BioOne sees sustainable scholarly publishing as an inherently collaborative enterprise connecting authors, nonprofit publishers, academic institutions, researchlibraries, and research funders in the common goal of maximizing access to critical research.

Systematics of the Neotropical Blueberry Genus Disterigma (Ericaceae)Author(s): Paola Pedraza-PeñalosaSource: Systematic Botany, 34(2):406-413. 2009.Published By: The American Society of Plant TaxonomistsURL: http://www.bioone.org/doi/full/10.1600/036364409788606352

BioOne (www.bioone.org) is a nonprofit, online aggregation of core research in the biological, ecological, andenvironmental sciences. BioOne provides a sustainable online platform for over 170 journals and books publishedby nonprofit societies, associations, museums, institutions, and presses.

Your use of this PDF, the BioOne Web site, and all posted and associated content indicates your acceptance ofBioOne’s Terms of Use, available at www.bioone.org/page/terms_of_use.

Usage of BioOne content is strictly limited to personal, educational, and non-commercial use. Commercial inquiriesor rights and permissions requests should be directed to the individual publisher as copyright holder.

Systematic Botany (2009), 34(2): pp. 406–413© Copyright 2009 by the American Society of Plant Taxonomists

406

Disterigma s. l. (Klotzsch) Nied. is a genus of 37 species of small shrubs that grow in humid and relatively cold montane ecosystems in Central and South America, principally in the cloud forests and páramos, above 2,000 m. A few species of Disterigma are widespread, many are endemics, and the great majority of them have restricted altitudinal ranges ( Pedraza-Peñalosa 2008a , in press).

Disterigma belongs to the inferior-ovaried tribe Vaccinieae ( Kron et al. 2002a ) and was first described ( Klotzsch 1851 ) as a subgenus of Vaccinium L. characterized by its persistent leaves, one to three axillary flowers, 4-lobed tubular or conical corollas, anthers without spurs, and a distinctive pair of brac-teoles embracing the calyx. Ever since Disterigma was elevated to generic rank ( Niedenzu 1889 ), its phylogenetic affinities have been poorly understood, and as the number of recog-nized species almost tripled after the taxonomic revision of Smith (1933 ), who accepted 15 species, the characters that dis-tinguish Disterigma from other Vaccinieae became less clear. Moreover, morphologically divergent species, often called “isolated” (e.g. D. rimbachii ), were included within Disterigma , whereas other species without atypical morphological char-acters were transferred into new genera [e.g. Metagonia alater-noides (Kunth) Nutt.].

The notion that the morphological circumscription of Disterigma was too wide and that the genus might not be a monophyletic group was supported by preliminary molec-ular analyses including few representatives of the genus. The analysis of molecular data of Vaccinieae in a worldwide basis ( Kron et al. 2002b ) found that two of the three species of Disterigma studied were placed within the large Andean clade, which contained the majority of the neotropical species tested. The third taxon included in their study, the Panamanian D. trimerum , was resolved within the sister group of the Andean clade, the Caribbean/Mesoamerican clade, along with the Central American Vaccinium poasanum ; none of the other Vaccinium sampled were placed in the Andean clade. In a later analysis, focused on Andean Vaccinieae also using parsimony and nuclear and plastid sequence data ( Powell and Kron 2003 ), five species of Disterigma from Central and South America were included. There, Disterigma had three origins with D. trimerum placed again within the Caribbean/Mesoamerican clade (99% bootstrap), while the other four species were found within the Andean clade. Disterigma rim-bachii was resolved at the base of a clade containing species of

Sphyrospermum Poepp. & Endl., sister to a clade formed by the remaining D. alaternoides , D. pernettyoides, and D. ovatum .

Consequently, the significance of the characters that sepa-rate Disterigma from Vaccinium and other Vaccinieae, namely the presence of a pair of bracteoles at the apex of the pedicel that envelop the calyx, has been challenged. As for the new relationship between Disterigma and Sphyrospermum sug-gested by the molecular evidence ( Powell and Kron 2003 ), it is not well supported (< 50% bootstrap) and it is hard to find putative morphological synapomorphies that fully explain it as the two genera are very different (see discussion).

Therefore, this study addresses the monophyly of Disterigmaand its placement within Vaccinieae using nuclear and plas-tid molecular data. By including almost all described species within the genus, this paper leads to a clearer picture of the circumscription of Disterigma and its relationships.

Materials and Methods

Taxonomic Sampling— A total of 85 terminals corresponding to 79 spe-cies and 13 genera of neotropical Vaccinieae were analyzed (Appendix 1); the sampling represents the geographic and morphological variation of Andean Vaccinieae and has emphasis on the ingroup, Disterigma s. l. Twenty-nine (out of 37) of the currently recognized species of Disterigmas. l. were included, along with two undescribed taxa for a total of 31 spe-cies. Morphologically variable species were broken down into OTU’s as follows: five OTUs for widespread D. humboldtii (four from South America, one from Central America), two for D. noyesiae (from Colombia and Ecuador), and two for D. acuminatum (from Central and Southern Colombia; Appendix 1). The outgroup includes 48 species and 12 genera that represent the Caribbean/Mesoamerican and Andean clades, which are the two major groups that the New World Vaccinieae formed in a worldwide based phylogenetic analysis of the tribe ( Kron et al. 2002b ); none of the members of Disterigma s. l. analyzed in this worldwide study were found outside these clades. In this study the trees were rooted with Symphysia racemosa, which has been found to be sister to the Caribbean/Mesoamerican and Andean clades ( Kron et al. 2002b ).

Leaf material and herbarium specimens were obtained during exten-sive fieldwork in Bolivia (Convenio NY-LPB 2005), Colombia (DTSA 033 SFF Galeras y otros; Acceso a Recursos Genéticos Res. 734 de 30 de Abril de 2007), Ecuador (021-IC-FLO-DBAP-MA), Panama (STRI 2002), and Peru (35–2005-INRENA-IFFS-DCB). Additional leaf material came from the greenhouses of The Royal Botanical Garden of Edinburgh and The New York Botanical Garden.

DNA Extraction and Sequencing— Total genomic DNA was extracted from silica-dried leaves and it was later purified using Qiagen products (Valencia, California). When necessary, DNA was extracted from nonal-cohol-treated and recently collected herbarium specimens; these DNA extractions were not very successful as only partial amplifications were obtained for some regions.

Systematics of the Neotropical Blueberry Genus Disterigma (Ericaceae)

Paola Pedraza-Peñalosa

New York Botanical Garden, 200th Street and Kazimiroff Boulevard, Bronx, New York 10458 U. S. A. Author for correspondence (ppedraza@nybg.org )

Communicating Editor: Lena Struwe

Abstract—Disterigma s. l. comprises 37 species of small shrubs found in Central and South America, mostly in cloud forests and páramos. The notion that the morphological circumscription of Disterigma s. l. is too wide and that it may not be a monophyletic group was supported by recent molecular evidence extracted from only a few species of Disterigma . This study addresses the monophyly and position of Disterigmas. l. within the complex blueberry tribe Vaccinieae through an intensive taxon sampling. Seventy-nine species are sampled, including 84% of the species of Disterigma s. l. and 13 genera of neotropical Vaccinieae. The parsimony analysis of nrITS and ndhF data reveal that Disterigma s. l. is polyphyletic with three independent origins within Vaccinieae. The majority of the species form a well supported monophyletic group, Disterigma s. s., which is located within a large Andean clade; all Disterigma s. s. species share the presence of a differentiated pair of apical brac-teoles. Segregated from Disterigma s. s., but also Andean in origin, is the novel Central Andes Segregated Disterigma clade, where D. bracteatum , D. pentandrum , D. rimbachii , and D. ulei are found. Also resolved outside of Disterigma s. s. is D. trimerum, a taxon of Mesoamerican origin.

Keywords—Disterigma , Ericaceae , molecular data , Neotropics , phylogeny , Vaccinieae.

2009] PEDRAZA-PEÑALOSA: SYSTEMATICS OF THE BLUEBERRY DISTERIGMA 407

A combination of nuclear (nrITS, ca. 639 bp) and plastid (5′ end of ndhF , ca. 1,244 bp) markers were selected according to their estimated num-ber of phylogenetically informative characters (PICs), aligned length, and descriptive tree statistics obtained in previous analyses of Vaccinieae ( Kron et al. 2002b ; Powell and Kron 2003 ) and in exploratory assays for this study. Complete sequences of ndhF (ca. 1,910 bp) were obtained for many of the newly sequenced species, but since the 3′ end of ndhF is not available for outgroup taxa (missing in more than 20% of the species here analyzed), the 3′ end of ndhF was removed from the matrix. Missing data in the matrix represent 1.19% of the cells.

The primers used for nrITS are; 18S-F: CCTTATCATTTAGAGGAAGGAG, 5.8S-32F: GCATCGATGAAGAACGTAGC, 26S-25R: TATGCTTAAAYTCAGCGGGT, and 5.8S-32R: GCTACGTTCTTCATCGATGC. The prim-ers used for ndhF , including newly designed ones, are; 1F: ATGGAACAKACATATSAATATGC, 450F (new): ACAAGGCCTGTTGCAGCAAG, 477F (new): CTGTTGCAGCAAGTGCTTGTCAA, 972F: GTCTCAATTGGGTTATATGATG, 1318F: GGATTAACYGCATTTTATATGTTTCG, 1347F (new): TGTTTCGAATCTATTTACTTACC, 536R: TCCCCTACACGATTAGTTACAA, 1318R: CGAAACATATAAAATGCRGTTAATCC, 1603R : GCATAGTATTGTCCGATTCATRAGG, 1955R : CGATTATATGACCAATCATATT , and 1974R (new): ATGACCAATCATATTTGATAC. The DNA amplifications followed modified standard methods ( Clark 1997 ) and when difficult amplifications arose, the PCR step-up approach was effec-tive ( Hillis et al. 1996 ). The material was sequenced on an ABI 377 XL auto-mated sequencer or on a 3730xl Capillary DNA Analyzer. Sequences were edited with Sequencher 4.5 (Gene Codes Corporation, Ann Arbor).

A total of 80 sequences were generated for this study, corresponding to 40 species. Two unpublished sequences (one species) were kindly pro-vided by Dr. K. Kron and were prepared at Wake Forest University. The remaining sequences were obtained from Genbank.

Analytical Methods— The combined analysis of all data partitions provides the greatest possible explanatory power, and therefore it is pre-ferred over individual analyses ( Donoghue and Sanderson 1992 ; Nixon and Carpenter 1996 ). Nevertheless, each marker was separately analyzed to find possible problematic taxa or characters, alignment problems, or incongruence. The multiple alignment was produced with CLUSTAL X ( Thompson et al. 1997 ) with GO and GE values 1, DNA Transition Weight 0, Delay Divergent Sequences 30% (default), and the Clustal W (1.6) DNA Weight Matrix. The matrix was deposited in TreeBASE (Study number S2155).

The tree search was conducted using the Willi Hennig Society edition of TNT ( Goloboff et al. 2000 ) with the following parameters: 1,000 replicates, 10 trees per rep, TBR mult*max*; Bremer subopt 20; jackknife 1,000 reps, 1 random taxa entry, 10 trees saved per rep. Indels were coded as a fifth state and all characters were equally weighted. Node support was evalu-ated with Bremer support, or decay index ( Bremer 1994 ) and jackknife analyses ( Farris et al. 1996 ). Outgroup and ingroup taxa were simultane-ously analyzed.

Results

The individual analyses of nrITS and ndhF sequence data from 79 species of Vaccinieae are in agreement, but both have limited resolution; in both cases, the great majority of the spe-cies form a well supported Andean clade (trees not shown). Moreover, both markers coincide in recovering a monophyl-etic group within the Andean clade containing the majority of the species of Disterigma , and from which D. bracteatum , D. pentandrum , D. rimbachii , D. ulei , and, D. trimerum are excluded. When nrITS and ndhF are combined the same gen-eral pattern is recovered, but the resolution visibly improves and the support values grow or remain about the same ( Fig. 1 ). The following discussion regarding the position of Disterigma s. l. within Vaccinieae will refer to the combined molecular tree. Because Disterigma s. l. is the subject of this study, only the findings connected with the genus and closely related genera will be discussed at the moment.

The combined molecular analysis retrieved 36 most parsi-monious trees (MPT) 947 steps long (CI = 0.47, RI = 0.78). The strict consensus tree shows a polyphyletic Disterigma s. l. with elements of both Andean and Mesoamerican origin ( Fig. 1 ). As previously found in studies of Vaccinieae on a worldwide

basis and of the Andean clade ( Kron et al. 2002b ; Powell and Kron 2003 ), the Central American D. trimerum is placed with high support (99% jackknife; 11 Bremer [herein support is always presented with jackknife followed by Bremer support]) within Mesoamerican elements in a clade at the base of the Andean clade.

As for the species of Disterigma s.l within the Andean clade, they form two clades with independent origins ( Figs. 1 ,– 2 ). The larger of the two groups, Disterigma s. s., includes the type species of the genus ( D. empetrifolium ) and all but four of the Disterigma s. l. sampled. Disterigma s. s. is a strongly supported (96%;11) monophyletic group, sister to a clade of Sphyrospermum. The second group is composed by the rest of the South American species of Disterigma s. l. sampled: D. bracteatum , D. pentandrum , D. rimbachii , and D. ulei . All form a novel group, hereafter called the “Central Andes Segregated Disterigma clade”, along with a new undescribed species from Central Peru; the support for this group is not great (< 50%; 1), but its internal nodes are well supported (> 93%; 11).

The species of Sphyrospermum here sampled form a well supported monophyletic group (98%; 11) with well supported internal nodes. However, in this data set the support for the hypothesis of Sphyrospermum as the sister group of Disterigmas. s. is not strong (< 50%; 1) ( Fig. 2 ). The support for the Central Andes Segregated Disterigma clade as sister to Disterigma s. s. + Sphyrospermum (< 50%; 1) is also weak.

The monophyletic Disterigma s. s. includes 26 species in this analysis. Its internal resolution is rather limited and few major clades have moderate or high jackknife and Bremer support values ( Fig. 2 ).

Discussion

The Position of Disterigma s. l. within Vaccinieae— The basal nodes of the Andean clade are unresolved in this com-bined analysis, and although there is resolution at the node sister to Disterigma s. s., the support for Sphyrospermum as its sister group is low (< 50%; 1) ( Figs. 1 ,– 2 ). Nonetheless, this result refutes the paraphyly of Sphyrospermum and Disterigmas. l. suggested in the previous analysis of Andean Vaccinieae ( Powell and Kron 2003 ). Here, all species of Sphyrospermumform a robust clade and D. rimbachii is resolved outside of Sphyrospermum and placed within the Central Andes Segregated Disterigma clade, along with morphologically sim-ilar species. Morphologically, the 26 species of Sphyrospermum(Luteyn and Pedraza-Peñalosa, unpubl. results) are easily dis-tinguished from Disterigma s. l. and their differences are sum-marized in Table 1 and Fig. 3 .

Historically, Disterigma was thought to be more closely related to Vaccinium given that Disterigma was originally described as one of its subgenera ( Klotzsch 1851 ). However, in a worldwide phylogenetic analysis of Vaccinieae ( Kron et al. 2002b ) none of the species of Vaccinium sampled were placed in the Andean clade with Disterigma. The South American species of Vaccinium were resolved in more basal grades; only V. poasanum (Guatemala-Panama) was placed in more derived grades within the Mesoamerican clade. Because the South American species of Vaccinium , or at least those so far sam-pled, are not thought to be closely related to members of the Andean clade, they are not included in the present molecu-lar study. In this analysis, V. poasanum is again resolved along with D. trimerum ( Fig. 1 , Mesoamerican clade). Disterigmatrimerum is endemic to the montane forests of Panama and

408 SYSTEMATIC BOTANY [Volume 34

2009] PEDRAZA-PEÑALOSA: SYSTEMATICS OF THE BLUEBERRY DISTERIGMA 409

Costa Rica, and remains as the only 3-merous taxon within Vaccinieae.

All the South American species of Disterigma s. l. resolved outside of Disterigma s. s. (i.e. D. bracteatum , D. pentandrum , D. rimbachii , and D. ulei ) occur in the central Andes, more spe-

cifically in southern Ecuador, Peru, and Bolivia; therefore the name of Central Andes Segregated Disterigma clade for this novel group ( Figs. 1 ,– 2 ). These segregated Disterigma cluster with an undescribed species from Peru that can be ambigu-ously placed in more than one genus (including the polyphyl-

Fig. 2. Enlarged detail of Fig. 1 showing the clades Disterigma s. s., Central Andes Segregated Disterigma , and Sphyrospermum . Bremer support above and jackknife support below the lines. See the text for the explanation of the clades highlighted by the arrows.

Table 1. Some morphological differences between Disterigma s. s., Central Andes Segregated Disterigma , and Sphyrospermum

Characters Disterigma s.s. Central Andes Segregated Disterigma clade Sphyrospermum

Pedicel and calyx juncture Articulate Articulate ContinuousPedicel appearance and

conspicuousnessStout and cryptic (subsessile),

usually up to 2 mm longStout and cryptic (subsessile),

usually up to 2 mm longVery slender and filiform, usually up

to several cm long (> 2 mm long)Pair of bracteoles inserted at the

apex of the pedicel, clasping the calyx, and well differentiated in size from other bracts and bracteoles

Present Absent. Bracts and bracteoles alike. Bracteoles distributed throughout the pedicel; although they can obscure the calyx, they are not clasping

Absent. Bracts and bracteoles are alike; the bracteoles are towards the base or middle of pedicel and therefore do not envelope the calyx

Flower merosity 4(-5)-merous, diplostemonous (4-)5(-7)-merous, haplostemonous (except D. ulei )

4(-5)-merous, diplostemonous or haplostemonous

Fig. 1. Strict consensus of 36 MPT found in the combined analysis of nrITS and ndhF data of 79 species of Vaccinieae. Bremer support above and jack-knife support below the lines. See enlarged Disterigma clades in Fig. 2 .

410 SYSTEMATIC BOTANY [Volume 34

Fig. 3. Some examples of the morphological differences between Disterigma s. s. (A, B, C), Sphyrospermum (D, F) and the Central Andes Segregated Disterigma clade (E, G). A. Section of a branch with subsessile flowers (1), corolla (2), and, calyx with inconspicuous bracts at the base of the short pedicel and the calyx basally enveloped by a pair of differentiated apical bracteoles (3), D. sp. nov. “ campanulatum” ; B. Flower with corolla and one of the clasping differentiated apical bracteoles removed to show the calyx, D. cryptocalyx ; C. Longitudinal section of the calyx (4) and calyx with the differentiated apical bracteoles removed (5), both showing the articulation between calyx and pedicel, D. sp. nov. “chocoanum ”; D. Corolla (6), external view (7) and longitu-dinal section of the calyx (8), both showing the calyx continuous with pedicel, S. cordifolium ; E. Section of a branch with subsessile flowers surrounded by undifferentiated bracts, D. bracteatum modified from Luteyn (2005) ; F. Branches with flowers pendent and with long pedicels, S. cordifolium ; G. Flower without corolla showing the undifferentiated bracts and bracteoles surrounding the calyx (9), complete flower with all but one of the bracts and bracteoles removed (10), D. bracteatum modified from Luteyn (2005) .

2009] PEDRAZA-PEÑALOSA: SYSTEMATICS OF THE BLUEBERRY DISTERIGMA 411

etic Vaccinium) without stretching the generic morphological boundaries.

Although all species of Disterigma s. l. resolved outside of Disterigma s. s. have subsessile flowers surrounded by sev-eral bracts or bracteoles, they do not have a differentiated pair of bracteoles inserted at the apex of the pedicel; instead, all the bract-like structures are morphologically undiffer-entiated and scattered along the pedicel ( Fig. 3 ). Moreover, D. bracteatum , D. pentandrum, and D. rimbachii can be further differentiated from any other Disterigma s. l. because their flow-ers are haplostemonous (five stamens and five corolla parts) and not diplostemonous (eight or 10 stamens and four to five corolla parts). It was because the unusual number of stamens (five) and the presence of undifferentiated and numerous bracts and bracteoles of D. pentandrum that Smith (1933 ) rec-ognized this taxon as isolated within the genus. The descrip-tion of the two other haplostemonous Disterigma species from the Central Andes came after Smith’s revision. Disterigma rim-bachii was originally described by Smith (1935 ) in CeratostemaJuss.; Smith noted that although it resembled certain species of Disterigma , C. rimbachii lacked the distinctive “large pedi-cellary bracts” (differentiated apical bracteoles) and had long “pseudostipules” (prophylls or the bracts of a lateral bud; for nomenclature see Pedraza-Peñalosa 2008b ). Afterwards, the generic placement of C. rimbachii was much disputed, moving from Plutarchia A. C. Sm. to Pellegrinia Sleumer, before being finally transferred to Disterigma, despite the lack of differen-tiated apical bracteoles ( Luteyn 1996 ; Sleumer 1935 ; Smith 1936 ). In the case of D. bracteatum, it was described as a new species probably closely related to D. pentandrum and D. rim-bachii ( Luteyn 2005 ) because they all share succulent leaves and haplostemonous flowers surrounded by multiple undif-ferentiated bracts.

The phylogenetic affinities and taxonomic identity of the last of the species included in the Central Andes Segregated Disterigma clade, D. ulei, were also poorly understood. The holotype (unicate) of D. ulei was destroyed in the fire at the Berlin herbarium and only a blurred photograph of it sur-vived. When originally described, D. ulei , was placed in Disterigma rather than in Vaccinium because of its habit and resemblance to D. pentandrum, in spite of its reduced “bracts”, here reinterpreted as the absence of differentiated apical brac-teoles ( Sleumer 1941 ). Disterigma ulei is different from D.pentandrum and other species in the clade because its flow-ers are diplostemonous. Recent field work has extended the known distribution of D. ulei from northern Peru to northern Bolivia. However, the collections are still few and spotty and almost all we know about this taxon comes from specimens taken from fallen branches as it apparently grows high in the canopy (Pedraza-Peñalosa, pers. obs.).

The Disterigma s. s. Clade— All species within this well sup-ported clade (96%; 11; Figs. 1 ,– 2 ) have a characteristic pair of bracteoles which are clearly differentiated from other bracts/bracteoles in size and which are inserted at the apex of the pedicel and embrace the calyx ( Fig. 3 ). These differentiated apical bracteoles are absent in the taxa resolved outside of Disterigma s. s. and the extent in which these bracteoles clasp the calyx is taxonomically useful to identify species ( Pedraza-Peñalosa 2008a ).

The resolution within Disterigma s. s. in this molecular anal-ysis is rather limited and the discussion will focus on those few major clades with moderate to high jackknife or Bremer values. Disterigma utleyorum is sister to the remainder of

Disterigma s. s. ( Fig. 2 , clade A). Disterigma utleyorum is dis-tributed from Costa Rica to northern Ecuador, and contrary to the majority of the group, it grows at lower elevations in the transition from the lowland rainforest to the premontane forest (300–1,100 m). This species is the only one in the genus in which the differentiated apical bracteoles are fused on both ends, forming a single and ring-shaped bracteole ( Pedraza-Peñalosa 2008a , in press).

The clade formed by D. campii , D. balslevii , D. empetrifolium , D. acuminatum (two OTU’s), D. codonanthum, and D. pernet-tyoides (81%; 5) groups species that, with exception of D. campii,are typically found in the highest belts of the Andean vegeta-tion ( Fig. 2 , clade B). These species are abundant in the dry, humid, grassy, or shrubby páramos and subpáramos of the northern Andes, or, in the humid puna and yungas (páramo yungeño) of the central Andes. In the case of D. acuminatum , although it can be locally abundant in shrubby páramos and punas, overall, it occurs more frequently in the upper mon-tane cloud forest. Disterigma campii, which grows at lower alti-tudes (800–1,700 m) in the premontane cloud forest, shares small stamens and small, campanulate, and green corollas (both ca. 3–5 mm long) with other members of this clade. Within clade B, the only relationship well supported is that of the two species with long campanulate corollas (ca. 7–17 mm long), D. codonanthum and D. pernettyoides (72%; 11). These last two species can easily be differentiated when flowering, but not from sterile material. Disterigma codonanthum and D. per-nettyoides share geniculate (S-shaped) staminal filaments with other members of the clade; however, the filaments of D. codo-nanthum are only rarely geniculate. Disterigma codonanthumand D. pernettyoides have complementary geographic distri-butions with D. codonanthum mostly found in Colombia and Ecuador and D. pernettyoides concentrated in southern Peru and northern Bolivia; only in few occasions have these taxa been collected in the same general region (central Peru), at the outermost limits of their distributions, but never together in the same locality ( Pedraza-Peñalosa 2008a , in press).

The next clade with high support is that formed by the five OTUs from Central and South America of the polymor-phic Disterigma humboldtii (86%; 3; Fig. 2 , clade C). This spe-cies exhibits extensive variation in the size of the leaves and flowers, and some variation in the presence of hairs within the corolla, a character otherwise diagnostic for the other 31 species of Disterigma s. s. ( Pedraza-Peñalosa 2008a , in press). Sister to the group of D. humboldtii , but with relatively low support for the relationship (53%; 2), is the clade of D. cryptoca-lyx , D. micranthum , and the two OTUs of D. noyesiae (< 50%; 2; Fig. 2 , clade D); clade D groups species from Ecuador and Colombia with a wide altitudinal range, but perhaps more commonly found in the premontane cloud forests. All these species were described after Smith’s revision and D. micran-thum and D. noyesiae were only known from the type speci-mens until recently ( Luteyn 1996 ; Pedraza-Peñalosa 2008a , in press). The type collections of D. cryptocalyx , D. micranthum , and D. noyesiae are quite different from each other, with the small-leaved D. micranthum bearing some of the smallest flow-ers known in the genus (corollas ca. 3 mm long) and the large-leaved D. cryptocalyx in the other extreme (corollas ca. 7–10 mm long). Nevertheless, these three species have differenti-ated apical bracteoles extending beyond the calyx and even enclosing the basal half of the corolla. Although the two OTU’s of D. noyesiae are placed in two adjacent clades, the support for their position is too weak to make any inferences (≤ 50%; 2).

412 SYSTEMATIC BOTANY [Volume 34

Nevertheless, the morphological study of the entire genus revealed that the OTU of D. noyesiae from Colombia is nothing more than a miniaturized version of D. noyesiae that has all the diagnostic characters ( Pedraza-Peñalosa 2008a , in press).

In summary, it can be concluded that Disterigma s. l., as currently circumscribed, is a polyphyletic group with three independent origins. The segregation from Disterigma s. s. of D. trimerum from the Mesoamerican clade and of D. bractea-tum , D. pentandrum , D. rimbachii , and D. ulei from the novel Central Andes Segregated Disterigma clade is supported by nuclear and plastid molecular data. The remaining 26 species of Disterigma s. l. analyzed, including the type species of the genus, are part of the monophyletic Disterigma s. s. ; this well supported group can be diagnosed by the presence of a pair of bracteoles clearly differentiated from other bracts/bracte-oles in size, which are inserted at the apex of the pedicel and embrace the calyx.

Although the position of D. trimerum within taxa of Mesoamerican origin is well founded and D. bracteatum , D. pentandrum, and D. rimbachii form a well supported group within a novel clade, the proper placement of these species within Vaccinieae needs further work. More evidence and additional sampling of the tribe are necessary to resolve their complex generic affinities. A phylogenetic analysis including morphological data will shed further light on the relationships of Disterigma s. l. and will allow testing of different hypoth-eses of synapomorphies within a phylogenetic framework.

Even though Sphyrospermum is resolved as the sister to Disterigma s. s. and both are diagnosable clades, the support for this relationship remains weak and morphological studies are needed to discover putative synapomorphies that explain it.

Acknowledgments. I would like to thank the reviewers and James L. Luteyn, Kathleen A. Kron, and Fabian Michelangeli for their critical review of the manuscript; I also want to thank the many friends and col-leagues who helped me in the field. This research was partially funded by the Graduate Program and the Lewis B. and Dorothy Cullman Program for Molecular Systematics Studies from The New York Botanical Garden. Fieldwork was supported by the Tropical Botany Award of the Garden Club of America, The Eloise Gerry Fellowship of Sigma Delta Epsilon/Graduate Women in Science, the Student Award of the Torrey Botanical Society, the Sue Rosenberg Zalh Ph.D. Student Travel Award of the City University of New York, Idea Wild, and by the National Science Foundation (NSF DDIG No. 0607528, DEB 0444238 to Dr. J. L. Luteyn). Logistical sup-port was provided by the following institutions; Corporación Serraniagua (Colombia), Ecopar (Ecuador), Grupos Ecológicos de Risaralda (Colombia, Reserva Karagabí), Instituto de Ciencias Naturales de la Universidad Nacional de Colombia, Smithsonian Tropical Research Institution, Unidad de Parques Nacionales Naturales de Colombia, and herbaria; COL, CUZ, HUA, LPB, QCA, and USM, to which I am very grateful. To the horticul-ture departments of The Royal Botanical Garden of Edinburgh and The New York Botanical Garden, thanks for facilitating access to the living plant collections. Bobbi Angell prepared the beautiful illustrations.

Literature Cited

Bremer , K. 1994 . Branch support and tree stability . Cladistics 10 : 295 – 304 . Clark , M. S. 1997 . Plant molecular biology: a laboratory manual . Berlin :

Springer-Verlag. Donoghue , M. J. and M. J. Sanderson . 1992 . The suitability of molecular

and morphological evidence in reconstructing plant phylogeny . Pp. 340 – 368 in Molecular systematics of plants , eds. P. S. Soltis , D. E. Soltis , and J. J. Doyle . New York : Chapman and Hall .

Farris , J. S. , V. A. Albert , M. Källersjo , D. Lipscomb , and A. G. Kluge . 1996 . Parsimony jackknifing outperforms neighbor-joining . Cladistics 12 : 99 – 124 .

Goloboff , P. , J. S. Farris , and K. C. Nixon . 2000 . T.N.T.: tree analysis using new technology ver. 1.0 (September 2005) . http://www.cladistics.org/tnt.html .

Hillis , D. M. , C. Moritz , and B. K. Mable . 1996 . Molecular systematics . Sunderland : Sinauer Associates Inc.

Klotzsch , J. F. 1851 . Studien über die natürliche Klasse Bicornes Linné . Linnaea 24 : 1 – 88 .

Kron , K. A. , W. S. Judd , P. F. Stevens , D. M. Crayn , A. A. Anderberg , P. A. Gadek , C. J. Quinn , and J. L. Luteyn . 2002a . Phylogenetic classifi-cation of Ericaceae: molecular and morphological evidence . BotanicalReview 68 : 335 – 423 .

Kron , K. A. , E. A. Powell , and J. L. Luteyn . 2002b . Phylogenetic relation-ships within the blueberry tribe (Vaccinieae, Ericaceae) based on sequence data from matK and nuclear ribosomal ITS regions, with comments on the placement of Satyria . American Journal of Botany 89 : 327 – 336 .

Luteyn , J. L. 1996 . Ericaceae . Flora of Ecuador 54 : 1 – 404 . Luteyn , J. L. 2005 . Four new species of Ericaceae (Vaccinieae) from

Ecuador . Sida 21 : 1269 – 1282 . Niedenzu , F. 1889 . Uber den anatomischen bau de taubblätter der

Arbutoideae und Vaccinioideae in bieze hung zuihrer systematischen gruppierung und geographischen verbreitung . Botanische Jahrbücher für Systematik 11 : 134 – 263 .

Nixon , K. C. and J. M. Carpenter . 1996 . On simultaneous analysis . Cladistics 12 : 221 – 241 .

Pedraza-Peñalosa , P. 2008a . Systematics and phylogeny of the Andean blue-berry Disterigma (Ericaceae: Vaccinieae) . Ph.D. Dissertation, New York : The City University of New York .

Pedraza-Peñalosa , P. 2008b . Three New Species of Disterigma (Ericaceae: Vaccinieae) from western Colombia, with comments on morphologi-cal terminology . Brittonia 60 : 1 – 10 .

Pedraza-Peñalosa , P. In press. Disterigma (Ericaceae: Vaccinieae). Flora Neotropica Monographs .

Powell , E. A. and K. A. Kron . 2003 . Molecular systematics of the north-ern Andean blueberries (Vaccinieae, Vaccinioideae, Ericaceae) . International Journal of Plant Sciences 164 : 987 – 995 .

Sleumer , H. O. 1935 . Ericaceae americanae novae vel minus cognitae, II . Notizblatt des Botanischen Gartens und Museums zu Berlin-Dahlem 12 : 277 – 294 .

Sleumer , H. O. 1941 . Vaccinioideen-Studien . Botanische Jahrbücher für Systematik 71 : 375 – 510 .

Smith , A. C. 1933 . The genera Sphyrospermum and Disterigma . Brittonia 1 : 203 – 232 .

Smith , A. C. 1935 . Studies of South American plants, IV. New Monimi-aceae, Trigoniaceae, and Vacciniaceae . Phytologia 1 : 126 – 132 .

Smith , A. C. 1936 . Studies of South American plants, V. Additional notes on Thibaudieae . Bulletin of the Torrey Botanical Club 63 : 307 – 316 .

Thompson , J. D. , T. J. Gibson , F. Plewniak , F. Jeanmougin , and D. G. Higgins . 1997 . The CLUSTAL_X windows interface: flexible strate-gies for multiple sequence alignment aided by quality analysis tools . Nucleic Acids Research 25 : 4876 – 4882 .

Appendix 1. Alphabetical list of taxa used in the analysis of nrITS and ndhF data of neotropical Vaccinieae. After the species name, the voucher details are listed as: species distribution, collector name and col-lecting number (herbarium or garden), nrITS accession number, and ndhFaccession number. Abbreviations correspond to: ABG = Atlanta Botanical Garden, ACAD = Acadia University, NY = New York Botanical Garden, RBGE = Royal Botanic Garden Edinburgh, RBGK = Royal Botanic Garden Kew, WFU = Wake Forest University. *inedit. species.

Anthopterus wardii Ball, Panama-Colombia, Luteyn 15191 (NY), AF382656, AY331921. Cavendishia bracteata (Ruiz & Pav.) Hoer., Mexico-Bolivia, Luteyn 14223 (NY), AY331867, AY331922. Cavendishia capitulataDonn. Sm., Costa Rica-Colombia, EAP 10 (WFU), AY331868, AY331923. Cavendishia complectens Hemsl., Nicaragua-Peru, ABG-91-1336 (ABG), AF382657, AY419723. Cavendishia grandifolia Hoer., Ecuador, Luteyn 8023(NY), AY331869, AY331924. Cavendishia martii (Meisn.) A. C. Sm., Peru-Bolivia, Luteyn 15443 (NY), AF382658, AY331925. Ceratostema lanigerum(Sleumer) Luteyn, Ecuador, Luteyn 14216 (NY), AY331870, AY331926. Ceratostema rauhii Luteyn, Peru, Rauh 68468 (NY), AY331871, AY331927. Ceratostema reginaldii (Sleumer) Luteyn, Ecuador, Luteyn 14159 (NY), AY331872, AY331928. Ceratostema silvicola A. C. Sm., Ecuador, ABG-90-1101 (ABG), AY331873, AY331929. Demosthenesia pearcei (Britton) A. C. Sm., Peru-Bolivia, Luteyn 15435 (NY), AF382663, AY331930. Disterigma acumi-natum (H. B. K.) Nied., Colombia-Peru, P. Pedraza 1098 (NY), FJ001669, FJ001708. Disterigma acuminatum /Galeras, Colombia, N. R. Salinas 245 (NY), FJ001670, FJ001709. Disterigma agathosmoides (Wedd.) Nied., Panama-Ecuador, Luteyn 15190 (NY), P. Pedraza 1001 (NY), FJ001671,

2009] PEDRAZA-PEÑALOSA: SYSTEMATICS OF THE BLUEBERRY DISTERIGMA 413

FJ001710. Disterigma alaternoides (H. B. K.) Nied., Colombia-Bolivia, Luteyn 15074 (NY), FJ001672, FJ001711. Disterigma appendiculatum Pedraza, Colombia, P. Pedraza 1113 (NY), FJ001673, FJ001712. Disterigma balsleviiLuteyn, Ecuador, P. Pedraza 998 (NY), FJ001674, FJ001713. Disterigmabracteatum Luteyn, Ecuador, P. Pedraza 1016 (NY), FJ001675, FJ001714. Disterigma campii A. C. Sm., Ecuador, Luteyn 15056 (NY), P. Pedraza 1237(NY), FJ001676, FJ001715. Disterigma sp. nov. “chocoanum”*, Colombia, P.Pedraza 1121 (NY), FJ001696, FJ001737. Disterigma codonanthum S. F. Blake, Colombia-Peru, Luteyn 15117 (NY), P. Pedraza 1041 (NY), FJ001677, FJ001716. Disterigma cryptocalyx A. C. Sm., Colombia-Ecuador, Luteyn14993 (NY), P. Pedraza 1071 (NY), FJ001678, FJ001717. Disterigma dumon-tii Luteyn, Colombia-Ecuador, Luteyn 15177 (NY), P. Pedraza 1005 (NY), FJ001679, FJ001718. Disterigma empetrifolium (H. B. K.) Drude, Colombia-Bolivia, C. Pedraza 7 (NY), FJ001680, FJ001719. Disterigma hiatum Pedraza, Colombia, P. Pedraza 1112 (NY), FJ001681, FJ001720. Disterigma humbold-tii (Klotzsch) Nied./Colombia 1 [corolla glabrous], Mexico-Peru, Pedraza1075 (NY), FJ001682, FJ001721. Disterigma humboldtii /Colombia 2 [corolla glabrate], Mexico-Peru, Pedraza 1069 (NY), FJ001683, FJ001722. Disterigmahumboldtii /Ecuador, Mexico-Peru, Pedraza 959 (NY), FJ001691, FJ001730. Disterigma humboldtii /Panama, Mexico-Peru, Luteyn & P. Pedraza 15571(NY), FJ001684, FJ001723.Disterigma humboldtii /Peru, Mexico-Peru, Pedraza1614 (NY), FJ001685, FJ001724. Disterigma leucanthum A. C. Sm., Ecuador, Cubey 2 (E), FJ001686, FJ001725. Disterigma luteynii Wilbur, Panama, Luteyn& P. Pedraza 14797 (NY), FJ001687, FJ001726. Disterigma micranthum A. C. Sm., Ecuador, P. Pedraza 1229 (NY), FJ001688, FJ001727. Disterigma noy-esiae Luteyn/Ecuador, Colombia-Ecuador, P. Pedraza 989 (NY), FJ001689, FJ001728. Disterigma noyesiae /Colombia, Colombia-Ecuador, P. Pedraza 1155 (NY), FJ001690, FJ001729. Disterigma sp. nov. “ollacheum”*, Peru, P. Pedraza 1528 (NY), FJ001697, FJ001738. Disterigma ovatum (Rusby) S. F Blake, Peru, Luteyn & P. Pedraza 15457 (NY), FJ001692, FJ001731. Disterigmapallidum A. C. Sm., Bolivia, P. Pedraza 1506 (NY), AF382674, FJ001732. Disterigma pentandrum S. F. Blake, Ecuador-Peru, Luteyn 15085 (NY), P. Pedraza 1201 (NY), FJ001693, FJ001733. Disterigma pernettyoides (Griseb. Ex Wedd.) Nied., Peru-Bolivia, Luteyn 15441 (NY), P. Pedraza 1508 (NY), AF382675, FJ001734. Disterigma pseudokillipiella Luteyn, Colombia-Ecuador, P. Pedraza 1143 (NY), FJ001694, FJ001735. Disterigma rimbachii (A. C. Sm.) Luteyn, Ecuador, P. Pedraza 1018 (NY), FJ001695, FJ001736. Disterigmastaphelioides (Planch. ex Wedd.) Nied., Colombia, Venezuela, Guyana, Brazil?, P. Pedraza 1062 (NY), FJ001698, FJ001739. Disterigma stereophyl-lum (A. C. Sm.) Luteyn, Colombia-Ecuador, Luteyn 15206 (NY), FJ001699, FJ001740. Disterigma trimerum Wilbur & Luteyn, Panama, Luteyn 15568(NY), FJ001700, FJ001741. Disterigma ulei Sleumer, Peru-Bolivia, P. Pedraza 1515 (NY), FJ001701, FJ001742. Disterigma utleyorum Wilbur & Luteyn, Costa Rica-Ecuador, P. Pedraza 981 (NY), FJ001702, FJ001743. Disterigmaverruculatum Pedraza, Colombia, P. Pedraza 1138 (NY), FJ001703, FJ001744.

Macleania coccoloboides A. C. Sm., Ecuador, Luteyn 15852A (NY), AF382680, AY331938. Macleania cordifolia Benth., Ecuador, NYBG-887/96 (NY), AY331877, AY331939. Macleania floribunda W. J. Hooker, Ecuador-Peru, P. Pedraza 1882 (NY), FJ001704, FJ001745. Macleania insignis M. Martens & Galeotti, Mexico-Costa Rica, RBGK-1969-19236 (RBGK), AF382681, AY331940. Psammisia dolichopoda A. C. Sm., Panama-Ecuador, Luteyn 15006(NY), AF382690, AF419730. Psammisia ecuadorensis Hoer., Ecuador, Luteyn15033 (NY), AF382691, AY331942. Psammisia sodiroi Hoer., Colombia-Ecuador, Luteyn 8021 (NY), AY331878, AY331943. Psammisia ulbrichianaHoer., Colombia-Peru, Luteyn 15170 (NY), AY331879, AY331944. Satyriaallenii A. C. Sm., Panama, Luteyn 15292 (NY), AF382692, AY331945. Satyriaboliviana Luteyn, Bolivia, Luteyn 15481 (NY), AF382693, AY331946. Satyriacerander (Dunal) A. C. Sm., French Guiana/ Brazil, Mori 25279 (NY), AY331880, AY331947. Satyria grandifolia Hoer., Colombia-Peru, Luteyn15204 (NY), AF382694, AY331948. Satyria leucostoma Sleumer, Ecuador-Peru, Luteyn 15051 (NY), AF382695, AY331949. Satyria meiantha J. D. Smith, Costa Rica, Luteyn 15236 (NY), AF382696, AY331950. Satyria polyantha A. C. Sm., Peru, EAP 83 (WFU), AY331881, AY331952. Satyria sp. nov., Panama, EAP 9 (WFU), AY331882, AY331953. Satyria vargasii A. C. Sm., Peru, EAP 75 (WFU), AY331883, AY331954. Satyria ventricosa Luteyn, Panama, Luteyn15293 (NY), AY331884, AY331955. Satyria warszewiczii Klotzsch, Mexico-Panama, RBGE-781009 (RBGE), AF382698, AY331956. Sphyrospermum boekei Luteyn, Colombia-Ecuador, P. Pedraza 975 (NY), AF382701, FJ001746. Sphyrospermum buxifolium Poeppig & Endl., Nicaragua-Bolivia, Guianas, P. Pedraza 1022 (NY), FJ001705, FJ001747. Sphyrospermum ellipticum Sleumer, Ecuador, P. Pedraza 1883 (NY), AY331885, FJ001748. Sphyrospermum sod-iroi (Hoer.) A. C. Sm., Ecuador, P. Pedraza 960 (NY), FJ001706, FJ001749. Symphysia racemosa (Vahl) Stearn, Antilles except Trinidad, Vander Kloet 2277274 (ACAD), AF382705, AF419733. Themistoclesia costaricensis Lutyen & Wilbur, Costa Rica-Colombia, Luteyn 14996 (NY), AF382706, AY331961. Themistoclesia epiphytica A. C. Sm., Colombia-Ecuador, Luteyn 15213 (NY), AF382707, AY331962. Thibaudia costaricensis Hoer., Costa Rica-Panama, EAP 16 (WFU), AY331887, AY331963. Thibaudia densiflora (Herzog) A. C. Sm., Bolivia, Luteyn 15459 (NY), AF382708, AY331964. Thibaudia diphyllaDunal, Peru, Moretz M001 (WFU), AY331888, AY331965. Thibaudia flori-bunda Kunth, Colombia-Peru, Luteyn 15090 (NY), AF382702, AY331966. Thibaudia inflata Luteyn, Ecuador, Luteyn 15029 (NY), AY331889, AY331967. Thibaudia macrocalyx Remy, Bolivia, Luteyn 15444 (NY), AF382711, AY331969. Thibaudia martiniana A. C. Sm., Ecuador, Luteyn 15028 (NY), AY331891, AY331970. Thibaudia pachyantha A. C. Sm., Colombia-Ecuador, Luteyn 15189 (NY), AF382712, AY331971. Thibaudia tomentosa Hoer., Peru, Luteyn 15502 (NY), AY331892, AY331973. Vaccinium poasanum J. D. Smith, Guatemala-Panama, Vander Kloet 131686 (ACAD), AF382736, AF419762. Undescribed sp. nov.*, Peru, Luteyn & P. Pedraza 15645 (NY), FJ001707, FJ001750.