 58 PCRTags amplified in each strain, indicating the presence of these segments. A-Like-Faker Assay Mating between MATα strains will occur when the MATα locus from either parental genotype is lost. Possible events include loss of the chromosome III, deletion, translocation or removal of the MATα locus. One mL of overnight culture of synIII strain and Tester α strain were mixed and kept at 30˚C for 4 hours (for mating). The cells were then washed twice with water by spinning at 2500 rpm for 2 minutes. The cells were resuspended in 500 µl of water and plated on SD plates. Overnight cultures were also plated on YPD plates to estimate the CFU. This experiment was carried out for ten independent synIII and BY4742 strains and the average loss rate of MATa calculated using the method of the median (47). The yeast strain, yLM197, was used for this experiment. SCRaMbLE Mating Type Assay Ten independent heterozygous diploid strians (NAY002 to NAY11) were transformed with HIS3 plasmid pLM006 expressing the Cre-EBD fusion protein under the control of the SCW11 promoter. We then inoculated isolated colonies into 5 mL YPD for overnight culture at 30°C. We then re-inoculated the overnight cultures into 5 mL YPD (1:10 ratio) medium with 1 µM estradiol (Sigma E2257). After 30 min incubation at 30°C, cells were plated in the absence of estradiol at varying number of cells (~20, ~200, and ~2000 cells, respectively) on solid YPD medium and the colonies were grown for two days at 30˚C. Mating assays were performed using mating type tester strain lawns with overnight mating at 30˚C and subsequently replica-plating onto SD medium. Loss of genomic segments containing the MATα region of synIII (i.e. deletion of synIII chromosome segments between two loxPsym sites that result in the loss of MATα) in these cells should lead to the development of a-type mating cells, detected by their ability to mate with a MATα tester strain lawn. Fourteen such clones were analyzed by 24 SYN PCRTags, each pair covering ~10 kb of the synIII chromosome, for the absence of SYN PCR products in the PCRTag reactions. These clones were similarly analyzed using all the MATα region-specific SYN PCRTags for the loss of MATα region on the synIII chromosome. Effect of Cre-EBD induction on synIII strain Subsequent to completion of synIII, we transformed a Cre-EBD plasmid into the haploid synIII strain to enable SCRaMbLEing of the chromosome (2, 3), which resulted in genome rearrangements of the synIII strain. Cre-EBD induction appears to greatly reduce the fitness of the synIII strain, but not the wild type (Fig. S16A). We also monitored growth curves of wild type and synIII strains throughout Cre-EBD induction time course, and as expected, synIII shows much decreased fitness as compared to the wild type under these SCRaMbLE-inducing conditions (Fig. 16B).
14
ChIPseq Analysis BY4742 and synIII cells were grown to an A600 of 0.5, and nocodazole was added to a concentration of 15 µg/mL. After arrest for 2 h at 30˚C, ~50 OD cells were fixed in 1% formaldehyde at 25˚C for 2 h and quenched in 125 mM glycine at 25˚C for 10 min. Cells were pelleted and washed twice with 1X TBS buffer before freezing. The frozen pellet was resuspended in 0.45 ml ChIP lysis buffer (50 mM HEPES•KOH pH 7.5, 500 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% deoxycholate, 0.1% SDS, 1 mM PMSF, 10 µM leupeptin, 5 µM pepstatin A, and Roche protease inhibitor cocktail) and lysed by bead beating. Lysate from 50 OD of cells was split into two tubes each containing 280 µL lysate and sonicated for 20 cycles (30 sec on, 30 sec off, high output) using a Bioruptor (Diagenode, Denville, NJ). The supernatant of the sonicated lysate was pre-cleared. 50 µL lysate was saved as input. 1.5 µg Mcd1 antibody (the kind gift of Vincent Guacci and Doug Koshland) was used. After incubation overnight, 50 µl protein A Sepharose beads (GE Healthcare Life Sciences, Piscataway, NJ, 17-5280-01) resuspended in ChIP lysis buffer was added and incubated for 1.5 h at 4˚C. Beads were washed twice with ChIP lysis buffer, washed twice with ChIP lysis buffer containing 500 mM NaCl, twice with DOC buffer (10 mM Tris•Cl pH 8.0, 0.25 M LiCl, 0.5% deoxycholate, 0.5% NP-40, 1 mM EDTA) and twice with TE. 125 µL of TES buffer (TE, pH 8.0 with 1% SDS, 150 mM NaCl, and 5 mM dithiothreitol) was added to resuspend the beads. The supernatant was collected after incubation at 65°C for 10 min. A second round of elution was performed and the eluates were combined. Reverse crosslinking was performed by incubation for 6 h at 65°C. An equal volume of TE containing 1.25 mg/mL proteinase K and 0.4 mg/mL glycogen was added to the samples after reverseing the crosslinks and the samples were incubated for 2 h at 37°C. Samples were extracted twice with an equal volume of phenol and once with 25:1 chloroform:isoamyl alcohol. DNA was precipitated in 0.1 volume 3.0 M sodium acetate (pH 5.3) and 2.5 volume of 100% ice-cold ethanol at -20˚C overnight. Pellets were washed once with cold 70% ethanol and resuspended in 20 µL TE. Library construction and sequencing were performed following the Illumina protocol; DNA ends were repaired and A-tailed. Barcoded adaptors were ligated and the DNA was run on a 2% agarose gel. 150 - 300 bp DNA fragments were excised from the gel and used for PCR. PCR products were gel-extracted again and quantified on an Agilent Bioanalyzer. Sequencing was performed on an Illumina Miseq. Raw reads were mapped using BOWTIE (-5 3 -3 10 --best) to the reference genome (sacCer2) or the synIII genome (identical to sacCer2 except replacing chr03 with synIII sequence) and the peaks were visualized using the CISGENOME Browser. Determination of replication origins of synIII The protocol for mapping replication origins was adapted from Agier et al. (36) as follows. Strain yLM197 was inoculated in 500 mL YPD at OD600 = 0.15 and grown O/N for approx. 18 h. 8X1010 cells were harvested by centrifugation 5 min at 4000 rpm, washed in 100 mL 1xPBS buffer and resuspended in 50 mL l PBS buffer to enter a Beckman elutriation system (Avanti J26 XP centrifuge combined with a JE-5.0 elutriator rotor and a 40 mL elutriation chamber). From the original asynchronous culture, G1 cells were sorted by elutriation, and 109 G1 cells were resuspended in 500 ml of fresh YPD pre-warmed to 25˚C before beginning the time course experiment. Subsequent culture growth was carried out in a water bath at 25˚C with constant shaking. Aliquots of cells were harvested at T0 and then every 10 minutes after a lag phase of 2 h and 30 min to allow entry into S-phase. At every time point, 1 mL cells were fixed with 2.3 mL EtOH (100%) to monitor S-phase progression using flow cytometry, and 30 mL cells were fixed
15
in 0.1% Na azide (final concentration) on ice, to be used for the replication origin determination. Cell morphology was also examined under the microscope, to check for bud formation. At the end of the time course, cells fixed in Na azide were washed twice with 20 mL of cold water (4˚C), and pellets were frozen at −80˚C until used for DNA extraction. After 12 h in EtOH at 4˚C, cell aliquots for FACS analysis were labeled with SYTOX® Green (Life Technologies) dye and analyzed with a MACSQuant® Analyzer. DNA extraction of the frozen pellets was performed using the Qiagen kit Genomic-tip 20/G, following manufacturer’s instructions. Each sample was then processed for Illumina sequencing using standard protocols and custom adapters, allowing multiplexing of the time points chosen for the experiment. All multiplexed time points were sequenced on a HiSEQ2000, with a single-end 50 base reads. For each time point, reads were mapped to the reference genome (BY4742 genome sequence with synIII instead of WT chromosome III) to determine replication origins, using the procedure described in Agier et al. (48).
16
(Next page for figure legend)
17
Figure S1: Map of synIII with common ORF names. Open reading frames (ORFs) - red, essential; dark blue, non-essential; purple, null mutation confers a slow growth phenotype; light blue, uncharacterized; white, dubious/pseudogene. Autonomously replicating sequences (ARSs), pale yellow. Loci marked with an “X” are present in the WT chromosome and are deleted in synIII. Green diamonds represent loxPsym sites embedded in the 3’ UTR of non-essential genes and at several other landmarks. Gray bars in ORFs symbolize PCRTag pairs. Fuchsia circles indicate synthetic stop codons (TAG recoded to TAA). Rare-cutting restriction enzyme sites bordering ~10 kb chunks are also shown.
18
Figure S2: Map of synIII with systematic ORF names. Open reading frames (ORFs) - red, essential; dark blue, non-essential; purple, null mutation confers a slow growth phenotype; light blue, uncharacterized; white, dubious/pseudogene. Autonomously replicating sequences (ARSs) pale yellow. Loci marked with an “X” are present in the WT chromosome and are deleted in synIII. Green diamonds represent loxPsym sites embedded in the 3’ UTR of non-essential genes and at several other landmarks. Gray bars in ORFs symbolize PCRTag pairs. Fuchsia circles indicate synthetic stop codons (TAG recoded to TAA). Rare-cutting restriction enzyme sites bordering ~10 kb chunks are also shown.
19
Figure S3: Hierarchy and nomenclature for synIII. A diagram of the hierarchy from oligonucleotide to intact chromosome is shown. See Supplementary Text for more details.
20
Figure S4: Schematic diagram of USER and Gibson isothermal assembly methods.
21
Figure S5: SynIII PCRTag analysis. The presence of synIII and absence of native chromosome III was verified by amplification of synthetic PCRTags (SYN) compared to wild-type PCRTags (WT). PCRTag analysis of synIII strain revealed the presence of SYN PCRTags and absence of WT PCRTags, with the exception of one single PCRTag, YCR004c.1 The synthetic version of YCR004c.1 (YCP4S) was subsequently incorporated by first deleting the native gene (YCP4) from the otherwise synthetic chromosome and then incorporating YCP4S (Fig. S6. Two SYN PCRTags (YCR067C.1 and YCR073W-A.1) did not yield amplicons under the PCR conditions used. Nucleotide sequence determination of synIII confirmed the presence of these two SYN PCRTags.
22
Figure S6: PCRTag analysis of wild-type gDNA (BY4742). PCRTags that are short pairs of recoded sequences, unique to either the wild-type or synthetic genome, were used to rapidly verify the introduction of designer synIII synthetic sequence and the removal of native wild-type yeast chromosome III sequence by PCR. PCRTag analysis of wild-type yeast (BY4742) gDNA showed the presence of only WT PCRTags, demonstrating the specificity of all PCRTag primers (Fig. S4). Two WT PCRTags, namely YCL061C.2 and YCL045C.2, did not yield any products under the PCR conditions that we employed for the PCRTag analysis. SYN, synthetic PCRTags; WT, wild-type PCRTags.
23
Figure S7: Incorporation of the synthetic version of YCP4 into synIII. PCRTags analysis revealed that YCP4 was not assimilated into the synIII strain, which was further confirmed by nucleotide sequence determination of synIII. However, we were able to subsequently incorporate the synthetic version of YCP4 (YCP4S) by first deleting the native gene and then incorporating the synthetic version. This was done in two steps: In the first step, we deleted the wild-type YCP4 by integrating URA3 at the YCP4 locus. In the second step, we removed URA3 by incorporating synthetic YCP4 S at this locus. Agarose gel profile of the PCRTag analysis around the region of YCP4 locus for synIII, YCP4∆::URA3 and YCP4S strains are shown: Lanes: 1, PCRTags for YCR003W.1; 2, YCR004C.1 (YCP4); and 3, YCR005C.1. SynIII strain shows the presence of the synthetic PCRTags for YCR003W.1 and YCR005C.1 loci and wild-type PCRTag for YCR004C.1 (YCP4). YCP4∆::URA3 strain has the wild-type PCRTag YCR004C.1 (YCP4) deleted. The YCP4S strain shows the presence of only synthetic PCRTags around the YCP4 region [synthetic sequence only for YCR003W.1, YCR004C.1 (YCP4) and YCR005C.1] and no wild-type PCRTags. YCP4S, synthetic version of YCP4.
24
Figure S8: Karyotypic analysis of synIII and intermediate assembly strains by pulsed-field gel electrophoresis revealed the size reduction of synIII compared to native III. Synthetic intermediate strains are denoted by the amount of synthetic DNA integrated (in kb) at each step. Yeast chromosome numbers are indicated on the right side. Native and synthetic versions of chromosome III are marked with closed circles. Karyotype abnormalities pre-existing in the starting strain (ΔYCL069W) and those that arose at the 5th integration step (93) are indicated with closed and open arrowheads, respectively. Backcrossing of the synIIIL intermediate to BY4742 eliminated chromosomal abnormalities (compare 97 to 97*) and yielded a strain of the opposite mating type (MATa versus MATα). SynIII (272,871 bp) and native chromosome VI (270,148 bp) co-migrate in the gel.
25
Figure S9: Validation of the left and right arm telomere ends of synIII. Southern blot analysis was used to verify and validate the left and right arm telomere ends of synIII (which had been specified by the UTC sequence) using arm-specific radiolabeled probes. (A) SynIII left arm telomere end has HML region deleted. Southern blot analysis of NotI/AlwNI digest of synIII swap strain yielded the expected 8.9 kb fragment as compared to 6.7 kb fragment for the wild type (BY4742) and ∆YCL069w strains confirming the deletion of HML from the left arm telomere end. (B) SynIII right arm telomere end has HMR region deleted. Southern blot analysis of BspEI digest of synIII swap strain yielded the expected 7 kb fragment as compared to the 28 kb fragment for the wild type strain (BY4742), confirming the deletion of the HMR from the right arm telomere end. The nucleotide sequence of the designer synIII chromosome further confirmed these results.
26
Figure S10: Growth curves for wild type (BY4742) and synIII strains in absence of estradiol induction (A) YPD and (B) SC−Ura. pRS, control plasmid without Cre; pCRE, plasmid with Cre.
27
(Next page for figure legend)
28
Figure S11: SynIII and synIIIL phenotyping on various types of media. Ten-fold serial dilutions of saturated cultures of wild type (BY4742), synIIIL and synIII strains were plated on the indicated media and incubated at noted temperatures (A). YPD, yeast extract peptone dextrose; SC, synthetic complete medium; SD, synthetic dextrose; YPGE, yeast extract peptone glycerol ethanol and MMS, methyl methanosulfate. Growth of wild type (BY4742), synIIIL intermediate and synIII strains have identical colony sizes at different temperatures and on various media types, with only one condition out of 21 (high sorbitol) showing a subtle fitness defect for synIII (B).
29
Figure S12: SynIII strain cell morphology. SynIII has a subtle morphological defect that arises as a specific integration intermediate that occurred on integration step synIII-219 kb. Arrowheads indicate cells with the morphological defect. Cells were grown to mid-log phase in SC medium at 30°C. DIC Images were collected using a Zeiss MicroscopeAxioskop 2 mot Plus (63X) with a Zeiss AxioCam HRc Camera.
30
Figure S13: Transcript profiling of wild-type (BY4742) and synIII strains. RNASeq analysis of synIII strain as compared to the wild type is shown in a volcano plot. Genes deleted from synIII are labeled in blue letters. Genes with significantly altered expression are shown in red. The dashed line identifies the Family Wise Error Rate (FWER) threshold at 5% (threshold=7.02e-6).
31
(Next page for figure legend)
32
Figure S14: ChIPseq map of cohesin binding sites on native chromosome and synIII. (A) Sequences were aligned to the native reference sequence (SacCer2) or to synIII (SYNIII). Red arrows and bars indicate tRNA genes. (B) The panel shows that the pattern of cohesin peaks is identical for chromosome VI in the synIII and wild-type strains. (C) The panel shows the chromosome III data from A, mapped to the synIII reference sequence rather than to the “Saccer2” reference sequence.
33
(Next page for figure legend)
34
Figure S15: Replication origins of synIII. Replication could be affected by the pervasive changes in underlying sequence. SynIII maintains 12 of 19 ARSs (autonomously replicating sequences) present in native III in completely unaltered form; six ARSs were deleted (they were associated with the subtelomere and HM loci) and three ARS sequences suffered very minor sequence changes not expected to affect ARS function (Table S9). Also, many tRNA genes, which can in principle affect the movement of replication forks, were deleted. We compared the replication dynamics of synIII and native III. The chromosomal extremities most likely to be affected by the synIII design are already known to bear late replicating origins that are not major contributors to global replication dynamics (14), and little change was observed in these regions. (A) FACS analysis of asynchronous cells before elutriation and all the time points of the replication origin experiment. Time points T1 to T9 were processed for Illumina sequencing. (B) Graph of relative DNA content (R) during the time course experiment, which varies between 1 and 2, is calculated using the following formula: R= (G1+2*G2) / (G1+G2). (C) Replication program of chromosome III from strain synIII (yLM197) (this study), S. cerevisiae from Muller et al. 2012 (36) and Raghuraman et al. 2001 (37) are shown. For each study, replication data were plotted along the chromosome, after normalization of replication times or the relative copy number ranging between 0 and 1. Replication origins were detected on normalized data, as described in Agier et al. 2013 (35) which are indicated as diamonds on top of the replication curves. To be able to make a comparison between the WT chromosome III and synIII, the alignment between both chromosomes were considered for the projection of the replication data. (D) Correlation between replication data among the three studies. For each chromosome, we performed all pairwise comparisons by calculating the Spearman correlation coefficient (Rho). Each vertex corresponds to a pairwise comparison. E) Replication program of all the chromosomes of S. cerevisiae from this study, Muller et al. 2012 (35) and Raghuraman et al. 2001 (37) including chromosome III (C), are shown.
35
A
B
Figure S16: Conditional genome instability (SCRaMbLE). (A) Induction of the SCRaMbLE system by Cre results in genome rearrangements of synIII. Cre induction greatly reduces the fitness of the synIII strain, but not the wild type (WT; BY4742). EST: estradiol; Hours: exposure to estradiol. Comparison of synIII + Cre between SC–Ura and YPD plates indicated a high frequency of loss of the URA3 plasmid in the induced synIII strain that prevents its growth on selective medium and not on rich medium. (B) Growth curves for wild type (BY4742) and synIII strains during Cre induction time course. Upon Cre induction, synIII shows much decreased fitness as compared to wild type. WT, wild-type (BY4742). The small decreased fitness effect visible on the uninduced synIII in this experiment compared to the WT might be explained by leakiness of the Cre plasmid.
36
Figure S17: SUP61 essential tRNA complementation by a synthetic tRNA gene. First, a heterozygous diploid strain with SUP61S in the HIS3 plasmid was constructed that was heterozygous for synIII. The colonies were then screened for the loss of the HIS3 plasmid, which were then transformed with synthetic SUP61S cassette flanked by 500-bp homologous HO genomic sequence to integrate the donor at the HO locus. SUP61S, synthetic version of SUP61.
37
Figure S18: SCRaMbLE leads to a gain of mating type a behavior in synIII heterozygous diploids. (A) Schematics of SCRaMbLE experiment behavior in synIII heterozygous diploids. Frequency of a-mater and α-mater colonies post-SCRaMbLE (induction with estradiol) in synIII/III and III/III strains. (B) Genotypic analysis of 12 gain of “a mater” synIII/III strains. Select synthetic PCRTags spanning synIII (~10 kb intervals) were used to assess the effects of SCRaMbLE. Red boxes indicate absence of PCRTags (presumed deletions); white boxes indicate presence of PCRTags. Clones 1 & 4, presumed deletion of right arm of synIII; Clones 2, 3, 5-10, & 12, presumed loss of entire synIII; and Clone 11, segment deletions within the right arm of synIII. Stars “*” indicate the position of loxPsym sites around these regions of the synIII chromosome.
*Minichunks with pre-existing mutations: pNA082, 2324T deletion; pNA083, 467T deletion; pNA104, 1427T deletion; and pNA119, 825A deletion. The deletion numbers represent positions of mutations within the minichunks. #Minichunks that were digested with appropriate restriction enzymes to remove the mutated regions from overlapping BBs, but leaving sufficient overlap for HR.
43
Table S2: Summary of eleven iterative one-step assemblies and replacements of native III with synthetic fragments needed to construct synIII
UTC fragment N/A 166 [YCR088W1] −186 [YCR098C1] 272907 clone 28: 272 kb-synIII
L indicates synIII left arm; R indicates synIII right arm; *Round L5 was planned for replacement of PCRTags 37 to 64, using LEU2 as a selectable marker, but it was initially not possible to obtain a complete synthetic substitution. A clone in which PCRTags 37 and 38 amplified only the wild-type sequence and that was still [URA+] was selected for a second round of recombination with minichunks 27 to 33, using counter selection for URA3 by 5-FOA, allowing the next step to be carried out with a selection for [Ura+ Leu-] colonies. Transformations #R4 and #R5 also included minichunks 46 & 47 to encourage replacement of wild type YCP4 with synthetic YCP4S, but were not successful in this regard. ^For each clone, the amount of synthetic DNA (in kb) that was replaced in the native chromosome III is shown.
44
Table S3: Yeast strains used in this study
Strain name Description Replacement
round Genotype
BY4741 MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0
BY4742 MATα his3Δ1 leu2Δ0 lys2Δ0 ura3Δ0
BY4741 ∆YCL069w MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 YCL069W::kanMX
HMSY001 9 kb-synIII L1 MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 SYN3-8876bp-LEU2
HMSY002 30 kb-synIII L2 MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 SYN3-29626bp-URA3
HMSY003 46 kb-synIII L3 MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 SYN3-45560bp-LEU2
HMSY004 58 kb-synIII L4 MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 SYN3-58222bp-URA3
HMSY005 93 kb-synIII L5A, B MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 SYN3-92904bp-LEU2
HMSY006 97 kb-synIII L6 MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0a SYN3-97002bp-URA3
**Essential tRNA cassette SUP61S integrated at the HO locus
46
Table S4: Sequence variants in the synIII chromosome
Position in
SynIIIv.3_41
Reference
SynIIIv.3_41
Variant
SynIIIv.3_42
ORF Amino acid
Substitution
Closest ORF
*68618 G T YCL025C Synonymous -
71593.1 - C YCL024W Frameshift -
92548 C A YCL002C Q117H -
*176111 A G YCR038C Synonymous -
#182368 T - - - YCR042C (277 bp)
195513 G C YCR054C P462A -
#221701 T - YCR073C Frameshift -
243006 T C YCR088W Synonymous -
#252434 A - YCR091W Frameshift -
For each variant (single base substitution or indel variant), we report position relative to the designed sequence, the reference base(s) and the experimentally determined variants. Variants occurring inside ORFs are annotated with gene name and corresponding amino acid substitution. For variants outside coding regions, we report the closest gene with the distance to nearest ORF boundary. Since these variants arose during assembly step in yeast, it suggests an error rate in the assembly process of about 3.3 X 10-5. As explained in the text, one expected loxPsym site at position 59583 was also absent from the sequence. We believe that this probably arose through a recombinational mechanism.
*This variant corresponds to the native sequence and therefore probably arose by recombination. #This variant corresponds to a pre-existed mutation in the corresponding minichunk.
47
Table S5: Wild type and synthetic PCRTags and the expected size of amplicons
274 43 SYN TTTGCCGGTCCAACCGTTGCTAACTAGG CATCTCTTCTGAAGCTAGCGCTACTGCC
The wild-type (WT) and synthetic (SYN) PCRTags that did not yield any product under the conditions that were employed for the PCR reaction, are shaded.
Unique restriction sites were generated in synIII either by introduction of synonymous mutations in ORFs, or by removal of redundant sites by the same method to leave only one pre-existing instance of a given site in the synIII sequence.
63
Table S7: SynIII restriction site “landmarks” added
ORF Restriction Enzyme Name Start Stop Pre-existing/ introduced (P/I) Sequence
(WT/Syn) 9247 9255 AlwNI P 19537 19543 BlpI P 26359 26364 MmeI P 30017 30022 BpuEI P 39138 39144 Bpu10I P
YCL038C 45935 45943 RsrII I GGGTCCCAG CGGTCCGAG
52293 52303 BglI P YCL030C 58619 58624 BsaI P YCL025C 68581 68595 SfiI I TAGTCCAGCTGGACC
TAGGCCAGCTGGGCCYCL016C 76594 76600 SanDI P
88857 88862 BsmBI P 97388 97393 SacII P
YCR008W 109229 109234 AvrII P YCR017C 126643 126655 SfiI I AGCAGATTTTGCTTG
GGCCGATTTGGCCTG 136238 136246 DraIII P 147109 147115 AarI P
YCR030C 152457 152469 SfiI I GGCACCAGTGGCAGAGGCCCCAGTGGCCGA
YCR033W 163089 163094 EciI P YCR037C 172389 172396 SgrAI P YCR042C 180399 180405 BstEII P
190789 190795 AarI P YCR059C 201009 201021 SfiI P YCR067C 211291 211296 BspMI P YCR072C 218743 218749 SanDI P
231384 231390 PasI P YCR088W 243974 243985 AscI I AGACGAGCAACT
CGGCGCGCCACT
64
251576 251587 PpiI P YCR093W 259335 259349 SfiI I GAAGCTATTTTAGCC
GAGGCCATTTTGGCC 265584 265590 PasI P
65
Table S8: PCRTags for non-essential segments analysis
Segments Primer Name Forward Primer Reverse Primer PCR Amplification
Region in synIII
1 Custom Primer 01 CAACAAACTGTAGAATGGAGATGCAG GACATCACAGAAGTGGCACAATTC 1431…1743
2 Custom Primer 02 GGAGGAAACTAAGTACTCTTCGCAG CTACCGACAATGAGCATATTCATTG 3678…4070
3 Custom Primer 03 TACAGACTTCAACACAATCAGAATC TACTAAGTACATTAATTAGTTAATTG 5502…5729
1. A. Goffeau, B. G. Barrell, H. Bussey, R. W. Davis, B. Dujon, H. Feldmann, F. Galibert, J. D. Hoheisel, C. Jacq, M. Johnston, E. J. Louis, H. W. Mewes, Y. Murakami, P. Philippsen, H. Tettelin, S. G. Oliver, Life with 6000 genes. Science 274, 546–567 (1996). Medline doi:10.1126/science.274.5287.546
2. J. S. Dymond, S. M. Richardson, C. E. Coombes, T. Babatz, H. Muller, N. Annaluru, W. J. Blake, J. W. Schwerzmann, J. Dai, D. L. Lindstrom, A. C. Boeke, D. E. Gottschling, S. Chandrasegaran, J. S. Bader, J. D. Boeke, Synthetic chromosome arms function in yeast and generate phenotypic diversity by design. Nature 477, 471–476 (2011). Medline doi:10.1038/nature10403
3. J. Dymond, J. Boeke, The Saccharomyces cerevisiae SCRaMbLE system and genome minimization. Bioeng. Bugs 3, 168–171 (2012). Medline doi:10.4161/bbug.19543
4. J. Cello, A. V. Paul, E. Wimmer, Chemical synthesis of poliovirus cDNA: Generation of infectious virus in the absence of natural template. Science 297, 1016–1018 (2002). Medline doi:10.1126/science.1072266
5. L. Y. Chan, S. Kosuri, D. Endy, Refactoring bacteriophage T7. Mol. Syst. Biol. 1, 0018 (2005). Medline doi:10.1038/msb4100025
6. G. Pósfai, G. Plunkett 3rd, T. Fehér, D. Frisch, G. M. Keil, K. Umenhoffer, V. Kolisnychenko, B. Stahl, S. S. Sharma, M. de Arruda, V. Burland, S. W. Harcum, F. R. Blattner, Emergent properties of reduced-genome Escherichia coli. Science 312, 1044–1046 (2006); 10.1126/science.1126439. Medline doi:10.1126/science.1126439
7. D. G. Gibson, G. A. Benders, C. Andrews-Pfannkoch, E. A. Denisova, H. Baden-Tillson, J. Zaveri, T. B. Stockwell, A. Brownley, D. W. Thomas, M. A. Algire, C. Merryman, L. Young, V. N. Noskov, J. I. Glass, J. C. Venter, C. A. Hutchison 3rd, H. O. Smith, Complete chemical synthesis, assembly, and cloning of a Mycoplasma genitalium genome. Science 319, 1215–1220 (2008); 10.1126/science.1151721. Medline doi:10.1126/science.1151721
8. C. Lartigue, J. I. Glass, N. Alperovich, R. Pieper, P. P. Parmar, C. A. Hutchison 3rd, H. O. Smith, J. C. Venter, Genome transplantation in bacteria: Changing one species to another. Science 317, 632–638 (2007); 10.1126/science.1144622. Medline doi:10.1126/science.1144622
9. H. H. Wang, F. J. Isaacs, P. A. Carr, Z. Z. Sun, G. Xu, C. R. Forest, G. M. Church, Programming cells by multiplex genome engineering and accelerated evolution. Nature 460, 894–898 (2009). Medline doi:10.1038/nature08187
10. D. G. Gibson, J. I. Glass, C. Lartigue, V. N. Noskov, R. Y. Chuang, M. A. Algire, G. A. Benders, M. G. Montague, L. Ma, M. M. Moodie, C. Merryman, S. Vashee, R. Krishnakumar, N. Assad-Garcia, C. Andrews-Pfannkoch, E. A. Denisova, L. Young, Z. Q. Qi, T. H. Segall-Shapiro, C. H. Calvey, P. P. Parmar, C. A. Hutchison 3rd, H. O. Smith, J. C. Venter, Creation of a bacterial cell controlled by
11. F. J. Isaacs, P. A. Carr, H. H. Wang, M. J. Lajoie, B. Sterling, L. Kraal, A. C. Tolonen, T. A. Gianoulis, D. B. Goodman, N. B. Reppas, C. J. Emig, D. Bang, S. J. Hwang, M. C. Jewett, J. M. Jacobson, G. M. Church, Precise manipulation of chromosomes in vivo enables genome-wide codon replacement. Science 333, 348–353 (2011). Medline doi:10.1126/science.1205822
12. S. G. Oliver, Q. J. M. van der Aart, M. L. Agostoni-Carbone, M. Aigle, L. Alberghina, D. Alexandraki, G. Antoine, R. Anwar, J. P. G. Ballesta, P. Benit, G. Berben, E. Bergantino, N. Biteau, P. A. Bolle, M. Bolotin-Fukuhara, A. Brown, A. J. P. Brown, J. M. Buhler, C. Carcano, G. Carignani, H. Cederberg, R. Chanet, R. Contreras, M. Crouzet, B. Daignan-Fornier, E. Defoor, M. Delgado, J. Demolder, C. Doira, E. Dubois, B. Dujon, A. Dusterhoft, D. Erdmann, M. Esteban, F. Fabre, C. Fairhead, G. Faye, H. Feldmann, W. Fiers, M. C. Francingues-Gaillard, L. Franco, L. Frontali, H. Fukuhara, L. J. Fuller, P. Galland, M. E. Gent, D. Gigot, V. Gilliquet, N. Glansdorff, A. Goffeau, M. Grenson, P. Grisanti, L. A. Grivell, M. de Haan, M. Haasemann, D. Hatat, J. Hoenicka, J. Hegemann, C. J. Herbert, F. Hilger, S. Hohmann, C. P. Hollenberg, K. Huse, F. Iborra, K. J. Indje, K. Isono, C. Jacq, M. Jacquet, C. M. James, J. C. Jauniaux, Y. Jia, A. Jimenez, A. Kelly, U. Kleinhans, P. Kreisl, G. Lanfranchi, C. Lewis, C. G. vanderLinden, G. Lucchini, K. Lutzenkirchen, M. J. Maat, L. Mallet, G. Mannhaupet, E. Martegani, A. Mathieu, C. T. C. Maurer, D. McConnell, R. A. McKee, F. Messenguy, H. W. Mewes, F. Molemans, M. A. Montague, M. Muzi Falconi, L. Navas, C. S. Newlon, D. Noone, C. Pallier, L. Panzeri, B. M. Pearson, J. Perea, P. Philippsen, A. Pierard, R. J. Planta, P. Plevani, B. Poetsch, F. Pohl, B. Purnelle, M. Ramezani Rad, S. W. Rasmussen, A. Raynal, M. Remacha, P. Richterich, A. B. Roberts, F. Rodriguez, E. Sanz, I. Schaaff-Gerstenschlager, B. Scherens, B. Schweitzer, Y. Shu, J. Skala, P. P. Slonimski, F. Sor, C. Soustelle, R. Spiegelberg, L. I. Stateva, H. Y. Steensma, S. Steiner, A. Thierry, G. Thireos, M. Tzermia, L. A. Urrestarazu, G. Valle, I. Vetter, J. C. van Vliet-Reedijk, M. Voet, G. Volckaert, P. Vreken, H. Wang, J. R. Warmington, D. von Wettstein, B. L. Wicksteed, C. Wilson, H. Wurst, G. Xu, A. Yoshikawa, F. K. Zimmermann, J. G. Sgouros, The complete DNA sequence of yeast chromosome III. Nature 357, 38–46 (1992). Medline doi:10.1038/357038a0
13. S. M. Richardson, S. J. Wheelan, R. M. Yarrington, J. D. Boeke, GeneDesign: rapid, automated design of multikilobase synthetic genes. Genome Res. 16, 550–556 (2006). Medline doi:10.1101/gr.4431306
14. W. P. Stemmer, A. Crameri, K. D. Ha, T. M. Brennan, H. L. Heyneker, Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides. Gene 164, 49–53 (1995). Medline doi:10.1016/0378-1119(95)00511-4
15. J. S. Dymond, L. Z. Scheifele, S. Richardson, P. Lee, S. Chandrasegaran, J. S. Bader, J. D. Boeke, Teaching synthetic biology, bioinformatics and engineering to
16. N. Annaluru, H. Muller, S. Ramalingam, K. Kandavelou, V. London, S. M. Richardson, J. S. Dymond, E. M. Cooper, J. S. Bader, J. D. Boeke, S. Chandrasegaran, Assembling DNA fragments by USER fusion. Methods Mol. Biol. 852, 77–95 (2012). Medline doi:10.1007/978-1-61779-564-0_7
17. D. G. Gibson, L. Young, R. Y. Chuang, J. C. Venter, C. A. Hutchison 3rd, H. O. Smith, Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343–345 (2009). Medline doi:10.1038/nmeth.1318
18. H. Ma, S. Kunes, P. J. Schatz, D. Botstein, Plasmid construction by homologous recombination in yeast. Gene 58, 201–216 (1987). Medline doi:10.1016/0378-1119(87)90376-3
19. V. Larionov, N. Kouprina, J. Graves, X. N. Chen, J. R. Korenberg, M. A. Resnick, Specific cloning of human DNA as yeast artificial chromosomes by transformation-associated recombination. Proc. Natl. Acad. Sci. U.S.A. 93, 491–496 (1996). Medline doi:10.1073/pnas.93.1.491
20. D. G. Gibson, G. A. Benders, K. C. Axelrod, J. Zaveri, M. A. Algire, M. Moodie, M. G. Montague, J. C. Venter, H. O. Smith, C. A. Hutchison 3rd, One-step assembly in yeast of 25 overlapping DNA fragments to form a complete synthetic Mycoplasma genitalium genome. Proc. Natl. Acad. Sci. U.S.A. 105, 20404–20409 (2008). Medline doi:10.1073/pnas.0811011106
21. H. Muller, N. Annaluru, J. W. Schwerzmann, S. M. Richardson, J. S. Dymond, E. M. Cooper, J. S. Bader, J. D. Boeke, S. Chandrasegaran, Assembling large DNA segments in yeast. Methods Mol. Biol. 852, 133–150 (2012). Medline doi:10.1007/978-1-61779-564-0_11
22. D. C. Schwartz, C. R. Cantor, Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell 37, 67–75 (1984). Medline doi:10.1016/0092-8674(84)90301-5
23. M. Lynch, W. Sung, K. Morris, N. Coffey, C. R. Landry, E. B. Dopman, W. J. Dickinson, K. Okamoto, S. Kulkarni, D. L. Hartl, W. K. Thomas, A genome-wide view of the spectrum of spontaneous mutations in yeast. Proc. Natl. Acad. Sci. U.S.A. 105, 9272–9277 (2008). Medline doi:10.1073/pnas.0803466105
24. K. W. Yuen, C. D. Warren, O. Chen, T. Kwok, P. Hieter, F. A. Spencer, Systematic genome instability screens in yeast and their potential relevance to cancer. Proc. Natl. Acad. Sci. U.S.A. 104, 3925–3930 (2007). Medline doi:10.1073/pnas.0610642104
25. C. D’Ambrosio, C. K. Schmidt, Y. Katou, G. Kelly, T. Itoh, K. Shirahige, F. Uhlmann, Identification of cis-acting sites for condensin loading onto budding yeast chromosomes. Genes Dev. 22, 2215–2227 (2008). Medline doi:10.1101/gad.1675708
26. A. Lengronne, Y. Katou, S. Mori, S. Yokobayashi, G. P. Kelly, T. Itoh, Y. Watanabe, K. Shirahige, F. Uhlmann, Cohesin relocation from sites of chromosomal loading
to places of convergent transcription. Nature 430, 573–578 (2004). Medline doi:10.1038/nature02742
