Targeting the miR-221–222/PUMA/BAK/BAXPathwayAbrogatesDexamethasoneResistance inMultiple MyelomaJian-Jun Zhao1, Zhang-Bo Chu1,2, Yu Hu2, Jianhong Lin1,3, Zhongqiu Wang1, Meng Jiang1,Ming Chen1, Xujun Wang4, Yue Kang1, Yangsheng Zhou1, Triona Ni Chonghaile1,Melanie E. Johncilla5, Yu-Tzu Tai1,3, Jin Q. Cheng6, Antony Letai1, Nikhil C. Munshi1,3,7,Kenneth C. Anderson1,3, and Ruben D. Carrasco1,3,5
Abstract
Despite recent therapeutic advances that have doubled themedian survival time of patients with multiple myeloma, intra-tumor genetic heterogeneity contributes to disease progressionand emergence of drug resistance. miRNAs are noncoding smallRNAs that play important roles in the regulation of gene expres-sion and have been implicated in cancer progression and drugresistance. We investigated the role of the miR-221–222 family indexamethasone-induced drug resistance in multiple myelomausing the isogenic cell lines MM1R and MM1S, which repre-sent models of resistance and sensitivity, respectively. Analysisof array comparative genome hybridization data revealed gain ofchromosome X regions at band p11.3, wherein the miR-221–222resides, in resistant MM1R cells but not in sensitive MM1S cells.DNA copy number gains in MM1R cells were associated withincreased miR-221–222 expression and downregulation of p53-upregulated modulator of apoptosis (PUMA) as a likely proa-poptotic target. We confirmed PUMA mRNA as a direct target ofmiR-221–222 inMM1S andMM1R cells by both gain-of-function
and loss-of-function studies. In addition,miR-221–222 treatmentrendered MM1S cells resistant to dexamethasone, whereas anti-miR-221–222 partially restored the dexamethasone sensitivityof MM1R cells. These studies have uncovered a role formiR-221–222 in multiple myeloma drug resistance and suggesta potential therapeutic role for inhibitors of miR-221–222 bind-ing to PUMA mRNA as a means of overcoming dexamethasoneresistance in patients. The clinical utility of this approach ispredicated on the ability of antisense miR-221–222 to increasesurvival while reducing tumor burden and is strongly supportedby the metastatic propensity of MM1R cells in preclinical mousexenograft models of multiple myeloma. Moreover, our observa-tion of increased levels of miR-221–222 with decreased PUMAexpression in multiple myeloma cells from patients at relapseversus untreated controls suggests an even broader role formiR-221–222 in drug resistance and provides a rationale forthe targeting of miR-221–222 as a means of improving patientoutcomes. Cancer Res; 75(20); 4384–97. �2015 AACR.
IntroductionDespite recent advances in treatment, multiple myeloma
remains incurable due to tumor progression and the emergence
of resistance (1). Therefore, to develop more effective treatmentsand improve patient outcome, it is imperative to better under-stand the cellular and molecular mechanisms mediating drugresistance in multiple myeloma. Many treatment regimensinclude novel agents in combinationwith dexamethasone; unfor-tunately, however, multiple myeloma cells often become dexa-methasone resistant (1).
The exact basis for the beneficial mechanism of action ofglucocorticoids in cancer treatment has not been fully and defin-itively elucidated, although the apoptotic pathway is consideredto be the main target. It is thought that glucocorticoid-inducedapoptosis is initiated via activation of transcription of death-specific genes, and inhibition of the apoptotic cascade is believedto occur via negative modulation of proinflammatory cytokinesthat block transcription of death-specific genes (2). During pro-longed exposure to dexamethasone, it is believed that resistanceapparently stems fromdownregulation of glucocorticoid receptor(GR) gene expression (3). Although only one GR gene has beenidentified, several GR proteins (e.g., GRa and GRb) can begenerated by alternative splicing of the mRNA. GRa is expressedat relatively higher levels than GRb in most tissues and plays amajor role in dexamethasone -induced apoptosis. However, themechanism of GRa downregulation in dexamethasone-resistant
1Medical Oncology, Dana-Farber Cancer Institute, Harvard MedicalSchool, Boston, Massachusetts. 2Institute of Hematology, Union Hos-pital, Tongji Medical College, Huazhong University of Science andTechnology,Wuhan, China. 3LeBow Institute for Myeloma Therapeu-tics and Jerome Lipper Center for Multiple Myeloma Research, Har-vard Medical School, Dana-Farber Cancer Institute, Boston, Massa-chusetts. 4Department of Bioinformatics, School of Life Science andTechnology, Tongji University, Shanghai, China. 5Department ofPathology, Brigham and Women's Hospital, Boston, Massachusetts.6H. Lee Moffitt Cancer Center and Research Institute, Tampa, Florida.7Boston VA Healthcare System, Boston, Massachusetts.
Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).
J.-J. Zhao, Z.-B. Chu, and Y. Hu contributed equally to this article.
Corresponding Authors: Ruben D. Carrasco, Dana-Farber Cancer Institute, 44Binney Street, Boston, MA 02215. Phone: 617-582-8159; Fax: 617-582-8187;E-mail: [email protected]; and Jian-Jun Zhao, E-mail:[email protected]
patients remains somewhat ambiguous (3).Othermechanisms ofinduced dexamethasone resistance have been proposed andinclude the following: (i) overexpression of the ABC transporterthat will decrease intracellular dexamethasone levels, leading toresistance (4); (ii) blocking of the proapoptotic effect of dexa-methasone by cytokines secreted by the bone marrow microen-vironment, or via binding of multiple myeloma cells to bonemarrow stroma, in either case inducing cell adhesion–mediatedresistance (5).
miRNAs are small (�22nt) noncoding RNAs that negativelyregulate protein-coding gene expression by enhancing degra-dation or inhibiting translation of mRNAs (6, 7). Dysregulationof miRNA expression is frequently detected in multiple mye-loma and has been associated with increased metastatic poten-tial and poor clinical outcome, suggesting an important rolefor miRNAs in multiple myeloma disease progression (8).miR-221 and miR-222 are highly homologous miRNAsencoded on the X-chromosome (9) and designated as themiR-221–222 cluster. This cluster has been found to be over-expressed in a large variety of human cancers, including hema-tologic malignancies such as multiple myeloma (10). It hasbeen shown that miR-221–222 promotes oncogenesis bydownregulating the expression of tumor suppressors such asthe proapoptotic protein p53-upregulated modulator of apo-ptosis (PUMA) and the bcl2-interacting mediator of cell death(BIM; ref. 11). Here, we have used the isogenic cell lines MM1Rand MM1S, which represent resistance and sensitivity, respec-tively, to dexamethasone, to delineate a pathogenetic role ofthe miR-221–222 cluster in promoting dexamethasone resis-tance in multiple myeloma via downregulation of PUMA, andinhibition of apoptosis.
Materials and MethodsCell lines and human tumor tissues and RNA isolation.
MM1S and MM1R cell lines were obtained from the ATCC.
miRNA profiling in MM1S and MM1R cellsTotal RNA was isolated from MM1R and MM1S cells grown in
tissue culture or isolated from xenografts using TRIzol reagents(Invitrogen), and subjected to quantitative RT-PCR (qRT-PCR)analysis or whole-genomic miRNA profiling using TaqMan LowDensity microRNA Array (AM1792, Invitrogen). Expression ofeach miRNA was presented directly using their threshold cyclenumber (Ct). Upregulated miRNAs are with lowCt number whiledownregulated miRNAs are with high Ct number.
qRT-PCR and immunoblot analysesqRT-PCR for evaluating miR-221, miR-222, and PUMAmRNA
levelswas performed aspreviously described (12). Theprimers formiR-221(#000524), miR-222(#000525), U44(#001094), PUMA(#Hs00248075_m1), and GAPDH (#Hs99999905_m1) werepurchased from Applied Biosystems. Immunoblots wereobtained as previously described (13). Primary antibodies includ-ed: anti-PUMA (#4976, Cell Signaling Technology), anti-BAX(#2772; Cell Signaling Technology), anti-cleaved caspase-3(#9661; Cell Signaling Technology), anti-PARP (#9542, CellSignaling Technology), anti-BID (#sc-11423; Santa Cruz Biotech-nology), anti-BAK (#06-536; Millipore), anti-P53 (#SC-126;Santa Cruz Biotechnology), and anti-BIM (#202000; Calbio-chem). Horseradish peroxidase (HRP)-conjugated secondary
Plasmids and 20-OMe–modified anti-miR-221/222Viral expression vectors of miR-221–222 (V-miR-221–222)
were created by PCR utilizing normal human DNA and thefollowing pair of primers: V-miR-221–222 (F) (EcoR1) TAGC-GAATTCGCTCCCCAGAAGGCAAAGGAT, and V-miR-221–222(R) (Not1) CTTCGCGGCCGCTGGTGAGACAGCCAATGGAG,then cloned into the EcoR1 and Not restriction sites of pCDH-CMV-EF1-GFP viral vector (#CD511B-1; SystemBiosciences). Thepackaging system was used according to the manufacturer'sprotocol. The sequences of as-miR-222 and as-miR-221 were50-ACCCAGUAGCCAGAUGUAGCU-30, and 50- GAAACCCAG-CAGACAAUGUAGCU-30, respectively. Scrambled 20-OMe-mod-ified RNA (50-AAGGCAAGCUGACCCUGAAGU-30) was used as anegative control.
As-miR-221–222 sponge plasmidThe following oligos were obtained from Integrated DNA
Technologies: as-221–222-EN(F) 50-AATTCGAAACCCAGCAGA-CAATGTAGCTACCCAGTAGCCAGATGTAGCTGAAACCCAGCA-GACAATGTAGCTACCCAGTAGCCAGATGTAGCTGAAACCCAG-CAGACAATGTAGCTACCCAGTAGCCAGATGTAGCTGAAACCC-AGCAGACAATGTAGCTACCCAGTAGCCAGATGTAGCTgc-30, as-221–222-EN(R) 50-GGCCGCAGCTACATCTGGCTACTGGGTA-GCTACATTGTCTGCTGGGTTTCAGCTACATCTGGCTACTGGGT-AGCTACATTGTCTGCTGGGTTTCAGCTACATCTGGCTACTGGG-TAGCTACATTGTCTGCTGGGTTTCAGCTACATCTGGCTACTGG-GTAGCTACATTGTCTGCTGGGTTTCg-30. The oligos were dis-pensed into annealing buffer and inserted into the EcoRI site ofpCDH-CMV-EF1-GFP (#CD511B-1, System Biosciences). Theconstruct is pCDH-CMV-as-miR-221–222-EF1-GFP with 3 repeatof antisense of miR-221 and miR-222 sequences (50-GAAACC-CAGCAGACAATGTAGCTACCCAGTAGCCAGATGTAGCT-30),and is referred to as V-as-miR-221–222-GFP.
Argonaute 2 (AGO2) binding RNA immunoprecipitation anal-ysis were performed as described (14). MM1S V-GFP and MM1SV-miR-221–222-GFP stable transduced cells (3 � 107 per RNAimmunoprecipitation experiment) were washed with ice-coldPBS and dispensed into 1 mL of cell lysis buffer (50 mmol/LTris–HCl pH 7.5, 150mmol/L NaCl, 1mmol/L EDTA, 1%NP40)containing Protease inhibitor (#5871S, Cell Signaling Technolo-gy) and RNase inhibitor (#N808-0119, Invitrogen) for 20 min-utes on ice. Lysates were microcentrifuged at maximum speed for20 minutes at 4�C, and supernatants were collected and pre-cleared with 20 mL of Protein A and G Dynabeads coupled with 5mg of normal Rabbit IgG (#SC-3888, Santa Cruz Biotechnology).The beads were removed by centrifugation and the supernatantsincubated with Dynabeads A and G coupled with 5 mg of anti-AGO2–specific antibody (#2897S; Cell Signaling Technology) or5 mg IgG isotype control antibody (#SC-3888; Santa Cruz Bio-technology) overnight at 4�C, followed by three timewashes withwashing buffer (50mmol/L Tris–HCL pH 7.5, 300mmol/L NaCl,1mmol/L EDTA, 1% NP 40, Protease inhibitor). After pulldownby centrifugation, RNA was extracted using 1000 mL TRIzolreagent (Invitrogen). qRT-PCR detection of pulled-down PUMA
The Role of miR-221/222 in Multiple Myeloma Dexamethasone Resistance
www.aacrjournals.org Cancer Res; 75(20) October 15, 2015 4385
mRNA and miR-221/222 was performed as described in thesection of qRT-PCR.
PUMA open reading frame overexpression virusPUMA cDNA lacking a 30UTR was amplified from pHA-
PUMA plasmid (Plasmid #16588, Addgene; ref. 15) using thefollowing pair of primers: PUMA-V-dsRed-F-EcoR1, 50-GCTA-GCGAATTCGCCGCCACCATGGCCCGCGCACGCCAG-30 andPUMA-V-dsRed-R-BamH1, 50-CCGCGGATCCATTGGGCTCCA-TCTCGGG-30. The PCR products were purified and cloned intothe EcoR1 and BamH1 restriction sites of the pCDH-CMV-EF1-dsRed viral vector (herein referred as V-PUMA-dsRed), and toallow sorting by flow cytometry using the red fluorescentprotein dsRed as a marker.
BH3 domain profiling in multiple myeloma cellsMM1R V-dsRed and MM1R V-PUMA-dsRed stable transduced
cells were subjected to BH3profiling as previously described (16).Briefly, cells were permeabilized with digitonin and exposed toBH3 peptides on a 384-well plate. Loss of mitochondrial trans-membrane potential loss induced by the peptides was measuredover a period of 3 hours with the help of the radiometric dye JC-1and a Tecan plate reader. Mitochondrial membrane depolariza-tion, expressed as a percentage of control values, was calculatedfrom the area under the curve for each peptide, and was normal-ized relative to the solvent-only control, dimethyl sulfoxide(DMSO), designated as 0%, and, as a positive control, the ion-ophore carbonyl cyanide p-trifluoromethoxyphenylhydrazone(FCCP), designated as 100%.
Locked nucleic acid miRNA in situ hybridization andimmunostaining
Locked nucleic acid miRNA in situ hybridization (LNA-ISH)was performed and analyzed as previously described (12) fol-lowing the instruction of the DIG Nucleic Acid Detection Kit(#11175041910; Roche). The sequences of digoxigenin (DIG)-labeled oligos were LNA-miR-222 (50-DIG-accCaGtAgCcAgaTg-TAgct-30), and LNA-miR-221 (50-DIG-gaaacCcaGcaGacAaTG-tAGct-30). Capital letters indicate LNA modification.
Immunostains were performed according to our routine pro-cedures (12). Briefly, formalin-fixed tissues were embedded inparaffin, sectioned, and stained with hematoxylin and eosin.Sections (4 mm) of formalin-fixed tissue were used for immuno-histochemical analysis after baking at 60�C for 1 hour, depar-affinization, and rehydration. The sections were then blocked forperoxidase activity with 3% hydrogen peroxide in methanol for10 minutes, washed under running water for 5 minutes, andfinally pressure-cooked at 123�C in citrate buffer (DAKO TargetRetrieval Solution, S1699) for antigen retrieval. The slides werecooled for 15 minutes, transferred to Tris-saline (TBS), andincubated with primary antibodies (5 mg/mL) or the correspond-ing IgG fractionof preimmune serumovernight at 4�C inblockingsolution consisting of containing 3% BSA in PBS. Anti-humanprimary specific antibodies included were PUMA (#AB9643,AbCam), BAX (#5023P; Cell Signaling Technology), and BAK(#6947S; Cell Signaling Technology), cleaved caspase-3 (#9664;Cell Signaling Technology), and were visualized with the aid ofthe corresponding biotinylated antibody coupled to streptavidin-peroxidase complex (Vector Labs). Optimal antibody concentra-tions were used according to recommendations of the manufac-turer. Incubations were carried out under a CO2 humidified
atmosphere at room temperature, and slides were incubated withVECTASTAIN Universal ABC Kit (Vector) for 30 minutes andrinsed with PBS between each incubation. The sections weredeveloped using 3,30-diaminobenzidine (DAB) (Sigma-Aldrich)as the substrate, and were counterstained with Mayer hematox-ylin. Frozen and formalin-fixed paraffin-embedded human pri-mary multiple myeloma cells were obtained from the TissueProcurement Facility at Dana-Farber Cancer Institute (DFCI,Boston, MA) in accord with Institutional Review Board protocols.For cleaved caspase-3 immunostains, cells were first spun downonto slides using a cytocentrifuge (Shandon), then fixed inmethanol:acetone for 2 minutes, and washed in PBS prior toimmunostaining.
Cell viability assayCell viability was assessed with MTT, as previously described
(17). A total of 1� 104MM1SV-GFP andMM1SV-miR-221–222-GFP stable transduced cells were seeded onto a 96-well plate, andafter 24 hours of incubation were treated with dexamethasone(20 mg/mL, Sigma-Aldrich), bortezomib (PS-341; Velcade;10 nmol/L, LC Laboratories), lenalidomide (1 mmol/L, AVAChem), melphalan (1 mmol/L, Sigma-Aldrich), doxorubicin(25 ng/mL, Sigma-Aldrich), or DMSO/Ethanol alone as controlfor 48 hours and then subjected to the MTT assay.
In vitro luciferase reporter assayTwo reporter plasmids that could recognize the miR-221–222
target PUMA30UTRwere constructed intopmiR-REPORTplasmid(#AM5795, Life Technologies), pmiR-PUMA-wt and pmiR-PUMA-mut, that served as conserved and nonconserved targetsites ofPUMA30-UTR, respectively. The sequenceswere as follows:pmiR-PUMA-wt(F), CGCGTGACTTTCTCTGCACCATGTAGCA-GACTTTCTCTGCACCATGTAGCAGACTTTCTCTGCACCATGTA-GCAGGATCCA; pmiR-PUMA-wt(R), AGCTTGGATCCTGCTACA-TGGTGCAGAGAAAGTCTGCTACATGGTGCAGAGAAAGTCTGC-TACATGGTGCAGAGAAAGTCA; pmiR-PUMA-Mut(F), CGCGT-GACTTTCTCTGCACCTACATCGTGACTTTCTCTGCACCTACATC-GTGACTTTCTCTGCACCTACATCGTGGATCCA; pmiR-PUMA-Mut (R), AGCTTGGATCCACGATGTAGGTGCAGAGAAAGTCAC-GATGTAGGTGCAGAGAAAGTCACGATGTAGGTGCAGAGAAA-GTCA. The primers were annealed and inserted into the pmiR-Reporter construct (Ambion). Empty pmiR plasmid (pmiR-0)served as a negative control. Triplicate samples of 1 � 104 MM1Sand MM1R cells in 24-well plates were transfected using Lipofec-tamine 2000 (Invitrogen)with 0.1mg of the reporter plasmids and0.05 mg of Renilla control plasmid (Promega). Six hours aftertransfection, the cells were fed with fresh DMEM with 10% FBSand incubated overnight. Cell extracts were then prepared, andluciferase assayswere performedusing theDual Luciferase Report-er Assay System (Promega). Luciferase activities were normalizedwith respect to parallel Renilla activities.
Mouse xenograft models of tumor burden and metastasisA total of 5 � 106 MM1S cells stably transduced with V-miR-
221–222-GFP or V-GFP and MM1R cells, stably transduced withV-as-miR-221–222-GFP or V-GFP, were injected via the tailvein into CB17.Cg-PrkdcscidLystbg-J/Crl mice (Code 250,Charles River) to establish a disseminated human multiple mye-loma xenograft model as previously described (12). Survivalwas evaluated from the first day of tumor injection untildeath. All mice were intraperitoneally injected with 9 mg/kg
Zhao et al.
Cancer Res; 75(20) October 15, 2015 Cancer Research4386
dexamethasone-21-phosphate disodium salt (Sigma-Aldrich) ondays 1–4, 9–12, and 17–20. Mice were observed daily andsacrificed when hind limb paralysis was detected. Hind limbparalysis and tumor burden were used as an endpoint. To assessin vivo cell proliferation, apoptosis, and expression of miR-221–222 target genes, GFP-positive tumor samples were excised forimmunohistochemical analysis, as in previous studies (12). Allexperiments involving animals were preapproved by the DFCIInstitutional Animal Care and Use Committee.
The MM1R-Luc-GFP tumor dissemination mouse modelTotally15NOD/SCIDmicewere injectedvia the tail veinwith5�
106MM1R-Luc-GFP cells (Gift fromDr. Constantine S.Mitsiades, atDFCI), and one week after injection, the mice were randomized toseparate to control and treated groups and treatedby intraperitonealinjection once a week with vehicle, RNA-LANCErII (BioScience) tocontrol mice, or 1:1 as-miR-221 and as-miR-222 (as-miR-221–222mix; 100 pmol total, pre-mixed in RNA-LANCErII) to treatmentgroup mice. All mice were intraperitoneally injected with 9 mg/kgdexamethasone-21-phosphate disodium salt (Sigma-Aldrich) ondays 2–5, 9–12, 17–20, and 25–28. Tumor development wasmonitored by whole-body imaging using a Xenogen system. Micewere evaluated every week after initiation of treatment, and survivalwas evaluated from the day of tumor injection until death.
Statistical analysisDifferences between groups were analyzed by the unpaired
Student t test (with the exception of survival curves). Kaplan–Meier survival curves were generated using Prism software andcompared using a log-rank test. In all statistical analyses, P� 0.05considered statistically significant.
ResultsDifferential expression of miR-221–222 in MM1S and MM1Rmyeloma cell lines
To study the mechanism of dexamethasone resistance in mul-tiple myeloma, two isogenic cell lines were previously generated(18): the parental cell lineMM1S and the resistantMM1R subline.To investigate a possible role of miRNAs in promoting dexameth-asone resistance in MM1R cells, we first performed genome-widemiRNA expression analysis in MM1R and MM1S cells usingmiRNA arrays. We found that 10 miRNAs were upregulated(Fig. 1A), whereas 12 others were downregulated in MM1R cells(Fig. 1B) versusMM1S cells. These results prompted us to examineCGH array data from the Broad Institute's Multiple MyelomaGenomics Portal (http://www.broadinstitute.org/mmgp/home;ref. 19). Copy numbers were log2-transformed prior to plottingusing the Broad's Integrative Genome Browser. Interestingly,analysis of the data revealed copy number gains in the X-chro-mosome of MM1R as compared with MM1S cells, without sig-nificant copy number differences in other chromosomal regions(Fig. 1C, top). Interestingly, miR-222 was among the upregulatedmiRNAs inMM1R cells. Increased levels ofmiR-221 andmiR-222expression inMM1R cells were confirmed using qRT-PCR (Fig. 2F,see below). More detailed examination of the X-chromosomerevealed that band p11.3, in which the miR-221–222 clusterresides, has a normal gene copy number in MM1S cells but istetraploid in MM1R cells (Fig. 1C, bottom). Taken together, thesefindings indicate that gene copy numbers contribute to higherexpression of the miR-221–222 in MM1R cells than in MM1S
cells, suggesting a possible pathogenetic role for this cluster indexamethasone resistance.
PUMA plays a key role in the dexamethasone resistance inMM1R cells
As dexamethasone promotes multiple myeloma cell deaththrough induction of apoptosis (20); we next examined expres-sion levels of proapoptotic factors inMM1SandMM1R cells usingimmunoblot analysis. As shown in Fig. 2A and SupplementaryFig. S1, PUMA expression was significantly decreased in MM1Rcells as compared with MM1S cells. In agreement with the wild-type status of p53 in these two cell lines (21), equal levels of p53protein were detected by immunoblots. To further verify thatPUMAplays amajor role in promoting dexamethasone resistanceinMM1R cells, we lentivirally transducedMM1R cells with vectorsexpressing dsRed protein alone as control (V-dsRed) or dsRed incombination with PUMA (V-PUMA-dsRed). To exclude possibleendogenous miRNA regulation of transduced PUMA, the mRNAencoding PUMA lacked 30UTR sequences. After flow cytometricsorting of dsRed-positive cells, stably V-PUMA-dsRed- and V-dsRed–transduced cells were first examined by Western blotanalysis (Fig. 2B) and immunohistochemical (Fig. 2C, top) anal-ysis to confirm increased PUMA expression in V-PUMA-dsRedcells, and then evaluated them for apoptosis in the absence orpresence of dexamethasone. As shown in Fig. 2C, apoptosisobserved by cleaved caspase-3 staining was greater in MM1R V-PUMA-dsRed cells than in V-dsRed cells, especially after treatmentwith dexamethasone. In addition, BH3 profiling revealed thatMM1R V-PUMA-dsRed cells were more primed to undergo apo-ptosis than V-dsRed cells (Fig. 2D), further highlighting the role ofPUMA as amediator of dexamethasone resistance inMM1R cells.
The 30UTRof PUMAmRNAs contains two binding sites formiR-221–222
We next investigated whether PUMA mRNA expression isregulated by miRNAs. We first used miRNA target predictiondatabases (TargetScan) to identify possible miRNAs targetingPUMA among the upregulated miRNAs in our MM1S and MM1RmiRNA profiling data (Fig. 1A). Interestingly, miR-221 and miR-222 were the top candidates that could target PUMA. Bioinfor-matics analysis indicated thatmiR-221 andmiR-222 share a singlebinding site on the 30UTR of PUMAmRNA, which turns out to beconserved across different species (Fig. 2E), suggesting a possiblerole for thesemiRNAs in regulating PUMA expression. The inversecorrelation of miR-221–222 and PUMA mRNA expression inMM1S andMM1R cells, as evaluated by qRT-PCR, further supportthis possibility (Fig. 2F).
To directly demonstrate a physical and functional interactionbetweenmiR-221–222and the30UTRofPUMA, wemade reporterconstructs containing empty (pmiR-0), wild-type (pmiR-PUMA-wt), and mutant (pmiR-PUMA-mut) sequences of the 30UTR ofPUMA mRNA (Fig. 2E). The constructs were transfected intoMM1S cells, which were subsequently mock-treated with cel-miR-67 or treated miR-221–222 (Fig. 3A). After documentingenforced expression of both miR-221 (Fig. 3A, top) and miR-222(Fig. 3A,middle) by qRT-PCR,weobserved thatwild-type, but notmutant, PUMA reporter activity was inhibited by miR-221–222(Fig. 3A, bottom). To further define the role of targetingmiR-221–222 as a way to abrogate dexamethasone resistance, MM1R cellstransduced with pmiR-0, pmiR-PUMA-wt, or pmiR-PUMA-mutreporter vectors were treated with control (scrambled miR) or
The Role of miR-221/222 in Multiple Myeloma Dexamethasone Resistance
www.aacrjournals.org Cancer Res; 75(20) October 15, 2015 4387
anti-sense (as) miR-221–222 (20-OMe as-miR-221–222) oligos(Fig. 3B). After confirming by qRT-PCR that expression of bothmiR-221 (Fig. 3B, top) and miR-222 (Fig. 3B, middle) wasefficiently knocked down, we observed that wild-type, but notmutant, PUMA reporter activity was restored (Fig. 3B, bottom).
As the AGO2/Dicer complex is known to recruit functionalmiRNAs (22), we performed the AGO2 pull-down RNA qRT-PCRassay to further evaluate whether PUMA mRNA is the target ofmiR-221–222 in multiple myeloma cells. As expected from ourprevious studies (Fig. 4), after ectopic upregulation of miR-221and miR-222 expression in MM1S cells and transduction with V-miR-221–222-GFP, there was significant downregulation of
PUMA mRNA in comparison with MM1S cells transduced withcontrol V-GFP (Supplementary Fig. S2A). In addition, weobserved that miR-221–222 and PUMA mRNA levels increasedin pulled-down AGO2 complexes from MM1S cells transducedwith V-miR-221–222-GFP (Supplementary Fig. S2B), indicatingthat upregulation of miR-221–222 recruits PUMA mRNA to theAGO2/Dicer complex.
miR-221–222 downregulates both PUMA mRNA and proteinexpression in MM1S cells in vitro
To examine whether miR-221 and miR-222 could inducedexamethasone resistance inmultiple myeloma cells, MM1S cells
Figure 1.Overexpression of miR-222 and gene copy gain in the X-chromosome of MM1R cells. Analysis of miRNA expression profiling using TaqMan Low DensitymicroRNAArray inMM1S andMM1Rcells reveals that severalmiRNAs are upregulatedwith lowCt number (A)while others are downregulatedwith highCt number (B)in MM1R cells as compared with MM1S cells. Ct, threshold cycle number. C, CGH array analysis of MM1S and MM1R cells shows gene copy number gainson the X-chromosome in MM1R as compared with MM1S cells (top). Closer examination of the X-chromosome reveals that band p11.3, where the miR-221–222cluster resides, has a normal gene copy number in MM1S cells (heatmap showing in light red color) but is tetraploid in MM1R cells (heatmap showing indark red; bottom).
Zhao et al.
Cancer Res; 75(20) October 15, 2015 Cancer Research4388
were lentivirally transducedwith vectors expressingGFP alone (V-GFP) or GFP and miR-221–222 (V-miR-221–222-GFP). Afterflow cytometric sorting of GFP-positive cells, stably transduced
MM1S V-miR-221–222-GFP and MM1S V-GFP cell lines wereexpanded, and expression of both miR-221 and miR-222 wasverified byqRT-PCR (Fig. 4A andB).PUMAmRNAexpression and
Figure 2.PUMA is the major proapoptotic target in dexamethasone (Dex)-resistant MM1R cells. A, immunoblot analysis of PUMA expression in MM1S and MM1R cells.B, immunoblot analysis showing increased expression of PUMA in MM1R cells lentivirally transduced with a vector encoding PUMA (V-PUMA-dsRed) ascompared with mock transduced cells (V-dsRed). C, immunocytochemical analysis of PUMA (top) and cleaved caspase-3 (middle) expression in MM1R cellstransduced with V-PUMA-dsRed and V-dsRed and treated (bottom) with dexamethasone or untreated (middle). D, BH3 profiling of MM1R cells transducedwith V-PUMA-dsRed and V-dsRed. E, miR-221 and miR-222 were predicted to bind to the 30UTR region of human PUMA mRNA. The seed sequence of themiR-221–222-binding site on the PUMA 30UTR, highly conserved in human (Hsa), mouse (Mm), and catfish (Cf), was replaced by the unrelated artificial sequenceshown in red on the pmiR-PUMA-mut reporter plasmid. F, comparative qRT-PCR analysis of miR-221 (left), miR-222 (middle), and PUMAmRNA (right) expressionin MM1S and MM1R cells. � , P < 0.05; �� , P < 0.01.
The Role of miR-221/222 in Multiple Myeloma Dexamethasone Resistance
www.aacrjournals.org Cancer Res; 75(20) October 15, 2015 4389
protein levels were also evaluated by qRT-PCR (Fig. 4C) andimmunoblot analysis (Fig. 4D), respectively. Most importantly,ectopic expression of miR-221–222 can render MM1S cells resis-tant to dexamethasone as documented by PARP and caspase-3activation detected byWestern blot analysis (Fig. 4E), aswell as by
viability assays (Fig. 4F). Stably transduced cells were also exam-ined by immunohistochemical analysis to assess the extent ofapoptosis in V-miR-221–222-GFP cells in the absence or presenceof dexamethasone. As shown in Fig. 4G, apoptosis as evaluated bycleaved caspase-3 expression, decreased inMM1S cells lentivirally
Figure 3.miR-221–222 targets PUMA expression throughbinding to the 30UTR region of mRNA. A, qRT-PCRanalysis of miR-221 (top) and miR-222 (middle)expression as well as reporter activity (bottom) inMM1S cells mock-transfected (cel-miR-67) ortransfected with miR-221–222. Wild-type (wt), butnot mutant (mut), pmiR-PUMA 30UTR reporteractivity was inhibited by miR-221–222. � , P < 0.05.B, qRT-PCR analysis of miR-221 (top) and miR-222(middle) expression as well as reporter activity(bottom) in MM1R cells mock-transfected(scrambled mRNA) or transfected with 20-OMe as-miR-221–222. Wild-type, but not mutant, pmiR-PUMA 30UTR reporter activity was increased byknockdown of miR-221–222. � , P < 0.05.
Zhao et al.
Cancer Res; 75(20) October 15, 2015 Cancer Research4390
transduced with V-miR-221–222-GFP versus V-GFP, especiallyafter treatment with dexamethasone.
Knockdown of miR-221 and miR-222 in MM1R cells partiallyrestores PUMA expression and dexamethasone sensitivity invitro
To evaluate the therapeutic role ofmiR-221–222 in vivo, wenextgenerated sponge lentivirus to obtain long-lasting knockdown ofmature miR-221 and miR-222 expression in vivo. We transducedMM1R cells with either V-GFP as a control or antisense miR-221–222 (V-as-miR-221–222-GFP) and assessed knockdown efficien-cy by qRT-PCR and Western blot analysis. As shown in Fig. 5A
and B, expression of both mature miR-221 and mature miR-222was efficiently knocked down. PUMA expression was found to berestored in V-as-miR-221–222-GFP cells as compared with stablyV-GFP–transduced MM1R cells checked by qRT-PCR (Fig. 5C) aswell as immunoblot (Fig. 5D) analysis. Most importantly, knock-down of miR-221–222 was able to resensitize MM1R cells todexamethasone as assessed by apoptosis (Fig. 5E and G) andviability (Fig. 5F) assays. Stably transduced cells were also exam-ined by immunohistochemical analysis to confirm restoration ofPUMA expression in V-as-miR-221–222-GFP MM1R cells, and todocument apoptosis in the absence or presence of dexametha-sone. As shown in Fig. 5G, cleaved caspase-3 immunostaining for
Figure 4.Enhanced miR-221–222 expressiondecreases PUMA expression in MM1Scells in vitro. qRT-PCR analysis of miR-221 (A) and miR-222 (B) expression inMM1S cells lentivirally transducedwithempty vector (V-GFP) or V-miR-221–222-GFP. �� , P < 0.01. Analysis ofPUMA expression at the mRNA (C)and protein (D) level in MM1S cellslentivirally transduced with emptyvector (V-GFP) or with V-miR-221–222-GFP. � , P < 0.05. E, immunoblotanalysis of PARP and caspase-3activation in MM1S cells lentivirallytransduced with empty vector(V-GFP) or with V-miR-221–222-GFP,in the presence or absence ofdexamethasone. F, viability assay ofMM1S cells lentivirally transducedwith empty vector (V-GFP) or withV-miR-221–222-GFP after treatmentwith dexamethasone. �� , P < 0.01.G, immunocytochemical analysis ofcleaved caspase-3 expression in MM1Scells lentivirally transduced withempty vector (V-GFP) or withV-miR-221–222V-GFP, then treatedwith dexamethasone (Dex) or leftuntreated.
The Role of miR-221/222 in Multiple Myeloma Dexamethasone Resistance
www.aacrjournals.org Cancer Res; 75(20) October 15, 2015 4391
apoptosis was increased in MM1R cells lentivirally transducedwith V-as-miR-221–222-GFP versus V-GFP–transduced controls,especially after treatment with dexamethasone.
miR-221–222 induces dexamethasone resistance in vivoTo further confirm the role of miR-221–222 in promoting
dexamethasone resistance in vivo, MM1S cells stably transducedwith V-GFP or V-miR-221–222-GFP, as well as MM1R cells stablytransduced with V-GFP or V-as-miR-221–222-GFP, were injectedvia the tail vein in our mouse model of multiple myelomadissemination (12). As in our in vitro studies showing that MM1S
V-miR-221–222-GFP cells became dexamethasone-resistant (Fig.4), mice injected with MM1S V-miR-221–222-GFP cells andtreated with dexamethasone were observed to have shorter sur-vival times than control mice injected with MM1S V-GFP cells(Fig. 6A). The levels of miR-221 (Supplementary Fig. S3A), miR-222 (Supplementary Fig. S3B), and PUMA (Supplementary Fig.S3C) in excised GFP-positive tumor xenografts were analyzed byqRT-PCR. As PUMA is a proapoptotic factor that may be involvedin other drug responses, we evaluated whether miR-221–222could enhance resistance to other drugs used in multiple myelo-ma. Interestingly, we found that overexpression of miR-221–222
Figure 5.Knockdown of miR-221–222 enhancesPUMAexpression inMM1R cells in vitro.qRT-PCR analysis of miR-221 (A) andmiR-222 (B) expression in MM1R cellslentivirally transduced with controlvector (V-GFP) or V-as-miR-221–222-GFP vector. �� , P < 0.01. Analysis ofPUMA expression at mRNA (C) andprotein (D) levels in V-GFP and V-as-miR-221–222-GFP MM1R cells. �, P <0.05. E, immunoblot analysis of PARPand caspase-3 activation in MMR1 cellsvirally transduced with V-GFP or V-as-miR-221–222-GFP and treated withdexamethasone or left untreated.F, viability assay of MMR1 cellstransduced with V-GFP and V-as-miR-221–222-GFP MM1R cells and treatedwith dexamethasone. � , P < 0.05.G, Immunocytochemical analysis ofPUMA and cleaved caspase-3expression in V-GFP and20-OMe–modified anti-miR-221–222-GFP MM1R cells treated withdexamethasone or left untreated.
Zhao et al.
Cancer Res; 75(20) October 15, 2015 Cancer Research4392
increased MM1S cell survival after treatment with valcade, lena-lidomide, melphalan, and doxorubicin (Supplementary Fig. S4).
As-miR-221–222 abrogate dexamethasone resistance of MM1Rcells in vivo
In contrast to preceding experiment, mice transplanted withMM1R V-as-miR-221–222-GFP cells and treated with dexameth-asone showed increased survival when compared with controlmice transplanted with MM1R V-GFP cells (Fig. 6A). These
changes in survival were associated with a lower tumor burdenin mice transplanted with V-as-miR-2221-221-GFP cells thanin mice transplanted with V-GFP cells as evaluated by whole-body imaging (Fig. 6B, top) aswell as histologic examination (Fig.6B, middle). We also observed that downstream target genes ofmiR-221–222, including PUMA, BAK, and BAX, were downregu-lated in V-miR-221–222-GFP MM1S tumors and upregulated inV-as-miR-221–222-GFP MM1R tumors in vivo (Fig. 6B, bottom).These results demonstrated that low miR-221–222 expression
Figure 6.miR-221–222 decreases survival of MM1S cells whereas as-miR-221–222 increases survival of MM1R cells in vivo. A, Kaplan–Meier survival plots of mice injectedvia the tail vein with lentivirally transduced MM1S V-GFP, MM1S V-miR-221–222-GFP, MM1R V-GFP, or MM1R V-as-miR-221–222-GFP cells and treated withdexamethasone (red arrows). � , P < 0.05. B, tumor burden at day 30 after tumor injection ofmice, as evaluated bywhole-body fluorescence imaging (top); standardhistology (middle); and immunohistochemical (bottom) analysis of PUMA, BAX, and BAK expression in GFP-positive tumors. As-miR-221–222 treatmentincreases survival and decreases tumor burden in MM1R-Luc-GFP bearingmice. C, Kaplan–Meier survival plots of mice treated with vehicle or with 20-OMe–modifiedas-miR-221–222 plus dexamethasone (red arrows) tail vein injection of MM1R-Luc-GFP cells. �, P < 0.05. D, Xenogen images of vehicle and as-miR-221–222-treated mice at different time points (7, 21, and 35 days) after vein tail injection of cells.
The Role of miR-221/222 in Multiple Myeloma Dexamethasone Resistance
www.aacrjournals.org Cancer Res; 75(20) October 15, 2015 4393
sensitized the MM1R cells to dexamethasone-induced growtharrest and apoptosis, thereby prolonging survival in tumor-bear-ing mice.
As-miR-221–222 treatment increases survival of MM1R cellsin vivo
We next performed a mouse xenograft experiment to evaluatethe therapeutic effect of in vivo delivery of 20-OMe–modifiedantisense-miR-221–222 (as-miR-221–222). We evaluated tumorgrowth in mice transplanted with MM1R-luc-GFP cells afterintraperitoneal delivery of as-miR-221–222 using lipid nanopar-ticles in combination with dexamethasone. As shown in Fig. 6C,survival increased in mice treated with as-miR-221–222 com-pared with mice treated with vehicle alone (52.4 � 10.2 days vs.36.1 � 4.1 days, P < 0.05.), and was associated with decreasedtumor burden as evaluated by Xenogen imaging (Fig. 6D).
High levels of miR-221–222 expression correlates with lowlevels of PUMA expression in multiple myeloma patientsamples
The above results prompted us to investigate the relationshipbetween miR-221–222 and PUMA mRNA levels in a large set ofmultiple myeloma cells from patients to assess the role of thesemolecules in drug resistance more broadly. We used publisheddatasets GSE16558 (23) for which both miRNA and mRNA geneexpression profiling were available. Interestingly, this analysisshoweda significant (P¼0.001) and inverse relationship betweenmiR-221 and PUMA mRNA expression (Fig. 7A). We furtherinvestigated this relationship using qRT-PCR in eighteenmultiplemyeloma patients for whom clinical information, mRNA sam-ples, and bone marrow biopsies were available (SupplementaryTable S1). Of these, 8 were from untreated, newly diagnosedpatients, and 10 were from patients with relapsed refractorymultiple myeloma. As shown in Fig. 7B, higher levels of miR-221 with corresponding lower levels of PUMA mRNA wereobserved in multiple myeloma cells from relapsed refractoryversus newly diagnosed patient. In the case ofmiR-222 andPUMAmRNA levels, this inverse correlation was less evident; however,samples from two refractory patients had relatively high levels ofmiR-222 expressionwith lower levels ofPUMAmRNAexpression.One sample (MM2) had high levels of both miR-221 and miR-222. To further investigate the relationship between miR-221–222 and the downstream targets PUMA, Bak and Bax, we per-formed LNA-ISH and immunohistochemical stains, respectively,on bone marrow biopsies. Interestingly, an inverse correlationwas observed betweenmiR-221–222 expression and PUMA, BAK,and BAX expression. Two representative cases, a newly diagnosedmultiple myeloma (MM2) and a refractory multiple myeloma(MM10), are show in Fig. 7C. Taken together, the results revealedhigher levels of miR-221 and/or miR-222 expression with corre-sponding lower levels of PUMA expression in a subset of samplesfrom refractory multiple myeloma patients as compared withthose fromuntreated, newly diagnosedmultiplemyeloma. There-fore, the miR-221–222 cluster, by regulating expression of theproapoptotic regulator PUMA, may more broadly mediate drugresistance leading to disease progression in multiple myeloma.
DiscussionDisease progression in multiple myeloma is due partly to
development of drug resistance. Dexamethasone is an effective
therapeutic agent against multiple myeloma; however, resistanceeventually develops, signaling the arrival of unwelcome relapse.Previous studies have shown that tumor cells from steroid-resis-tant multiple myeloma patients have lower expression of the GRthan those from steroid-sensitive patients, but the molecularmechanisms for clinical dexamethasone resistance remain poorlyunderstood. In this study, we offer the first evidence for a role ofthe miR-221–222 cluster in mediating dexamethasone resistanceand disease progression in multiple myeloma. Importantly, weprovide compelling preclinical proof-of-concept experiments set-ting the stage for a novel antisense pharmacologic strategy toabrogate dexamethasone resistance specifically linked toenhanced expression of the miR-221–222 cluster that downregu-lates PUMA expression. The latter is a Bcl-2 homology 3 (BH3)-only Bcl-2 family member, and a critical mediator of p53-depen-dent and -independent (FOXO3a and p73) apoptosis induced bya wide variety of stimuli, such as: genotoxic stress, deregulatedoncogene expression, toxins, altered redox status, growth factor/cytokine withdrawal, and infection while at the same time trig-gering drug resistance (24). Our experiments show that directtargeting of the miR-221–222 cluster can abrogate this generalmechanism of drug resistance, and because its target PUMA is adownstream regulator of apoptosis, it is likely that as-miR-221–222 therapy should not only overcome dexamethasone resistancebut also resistance to other drugs, including novel agents such asLenolinamide, as well as p-53-dependent and -independentmechanisms of drug resistance (Fig. 7D).
miR-221 and miR-222 are highly homologous miRNAsencoded as a cluster froma genomic region on the X-chromosome(9). They are widely overexpressed and involved in the patho-genesis of many human cancers including thyroid papillarycarcinoma (25), glioblastoma (26), colorectal (27), lung (28),pancreas (29), ovarian (30), breast (17), gastric (31), liver (32),and chronic lymphocytic leukemia (33) and lymphoma (34).Accumulating in vitro evidence implicates the miR-221–222 clus-ter as an oncogene that bypasses cell quiescence and increases thesurvival (35), proliferation (36), and metastatic potential ofcancer cells (37). This cluster has also been shown to promoteoncogenesis via downregulation of several tumor suppressorproteins including p27 (38, 39), p57 (35), PTEN (31), PUMA(40), BIM (11), TIMP3 (41), and many others (http://www.ncbi.nlm.nih.gov/pubmed/21743492; refs. 26, 42). We and othershave also found thatmiR-221–222 is highly expressed inmultiplemyeloma (10, 43), and we first time found that miR-221–222targets PUMA inmultiplemyeloma cells. However, in the referredstudy (44), it was found that PTEN, BIM, p27, and p57 were alsotargets of miR-221–222 in other multiple myeloma cell lines,indicating that the target of these miRNAs are cell type–specificand/or dependent on the physiologic or pathologic state ofthe cells.
Our studies further indicate that inhibition ofmiR-221–222 viaantisense therapy offers an enticing approach by which to over-come drug resistance more broadly. In dexamethasone resistanceas it operates in the MM1S/MM1R cellular model, the targetPUMA is downstream of the GR. Therefore, downregulatedexpression of PUMA mRNA via as-miR-221–222 therapy couldtrigger apoptosis independently of the status of theGR receptor. Inaddition, p53 mutations, which are highly recurrent in multiplemyeloma, and are associated with primary drug resistance (45),as-miR-221–222 treatment may abrogate drug resistance andpromote apoptosis even in the presence of p53 mutation by
Zhao et al.
Cancer Res; 75(20) October 15, 2015 Cancer Research4394
restore the expression of PUMAmRNA. Furthermore, our studiesdocumenting higher levels of miR-221–222 in refractory than innewly diagnosedmultiple myeloma patients suggest that as-miR-221–222 therapy may prevent, or at least delay, dexamethasoneresistance in particular and perhaps resistance more broadly inmultiple drugs such as valcade, lenalidomide, melphalan, and
doxorubicin. With regard to the possibility of overcoming mul-tiple myeloma resistance to Lenolinamide (46) using as-miR-221–22 therapy, it is worth mentioning that this effect is alsoexpected to take place by regulating PUMA levels and apoptosisrather than regulating the levels of Cerebron (CRBN) and thebinding proteins (IKZF-1 and IKZF-3) as no consensus bindings
Figure 7.Analysis of miR-221–222 and PUMA mRNA expression in multiple myeloma cells from patients. A, PUMA mRNA expression is inversely correlated withmiR-221 expression in multiple myeloma cells; analysis based on published data set GSE16558 (P ¼ 0.001). B, miR-221–222 levels are associated with lowerPUMA mRNA levels in multiple myeloma cells from patients with refractory disease. C, inverse correlation between miR-221–222 and PUMA protein expression byLNA-ISH and immunohistochemical analysis of bone marrow biopsies from multiple myeloma patients with newly diagnosed or refractory disease. Tworepresentative cases are shown, new (MM2) and refractory myeloma (MM10). D, schematic model for upregulation of the proapoptotic protein PUMA byanti-miR-221–222 therapy in multiple myeloma. Anti-mR-221–222 therapy, by increasing the level of PUMA, which is downstream of GR and p53, may abrogatedrug resistance associated with p53 inactivation and decreased GR expression.
The Role of miR-221/222 in Multiple Myeloma Dexamethasone Resistance
www.aacrjournals.org Cancer Res; 75(20) October 15, 2015 4395
sites for miR-221–222 are present in the 30 UTR of CRBN mRNA(data not shown). Althoughour studies indicate that as-miR-221–222 could be used as a therapy to overcome drug resistance inmultiple myeloma patients, additional preclinical studies will beneeded to further validate this hypothesis. In addition, thesestudies should include the development of better delivery systemsthat could provide tumor specific uptake of miRNAs and avoidoff-target effects.
Finally, miR-221–222 expression may be a useful prognosticmarker in diffuse large B-cell lymphoma (47), papillary thyroidcarcinoma (48), and lung cancer (49). In light of our findings, useof these miRNAs to predict prognosis and clinical response todexamethasone and/or other drugs warrants similar evaluation inpatients with multiple myeloma.
Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.
Authors' ContributionsConception and design: J.-J. Zhao, Z.-B. Chu, J.Q. Cheng, R.D. CarrascoDevelopment of methodology: J.-J. Zhao, Z.-B. Chu, Z. Wang, Y. Zhou,R.D. Carrasco
Acquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): J.-J. Zhao, Z.-B. Chu, Y. Hu, J. Lin, Z. Wang, M. Jiang,M. Chen, T.N. Chonghaile, M.E. Johncilla, A. LetaiAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): J.-J. Zhao, Z.-B. Chu, Z. Wang, X. Wang, Y. Kang,J.Q. Cheng, A. Letai, N.C. Munshi, K.C. AndersonWriting, review, and/or revision of the manuscript: J.-J. Zhao, Z.-B. Chu,N.C. Munshi, K.C. Anderson, R.D. CarrascoAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): J.-J. Zhao, Z.-B. Chu, M.E. Johncilla, Y.-T. Tai,R.D. CarrascoStudy supervision: J.-J. Zhao, Y. Hu, R.D. Carrasco
AcknowledgmentsJ.J. Zhao is supported by aMultiple Myeloma Research Foundation (MMRF)
research fellow award and by a Pathway to Independence Award(1K99CA172292) from the NIH. T.N. Chonghaile is supported by an MMRFresearch fellow award. Z.B. Chu and Z. Wang are supported by a ChinaScholarship Council (CSC) award. D.R. Carrassco is supported by an MMRFsenior award from the Doctors Cancer Foundation and a research grant(1R01CA151391) from the NIH.
Received February 17, 2015; revised June 10, 2015; accepted June 29, 2015;published OnlineFirst August 6, 2015.
References1. Anderson KC, Alsina M, Bensinger W, Biermann JS, Cohen AD, Devine S,
et al. Multiple myeloma, version 1.2013. J Natl Compr Canc Netw2013;11:11–7.
2. Villunger A,Michalak EM,Coultas L,Mullauer F, BockG, AusserlechnerMJ,et al. p53- and drug-induced apoptotic responses mediated by BH3-onlyproteins puma and noxa. Science 2003;302:1036–8.
3. Sharma S, Lichtenstein A. Dexamethasone-induced apoptotic mechanismsin myeloma cells investigated by analysis of mutant glucocorticoid recep-tors. Blood 2008;112:1338–45.
4. Fisher C, Coleman T, Plant N. Probabilistic orthology analysis of the ATP-binding cassette transporters: implications for the development ofmultipledrug resistance phenotype. Drug Metab Dispos 2012;40:1397–402.
5. Cheung WC, Van Ness B. The bone marrow stromal microenvironmentinfluences myeloma therapeutic response in vitro. Leukemia 2001;15:264–71.
6. Pasquinelli AE, Reinhart BJ, Slack F, Martindale MQ, Kuroda MI, Maller B,et al. Conservation of the sequence and temporal expression of let-7heterochronic regulatory RNA. Nature 2000;408:86–9.
7. Ambros V. microRNAs: tiny regulators with great potential. Cell 2001;107:823–6.
8. LofflerD, Brocke-Heidrich K, PfeiferG, Stocsits C,Hackermuller J, Kretzsch-mar AK, et al. Interleukin-6 dependent survival of multiple myeloma cellsinvolves the Stat3-mediated induction of microRNA-21 through a highlyconserved enhancer. Blood 2007;110:1330–3.
9. KimYK, Yu J,HanTS, Park SY,NamkoongB, KimDH, et al. Functional linksbetween clustered microRNAs: suppression of cell-cycle inhibitors bymicroRNA clusters in gastric cancer. Nucleic Acids Res 2009;37:1672–81.
10. Lionetti M, Biasiolo M, Agnelli L, Todoerti K, Mosca L, Fabris S, et al.Identification of microRNA expression patterns and definition of a micro-RNA/mRNA regulatory network in distinct molecular groups of multiplemyeloma. Blood 2009;114:e20–6.
11. Terasawa K, Ichimura A, Sato F, Shimizu K, Tsujimoto G. Sustainedactivation of ERK1/2 by NGF induces microRNA-221 and 222 in PC12cells. FEBS J 2009;276:3269–76.
12. Zhao JJ, Lin J, Zhu D, Wang X, Brooks D, Chen M, et al. miR-30–5pfunctions as a tumor suppressor and novel therapeutic tool by targetingthe oncogenic Wnt/beta-catenin/BCL9 pathway. Cancer Res 2014;74:1801–13.
13. Zhao JJ, Lin J, Lwin T, Yang H, Guo J, Kong W, et al. microRNA expressionprofile and identification of miR-29 as a prognostic marker and pathoge-netic factor by targeting CDK6 in mantle cell lymphoma. Blood 2010;115:2630–9.
14. Meier J, Hovestadt V, ZapatkaM, Pscherer A, Lichter P, Seiffert M. Genome-wide identification of translationally inhibited and degraded miR-155targets using RNA-interacting protein-IP. RNA Biol 2013;10:1018–29.
15. Yu J, Zhang L, Hwang PM, Kinzler KW, Vogelstein B. PUMA induces therapid apoptosis of colorectal cancer cells. Mol Cell 2001;7:673–82.
16. Ni Chonghaile T, Sarosiek KA, Vo TT, Ryan JA, Tammareddi A, Moore VdelG, et al. Pretreatment mitochondrial priming correlates with clinicalresponse to cytotoxic chemotherapy. Science 2011;334:1129–33.
17. Zhao JJ, Lin J, Yang H, Kong W, He L, Ma X, et al. MicroRNA-221/222negatively regulates estrogen receptor alpha and is associated with tamox-ifen resistance in breast cancer. J Biol Chem 2008;283:31079–86.
18. Greenstein S, Krett NL, Kurosawa Y, Ma C, Chauhan D, Hideshima T, et al.Characterization of theMM.1 humanmultiplemyeloma (MM) cell lines: amodel system to elucidate the characteristics, behavior, and signaling ofsteroid-sensitive and -resistant MM cells. Exp Hematol 2003;31:271–82.
20. Distelhorst CW. Recent insights into the mechanism of glucocorticoster-oid-induced apoptosis. Cell Death Differ 2002;9:6–19.
21. Saha MN, Jiang H, Chang H. Molecular mechanisms of nutlin-inducedapoptosis inmultiplemyeloma: evidence for p53-transcription-dependentand -independent pathways. Cancer Biol Ther 2010;10:567–78.
22. Chendrimada TP, Gregory RI, Kumaraswamy E, Norman J, Cooch N,Nishikura K, et al. TRBP recruits the Dicer complex to Ago2 for microRNAprocessing and gene silencing. Nature 2005;436:740–4.
23. Gutierrez NC, Sarasquete ME, Misiewicz-Krzeminska I, DelgadoM, De LasRivas J, Ticona FV, et al. Deregulation of microRNA expression in thedifferent genetic subtypes of multiple myeloma and correlation with geneexpression profiling. Leukemia 2010;24:629–37.
24. Yu J, Zhang L. PUMA, a potent killer with or without p53. Oncogene2008;27:S71–83.
25. Le Pennec S, Savagner F. [MiRNAs in follicular thyroid tumors]. PresseMed2011;40:683–9.
26. Quintavalle C, Garofalo M, Zanca C, Romano G, Iaboni M, Del Basso DeCaro M, et al. miR-221/222 overexpression in human glioblastomaincreases invasiveness by targeting the protein phosphate PTPmu. Onco-gene 2012;31:858–68.
27. Pu XX, Huang GL, Guo HQ, Guo CC, Li H, Ye S, et al. Circulating miR-221directly amplified from plasma is a potential diagnostic and prognosticmarker of colorectal cancer and is correlated with p53 expression.J Gastroenterol Hepatol 2010;25:1674–80.
Cancer Res; 75(20) October 15, 2015 Cancer Research4396
28. Navarro A, Marrades RM, Vinolas N, Quera A, Agusti C, Huerta A, et al.MicroRNAs expressed during lung cancer development are expressedin human pseudoglandular lung embryogenesis. Oncology 2009;76:162–9.
29. Greither T, Grochola LF, Udelnow A, Lautenschlager C, Wurl P, TaubertH. Elevated expression of microRNAs 155, 203, 210 and 222 inpancreatic tumors is associated with poorer survival. Int J Cancer 2010;126:73–80.
30. Vaksman O, Stavnes HT, Kaern J, Trope CG, Davidson B, Reich R. miRNAprofiling along tumour progression in ovarian carcinoma. J Cell Mol Med2010;15:1593–602.
31. Chun-Zhi Z, Lei H, An-Ling Z, Yan-Chao F, Xiao Y, Guang-Xiu W, et al.MicroRNA-221 and microRNA-222 regulate gastric carcinoma cell prolif-eration and radioresistance by targeting PTEN. BMC Cancer 2010;10:367.
32. Pineau P, Volinia S,McJunkin K,Marchio A, BattistonC, Terris B, et al.miR-221overexpression contributes to liver tumorigenesis. ProcNatl Acad SciUS A 2010;107:264–9.
33. FerracinM, Zagatti B, Rizzotto L, Cavazzini F, Veronese A, CicconeM, et al.MicroRNAs involvement in fludarabine refractory chronic lymphocyticleukemia. Mol Cancer 2010;9:123.
34. Lawrie CH, Soneji S, Marafioti T, Cooper CD, Palazzo S, Paterson JC, et al.MicroRNA expression distinguishes between germinal center B cell-likeand activated B cell-like subtypes of diffuse large B cell lymphoma. Int JCancer 2007;121:1156–61.
35. Medina R, Zaidi SK, Liu CG, Stein JL, van Wijnen AJ, Croce CM, et al.MicroRNAs 221 and 222 bypass quiescence and compromise cell survival.Cancer Res 2008;68:2773–80.
36. Yang CJ, Shen WG, Liu CJ, Chen YW, Lu HH, Tsai MM, et al. miR-221 andmiR-222 expression increased the growth and tumorigenesis of oralcarcinoma cells. J Oral Pathol Med 2011;40:560–6.
37. Liu X, Yu J, Jiang L, Wang A, Shi F, Ye H, et al. MicroRNA-222 regulates cellinvasion by targeting matrix metalloproteinase 1 (MMP1) andmanganesesuperoxide dismutase 2 (SOD2) in tongue squamous cell carcinoma celllines. Cancer Genomics Proteomics 2009;6:131–9.
38. Galardi S, Mercatelli N, Giorda E, Massalini S, Frajese GV, Ciafre SA, et al.miR-221 and miR-222 expression affects the proliferation potential ofhuman prostate carcinoma cell lines by targeting p27Kip1. J Biol Chem2007;282:23716–24.
39. le Sage C, Nagel R, Egan DA, Schrier M, Mesman E, Mangiola A, et al.Regulation of the p27(Kip1) tumor suppressor by miR-221 and miR-222promotes cancer cell proliferation. EMBO J 2007;26:3699–708.
40. Zhang C, Zhang J, Zhang A, Wang Y, Han L, You Y, et al. PUMA is a noveltarget of miR-221/222 in human epithelial cancers. Int J Oncol 2010;37:1621–6.
41. Lu Y, Roy S, Nuovo G, Ramaswamy B, Miller T, Shapiro C, et al. Anti-microRNA-222 (anti-miR-222) and -181B suppress growth of tamoxifen-resistant xenografts in mouse by targeting TIMP3 protein and modulatingmitogenic signal. J Biol Chem 2011;286:42292–302.
42. Stinson S, Lackner MR, Adai AT, Yu N, Kim HJ, O'Brien C, et al. miR-221/222 targeting of trichorhinophalangeal 1 (TRPS1) promotes epithelial-to-mesenchymal transition in breast cancer. Sci Signal 2011;4:pt5.
43. Lionetti M, Agnelli L, Mosca L, Fabris S, Andronache A, Todoerti K, et al.Integrative high-resolution microarray analysis of human myeloma celllines reveals deregulated miRNA expression associated with allelic imbal-ances and gene expression profiles. Genes Chromosomes Cancer 2009;48:521–31.
44. DiMartinoMT,Gulla A, CantafioME, LionettiM, Leone E, AmodioN, et al.In vitro and in vivo anti-tumor activity of miR-221/222 inhibitors inmultiple myeloma. Oncotarget 2013;4:242–55.
45. Neri A, Baldini L, TreccaD,Cro L, Polli E,Maiolo AT. p53 genemutations inmultiple myeloma are associated with advanced forms of malignancy.Blood 1993;81:128–35.
46. Ocio EM, Fernandez-Lazaro D, San-Segundo L, Lopez-Corral L, CorcheteLA, Gutierrez NC, et al. In vivo murine model of acquired resistance inmyeloma reveals differential mechanisms for lenalidomide and pomali-domide in combinationwith dexamethasone. Leukemia 2015;29:705–14.
47. Alencar AJ, Malumbres R, Kozloski GA, Advani R, Talreja N, Chinichian S,et al. MicroRNAs are independent predictors of outcome in diffuse largeB-cell lymphoma patients treated with R-CHOP. Clin Cancer Res 2011;17:4125–35.
48. Yip L, Kelly L, Shuai Y, Armstrong MJ, Nikiforov YE, Carty SE, et al.MicroRNA signature distinguishes the degree of aggressiveness of papillarythyroid carcinoma. Ann Surg Oncol 2011;18:2035–41.
49. Lin Q, Mao W, Shu Y, Lin F, Liu S, Shen H, et al. A cluster of specifiedmicroRNAs in peripheral blood as biomarkers formetastatic non-small-celllung cancerby stem-loopRT-PCR. JCancerResClinOncol2012;138:85–93.
www.aacrjournals.org Cancer Res; 75(20) October 15, 2015 4397
The Role of miR-221/222 in Multiple Myeloma Dexamethasone Resistance
2015;75:4384-4397. Published OnlineFirst August 6, 2015.Cancer Res Jian-Jun Zhao, Zhang-Bo Chu, Yu Hu, et al. Dexamethasone Resistance in Multiple Myeloma
222/PUMA/BAK/BAX Pathway Abrogates−Targeting the miR-221
Updated version
10.1158/0008-5472.CAN-15-0457doi:
Access the most recent version of this article at:
