Regulation of the anaerobic

responsive transcription factor TdcA

in Salmonella Typhimurium

BA Microbiology Thesis 2014

James Britton

Page | 1

I, James Britton, certify that the experimentation recorded herein represents my own work.

I further certify that I have read the University regulations concerning plagiarism contained

within The University of Dublin Calendar 2012 – 2013 Part 1, H19-H21 and that this thesis

represents my own unaided work.

Signature: .

Date: .

Page | 2

ABSTRACT

The anaerobically induced tdc operon of Salmonella Typhimurium is involved in the transport

and metabolism of amino acids L-threonine and L-Serine to provide cellular metabolites and

ATP during anaerobiosis. The first gene in the operon tdcA has been implicated in the regulation

of various virulence traits including flagella formation and expression of Salmonella Pathogenicity

Islands 1 and 2. As of yet there have been few investigations into how tdcA is regulated in

Salmonella, despite this there are multiple studies into its expression in Escherichia coli which have

uncovered a complex regulatory system involving multiple factors including TdcA itself,

principle control of the operon comes from the binding of the cAMP receptor protein (CRP).

Due to the similarities in binding sites of key transcription factors of tdcA between E. coli and

Salmonella the effects of these key players have not been investigated in detail. In this study both

transcriptional and DNA binding analyses of the tdcA promoter and coding sequence (CDS)

were carried out with respect to CRP, FNR and H-NS. CRP showed a similar regulatory role in

Salmonella as in E. coli. H-NS was found to have reduced binding under anaerobic shock and had

a positive transcriptional effect. FNR showed increased association with the tdcA promoter

under anaerobic shock, it also had a negative effect on transcription, very unlike the role of FNR

in E. coli transcription in which it acts as an indirect positive regulator. These interesting results

may point the way towards a novel method of regulation of tdcA in Salmonella.

Page | 3

INTRODUCTION

Salmonella Typhimurium is a Gram-negative facultative anaerobe which can cause enteric

disease if ingested. During the infection cycle of Salmonella it encounters varying oxygen

conditions, consequently Salmonella and other enteric bacteria such as Escherichia coli have

developed various mechanisms to survive and infect in limited oxygen environments.

Both E. coli and Salmonella contain the anaerobically transcribed tdc operon which is involved in

both the transport and catabolism of L-threonine and L-serine (15; 35). During anaerobiosis the

tdc operon provides ATP to the cell and helps form both propionate and acetate from L-

threonine and L-serine respectively, both of which can be used in further metabolism and amino

acid production (35). However since the divergence of these species over 100-160 million years

ago (29) the tdc operon has changed much between the species. The E. coli tdc operon contains 8

genes; tdcA-G and the oppositely transcribed tdcR. tdcB-G encode proteins involved in the

metabolism of L-threonine and L-Serine. The dehydratase TdcB, the propionate kinase TdcD

and the 2-ketobutyrate-lyase TdcE are all involved in the metabolism of L-threonine to

propionate as shown in Fig. 1 (17; 35). TdcC is a membrane associated permease which allows

both L-serine and L-threonine into the cell (41), TdcG is another dehydratase which acts on L-

serine and the function of tdcF has not yet been elucidated (4). tdcA and tdcR are both

transcription factors which are needed for the full induction of the tdc operon (37; 46).

While the E. coli tdc operon contains 8 genes the tdc operon of Salmonella only has 6 (Fig. 2);

tdcA, B, C, D, E and G. These conserved genes are roughly 80% identical to their counterparts in

E. coli (21).

FIG. 1. Metabolism of L-threonine involving products of the tdc operon. L-threonine is dehydrated into 2-ketobutyrate via TdcB. The 2-ketobutyrate is then converted to propionyl –CoA by TdcE and further to Propionyl-P by Pta (Phosphotransacetylase) which is then converted to propionate by TdcD with the release of ATP. Adapted from Hesslinger 1998(17).

Page | 4

FIG. 2. Basic representation of the tdc operon region of (A) E. coli and (B) Salmonella. Salmonella has lost the tdcR and tdcF genes since the divergence of the two species.

The tdc operon is under complex regulation in both E. coli and Salmonella. In the past there have

been many studies into the regulation of the tdc operon, particularly in E. coli.

Evidence for an anaerobically active threonine dehydratase now known as TdcB in E. coli has

been available as early as 1957 (42). In the intervening years there have been many investigations

into the regulation of the tdc operon (12; 15; 33; 36). It is now known that the tdc operon of E.

coli is under complex regulation influenced by at least 5 factors. The tdc operon induction is

maximized in E. coli when it has been grown under anaerobic conditions in a medium containing

no primary catabolite repressing sugars but is rich in amino acids (13).

The reason why this growth condition causes the highest levels of tdc transcription is likely due

to the effect it has on cyclic AMP (cAMP) levels (38). When in conditions where a secondary

catabolite must be utilized, concentrations of cAMP increase (3). Cyclic AMP levels also rise

upon anaerobic shock (33) and this has been linked to increased tdc expression.

The factor which has the largest influence on the transcription of tdc is the cAMP receptor

protein (CRP) cAMP complex which has been shown to bind to the tdcA promoter of E. coli at

around position -43.5 relative to the transcription start site (36; 46). The cAMP-CRP complex

binds promoter sequences and regulates the transcription of over 100 genes in E. coli (2). The

binding of CRP at -43.5 is unusual for class II CRP dependent promoters at which CRP usually

binds at -41.5 relative to the start site (5). It has been suggested that altering of DNA

supercoiling at the tdcA promoter may be involved in activation of tdcA by allowing CRP bound

at -43.5 to come into contact with RNA polymerase (36). However CRP binding alone is not

enough to facilitate tdc transcription. Studies have shown that Integration host Factor (IHF), a

protein which is known to induce sharp bends in DNA, binds the tdcA promoter at -104 and is

necessary for transcription (46). It is possible that IHF acts at the tdcA promoter as it does in the

Page | 5

fim switch of type 1 fimbriae; causing DNA bending which allows for activation by repositioning

other transcription factors (7).

