Supported by a grant from the Alfred P. Sloan Foundation
What is the Urban Barcode Project (UBP)?
• An opportunity for NYC high school students “to do science” and compete for $20,000 in prizes.
• A chance to explore the living environment in NYC.
• A way to take part in a global effort to identify all living organisms.
What is DNA barcoding and why is it important?
?
ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG
Organism is sampled DNA is extracted “Barcode” amplified
Sequenced DNA is compared with a barcode database
How DNA barcoding works
Issue #1: No one knows how many species there are.
How many species can you name?How many Animals did you name?
How many mammals?How many plants?How many insects?
“Cat”Felis catus
“Dog”Canis lupus familiaris
“Oak Tree”Quercus alba
“Shark”Ginglymostoma cirratum
“Beetle”Popillia
japonica
• Currently between 1.5 and 2 million species are described/known
• This number may represent as little as a third of the true number of species
• Perhaps more than 1/3 of all species are threatened(IUCN Red list version
2010.1)
Vertebrates Species
Mammals 5,490
Birds 9,998
Reptiles 9,084
Amphibians 6,433
Fishes 31,300
Total 62,305
Invertebrates Species
Insects 1,000,000
Mollusks 85,00
Crustaceans 47,000
Corals 2,175
Arachnids 102,248
Total (+others) 1,305,250
Plants Species
Angiosperms 281,821
Gymnosperms 1,021
Ferns and Allies 12,000
Mosses 16,236
Algae 10,134
Total 321,212
Issue #2: There is a lack of agreement of what “species” means.
?
Canis lupus Canis lupus (familiaris)
Anas platyrhynchos
Defining “species” is complex and
depends on many factors:
• Interbreeding capabilities
• Morphological variation
• Ecological context
• Genetic similarities
Issue #3: Traditional taxonomic identification methods may be inadequate/too slowto capture vanishing biodiversity
Classical taxonomy is difficult for non-experts to understand
The body form ranges from hemispherical (e.g., Cleidostethus) to elongate oval (e.g., Clypastraea) to latridiid-like (e.g., Foadia). Corylophids are typically dull brown, but some species have contrasting yellowish-brown patches on the pronotum or elytra. The integument is often densely punctured and may be glabrous or bear short, fine recumbent setae. Most corylophid adults can be diagnosed using the following morphological features: Maxilla with single apical lobe; Mesotrochanter short and strongly oblique; Head usually covered by pronotum; Frontoclypeal suture absent; Antennae elongate with 3-segmented club; Procoxal cavities closed externally; Tarsal formula 4-4-4; Pygidium exposed
Adding to the complexity: immature, damaged or incomplete specimen may make identification impossible.
Classical taxonomy may call one species what it is actually many…
Issue #4: Education lacks opportunities to engage students in their own learning
DNA Barcoding is engaging in and outside of the classroom, and directs curiosity to opportunities for practical inquiry…
Kate Stoeckle
August 23, 2008
How will UBP work?
1. Students will convene in teams and design projects that use DNA barcoding to answer a question
Who can enter the competition?• Competition open to NYC high school students enrolled in grades 9–
12.
• Student teams consist of either 9th/10th graders or 11th/12th graders.
• Team members do not have to be from the same school.
• Teams of 2–4 students must be sponsored by a qualifying teacher who has completed a six-hour training session with the DNALC (see next slide).
• Sponsors do not have to be from the same school as any of the students on their team.
How does a sponsor qualify?
• Only science teachers currently employed by a private or public secondary school in NYC’s five boroughs can sponsor a team.
• A sponsor commits to overseeing her/his student team.
• Sponsors can work with up to five (5) student teams.
• Each team can have a maximum of four (4) students.
• Prospective sponsors must participate in a six-hour training workshop A $150 stipend is available for teachers participating in the training.
• Training events will be held at the Harlem DNA Lab on either
- Saturday, April 2, 2011 9:00am-3:00pm, or- Saturday, April 30 , 2011 9:00am-3:00pm, or- Saturday, May 14 , 2011 9:00am-3:00pm, or- Saturday, June 4 , 2011 9:00am-3:00pm.
• Prospective sponsors must r.s.v.p. on the UBP website for a training session.
What will sponsor training entail?1. Background information on DNA barcoding.
2. Project and lab safety training.
3. Training in all lab and bioinformatics procedures required to conduct DNA barcoding, including:1. DNA extraction from plant and animal tissues and food
sources;2. PCR amplification of DNA barcodes;3. Agarose gel electrophoresis;4. Submitting DNA barcodes to sequencing facilities;5. Analyzing DNA barcode sequences.
4. Assistance with proposal ideas and outlines
2. Student teams must submit a research/project proposal
Proposals will be accepted duringone of two submission periods
June 1-15, 2011 (Round I)
October 1-15, 2011 (Round II)
Proposals must be submitted onlineat the UBP website
www.urbanbarcodeproject.org
A research question can be about any living thing in NYC or about non-living things (foods or other products) that have
DNA.
• Are there invasive or non-native plants in my local park?
• What are the most popular types of flowers in NYC?
• Do the teas I buy at my supermarket really contain the ingredients on the package?
• How many different living organisms can I find in an office building?
• How many species of butterfly migrate through NYC?
What kind of research questions are acceptable?
Examples for research questions:
1. An introduction to the question, describing why your question is original, creative, and relevant. You should also have references to previous research, such as examples of DNA barcoding used to answer a similar question or examples relating to research on the specific organisms.
2. Explain the goal of your project, and what you plan to achieve.
3. Methods, including how samples will be collected and processed.
4. Safety and legality concerns, such as how any necessary permission will be secured.
5. Brief biographies of each team member.
Proposals will include, amongst other things:
3. If a proposal is accepted, the team becomes part of the UBP
and the research can begin
Collect Samples(Leaves, Insects,
Foods, etc. )
Do DNA Barcoding
Experiment
Get Results and Make
Conclusions
Project Workflow
Teams whose proposal is accepted will have access tothe materials needed for the DNA barcoding
component of their project:
• DNA extraction Kit
• PCR machine and reagents
• DNA sequencing
• Bioinformatic tools (analysis of DNA sequence)
The DNA barcoding equipment is safe and easy to use, and the experiments can be done in a few
hours
Materials and equipment are provided to participating teams…
• either by attending “Open Lab” days held in NYCat sites including:
- Harlem DNA Lab- New York Academy of Sciences
- American Museum of Natural History- The Rockefeller University
- Others (TBA)
• Or: by borrowing it from the UBP
Teams will have access to online tools to analyze their results
***Demo Blue Line***at
www.dnasubway.org
Every participating team will also be assigned ascientific mentor
Mentors will be drawn from NYC research institutionsand will help with technical issues
4. Finish your research, and present itat the UBP symposium in Spring 2012
Summary Details
1. Form a team of 2-4 NYC high school students and a qualifying science teacher (sponsor).
2. Develop a project proposal.
3. Go to www.urbanbarcodeproject.org and submit your proposal online by one of two deadlines.
4. Proposals will be judged for originality, creativity, relevance, plausibility, and scientific merit. The top teams from each round of submissions will be invited to compete in the Urban Barcode Project.
5. Invited competitors must complete their projects by Spring 2012 and present their work at a project symposium.
Follow us Online
www.facebook.com/urbanbarcodeproject
twitter.com/urbanbarcode
www.urbanbarcodeproject.org
Latest news and announcements posted first to: