Draft
Development of a recombinase polymerase amplification
assay for Vibrio parahaemolyticus detection with an internal
amplification control
Journal: Canadian Journal of Microbiology
Manuscript ID cjm-2017-0504.R2
Manuscript Type: Article
Date Submitted by the Author: 21-Dec-2017
Complete List of Authors: Yang, Huanlan; Jinan University, Department of Food Science &
Engineering Wei, Shuang; Guangdong Entry-Exit Inspection and Quarantine Bureau Gooneratne, Ravi; Lincoln University Faculty of Agriculture and Life Sciences, Department of Wine, Food and Molecular Biosciences, Faculty of Agriculture & Life Sciences Mutukumirad, Anthony N.; Massey University - Albany Campus Ma, Xuejun; Chinese Center for Disease Control and Prevention Tang, Shuze; Jinan University, Department of Food Science & Engineering Wu, Xiyang; Jinan University, Department of Food Science & Engineering
Is the invited manuscript for consideration in a Special
Issue? : N/A
Keyword: V. parahaemolyticus, internal amplification control, isothermal nucleic acid amplification, toxR, recombinase polymerase amplification
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
1
Development of a recombinase polymerase amplification assay 1 for Vibrio parahaemolyticus detection with an internal 2
amplification control 3 Huan-Lan Yang
a, Shuang Wei
b, Ravi Gooneratne
c, Anthony N Mutukumira
d, Xue-Jun 4
Mae, Shu-Ze Tang
a, Xi-Yang Wu
a* 5 6 a Department of Food Science & Engineering, Jinan University, Guangzhou, China, 510632 7
b Guangdong Entry-Exit Inspection and Quarantine Bureau, Guangzhou, China, 510632 8
c Centre for Food Research and Innovation, Department of Wine, Food and Molecular Biosciences, 9
Faculty of Agriculture & Life Sciences, Lincoln University, Christchurch 7647, New Zealand 10 d Massey Institute of Food Science and Technology, Institute of Food and Nutrition, Massey 11 University, Albany Campus, New Zealand 12 e Chinese Center for Disease Control and Prevention, Beijing, China, 102206
13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 --------------------------------------------------- 43 *Corresponding author: Professor Xi-Yang Wu, Department of Food Science & Engineering, Jinan 44 University, Guangzhou, China, 510632; Tel / Fax: +86-20-85220225 45 Email: [email protected] 46 47
Page 1 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
2
Abstract 48
A novel RPA-IAC assay using recombinase polymerase and an internal amplification 49
control (IAC) for Vibrio parahaemolyticus detection was developed. Specific primers 50
were designed based on the coding sequence (CDS) for the toxR gene in V. 51
parahaemolyticus. The recombinase polymerase amplification (RPA) reaction was 52
conducted at a constant low temperature of 37°C for 20 min. Assay specificity was 53
validated by using 63 Vibrio strains and 10 non-Vibrio bacterial species. In addition, a 54
competitive IAC was employed to avoid false-negative results, which co-amplified 55
simultaneously with the target sequence. The sensitivity of the assay was determined as 56
3×103 CFU/mL, which is decidedly more sensitive than the established PCR method. 57
This method was then used to test seafood samples which were collected from local 58
market. 7 out of 53 different raw seafoods were detected as V.p positive, which were 59
consistent with those obtained using traditional culturing method and biochemical assay. 60
This novel RPA-IAC assay provides a rapid, specific, sensitive and more convenient 61
detection method for V. parahaemolyticus. 62
Keywords: V. parahaemolyticus; internal amplification control; recombinase polymerase 63
amplification; isothermal nucleic acid amplification; toxR 64
65
66
67
68
69
70
Page 2 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
3
1. Introduction 71
The V. parahaemolyticus bacterium inhabits surface waters and estuarine ecosystems 72
of varying temperatures and salinities around the world, and it can be detected in a wide 73
range of raw and mishandled seafood. This pathogen is of increasing concern, and it is 74
now a leading cause of bacterial food poisonings in the coastal provinces of China (Croci 75
et al. 2007; Liu et al. 2012; Nilsson and Turner 2016; Robert-Pillot et al. 2014). Lai et al. 76
(2010) reported a total positive rate of V. parahaemolyticus in samples taken from the 77
Pearl River estuary district in Guangzhou, China at 34.10%, 47.50%, 27.27% and 51.11% 78
for aquatic products, water, mud and other environmental samples, respectively. 79
Conventional culture-based and biochemical-based methods for the detection of food-80
borne pathogens are laborious and time-consuming (normally requiring more than 3 days 81
to complete). The application of genetic-based bacteria identification is more rapid and 82
specific (Crannell et al. 2016). Various PCR methods for the detection of V. 83
parahaemolyticus have been reported (Kim et al. 1999; Lee et al. 1995), however, the 84
conventional PCR requires thermal cycling equipment, which is not suitable for field 85
application. Therefore, the development of a simple, sensitive, rapid method to detect V. 86
parahaemolyticus for field use is indicated. 87
A number of isothermal nucleic acid amplification methods that do not require the use 88
of thermal cycling equipment have emerged (Cao et al. 2015; Gill and Ghaemi 2008; 89
Asiello and Baeumner 2011). These platforms use a fixed temperature heater in place of a 90
thermal cycler. Examples of isothermal nucleic acid amplification techniques are the loop 91
mediated amplification (LAMP), helicase dependent amplification (HDA), strand-92
displacement amplification (SDA), and rolling circle amplification (RCA). Among these 93
Page 3 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
4
isothermal amplification platforms, recombinase polymerase amplification (RPA) 94
represents a PCR-like, simple and easy to use method. RPA uses bacterial recombinase 95
enzymes to anneal primers to a template DNA for extension and amplification using an 96
isothermal polymerase. The RPA reaction runs at a constant low temperature of 37-42°C 97
for less than 1h, and it is available in a lyophilized form that can be transported without 98
the need for cold chain storage (Crannell et al. 2015; Lillis et al. 2016). Unlike other 99
DNA isothermal technologies (e.g., LAMP, which uses 4–6 primer pairs in one reaction), 100
RPA employs a recombinase enzyme to direct only two primers to a homologous target 101
sequence in a DNA template (Jaroenram and Owens 2014; Nimitphak et al. 2008). 102
Moreover, RPA products can be easily detected by gel electrophoresis (Piepenburg et al. 103
2006) in real-time using TwistAmpTMexo probes (TwistDx, Cambridge, UK) (Euler et al. 104
2013) or a lateral flow dipstick (LFD) assay (Wu et al. 2016). The ability to amplify low 105
concentrations of DNA and RNA rapidly without complex instrumentation makes RPA a 106
suitable tool for use at the point of care in resource limited settings (RLS) (Lillis et al. 107
2016). So far, RPA assays have been used for the detection of Francisella tularensis 108
(Sabate et al. 2014), Ebola virus (Yang et al. 2016) and foodborne viruses (Moore and 109
Jaykus 2017). 110
IAC (Internal amplification control) has been widely used in PCR assays to achieve an 111
acceptable level of confidence due to the absence of false-negative results. These can be 112
caused by inhibitory substances in the sample matrix, incorrect mixing of reagents, poor 113
enzyme activity, and other unknown factors (Maaroufi et al. 2006). In a previous study, 114
the use of IAC in a multiplex PCR to detect four different Vibrio species in food samples 115
was described (Wei et al. 2014) 116
Page 4 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
5
In this study, an RPA-IAC assay that targets the toxR gene for the detection of V. 117
parahaemolyticus was developed. A competitive IAC was developed by inserting into a 118
plasmid for better control of stability, size and copy number. 119
2. Materials and Methods 120
2.1. Bacterial strains 121
The Vibrio strains used in this study were collected from clinical and environmental 122
samples (Table 1). They were generously provided by the Shantou Entry-Exit Inspection 123
and Quarantine Bureau (Shantou, China), and by the School of Agriculture and Biology, 124
Shanghai Jiaotong University (Shanghai, China). The remaining strains were obtained 125
from the Department of Food Science and Engineering, Jinan University (Guangzhou, 126
China). 127
2.2 DNA extraction 128
Vibrio strains were grown in LB broth (Hopebio, Qingdao, China) containing 3% NaCl, 129
and the other bacterial strains were grown in Brain Heart Infusion Broth (BHI; Hopebio). 130
All cultures were grown aerobically at 37°C. DNA was extracted and purified using the 131
TIANamp Bacteria DNA Kit (Tiangen Biotech Co., Ltd., Beijing, China). The 132
concentration and the purity of extracted DNA were quantified using a Nano-Drop ND-133
1000 spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE, USA), and the 134
DNA samples were stored at -20°C before use. 135
2.3 Target genes and primer design 136
RPA was based on amplification of the toxR gene from V. parahaemolyticus (GenBank 137
ID: AB029908). The specific primers were designed according to the TwistAmpTM 138
reaction kit manual. The primers were modified using Primer Premier V5.0 software 139
Page 5 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
6
(Premier Biosoft International, Palo Alto, CA, USA) to maintain minimal mutual 140
interference among the different primers, and they were successfully checked for relevant 141
homologies by a BLAST search. All the oligonucleotide primers were purchased from 142
Sangon Biotech (Shanghai, China). 143
2.4 Construction of the IAC 144
The IAC was constructed based on methods previously reported (Abdulmawjood et al. 145
2002; Liu et al. 2012), with some modifications. An internal portion of the V. 146
parahaemolyticus genome, identified as CP011406, which was not homologous with the 147
target gene, was amplified by the YXF/R primer pair (Wei et al. 2014). Then, the 148
CP011406 gene was amplified by PCR using the long chimeric primers IACF/R. The 3’ 149
end sequences of IACF/R corresponded to the YXF/R primer set. Moreover, the 5’ 150
hanging end sequences of IACF/R corresponded to the F14/R14 primer set (Figure 1). 151
The PCR conditions were: 94 °C for 5 min, followed by 30 cycles of 94 °C for 30 s, 152
57 °C for 30 s and 72 °C for 60 s, and a final step at 72 °C for 10 min. The PCR product, 153
including the flanking regions of the target primer set, was cloned into a Mach1-T1 154
vector (Transgen, Beijing, China) and then transformed into a Trans1-T1 Phage Resistant 155
Chemically Competent Cell (Transgen, Beijing, China). The recombinant plasmid 156
(pYHL-1) was confirmed by DNA sequencing. 157
2.5 RPA-IAC assay 158
The RPA assay was carried out using the TwistAmp Basic kit (TwistDX, Cambridge, 159
UK). A typical RPA reaction in a 50 µL volume contained 100 ng of DNA templates, 0.5 160
M betaine, 480 nM of RPA primers F/R14, 1x rehydration buffer and 2 µL of 8.6×103 161
copies of internal amplification control plasmid pYHL-1. This master mix was used to 162
Page 6 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
7
rehydrate the freeze-dried reaction pellet, and 14 mM magnesium acetate was added to 163
the solution to initiate the reaction. The reaction was performed in a dry block heater 164
(Botong chemical Co., Ltd., Shanghai, China) at 37 °C. To optimize the reaction time, the 165
RPA-IAC assay was amplified for different periods of time (10, 20, 30, 40, 50, 60, 80 and 166
100 min). The assay was run in triplicate each length of time. The RPA products were 167
separated by 2% agarose gel electrophoresis, and stained with Goldview Nucleic Acid 168
Stain (Ding guo chang sheng Biotechnology, Beijing, China). DNA in the gel was 169
visualized by exposure to UV light and photographed with a digital capture system 170
(Tanon, Shanghai, China). The density of the bands was measured by Quantity One 171
software (BioRad). DNA fragment sizes were estimated using a DL2,000 DNA Marker 172
(TaKaRa, Otsu, Japan). RPA products were further validated by DNA sequencing. 173
2.6 Specificity and sensitivity test of RPA-IAC assay 174
The specificity of the RPA-IAC assay was evaluated using 63 Vibrio strains and 10 175
other bacterial species, while the sensitivity of the RPA-IAC assay was evaluated using 176
10-fold dilutions of the reference strain, ranging from 3×101-3×10
7 CFU/mL, and 8.6×10
3 177
copies of plasmid pYHL-1. Each strain dilution was plate counted followed by DNA 178
extraction. Each RPA-IAC assay was repeated three times. 179
2.7 Comparison with PCR detection techniques 180
The sensitivity of the newly developed RPA-IAC assay was compared with the 181
previously established, conventional PCR, which was also based on the toxR gene (Lee et 182
al. 2014). The PCR primers tox-F/R are listed in Table 2. 183
2.8 Application of RPA-IAC assay 184
Page 7 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
8
Fifty-three seafood samples, including shrimp, cuttlefish, clams and oyster, were 185
randomly selected from a seafood market in October in Guangzhou, China, which were 186
treated according to FDA’s Bacteriological Analytical Manual (The BAM) (Food and 187
Drug Administration, 2010). Briefly, a 50 g sample from each seafood was added to 450 188
ml PBS dilution water and blended for 1 min at 8,000 rpm. The homogenate was added to 189
alkaline peptone water (APW) and incubated overnight at 35±2°C. One milliliter from 190
each sample was analyzed using the RPA-IAC assay. The remainder of the incubated 191
APW was streaked onto thiosulfate citrate bile salts sucrose agar culture medium (TCBS) 192
(Hopebio, Qingdao, China) and incubated at 35±2°C overnight. All suspicious isolates 193
were purified and subjected to the biochemical identification. 194
195
3. Results 196
3.1 Primer design 197
The toxR gene encodes transmembrane proteins involved in the regulation of virulence 198
associated genes, and these are well conserved in the genus Vibrio (Matsumoto et al. 199
2000). By evaluating the specificity of the primers using on-line, a species specific CDS 200
(GenBank ID: AB029908) was selected as the target gene for V. parahaemolyticus. A 30-201
mer forward primer (F14: 5’-ACTCGTATGAGAACGTGACATTGCGTATTT-3’) and a 202
30-mer reverse primer (R14: 5’-TTGAACTCAGAAGGAGAAACAAGCAGGTAG-3’) 203
were then designed. Multiple alignments of F/R14 sequences and its phylogenetically 204
related reference species were constructed with the BioEdit program, as shown in Figure 205
2. 206
207
Page 8 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
9
3.2 RPA-IAC reaction time 208
The RPA-IAC amplicons with the expected size were visualized when the reaction 209
time was as brief as 20 min. The 331-bp amplicon of IAC can be easily distinguished 210
from the 426-bp target amplicon by gel electrophoresis. Quantity One software (Bio-Rad 211
Laboratories, Inc., USA), which was used to measure the density of the amplicon bands 212
on the gel, demonstrated that a longer reaction time (up to 40 min) could slightly increase 213
the yields. Notably, extending reaction time to 100 min reaction did not produce any 214
unspecific products and the amplicon yield was almost equal to that of the 40 min 215
reaction (Figure 3). To ensure the reaction performed rapidly, all RPA reactions were 216
performed for 20 min only. 217
3.3 Specificity and sensitivity of RPA-IAC assay 218
A total of 63 Vibrio strains, including V. parahaemolyticus (44), V. cholera (2), V. 219
alginolyticus (10) and V. vulnificus (5), V. mimicus (2) and 10 other non-Vibrio strains, 220
were tested using the RPA-IAC assay (Table 1). The IAC amplicon was apparent in all 221
strains tests (Figure 4), indicating that the IAC worked effectively. A 426-bp specific 222
band was only amplified in the V. parahaemolyticus strains. The results are summarized 223
in Table 1. The sensitivity V. parahaemolyticus was 3×103 CFU/mL (Figure 5). This 224
sensitivity was compared with the standard PCR by using the same templates at identical 225
concentrations. The sensitivity of the standard PCR was 3×104
CFU/mL for V. 226
parahaemolyticus, demonstrating that it is less sensitive than the RPA-IAC assay. 227
3.4 Application of the RPA-IAC assay 228
Fifty-three seafood samples, collected from local market, were used to detect the 229
presence of V. parahaemolyticus by the RPA-IAC assay. The RPA-IAC assay results 230
Page 9 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
10
indicated that 7 samples (13.2%) were V. parahaemolyticus positive, which was 231
consistent with the result of conventional culture method and biochemical test (as shown 232
in Table 3). 233
4. Discussion 234
In this study, a sensitive RPA-based assay to detect V. parahaemolyticus was developed, 235
while a competitive IAC was incorporated to indicate false-negative results. To our 236
knowledge, this is the first study of using RPA to detect V. parahaemolyticus with an IAC 237
to maximize detection accuracy. 238
The IAC has been proven to be an effective means to avoid false-negative results. 239
Daher et al. (2014) constructed an IAC in an RT-RPA to detect Group B Streptococci. 240
There are two ways to design an IAC - as a competitive or non-competitive unit. In other 241
studies, a non-competitive IAC with two pairs of PCR primers were complementary to 242
the target DNA and non-target DNA, respectively, were used to indicate inhibition 243
(Nordstrom et al. 2007; Wei et al. 2014). The disadvantage of a non-competitive IAC is 244
that both the IAC and the target gene are amplified under the same conditions, which may 245
be less efficient for one or both of these reactions (Hoorfar et al. 2004). However, a 246
competitive IAC can co-amplify simultaneously with the target sequence, and hence 247
effectively indicate false-negative results. Moreover, by using the competitive strategy, 248
both the target sequence and the IAC are amplified with one common set of primers 249
under the same conditions, which eliminates the risk of undesired interactions among 250
multiple primers and which may not become sub-efficient for one or both reactions after 251
optimization (Oikonomou et al. 2008). In this study, the target gene and the IAC were 252
easily differentiated by agarose gel electrophoresis due to differences in RPA product 253
Page 10 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
11
sizes. The optimal copies of IAC had no influence on the sensitivity of the assay. 254
Various factors may affect the identification of the results in this assay, and the 255
selection of the target gene and primer design are the two key steps. For example, the 16S 256
rRNA sequences of V. parahaemolyticus and V. alginolyticus are 99% identical, and 257
hence, not useful in differentiating between V. parahaemolyticus and V. alginolyticus 258
(Ruimy et al. 1994). Many target genes from V. parahaemolyticus have been reported, 259
such as dnaJ (Nhung et al. 2007), toxR (Lee et al. 2014), gyrB (Venkateswaran et al. 260
1998), pR72H (Lee et al. 1995), atpA (Izumiya et al. 2011), tdh, trh and tlh (Nordstrom et 261
al. 2007). However, the prevalence of tdh+ and trh+ genes in V. parahaemolyticus strains 262
in the environment appears to be very low (Rosec et al. 2009). In contrast, the toxR gene 263
is abundant in both clinical strains and environmental strains, and it has already been 264
confirmed as the marker gene for identification of V. parahaemolyticus (Kim et al. 1999). 265
Hence, the toxR gene was selected for use in this study. 266
One consideration with RPA is that primers for high or low GC content (>70% or 267
<30%, respectively) and mismatches at the 3'-end of the primer sequence reduce the 268
efficiency of RPA amplification. Moreover, since RPA functions at low and constant 269
temperature, which differs from conventional PCR, it is recommended one chooses target 270
regions with high mismatches to closely-related species (Daher et al. 2015). In this study, 271
the CDS of toxR shows distant homology and highly variable sequences from other 272
species based on sequence alignment. 273
The sensitivity of the RPA-IAC method in the present study was 3×103 CFU/mL, 274
which is comparable to the conventional PCR. It was observed that a longer amplification 275
time period did not significantly increase the sensitivity. The possible explanations for 276
Page 11 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
12
this are: 1. Inadequate recombinase polymerase or dNTPs in the reaction mix; 2. Primers 277
not perfectly designed; 3. Low resolution of agarose gel electrophoresis. Using a 278
fluorescent probe system for real time detection may largely enhance the sensitivity. 279
The limitation of this study is that it may not be ideal for field application. Evaluation 280
of the RPA-IAC assay using raw clinical samples and portable fluorescence detection 281
equipment or a lateral flow strip is required in the future to further advance this 282
methodology. Moreover, the use of a boiling method (Wang and Turechek 2016) instead 283
of a DNA extraction kit will be attempted for field application with a quicker time-to-284
result. 285
5. Conclusions 286
An RPA-IAC assay was developed which can be used as a rapid and specific assay for 287
the detection of V. parahaemolyticus. IAC played a significant role in the detection of 288
false-negative results. This method would be most helpful not only in food pathogen 289
detection and risk assessment but also in the rapid diagnosis of clinical samples and in 290
epidemiological studies. 291
292
Acknowledgements 293
This work was supported by the Science and Technology Project of Guangdong 294
Province (2015A050502030, 2016A050503031) and the Science and Technology 295
Planting Project of Guangdong Entry-Exit Inspection and Quarantine Bureau 296
(2017GDK48, 2015GDK27). We sincerely thank Dr. William Riley for critical reading 297
and reviewing of the manuscript. 298
Page 12 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
13
Conflict of interest 299
The authors declare that they have no conflicts of interest. 300
301
Reference: 302
Abdulmawjood A., et al. 2002. Two methods for construction of internal amplification controls for the detection of 303
Escherichia coli O157 by polymerase chain reaction. Molecular and Cellular Probes. 16(5): 335-339. 304
Asiello P J., and Baeumner A J. 2011. Miniaturized isothermal nucleic acid amplification, a review. Lab Chip. 11(8): 305
1420-1430. doi: 10.1039/c0lc00666a. 306
Cao D., et al. 2015. Real-time fluorescence Loop-Mediated Isothermal Amplification (LAMP) for rapid and reliable 307
diagnosis of pulmonary tuberculosis. Journal of Microbiological Methods. 109(2015): 74-78. doi: 308
10.1016/j.mimet.2014.12.013. 309
Crannell Z., et al. 2016. Multiplexed recombinase polymerase amplification assay to detect intestinal protozoa. 310
Analytical Chemistry. 88(3): 1610-1616. doi: 10.1021/acs.analchem.5b03267. 311
Crannell Z A., Cabada M M., Castellanos-Gonzalez A., Irani A., White A C., and Richards-Kortum R. 2015. 312
Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples. The American Journal of 313
Tropical Medicine and Hygiene. 92(3): 583-587. doi: 10.4269/ajtmh.14-0593. 314
Croci L., et al. 2007. Comparison of different biochemical and molecular methods for the identification of Vibrio 315
parahaemolyticus. Journal of Applied Microbiology. 102(1): 229-237. doi: 10.1111/j.1365-2672.2006.03046.x. 316
Daher R K., et al. 2015. Influence of sequence mismatches on the specificity of recombinase polymerase amplification 317
technology. Molecular and Cellular Probes. 29(2): 116-121. doi: 10.1016/j.mcp.2014.11.005. 318
Sabate J., Adly N Y., Sanchez J L., Henry O., and Sullivan C K. 2014. Electrochemical detection of Francisella 319
tularensis genomic DNA using solid-phase recombinase polymerase amplification. Biosensors and Bioelectronics. 320
54(8): 674-678. doi: 10.1016/j.bios.2013.11.03. 321
Euler M., et al. 2013. Development of a panel of recombinase polymerase amplification assays for detection of 322
biothreat agents. Journal of clinical microbiology. 51(4): 1110-1117. doi: 10.1128/JCM.02704-12. 323
Food and Drug Administration. 2010. Bacteriological analytical manual [online]. Available from 324
https://www.fda.gov/Food/FoodScienceResearch/LaboratoryMethods/ucm2006949.htm. 325
Gill P., and Ghaemi A. 2008. Nucleic acid isothermal amplification technologies: a review. Nucleosides Nucleotides 326
and Nucleic Acids. 27(3): 224-243. doi: 10.1080/15257770701845204. 327
Hoorfar J., et al. 2004. Practical considerations in design of internal amplification controls for diagnostic PCR assays. 328
Page 13 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
14
Journal of Clinical Microbiology. 42(5): 1863-1868. doi: 10.1128/jcm.42.5.1863-1868.2004. 329
Izumiya H., et al. 2011. Multiplex PCR assay for identification of three major pathogenic Vibrio spp., Vibrio cholerae, 330
Vibrio parahaemolyticus, and Vibrio vulnificus. Molecular and Cellular Probes. 25(4): 174-176. doi: 331
10.1016/j.mcp.2011.04.004. 332
Jaroenram W., and Owens L. 2014. Recombinase polymerase amplification combined with a lateral flow dipstick for 333
discriminating between infectious Penaeus stylirostris densovirus and virus-related sequences in shrimp genome. 334
Journal of Virological Methods. 208: 144-151. doi: 10.1016/j.jviromet.2014.08.006. 335
Kim Y., et al. 1999. Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted to the toxR 336
Gene. Journal of Clinical Microbiology. 37(4): 1173-1177. 337
Lai X., et al. 2010. Research of Vibrio parahaemolyticus of aquatic products and environment in the Pearl River estuary. 338
Journal of Tropical Medicine. 10(6): 715-718. 339
Lee C., et al. 1995. Sequence of a cloned pR72H fragmen and its use for detection of Vibrio parahaemolyticus in 340
shellfish with the PCR. Applied and Environmental Microbiology. 61(4): 1311-1317. 341
Lee N., et al. 2014. A multiplex PCR assay for simultaneous detection of Escherichia coli O157:H7, Bacillus cereus, 342
Vibrio parahaemolyticus, Salmonella spp., Listeria monocytogenes, and Staphylococcus aureus in Korean ready-to-eat 343
food. Foodborne Pathogens and Disease. 11(7): 574-580. doi: 10.1089/fpd.2013.1638. 344
Lillis L., et al. 2016. Factors influencing Recombinase polymerase amplification (RPA) assay outcomes at point of care. 345
Molecular and Cellular Probes. 30(2): 74-78. doi: 10.1016/j.mcp.2016.01.009. 346
Liu B., et al. 2012. Development of a real time PCR assay for rapid detection of Vibrio parahaemolyticus from seafood. 347
Protein Cell. 3(3): 204-212. doi: 10.1007/s13238-012-2017-6. 348
Maaroufi Y., et al. 2006. Development of a multiple internal control for clinical diagnostic real-time amplification 349
assays. FEMS Immunology and Medical Microbiology. 48(2): 183-191. doi: 10.1111/j.1574-695X.2006.00125.x. 350
Matsumoto C., et al. 2000. Pandemic spread of an O3:K6 clone of Vibrio parahaemolyticus and emergence of related 351
strains evidenced by arbitrarily primed PCR and toxRS sequence analyses. Journal of Clinical Microbiology. 38(2): 352
578-585. 353
Moore M D., and Jaykus L A. 2017. Development of a recombinase polymerase amplification assay for detection of 354
epidemic human Noroviruses. Scientific Reports. 7: 40244. doi: 10.1038/srep40244. 355
Nhung P H., et al. 2007. Rapid and specific identification of 5 human pathogenic Vibrio species by multiplex 356
polymerase chain reaction targeted to dnaJ gene. Diagnostic Microbiology and Infectious Disease. 59(3): 271-275. doi: 357
10.1016/j.diagmicrobio.2007.05.016. 358
Nilsson W B., and Turner J W. 2016. The thermostable direct hemolysin-related hemolysin (trh) gene of Vibrio 359
Page 14 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
15
parahaemolyticus:sequence variation and implications for detection and function. Journal of Microbiological Methods. 360
126(2016): 1-7. doi: 10.1016/j.mimet.2016.04.007. 361
Nimitphak T., et al. 2008. Shrimp hepatopancreatic Parvovirus detection by combining Loop-mediated isothermal 362
amplification with a lateral flow dipstick. Jounal of Virological Methods. 154(1): 56-60. doi: 363
10.1016/j.jviromet.2008.09.003. 364
Nordstrom J L., et al. 2007. Development of a multiplex real-time PCR assay with an internal amplification control for 365
the detection of total and pathogenic Vibrio parahaemolyticus bacteria in oysters. Applied and Environmental 366
Microbiology. 73(18): 5840-5847. doi: 10.1128/AEM.00460-07. 367
Oikonomou I., et al. 2008. Selective PCR: a novel internal amplification control strategy for enhanced sensitivity in 368
Salmonella diagnosis. Letters in Applied Microbiology. 46(4): 456-461. doi: 10.1111/j.1472-765X.2008.02340.x. 369
Piepenburg O., et al. 2006. DNA detection using recombination proteins. PloS Biology. 4(7): 1115-1121. doi: 370
10.1371/journal.pbio.0040204. 371
Robert-Pillot A., Copin S., Himber C., Gay M and Quilici M L. 2014. Occurrence of the three major Vibrio species 372
pathogenic for human in seafood products consumed in France using real-time PCR. International Journal of Food 373
Microbiology. 189(2014): 75-81. doi: 10.1016/j.ijfoodmicro.2014.07.014. 374
Rosec J P, et al. 2009. Detection of total and pathogenic Vibrio parahaemolyticus in shellfish: comparison of PCR 375
protocols using pR72H or toxR targets with a culture method. International Journal of Food Microbiology. 129(2): 136-376
145. doi: 10.1016/j.ijfoodmicro.2008.11.017. 377
Ruimy R., et al. 1994. Phylogenetic analysis and assessment of the genera Vibrio, Photobacterium, Aeromonas, and 378
Plesiomonas deduced from small-subunit rRNA sequences. International Jounal of Systematic Bacteriology. 44(3): 379
416-426. doi: 10.1099/00207713-44-3-416. 380
Venkateswaran K., et al. 1998. Cloning and nucleotide sequence of the gyrB gene of Vibrio parahaemolyticus and its 381
application in detection of this pathogen in shrimp. Applied and Environmental Microbiology. 64(2): 681-687. 382
Wang H., and Turechek W W. 2016. A Loop-mediated isothermal amplification assay and sample preparation procedure 383
for sensitive detection of xanthomonas fragariae in strawberry. Plos One. 11(1):1007-1013. doi: 384
10.1016/10.1371/journal.pone.0147122. 385
Wei S., et al. 2014. Multiplex PCR assays for the detection of Vibrio alginolyticus, Vibrio parahaemolyticus, Vibrio 386
vulnificus, and Vibrio cholerae with an internal amplification control. Diagnostic Microbiology and Infectious Disease. 387
79(2): 115-118. doi: 10.1016/j.diagmicrobio.2014.03.012. 388
Wu Y D., et al. 2016. Recombinase polymerase amplification (RPA) combined with lateral flow (LF) strip for 389
equipment-free detection of Cryptosporidium spp. oocysts in dairy cattle feces. Parasitology Research. 115(9): 3551-390
Page 15 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
16
3555. doi: 10.1007/s00436-016-5120-4. 391
Yang M., et al. 2016. Development and evaluation of a rapid and sensitive EBOV-RPA test for rapid diagnosis of Ebola 392
Virus disease. Scientific Reports. 6: 26943. doi: 10.1038/srep26943. 393
394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430
Page 16 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
17
Figure 1 Schematic for the construction of IAC. 431
432
Figure 2 Alignment of primer F/R 14 with homologous target sequences in the genus 433
Vibrio, obtained from GenBank. Dots represent consensus with F14 (1) or R14 (2) 434
sequence. 435
436
Figure 3 Comparison of RPA-IAC amplicon yield at different reaction times. The data 437
were obtained from triplicate experiments. 438
439
Figure 4 Specificity test of RPA-IAC assay. M, molecular weight marker; lane 1, V. 440
parahaemolyticus; lane 2, V. alginolyticus; lane 3, V. mimicus; lane 4, V. vulnificus; lane 5, 441
V. cholera; lane 6, Enterobacter sakazakii; lane 7, E.coli; lane 8 Staphylococcus aureus; 442
lane 9, Bacillus subtilis; lane 10, Lactobacillus planetarium; lane 11, blank control. 443
444
Figure 5 Detection sensitivity for V. parahaemolyticususing primer set F/R 14. The 445
concentration of V. parahaemolyticus varied from 3×101 3×10
7 CFU/mL. M, molecular 446
weight marker; lane 1, 3×107 CFU/mL; lane 2, 3×10
6 CFU/mL; lane 3, 3×10
5 CFU/mL; 447
lane 4, 3×104
CFU/mL; lane 5 3×103 CFU/mL; lane 6, 3×10
2 CFU/mL; lane 7, 448
3×101CFU/mL; lane 8, blank control. 449
Page 17 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Table 1 Bacterial strains used and the detection results
Species Source, strain (No.) RPA-IAC detection
V.p IAC
V. parahaemolyticus Ref. ATCC17802 (1) + +
Env. Shantou, China (1) + +
Clin. Shanghai, China (2) + +
Env. Chaozhou, China (7)
Env. Shenzhen, China (1)
Env. Zhanjiang, China (3)
Env. Zhangzhou, China (1)
Env. Raoping, China (1)
Env. Beihai, China (1)
Env. Guangzhou, China (13)
+
+
+
+
+
+
+
+
+
+
+
+
+
+
O1 Env. Guangzhou, China (3) + +
O2
O3
O4
O6
Env. Guangzhou, China (1)
Env. Guangzhou, China (1)
Env. Guangzhou, China (1)
Env. Guangzhou, China (1)
+
+
+
+
+
+
+
+
O8 Env. Guangzhou, China (2) + +
O9 Env. Guangzhou, China (2) + +
O10 Env. Guangzhou, China (1) + +
O11 Env. Guangzhou, China (1) + +
V. alginolyticus Ref. ATCC 17749 (1) - +
Env. Chaozhou, China (1) - +
Env. Guangzhou, China (5)
Env. Macau, China (1)
Env. Shenzhen, China (1)
Env. Zhanjiang, China (1)
-
-
-
-
+
+
+
+
V. mimicus Env. Chaozhou, China (1)
Ref. ATCC 33653 (1)
-
-
+
+
V. vulnificus Env. Shantou, China (2)
Ref. CMGCC 1.1758 (1)
-
-
+
+
Env. Shantou, China (2) - +
V. cholera
Enterobacter sakazakii
Escherichia. coli
Env. Shantou, China (2)
Ref. ATCC 29544 (2)
Env. Guangzhou, China (2)
-
-
-
+
+
+
Staphylococcus aureus Env. Guangzhou, China (2) - +
Bacillus subtilis Env. Guangzhou, China (2) - +
Lactobacillus planetarium Env. Guangzhou, China (2) - +
Note: Ref. Reference strains; Env. Environmental strains; Clin. Clinical strains.
Page 18 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Table 2 Sequences of primers utilized
Names Sequences (5'-3') Product
size
Reference
14F ACTCGTATGAGAACGTGACATTGCGTATTT 426bp This study
14R TTGAACTCAGAAGGAGAAACAAGCAGGTAG
YXF GAAAGTTGAACATCATCAGCACGA 271bp (Wei, et al.
2014) YXR GGTCAGAATCAAACGCCG
IACF ACTCGTATGAGAACGTGACATTGCGTATTTGAA
AGTTGAACATCATCAGCACGA
331bp
375bp
This study
(Lee, et
al., 2014)
IACR
tox-F
tox-R
TTGAACTCAGAAGGAGAAACAAGCAGGTAGGG
TCAGAATCAAACGCCG
TCATTTGTACTGTTGAACGCCTA
AATAGAAGGCAACCAGTTGTTGAT
Page 19 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Table 3 Detection of seafood samples using RPA-IAC assay and traditional culture
method
P*: positive results N*: negative results
Food Number Traditional culture (P*/N*) RPA-IAC(P*/N*)
Shrimp 12 1/11 1/11
Cuttlefish 17 2/15 2/15
Clams 8 1/7 1/7
Oyester 16 3/13 3/13
Total 53 7/46 7/46
Page 20 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Figure 1 Schematic for the construction of IAC.
54x34mm (300 x 300 DPI)
Page 21 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Figure 2 Alignment of primer F/R 14 with homologous target sequences in the genus Vibrio, obtained from GenBank. Dots represent consensus with F14 (1) or R14 (2) sequence.
75x32mm (300 x 300 DPI)
Page 22 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Figure 3 Comparison of RPA-IAC amplicon yield at different reaction times. The data were obtained from triplicate experiments.
80x44mm (300 x 300 DPI)
Page 23 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Figure 4 Specificity test of RPA-IAC assay. M, molecular weight marker; lane 1, V. parahaemolyticus; lane 2, V. alginolyticus; lane 3, V. mimicus; lane 4, V. vulnificus; lane 5, V. cholera; lane 6, Enterobacter sakazakii; lane 7, E.coli; lane 8 Staphylococcus aureus; lane 9, Bacillus subtilis; lane 10, Lactobacillus planetarium;
lane 11, blank control.
80x54mm (300 x 300 DPI)
Page 24 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology
Draft
Figure 5 Detection sensitivity for V. parahaemolyticususing primer set F/R 14. The concentration of V. parahaemolyticus varied from 3×101 3×107 CFU/mL. M, molecular weight marker; lane 1, 3×107 CFU/mL; lane 2, 3×106 CFU/mL; lane 3, 3×105 CFU/mL; lane 4, 3×104 CFU/mL; lane 5 3×103 CFU/mL; lane 6,
3×102 CFU/mL; lane 7, 3×101CFU/mL; lane 8, blank control.
66x55mm (300 x 300 DPI)
Page 25 of 25
https://mc06.manuscriptcentral.com/cjm-pubs
Canadian Journal of Microbiology