Supercoiling of DNA has also been implicated in the regulation of the tdc operon; analyses of

both DNA gyrase and topoisomerase 1 have shown that relaxation of DNA supercoiling

increases tdc transcription (45). Another nucleoid associated protein, HU, also exerts an effect on

tdc transcription. HU negatively effects the expression of tdcA by altering the topology of the

DNA (45).

The global regulator of anaerobic metabolism FNR (14; 31; 40) has also been indirectly

implicated in the transcription of tdcA, it has been suggested that even though there is possible a

FNR binding site in the tdcA promoter region the effect of FNR on tdc transcription comes

solely through the accumulation of metabolites of anaerobic metabolism (6).

In addition to the global regulators mentioned the two regulatory proteins encoded in the tdc

operon tdcA and tdcR which are both needed for full induction of tdc transcription. tdcA is a LysR

type transcriptional regulator (LTTR) which has been shown to bind to the tdc promoter at -175

(16). tdcR is immediately upstream of tdcA in E. coli facing in the opposite transcriptional

direction and is also needed for full tdc induction (16).

TdcA is a 78kDa protein which is part of the LTTRs family of transcriptional regulators.

LTTRs contain a helix-turn-helix DNA binding domain (28) and are known to bind co-inducing

molecules, which, when bound allows LTTRs to bind the promoter region of genes allowing for

efficient transcription of target genes (28). It is possible that in the case of tdcA the co-inducer to

which it binds may be a metabolite of anaerobic metabolism induced by FNR. LTTRs are a well-

conserved protein family and as such have in many cases evolved global regulatory roles in many

different cellular functions (10; 27; 39).

However, these studies focused on the regulation of the tdc operon in E. coli. As mentioned, the

tdc operon in Salmonella is quite different than that of E. coli in that it lacks both the tdcR and tdcF

genes (21). Maximal expression of tdcA in Salmonella occurs 30 minutes after log phase cultures

are anaerobically shocked and decreases thereafter, while in E. coli expression of tdcA rose post

anaerobic shock and then remained constant; this difference has been attributed to the tdcR gene

as its removal resulted in E. coli tdcA expression patterns resembling those of Salmonella (20).

TdcA in Salmonella has been found to play a role in virulence (19; 24). Mutational analysis of

tdcA in Salmonella has found that tdcA mutants have reduced flagellar biosynthesis (19) and

reduced SPI-1 and SPI-2 expression (24). tdcA mutants showed reduced expression of the

flagellar regulator fliZ (19). fliZ is also known to regulate hilA a positive regulator of SPI-1 (26).

Page | 6

However it is not yet known whether TdcA effects the transcription of hilA and various genes in

both SPI-1 and SPI-2 directly or by an indirect means.

The effects the nucleoid associated proteins H-NS and FIS on Salmonella tdcA expression has

been investigated and it has been found that H-NS inhibits expression while deletion of FIS

delays it (21). It is unknown whether either of these factors directly affect tdcA transcription: it is

possible that both Fis and H-NS directly bind to the tdcA promoter but no studies have shown

this as of yet.

From bioinformatic analysis of both the E. coli and Salmonella tdc promoter sequences it is seen

that the binding sites of CRP, IHF and TdcA in E. coli are quite well-conserved in Salmonella and

from this past investigations have assumed that the part these proteins play in Salmonella tdc

regulation is the same as that in E. coli (20). This assumption may be premature, the

aforementioned reports on the differential expression of tdcA in the two species as well as the

fact that the promoter sequence of tdcA is only 62% conserved between the species (20), makes

one question the validity of assumptions on this complex promoter system.

In this investigation both the regulation and regulon of tdcA were investigated. Attempts were

made to construct both Salmonella ∆tdcA and tdcA-FLAG strains in order to identify members of

the tdcA regulon. Transcriptional analysis of tdcA using various knockouts were carried out to

explore the regulation of tdcA expression, additionally DNA binding affinities of key proteins to

the tdcA promoter were analysed to determine if these proteins exerted direct or indirect effects

on expression as understanding of the regulation of this key transcription factor is integral to

understanding of Salmonella virulence.

Page | 7

MATERIALS AND METHODS

Bacterial Strains and growth media

All bacteria were grown at 37oC with shaking at 200 rpm in Lysogeny broth (LB Sigma, Cat #:

L3022) with the exception of strains harbouring temperature sensitive plasmid pKD46 which

were grown at 30oC. Stationary phase cultures which had grown overnight were added to fresh

LB at a dilution of 1:100 and grown to various growth phases. Cultures which harboured the

pKD46 plasmid were inoculated with arabinose at an OD600 of 0.1 to induce recombinase

expression. Cultures for ChIP qPCR and RT-PCR underwent anaerobic shock once desired

growth had been met. Anaerobic shock was administered via transferring 15/50ml of culture to

15 or 50ml falcon tubes and sealing; cultures were incubated at 37oC for 30 minutes while

stationary to maximize tdcA expression (20). Antibiotics were added to cultures when necessary

using the following concentrations: Chloramphenicol (Cl) 25µg/ml, Kanamycin (Kan) 100µg/ml

and Carbenicillin (Cb) 100µg/ml. A list of all strains and plasmids used is shown in table 1.

TABLE 1. Bacterial Strains and Plasmids used in this investigation.

Strain Description Source

SL1344 Wild Type parental strain Laboratory stock SL1344 pKD46 SL1344 + Temperature sensitive pKD46 Laboratory stock SL1344 Flag hns SL1344 hns:kanRFLAG Laboratory stock JH3567 SL1344 ∆hns::CbR J. Hinton Laboratory SL1344 Flag crp SL1344 crp:kanRFLAG Laboratory stock SL1344 ∆crp SL1344 ∆crp::CbR Laboratory stock ST474 Flag fnr ST474 fnr:kanRFLAG Laboratory stock JH3307 SL1344 ∆fnr::CbR J. Hinton Laboratory Plasmids pKD46 Temperature sensitive (30oC) plasmid

with CmR cassette and arabinose inducible recombinases.

Laboratory stock

pSUB11 Template for creation of tdcA Flag strain. Contains KanR cassette.

Laboratory stock

pKD3 Template for creation of ∆tdcA strain. Contains ClR cassette.

Laboratory stock

Primer design for strain construction Primers for creation of SL1344 Flag tdcA and SL1344 ∆tdcA strains were designed using the

Primer 3 website (43). Both forward and reverse primers for the SL1344 ∆tdcA strain were made

by using priming sites for the 3 and 5 prime ends of the Cb resistance cassette of the pkD3

plasmid attached to sequences homologous to before the transcription start codon and after the

stop codon. Similarly primers for the SL1344 Flag tdcA strain were made by using priming

sequences designed to amplify the kan resistance cassette attached to sequences homologous to

upstream and downstream of the tdcA stop codon. All primers were ordered from Integrated

Page | 8

DNA technologies. Primer sets for both Flag tdcA and ∆tdcA strain creation are shown in Table

2.

TABLE 2. Primers used for Strain construction. The final 20 3’ bases of each primer are homologous to plasmid resistance cassettes. The proximal portion of the primer is homologous to the SL1344 chromosome.

tdcA::kanRFLAG

Pf 5’-TGGATGCAGACGCAGGCAGTTAATAGAAATTGAA GACTACAAAGACCATGACGG-‘3

Pr 5’-AGGTGACGTCAATTTCGCTAAATATGTTTATTCCATA CATATGAATATCCTTAG-‘3

ΔtdcA::CbR

Pf 5’-TTTAATTTGCTACACTTCCTATGGAATAAACATATTTAGCGAAATTGACGT GAAGCAGCTCCAG‘-3

Pr 5’-ACTGTTCAAAAGAAACAGGTGACGTCAATTTCGCTAAATATGTTTATT CCATAGGACCATGGCTAATTCCCAT-‘3

Strain Construction

Salmonella enterica serovar Typhimurium strain SL1344 was used as the parental strain for all

experiments in this investigation. Attempts using both the one-step gene inactivation method (8)

and an epitope tagging method (44) were made to construct SL1344 ∆tdcA strain and Flag tdcA

strains. A Chloramphenicol resistance (CatR) cassette and a Kanamycin resistance (KanR)

cassette from pKD3 and pSUB11 respectively were amplified using the New England Biolabs

Phusion High-fidelity polymerase according to the manufacturers specifications (0.5µM Pf,

0.5µM Pr, 1 unit of Phusion) to create SL1344 ∆tdcA and SL1344 Flag tdcA strains using primers

shown in Table 2. To determine if PCR products of the correct size had formed aliquots of PCR

product were submitted to gel electrophoresis in a 1% TAE Agarose gel. PCR product was

purified using either the Qiagen QIAquick PCR purification kit according to the manufacturers

specifications or Phenol-Chloroform extraction as described by Sambrook (34). At the same

time strain SL1344 pKD46 was grown from a stationary overnight to an OD600 of 0.5 in 20ml

fresh LB. Arabinose was added at an OD600 of 0.1 to induce recombinase expression. Cells were

then made electrocompetent. Cells were pelleted at 4,000 rpm at 4oC for 10 minutes and

resuspended in 10ml of ice cold H2O followed by ice incubation for 20 minutes. Cells were

sedimented using the same conditions and resuspended in 1ml H2O. Cells were then pelleted at

6,000 rpm for 5 minutes and resuspended in 1ml H2O, this was carried out twice. After the

second resuspension cells were resuspended in 200µl H2O. These cells were now

electrocompetent.

Page | 9

Purified PCR product was electroporated into electrocompetent cells using the Bio-Rad Gene

pulser. Cells from both of these procedures were plated out on the appropriate antibiotic agar

and allowed to grow overnight.

There was no growth on any of the inoculated plates. To remedy this the DNA purification

method was changed by use of Phenol-Chloroform extraction and elution of DNA in filter

sterilized H2O to remove excess salts. Fresh stocks of arabinose were used in making cells

electrocompetent. The electroporator used was changed and electroporated cells were plated out

on agar containing lower antibiotic concentrations.

Primer design for ChIP and RNA extraction experiments

Primers were designed for the amplification of the tdcA Promoter and tdcA CDS for ChIP

qPCR and RT-PCR. The ChIP qPCR and RT-PCR reactions used primer pairs for the aspA

promoter and gmk CDS respectively as controls. In this study the primer pairs used for

amplification of the tdcA promoter and coding sequence were located at -212 to -298 and +79 to

190 respective to the transcription start site respectively. All primers were designed using

primer3 (43). Primer pairs are shown in Table 3.

TABLE 3. Primers for ChIP qPCR and RT-PCR analysis. All primers are listed in the 5’– 3’ direction. Annealing temperatures ranged from 58-63oC.

Pf Pr

tdcA promoter

TTGTCGATAAAATGTCCCGTAA TGGCGATAACCAGCCTATTT

tdcA CDS

CCGCAAAATCGTTAGGGTTA TCAACGTAACGCCGGTATTT

aspA promoter

TATGGTGGTGCGTAGCAAAA TGTGGGAATTTACCCCTTATTT

gmk CDS

AGCAAATTCGCGAAAAGATG TGGCAATGACTTCTTCGCTA

Growth curves

Prior to conducting both DNA binding and transcriptional analyses growth curves of all

strains to be used were conducted to better estimate the time at which desired growth conditions

were met. Cultures were allowed to grow to stationary phase overnight in LB. The stationary

phase cultures were inoculated into 20ml LB and grown at 37oC at 200rpm. Spectrophotometric

OD600 readings were taken every hour using the Thermo spectronic Genesys 10 UV

spectrophotometer and the readings were plotted. These readings are shown in Fig. 3. The

optimum growth stage for both RT-PCR and ChIP analyses was mid log phase, for all further

Page | 10

experiments this was taken as an OD600 of 0.3 which was usually reached just after two hours

incubation.

(A) FLAG strains

0 100 200 300 400 5000

1

2

3

4WT

SL1344 hns:kanRFLAG

SL1344 crp:kanRFLAG

SL1344 fnr:kanRFLAG

Time (minutes)

OD

60

0

(B) Deletion mutants

0 100 200 300 400 5000

1

2

3

4WT

SL1344 hns::CbR

SL1344 crp::CbR

SL1344 fnr::CbR

Time (minutes)

OD

60

0

FIG. 3. Growth curves of all (A) SL1344 FLAG strains and (B) SL1344 deletion mutants used in this study. Cultures were grown for 8 hours in LB. OD600 readings were taken every hour. This experiment was done in duplicate.

Chromatin Immunoprecipitation (ChIP)

Cultures of Wild type SL1344 and all flag strains listed in table 1 were grown to an OD600 of 0.3

from a stationary phase overnight. Half of each culture was anaerobically shocked as described

above while the other half remained aerobic as a control group. The ChIP procedure was carried

out as described by Dillon et al (9) with the following change; when possible anaerobically

shocked cells were kept under anaerobic conditions, for example post addition of formaldehyde

Page | 11

or PBS. When anaerobically shocked cells needed to be stirred while still anaerobic they were

attached to a rotating wheel and rotated at room temperature. Using DNA obtained from ChIP a

qPCR was undertaken. Primer pairs to amplify desired segments of the tdcA promoter and tdcA

coding sequence (CDS) were used with SYBR green probe master mix from life technologies

and ChIP DNA to conduct qPCR. Primers for the aspA promoter were used as a positive

control. aspA encodes an aspartase involved in the TCA cycle and synthesis of amino acids (22)

and is known to be under the influence of catabolite repression (32). Sequences of primer pairs

used are shown in table 3. The qPCR was carried out using the Applied Biosystems Step 1 plus

Real time PCR system. QPCR was carried out in a 96 well plate using SYBR green master mix

from life technologies to the manufacturer’s specifications. Both forward and reverse Primers

were used at a concentration of 0.15 µM. Results were analysed using applied biosystems step-

one software. Fold change was calculated using the 2-∆∆Ct method (25). All results were

normalised against the no antibody control.

RNA Isolation and Reverse transcriptase PCR (RT-PCR)

30ml cultures of SL1344 and all SL1344 deletion mutants listed above (table 1) were grown in

LB to an OD600 of 0.3 from a 1:100 dilution of stationary overnight culture. Once the correct

OD600 was reached the cultures were anaerobically shocked. One set of these aliquots was

shocked anaerobically while the other was left aerobic. Both sets were incubated at 37oC without

shaking for 30 minutes. Total RNA was then prepared from both sample sets using the SV total

RNA isolation system by Promega according to the manufacturers protocol. To remove any

DNA contamination the Ambion TURBO DNA-free kit was used. RNA quality and

concentration was checked using gel electrophoresis and the Thermo Scientific Nanodrop 1000

respectively. cDNA was synthesized from isolated RNA using New England Biolabs ProtoScript

first strand cDNA Synthesis kit to the manufacturers’ specifications. Concentrations of cDNA

were checked using the Nanodrop 1000 as above. Synthesized cDNA was then used for RT-

PCR. As above the RT-PCR assay was carried out using a SYBR green probe master mix,

primers for the desired site and cDNA synthesized from bacterial RNA. In all RT-PCR assays

carried out wells containing primers for the gmk CDS were used as a control. gmk encodes

guanylate kinase which is essential for the synthesis of guanine nucleotides (18). The assay was

carried out according to the specifications of the manufacturer of the SYBR probe (life

technologies) using the Applied Biosystems Step-one plus Real time PCR system as above.

Results were analysed using Applied Biosystems step-one software and Fold change was

Page | 12

calculated using the 2-∆∆Ct method (25). All results were normalised against the expression of the

gmk control.

Bioinformatic analysis

DNA sequences were found using the NCBI nucleotide search engine. The NCBI nucleotide

BLAST program was used to determine the similarity between various DNA sequences (1). To

determine binding locations of various proteins to DNA sequences the virtual footprint

promoter analysis program was used (30). Both Primer3 (43) and reverse-complement.com were

used in primer design. Protein weight was determined using the sciencegateway.org protein

molecular weight calculator.

Equipment used

PTC-200 peltier thermalcycler, Sanyo/MSE Soniprep sonicator, Eppendorf centrifuge 5810R,

Eppendorf centrifuge 5415R, Bio-Rad Gene Pulser, Alpha Imager 2200, Thermo spectronic

Genesys 10 UV, Nanodrop 1000 spectrophotometer, Techne Dri-block DB-2A, Applied

Biosystems Step 1 plus Real time PCR system.

Chemicals used

All chemicals used were obtained from Sigma Aldrich Ireland unless otherwise stated.

Page | 13

RESULTS

Creation of tdcA – Flag and ∆tdcA mutant strains

The one-step gene inactivation method (8) and the epitope tagging variation of this (44) were

used in attempts to construct SL1344 ∆tdcA and Flag –tdcA strains respectively. A

Chloramphenicol resistance (CatR) cassette ~ and a Kanamycin resistance (KanR) cassette from

pKD3 and pSUB11 respectively were amplified to create SL1344 ∆tdcA and SL1344 Flag tdcA

strains using primers shown in Table 2. The resulting PCR product was ran out on 1% TAE

agarose gel using gel electrophoresis, the PCR products shown in Fig. 3 were the correct size.

FIG. 3. Agarose gel electrophoresis of PCR products tdcA::kanR for use in Flag tdcA creation, size ~1.6kb and ∆tdcA::Cm for use in ∆tdcA strain creation, size ~1.1kb. Ladder used was 1kb DNA ladder from New England Biolabs.

The pKD46 plasmid used contained recombinases used for insertion of PCR products to

homologous regions of the chromosome. Recombinases were activated by the presence of

arabinose. Purified PCR product was electroporated into the electrocompetent cells which were

then plated out on the appropriate antibiotic agar and allowed to grow overnight. There was no

growth on any of the inoculated plates. To try and remedy this DNA was purified by use of

Phenol-Chloroform extraction as described by Sambrook (34), fresh stocks of pSUB11, pKD3

and arabinose were used and electroporated cells were plated out on agar containing half of the

normal antibiotic concentrations. After all of these changes to the method no colonies were

produced.

Checking Primer efficiency Prior to conducting both transcriptional and DNA binding assays the efficiency of the primer

pairs to be used for these was checked. An SL1344 colony was added to 100µl H2O and boiled

to lyse cells. The lysed cells were then used in colony PCR reactions using primers to amplify

regions in the tdcA promoter, tdcA CDS, aspA promoter and gmk CDS. Primer sequences are

shown in table 3. When products for all of the primer pairs listed were ran out on 1% TAE

agarose gel the appropriate product sizes were observed as in Fig. 5.

Page | 14

FIG. 5. Agarose gel electrophoresis of SL1344 PCR product using primer pairs to be used in qPCR and RT-PCR assays. Primers used and product sizes are as follows: 1. tdcA promoter, 86bp 2. tdcA CDS, 111bp 3. aspA promoter, 104bp 4. gmk CDS, 117bp.

Transcriptional effects of anaerobic shock on tdcA

An RT-PCR was carried out on WT SL1344 cells which had been anaerobically shocked as

described. Expression of tdcA rose between 2 and 2.5 fold during anaerobic shock in comparison

with the wild type. This observation is in line with those of Kim et al (21) who found that tdcA in

Salmonella Typhimurium is maximally expressed 30 minutes after anaerobic shock.

FIG. 6. RT-PCR analysis of tdcA gene expression after anaerobic shock in relation to an aerobic lifestyle. Fold change was analysed by use of the 2-∆∆Ct method (25). All results were normalised against the expression of the gmk control.

The effects of crp, fnr and hns deletions on tdcA transcription

Transcriptional analysis of tdcA expression in SL1344 crp, fnr and hns mutant strains under

anaerobic shock conditions was carried out using the RNA isolation and RT-PCR procedure

outlined in the materials and methods. As has been mentioned previously CRP, FNR and H-NS

have been found to influence tdcA transcription either in E. coli or Salmonella. There is much

evidence for CRP and FNR acting as positive regulators of tdcA in E. coli (6; 36; 46), however

similar data has yet to emerge for Salmonella. H-NS has been shown to slightly inhibit Salmonella

tdcA transcription in a study by Kim et al (21). The results of the RT-PCR analysis can be seen in

Fig. 7. As can be seen from the results deletion of crp reduces tdcA expression over 100 fold

whilst deletion of hns and fnr results in around a fourfold decrease and increase in expression,

respectively.

Page | 15

FIG. 7. (A) Positive and negative fold change in tdcA expression between SL1344 wild type in

aerobic conditions and the WT and selected mutants post anaerobic shock. (B) The same results

as shown in (A) are shown here excluding the crp mutant for scale. Fold change is calculated

relative to expression rates of control gene gmk.

Binding affinities of CRP, FNR and H-NS to the tdcA promoter and CDS

Using ChIP and qPCR analysis as described earlier the binding affinities of CRP, FNR and H-

NS to the tdcA promoter and CDS was investigated under aerobic and anaerobic shock

conditions. SL1344 strains which had the desired proteins tagged with a flag epitope were used

for this experiment. In E. coli CRP binds to the promoter region of tdcA at -43.5 under anaerobic

conditions (36; 46), however no similar investigations have taken place in Salmonella, although

due to the high conservation of the CRP binding site in the Salmonella tdcA promoter it has been

assumed that CRP likely plays a similar role in Salmonella. Similarly in FNR studies have shown

the indirect effect it has on tdcA transcription in E. coli (6) however, no studies have confirmed

this in the Salmonella homologue. As mentioned H-NS has been found to have an effect on tdcA

expression in Salmonella (21) however its binding affinities to the region under anaerobic

conditions remain unknown. The results of the ChIP analysis are shown in Fig. 8. As was

expected CRP and FNR showed little binding under aerobic conditions. However under

anaerobic shock conditions CRP binding increased both at the tdcA promoter and CDS over 4

and 3 fold respectively. FNR binding increased at the tdcA promoter region tested, however no

binding activity was detected in the coding sequence. H-NS showed high relative levels of

binding to both the tdcA promoter and CDS in the aerobically conditioned samples with fold

Page | 16

changes of over 1,000 and 850 relative to the control respectively. Under anaerobic shock

conditions the levels of H-NS binding were greatly reduced at both of the regions tested.

(A) crp

tdcA

Pro

mote

r Aer

obic

tdcA

Pro

mote

r Anae

robic

tdcA

CDS A

erobic

tdcA

CDS A

naero

bic-2

0

2

4

6

Fo

ld C

han

ge

(B) fnr

tdcA

Pro

mote

r Aer

obic

tdcA

Pro

mote

r Anae

robic

tdcA

CDS A

erobic

tdcA

CDS A

naero

bic-2

0

2

4

6

FIG. 8. Fold change in binding affinity of (A) CRP, (B) FNR and (C) H-NS to the tdcA promoter and CDS under aerobic and anaerobic shock conditions. Fold change was calculated relative to the no antibody control using the 2-∆∆Ct method (25).

Page | 17

DISCUSSION

All attempts to make both SL1344 Flag-tdcA and ∆tdcA strains were unsuccessful. During the

course of experimentation the experimental procedure for creation of these strains was altered in

the hope of successful strain creation. As well as those changes described in the results section

the method of preparing the cells for electroporation was altered by reducing all centrifugation

steps by half in the hope of making the cells more permissible. Fresh stocks of all chemicals

used in the Phenol – Chloroform extraction were also used to no avail. It was also found during

experimentation that the temperature sensitive carbenicillin resistance of the pKD46 plasmid

perhaps was not as temperature sensitive as one would like (Data not shown). This may suggest a

fault in the pKD46 plasmid used as the temperature sensitivity may not be entirely reliable. The

only component used in the creation of these strains which was not replaced during the course

of the investigation was the primers ordered from Integrated DNA Technologies. These primers

did amplify the desired regions of both the pSUB11 and pKD3 plasmids; however as is evident

there was a failure for the PCR product to recombine into the chromosomal DNA of SL1344

pKD46. As other colleagues attempting similar projects had similar obstructions and that all

primers were ordered at the same time it could be that there was a problem with the segment of

the primers ordered homologous to the Salmonella chromosome.

More interesting however are the results of the DNA binding and transcriptional analysis of

tdcA. Expression of Salmonella tdcA increased 2-2.5 fold in anaerobically shocked cells in

comparison with the wild type (Fig. 6). Other investigations have shown that maximal tdcA

expression takes place under anaerobic shock conditions (20; 23), however there is a discrepancy

between past work and that done here, past work has demonstrated tdcA expression under

anaerobic shock rises over 1,000 fold (23). It may be that the conditions used during the course

of this investigation were not truly anaerobic, as such all further conclusions must be viewed

with scepticism.

There is currently no evidence for the binding of CRP to the tdcA promoter in Salmonella.

However CRP binding to the tdcA promoter at the position centred at -43.5 relative to the

transcription start site has been shown to be essential to E. coli tdcA expression (36; 46). The

tdcA promoter regions of both E. Coli and Salmonella are highly conserved (72% identity) and as

such past studies have assumed similar mechanisms are at play in Salmonella (21). Using the

virtual footprint promoter analysis and regulon prediction analysis programs on

www.prodoric.de as described by Munch in 2005 (30) it was found that the tdcA promoter

sequence contains one possible binding site for CRP. This binding site is quite similar in both

position and sequence to that of the E. coli tdcA promoter. This suggests that the role of CRP in

Page | 18

tdcA transcription in Salmonella may be not too dissimilar to E. coli as suggested in the past. If the

ChIP results are to be believed then a similar mechanism may be at play in Salmonella, however,

due to the fact that the ChIP procedure was carried out singly without replicates all results must

be taken with a pinch of salt.

CRP was found to bind at both the tdcA promoter and CDS under anaerobic shock (Fig. 8A).

Binding at the promoter region of tdcA was expected (21) but the binding seen in the tdcA CDS

was not. To give reason to this unusual result the limitations of the experiments carried out must

be taken into account. During preparation of ChIP DNA a sonication step took place, during

this all sample cells are subjected to ultrasonic frequencies which fragment the DNA. The

average size of this fragmented DNA is ~500bp (9). Assuming fragments of 500bp were the

norm one must also assume that immunoprecipitated DNA fragments would have been this

length also. Continuing with this train of thought it can be speculated that if any

immunoprecipitated DNA fragments contain the sequence to be amplified by any primers used

then any positive result of the qPCR may mean binding of the DNA of the target protein up to

500bp upstream or downstream of the selected region. In this study the primer pairs used for

amplification of the tdcA promoter and coding sequence were located at -212 to -298 and +79 to

190 respective to the transcription start site. Therefore for all positive ChIP results the range for

the tdcA promoter and CDS primers must be extended. Using this logic and the fact that the

CRP binding site in the tdcA promoter is located at -43.5 one can conclude that any positive

result in the tdcA CDS could be the result of binding in the tdcA promoter. With this in mind

and the fact that the CRP binding site is located less than 50bp upstream of the tdcA

transcription start site it could be argued that the positive result shown by the tdcA CDS primers

in the CRP ChIP experiment come as a result of CRP binding to the proximal binding site in the

tdcA promoter. The results of the transcriptional analysis of tdcA in the crp mutant showed a large

decrease in tdcA expression in comparison with the wild type. Taken together these results show

an increased binding of CRP under anaerobic shock conditions and a necessity for CRP in tdcA

expression. One may assume that similarly to the regulation of E. coli tdcA CRP binds to the tdcA

promoter and promotes transcription.

From the results produced it seems FNR may play a slightly different role in tdcA regulation

than in E. coli. Under anaerobic shock conditions FNR showed high relative levels of binding to

the tdcA promoter (Fig. 8B) which is in direct conflict of the findings of Chattophady et al (6)

who found that in E. coli even though a possible FNR binding site is present in the tdcA

promoter FNRs influence on tdcA expression is indirect, possibly acting through the

accumulation of metabolites of anaerobic metabolism. A promoter analysis on tdcA using the

Page | 19

virtual footprint program on www.prodoric.de (30) found possible binding sites of FNR to the

tdcA promoter, a binding site at -150bp relative to the transcription start site was discovered.

This could possibly be the region in which FNR binds to the promoter, however the limitations

of ChIP discussed in relation to CRP may be at play here also. The region found has significant

homology to the possible FNR binding site revealed by Chattophady (6) in E. coli. It is possible

that since the divergence of the two species FNR has come to play a different role in tdcA

expression, although this may not be the case. The RT-PCR analysis of tdcA transcription in the

fnr mutant gave back a surprising result. In both replicates the levels of tdcA transcription rose

(Fig. 7B) in the fnr mutant under anaerobic shock. Collectively these results show an alternative

form of regulation by FNR on tdcA in Salmonella in which FNR binds directly to the tdcA

promoter and inhibits the transcription of tdcA. In E. coli the reasoning for the anaerobic

induction of tdcA is due to the rise in cAMP levels upon anaerobic shock (33) and partially to the

build-up of anaerobic metabolites as a result of FNR activation (6).

Previous studies have shown how expression of tdcA is maximized after 30 minutes of

anaerobic shock but decreases thereafter. If FNR is indeed a negative regulator of tdcA

transcription than it may be that FNR exhibits delayed binding. As shown in the past H-NS can

influence FNR occupancy at promoter regions (31). The DNA binding analysis of H-NS to the

tdcA region showed decreased binding post anaerobic shock (Fig. 8C). It is possible that FNR is

only able to bind once H-NS has sufficiently dissociated. Assuming H-NS dissociation is not

instantaneous one could speculate that this system provides a window of time when enough H-

NS has dispersed but prior to FNR binding during which tdcA may be expressed. In past studies

the fact that tdcA expression is limited, reaching maximum expression by 30 minutes and

decreasing thereafter (20). This possible “window” of expression theory provides a mechanism

for this. However investigations into both the exact timing of FNR binding and H-NS

dissociation must take place before this can have any credibility.

H-NS was found to have high levels of binding both at the tdcA promoter and CDS in cultures

which did not undergo anaerobic shock (Fig. 8C). The levels of promoter and CDS binding were

lowered considerably on anaerobic shock. A study on global H-NS binding conducted by Dillon

et al (9) showed that the region of the chromosome in which the tdc operon resides is highly

bound by H-NS. As a global transcription repressor H-NS often binds DNA in such a way as to

exclude RNA polymerase and upon gene activation is removed (11). However removal of the hns

gene resulted in reduced expression of tdcA under anaerobic shock. This finding is in

contradiction to those of Kim et al (21) who found slightly increased expression of tdcA in an hns

mutant. All transcriptional analyses were taken using cultures which had grown to an OD600 of

Page | 20

0.3, this was considered mid log phase. The hns mutant grew considerably slower than all other

strains used (Fig. 3B). The deletion of hns obviously had serious consequences on the fitness of

the strain, possibly resulting in reduced tdcA expression; in hindsight the tdcA expression levels in

the hns mutant under aerobic conditions should also have been tested. Also the fact that the tdcA

gene resides in a region highly bound by H-NS (9) might suggest that the local structure of the

DNA there may have been altered by its removal. Similarly to this in E. coli DNA supercoiling

has been shown to alter the expression of tdcA (45).

The tdc operon of Salmonella is under highly complex regulation by a number of different

factors. Although the operon has changed much between Salmonella and E. coli since their

divergence it still holds many similarities in regards to its regulation. CRP which holds principle

control of the operon seems to play a very similar role in Salmonella as in E. coli however the

regulation other less influential factors may vary as shown with FNR. There are still many

unanswered questions on Salmonella tdcA expression. The roles of TdcA, IHF and other factors

such as those involved in altering of DNA supercoiling have yet to be explored in Salmonella as

they have in E. coli.

Page | 21

Acknowledgements

I would like to thank my supervisor Professor Shane Dillon for his guidance during this project.

I would also like to thanks Professor Charles Dorman for the continued insight over the course

of the investigation and Dr. Heather Quinn for all of the help and advice given throughout the

project.

Page | 22

REFERENCES

1. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. J Mol Biol 215:403-10

2. Bott M. 1997. Anaerobic citrate metabolism and its regulation in enterobacteria. Archives of microbiology 167:78-88

3. Bruckner R, Titgemeyer F. 2002. Carbon catabolite repression in bacteria: choice of the carbon source and autoregulatory limitation of sugar utilization. FEMS microbiology letters 209:141-8

4. Burman JD, Stevenson CE, Sawers RG, Lawson DM. 2007. The crystal structure of Escherichia coli TdcF, a member of the highly conserved YjgF/YER057c/UK114 family. BMC structural biology 7:30

5. Busby S, Ebright RH. 1997. Transcription activation at class II CAP-dependent promoters. Mol Microbiol 23:853-9

6. Chattopadhyay S, Wu Y, Datta P. 1997. Involvement of Fnr and ArcA in anaerobic expression of the tdc operon of Escherichia coli. Journal of bacteriology 179:4868-73

7. Corcoran CP, Dorman CJ. 2009. DNA relaxation-dependent phase biasing of the fim genetic switch in Escherichia coli depends on the interplay of H-NS, IHF and LRP. Mol Microbiol 74:1071-82

8. Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences of the United States of America 97:6640-5

9. Dillon SC, Cameron ADS, Hokamp K, Lucchini S, Hinton JCD, Dorman CJ. 2010. Genome-wide analysis of the H-NS and Sfh regulatory networks in Salmonella Typhimurium identifies a plasmid-encoded transcription silencing mechanism. Molecular Microbiology 76:1250-65

10. Dillon SC, Espinosa E, Hokamp K, Ussery DW, Casadesus J, Dorman CJ. 2012. LeuO is a global regulator of gene expression in Salmonella enterica serovar Typhimurium. Mol Microbiol 85:1072-89

11. Dorman CJ. 2004. H-NS: a universal regulator for a dynamic genome. Nature reviews. Microbiology 2:391-400

12. Egan RM, Phillips AT. 1977. Requirements for induction of the biodegradative threonine dehydratase in Escherichia coli. Journal of bacteriology 132:370-6

13. Feldman DA, Datta P. 1975. Catabolite inactivation of biodegradative threonine dehydratase of Escherichia coli. Biochemistry 14:1760-7

14. Fink RC, Evans MR, Porwollik S, Vazquez-Torres A, Jones-Carson J, et al. 2007. FNR is a global regulator of virulence and anaerobic metabolism in Salmonella enterica serovar Typhimurium (ATCC 14028s). Journal of bacteriology 189:2262-73

15. Goss TJ, Schweizer HP, Datta P. 1988. Molecular characterization of the tdc operon of Escherichia coli K-12. Journal of bacteriology 170:5352-9

16. Hagewood BT, Ganduri YL, Datta P. 1994. Functional analysis of the tdcABC promoter of Escherichia coli: roles of TdcA and TdcR. Journal of bacteriology 176:6214-20

17. Hesslinger C, Fairhurst SA, Sawers G. 1998. Novel keto acid formate-lyase and propionate kinase enzymes are components of an anaerobic pathway in Escherichia coli that degrades L-threonine to propionate. Mol Microbiol 27:477-92

18. Inokuchi H, Ito R, Sekiguchi T, Sekiguchi M. 2013. Search for proteins required for accurate gene expression under oxidative stress: roles of guanylate kinase and RNA polymerase. J Biol Chem 288:32952-62

19. Kim M, Lim S, Kim D, Choy HE, Ryu S. 2009. A tdcA mutation reduces the invasive ability of Salmonella enterica serovar typhimurium. Molecules and cells 28:389-95

Page | 23

20. Kim M, Lim S, Ryu S. 2011. Comparison of tdcA expression between Escherichia coli and Salmonella enterica serovar Typhimurium. Journal of microbiology and biotechnology 21:252-5

21. Kim MJ, Lim S, Ryu S. 2008. Molecular analysis of the Salmonella typhimurium tdc operon regulation. Journal of microbiology and biotechnology 18:1024-32

22. Kim W, Surette MG. 2004. Metabolic differentiation in actively swarming Salmonella. Mol Microbiol 54:702-14

23. Kroger C, Colgan A, Srikumar S, Handler K, Sivasankaran SK, et al. 2013. An infection-relevant transcriptomic compendium for Salmonella enterica Serovar Typhimurium. Cell host & microbe 14:683-95

24. Lim S, Kim M, Choi J, Ryu S. 2010. A mutation in tdcA attenuates the virulence of Salmonella enterica serovar Typhimurium. Molecules and cells 29:509-17

25. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-8

26. Lostroh CP, Lee CA. 2001. The Salmonella pathogenicity island-1 type III secretion system. Microbes Infect 3:1281-91

27. Lu Z, Takeuchi M, Sato T. 2007. The LysR-type transcriptional regulator YofA controls cell division through the regulation of expression of ftsW in Bacillus subtilis. Journal of bacteriology 189:5642-51

28. Maddocks SE, Oyston PC. 2008. Structure and function of the LysR-type transcriptional regulator (LTTR) family proteins. Microbiology 154:3609-23

29. Meysman P, Sanchez-Rodriguez A, Fu Q, Marchal K, Engelen K. 2013. Expression divergence between Escherichia coli and Salmonella enterica serovar Typhimurium reflects their lifestyles. Mol Biol Evol 30:1302-14

30. Munch R, Hiller K, Grote A, Scheer M, Klein J, et al. 2005. Virtual Footprint and PRODORIC: an integrative framework for regulon prediction in prokaryotes. Bioinformatics 21:4187-9

31. Myers KS, Yan H, Ong IM, Chung D, Liang K, et al. 2013. Genome-scale analysis of escherichia coli FNR reveals complex features of transcription factor binding. PLoS genetics 9:20

32. Oh MK, Liao JC. 2000. Gene expression profiling by DNA microarrays and metabolic fluxes in Escherichia coli. Biotechnol Prog 16:278-86

33. Phillips AT, Egan RM, Lewis B. 1978. Control of biodegradative threonine dehydratase inducibility by cyclic AMP in energy-restricted Escherichia coli. Journal of bacteriology 135:828-40

34. Sambrook J, Russell DW. 2006. Purification of nucleic acids by extraction with phenol:chloroform. CSH Protoc 1

35. Sawers G. 1998. The anaerobic degradation of L-serine and L-threonine in enterobacteria: networks of pathways and regulatory signals. Archives of microbiology 171:1-5

36. Sawers G. 2001. A novel mechanism controls anaerobic and catabolite regulation of the Escherichia coli tdc operon. Mol Microbiol 39:1285-98

37. Schweizer HP, Datta P. 1989. Identification and DNA sequence of tdcR, a positive regulatory gene of the tdc operon of Escherichia coli. Mol Gen Genet 218:516-22

38. Shizuta Y, Hayaishi O. 1970. Regulation of biodegradative threonine deaminase synthesis in Escherichia coli by cyclic adenosine 3',5'-monophosphate. J Biol Chem 245:5416-23

39. Sperandio V, Li CC, Kaper JB. 2002. Quorum-sensing Escherichia coli regulator A: a regulator of the LysR family involved in the regulation of the locus of enterocyte effacement pathogenicity island in enterohemorrhagic E. coli. Infect Immun 70:3085-93

40. Spiro S, Guest JR. 1990. FNR and its role in oxygen-regulated gene expression in Escherichia coli. FEMS microbiology reviews 6:399-428

Page | 24

41. Sumantran VN, Schweizer HP, Datta P. 1990. A novel membrane-associated threonine permease encoded by the tdcC gene of Escherichia coli. Journal of bacteriology 172:4288-94

42. Umbarger HE, Brown B. 1957. Threonine deamination in Escherichia coli. II. Evidence for two L-threonine deaminases. Journal of bacteriology 73:105-12

43. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, et al. 2012. Primer3--new capabilities and interfaces. Nucleic acids research 40:e115

44. Uzzau S, Figueroa-Bossi N, Rubino S, Bossi L. 2001. Epitope tagging of chromosomal genes in Salmonella. Proceedings of the National Academy of Sciences of the United States of America 98:15264-9

45. Wu Y, Datta P. 1995. Influence of DNA topology on expression of the tdc operon in Escherichia coli K-12. Mol Gen Genet 247:764-7

46. Wu Y, Patil RV, Datta P. 1992. Catabolite gene activator protein and integration host factor act in concert to regulate tdc operon expression in Escherichia coli. Journal of bacteriology 174:6918-27