*- Ttud oh "s )l .t I t .-f ) .a I SlnA l- Wtichofthe following organisms can useRNA as its genetic material? A- Bacterium B- Virus C- Human D- Plant E- None of the above 2. Which of the following enz)rmes is used A. Restriction endonuclease B- RNA polymerase C- DNA polymerase D- Ligase E- None of the abc ''e for making new strandsof DNA? c ,/ ( humangenome? { n,/ t< ,/ 6 Z. Which of the following statements is/areNOlf true formitosis? v A. It takes place in all types of cells F B. It generates daughtercells that are identicai I C. The process of recombination occurs between homologous pairsof chromosomes D; AandC E. BandC 4. Which of the following statement(s) is/areFALSE for the A. Most of the DNA codefor proteins p B. Most genescontain introns-f C. Exons define rbgions of DNA which will not code D. AandB E. AandC for proteins ? Which of the following process and RNA? A. Replication B. Translation C. Transcription D. Splicing E. Noneof the above involves forrnationof hydrogen bondsbetween DNA 6. Which of the f-ollowing typesof RNA is/are involvedin the process of translation? A, RibosomalRNA ,.2 B. TransferRNA /, C- Messenger RNA ' , D- RibosomalRNA and transferRfiA E. Ribosomai RNA, trapsfer RNA andrnessenger RNA s I .n-.-,-.* PDF processed with CutePDF evaluation edition www.CutePDF.com
Transcript
*-
Ttud oh "s )l. tI
t. - f
).a
I
SlnA
l- Wtichofthe following organisms can use RNA as its genetic material?
A- BacteriumB- VirusC- HumanD- PlantE- None of the above
2. Which of the following enz)rmes is usedA. Restriction endonucleaseB- RNA polymeraseC- DNA polymeraseD- LigaseE- None of the abc ''e
for making new strands of DNA?
c,/
(
human genome?{
n,/t< ,/
6 Z. Which of the following statements is/areNOlf true formitosis?v A. It takes place in all types of cells F
B. It generates daughter cells that are identicai IC. The process of recombination occurs between homologous pairs of chromosomesD; AandCE. BandC
4. Which of the following statement(s) is/are FALSE for the
A. Most of the DNA code for proteins p
B. Most genes contain introns-fC. Exons define rbgions of DNA which will not codeD. AandBE. AandC
for proteins ?
Which of the following processand RNA?A. ReplicationB. TranslationC. TranscriptionD. SplicingE. None of the above
involves forrnation of hydrogen bonds between DNA
6. Which of the f-ollowing types of RNA is/are involved in the process of translation?A, Ribosomal RNA ,.2B. Transfer RNA /,C- Messenger RNA '
,D- Ribosomal RNA and transfer RfiAE. Ribosomai RNA, trapsfer RNA and rnessenger RNA
s
I.n-.-,-.*PDF processed with CutePDF evaluation edition www.CutePDF.com
13. Recombination during meiosis is important for creatingA. mutationsB. gene diversityC. chromosome stabilifyD. better genesE- longer chromosomes
Questions l4 to 19 refer to the following paragraph: _iy
Kevin, aged 30, does NOT develop kidney cancer despite that one of its alleles for gene Tcarries a rnutation as depicted above.
Prrrrlr.t.
14. What is the mode of such mutations?A. InversionB- InsertionC- DeletionD. DuplicationE. {Jnknown
15- Kevin's wife is free from this disorderand diagnostic tests confirmed that both heriilleles T have no such mutations. What is the chance of their children getting the
f"
disegg:. T in the future\A.Oo 1B. 2s%o 1C. 5OY" I
A
t
JI:
Tt
r:'IJ
/
r qRtr 6rh f \ tq Cq-nGAq npb"u'AqF 6(o hco 6nf l l
-*- q
t i
t t, t11 I
,4t- , t
Nrt l t r tl r l r
NI( lA/rD. 75yoE. lA0yo NN
N16. What is the chance of Kevin's brothei having one copy of the rnutated allele?
A- 250AB. 500AC. 75o/oD. r0a%E. Not enough information to predict it
-'.-.'.,,'..": T r{.-j, Ttr TT 11
t 11 1tv
! *'.-
]J
7.
8.
9.
Which statement(s) is/are TRUE for the synthesis of proteins in qukaryotes.?.A. This is a decoding process mediated by H-bonding between:tRNA and mRNAB- Proteins can be modified after translation 1 .C. IRNA are derived from transcription of its own gene{-.D. AandB
a
o
E. A,BandC
Translation is a process of makingA. DNAB. mRNAC. rRNAD. IRNAE. Protein
If a doqblg:stranded,Bryl has a cytosine composition of l5%o, what is thecomposition of its adenines?A. 15YoB. zOYoC. 25YoD. 35Yo
t -1't \ \
L'l v
(+G=N?A11
- \s l -
!r
i j i r
E. Not enough information to determine 'A\1NI '
10. If the codiag sequence of a DNA is 5'...GG(ccdrr{a""1.S,*at is the- r -o! \ I [ , . fcorresponding sequence for its. template?;' 1 rr*'r v Iuurr( 'bPurruruB Dsr lusrres rur rr .5. tcrrurrdrs{) i _ncir{ A i r r -
A. 5 ' - . -GGGCCCTTTAAA---3 ' i , : - i - i ' i ' ' ' i ; / 6A 6 ccc TTTAAn
C(C GbGANA 1_TT
is the corresponding sequence for its mRNA?
3' (cc Goc. AA;P- V!1tr g
6(( i .c'-\ ' ' ' .*1AFF
B. 5'. . .GGGCCCUUUAAA...3'C. 5'. . .TTTAJ{AGGGCCC...3'D. 5 ' . . .UUUAAAGGGCCC...3 'E. None of the above
From the Question l0 above, whatA. 5'. . .GGGCCCUUUAAA...3'B. 5'. -.TTTAAAGGGCCC...3'C. 5'. . -IJTruAAAGGGCCC...3'D. 5'. . .AAATTTCCCGGG. -.3'E. None of the above
12. The process of exchanging two regions of hornologous chromosomesAS
A. mutationB. translocationC. cross-overD. transpositionE. None of the above
t1
_Yis also known
17. Which'of the following descriptions BEST describes the role or properties ofproteinT?A. Wildqpe protein T is highly solubleB. Mutant protein T is highly solubleC. Mutant protein T causes formation of cancers only when its wildtype counterpart
is absent in cellsD. Mutant protein T causes formation of cancers even when
is present in cellsE. None of the above description is correct
"XLRefer to the genetic codon table provided in Appendix, and assume that AAArepresents one of the codons in the gene, what effect would such a mutation have on
,,lAh
ti r-. .._ D. It does not cause any change to the protein
Wo|Y E. No protein is expressed at alluwh, DC
h0
ffiI.the protein it encodes?A- It replaces one amino acid with another typeB- It lengthens the ptoteinC. It shortens ttre protein
20. Which of the following descriptions for the DNA skucture is FALSE?A. It is double-stranded with anti-parallglhelix -I
B. It is a polyrner of nucleotides linked from one nucleotide to the next byphosphodiester linkage{'
C. The polymer carries a netD. AandBE. BandC
negative charge due to the charges on its bases
Xc-\ --)il
t':L I (Td'f t oC rv' {
J"'Which of the followine human bhromosomes is the smallest?A. Chromosome I 'JtrilF-L 'tt^if
B. Chromosome 5C- Chromosome 15D. Chrornogome 18E. Chromosome 22
[.-t 15 Different properties of amino acids are due to differences' -J A. charges -l
B. sizes -iC. central carbon atoms FD. AandBE. AandC
26. More than 100,000 proteins can still be generatedthe human genome because ofA- altemative RNA splicingB. modification of proteins after their synthesisC. gene duplicationsD. AandBE. BandC
from the 35,000 genes predicted in
L
22.Which of the following statements below correctly describe(s) the organization ofDNA in various species?A. Viral genomes are very compact and can utilize different frames for synthesis of
different proteins TB. Human genome mainly consists ofnon-coding sequence {
;: *::du'" rouna in eukaryott";f:*f;*"-' i-. hr \-.!,, tl'*\'
\Y,ni ,^'E_ A, B and c V hol in^ prr( r"^1u p y..D{*'L ./
v c{erlfo w\Aa' -/23. Which of the following statements below correctly describes the relative order of
| 24.How many types of chromosomes are there in a healthy humanv A.2z
B. 23c. 24D. 46E. None
LrL-./
rygs$r?