27. S. Harashima, Y. Nogi, Y. Oshima, The genetic system controlling homothallism in Saccharomyces yeasts. Genetics 77, 639–650 (1974). Medline
28. J. N. Strathern, L. C. Blair, I. Herskowitz, Healing of mat mutations and control of mating type interconversion by the mating type locus in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U.S.A. 76, 3425–3429 (1979). Medline doi:10.1073/pnas.76.7.3425
29. K. A. Nasmyth, K. Tatchell, The structure of transposable yeast mating type loci. Cell 19, 753–764 (1980). Medline doi:10.1016/S0092-8674(80)80051-1
30. J. Abraham, K. A. Nasmyth, J. N. Strathern, A. J. Klar, J. B. Hicks, Regulation of mating-type information in yeast. Negative control requiring sequences both 5′ and 3′ to the regulated region. J. Mol. Biol. 176, 307–331 (1984). Medline doi:10.1016/0022-2836(84)90492-3
31. R. K. Mortimer, J. R. Johnston, Genealogy of principal strains of the yeast genetic stock center. Genetics 113, 35–43 (1986). Medline
32. M. C. Brandriss, L. Soll, D. Botstein, Recessive lethal amber suppressors in yeast. Genetics 79, 551–560 (1975). Medline
33. C. Baker Brachmann, A. Davies, G. J. Cost, E. Caputo, J. Li, P. Hieter, J. D. Boeke, Designer deletion strains derived from Saccharomyces cerevisiae S288C: A useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14, 115–132 (1998). Medline doi:10.1002/(SICI)1097-0061(19980130)14:2<115::AID-YEA204>3.0.CO;2-2
34. A. J. Klar, J. N. Strathern, J. B. Hicks, D. Prudente, Efficient production of a ring derivative of chromosome III by the mating-type switching mechanism in Saccharomyces cerevisiae. Mol. Cell. Biol. 3, 803–810 (1983). Medline
35. F. S. Dietrich, S. Voegeli, S. Brachat, A. Lerch, K. Gates, S. Steiner, C. Mohr, R. Pöhlmann, P. Luedi, S. Choi, R. A. Wing, A. Flavier, T. D. Gaffney, P. Philippsen, The Ashbya gossypii genome as a tool for mapping the ancient Saccharomyces cerevisiae genome. Science 304, 304–307 (2004); 10.1126/science.1095781. Medline doi:10.1126/science.1095781
36. A. Wach, A. Brachat, C. Alberti-Segui, C. Rebischung, P. Philippsen, Heterologous HIS3 marker and GFP reporter modules for PCR-targeting in Saccharomyces cerevisiae. Yeast 13, 1065–1075 (1997). Medline doi:10.1002/(SICI)1097-0061(19970915)13:11<1065::AID-YEA159>3.0.CO;2-K
37. C. A. Müller, C. A. Nieduszynski, Conservation of replication timing reveals global and local regulation of replication origin activity. Genome Res. 22, 1953–1962 (2012). Medline doi:10.1101/gr.139477.112
38. P. A. Lee, J. S. Dymond, L. Z. Scheifele, S. M. Richardson, K. J. Foelber, J. D. Boeke, J. S. Bader, CLONEQC: Lightweight sequence verification for synthetic
39. E. M. Cooper, H. Müller, S. Chandrasegaran, J. S. Bader, J. D. Boeke, The Build-a-Genome course. Methods Mol. Biol. 852, 273–283 (2012). Medline doi:10.1007/978-1-61779-564-0_20
40. D. G. Gibson, Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349–361 (2011). Medline doi:10.1016/B978-0-12-385120-8.00015-2
41. D. G. Gibson, Gene and genome construction in yeast. Curr. Protoc. Mol. Biol. Chapter 3, Unit3.22 (2011).
42. M. Lohse, A. M. Bolger, A. Nagel, A. R. Fernie, J. E. Lunn, M. Stitt, B. Usadel, RobiNA: A user-friendly, integrated software solution for RNA-Seq-based transcriptomics. Nucleic Acids Res. 40, W622–W627 (2012). Medline doi:10.1093/nar/gks540
43. C. Trapnell, L. Pachter, S. L. Salzberg, TopHat: Discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105–1111 (2009). Medline doi:10.1093/bioinformatics/btp120
44. S. Anders, HTSeq: Analysing high-throughput sequencing data with Python (2010).
45. S. Anders, W. Huber, Differential expression analysis for sequence count data. Genome Biol. 11, R106 (2010). Medline doi:10.1186/gb-2010-11-10-r106
46. D. L. Lindstrom, D. E. Gottschling, The mother enrichment program: A genetic system for facile replicative life span analysis in Saccharomyces cerevisiae. Genetics 183, 413–422 (2009). Medline doi:10.1534/genetics.109.106229
47. D. E. Lea, C. A. Coulson, The distribution of the numbers of mutants in bacterial populations. J. Genet. 49, 264–285 (1949). Medline doi:10.1007/BF02986080
48. N. Agier, O. M. Romano, F. Touzain, M. Cosentino Lagomarsino, G. Fischer, The spatiotemporal program of replication in the genome of Lachancea kluyveri. Genome Biol. Evol. 5, 370–388 (2013). Medline doi:10.1093/gbe/evt014