in their
r l tv// ftw
-rtt'
/Zl.Which of the following statement(s) is/are lBtiE for human cells?' A. All human cells can replicate y- toralCfXlp
B. All somatic cells are haploi{F daff;a I
C. All germ cells are diploid )r lV$t;aD- All somatic cells have identical genetic make-up TE- All germ cells have identical genetic make-up 7
28. Successful development of biotechnology industry requiresA. extensive manpowerB. sound funding/financial supportC- relwnt topics of researchD. AandBE. A,BandC
29. Amino acids in prottiins are linked up through chemical bonds termedA. hydrogen bondsB. phosphodiester linkagesC. peptide bondsD. ionic interactionsE. hydrophobic interactions
30. Cenhal dogma of molecularbiology describesA. how genetic information can be transmitted in cellsB. how proteins can fold to proper shapesC- how DNA.mutat.ions affect our lifeD. how genes are mddifiedE. how cells undergo adaptation
\9
\-l-
,l
L1
7
N,,/
ti l
sffi tce)I '
j^ : , , . , ' : - ,f \ . . " . : r ;
SEMESTER l: 1998199: Cyr,t: G'lo : I
Which statement is not true about DNA replication?
A. lt proceeds in a 5' to 3' direction onty J . ^B. One strand,of DNA is replicated fasier than the other strand{ fwtu\t .ltr€*lC. Replieation occurs as each base is paired with another exaetfry' ]lke it FD. Complementary base pairs are held together by hydrogen bonds
a
Because one original strand of the double helix is found in each daughter cell,the replication process is called
1.
2.
e)!,i,!g {'"a. t dr(
3-
A. ProofreadingB- Semi- conservativeC. Freeing of DNAD. Red'undant
Transformatisn of bacteria was shown to occur wheninjected into the mice and the mice
A. Live, smooth; diedB. Live, rough; didn't die
9-Live, smooth and died, smooth; diedlD. /Live, rough and dead, smooth; died
4. Which is not a major function of the genetic material? l
A. Stories information -{ .
B. Catalyzes chemical feactionsC. Replieates itself \D- Undergoes mutatibn rf -
5. DNA was proven to be the transfsrming substance when only theenzymes could inhibit transfor.mation.
14. What is the function of a,vector in genetic engineering?
A. Cut DNA into many fragments,' B. Carry DNA into a new cell' C. Link together newly joined fragments of DNA
D. Make millions of copies of a specific segment of DNA
v
" ,z'A 15. What is,the functicn of a restriction enzyme in genetic engineering?
A Cut DNA into many fragments :'B. Carry DNA into a new cettC. Linkiogether newly joined fragment of DNAD. Make millions of copies of a specific segment of DNA
16.What is the function of DNA ligase in genetic engineering?
A. Cut DNA into rnany fraEmentsB. Garry DNA into a new cellC. Link together. newly joined fragment of DNAD. Make millions of copies of aspedfic segment of DNA
17. What is the polymerase chain reaction?
_ A. A reaction which duplicates proteinsI B. A reaction which produees many RNA molecules
C. A reaction which produces many DNA fragmentsD. A reaction which is like DNA transcription
. lB.Which is not a cycle of PCR?
A. Denatu ratign/A. L'enaturailPB. Annealind u,,
,"'
D- f\ilHearililgr /C. ElongatioV
7?
D. Translation
triction site polymorphismsiare inhenited
D. By alwaYs following the father
20.A change in DNA that affects a restriction si!:e,1s detected by
, A. PhenotYPic characteristies. B. Genome sequencing
C. Difierence in restrictlon fragmentsD. Cloning
21 . Gene-tic diseases dre
A. Birth defectsB. Very commonC. EasY to detectD. Mosily untreatable
22.Down's sYndrome i3 caused bY
A. DNA deletionsB. DNA insertionsC. Foint mutationsD. Excess chromosomes
23.With the advancement of molecular biotogy,
A. lt is possible to detect all genetic diseasesB. lt is possible to diagnose all chrornosome disorders
[h tt is possible to predict a birth defectb. tt is possible to correct a birth defect
24.Choose the best statementto complete the sentence' The human genome
project is a Project to
\ /A. Study hum{nsB. Analyze all human chromosomesG. Determine the DhlA sequences in all human chromosomes
D. Diagnose human diseases
XD
D
v
I
25.PCR is a rnolecular biology;technique which can
A. Ampliff genesB. lsolate genesC. Amplifu proteinsD. lsolate pr,oteins
26.Sickle celt anemia is a
A., Geneticdisease6 B. Acquired disease
" C. Female- associated dlseSeD. A male- associated diseff;e
27.Gene therapy is a therapy using
A. VirusesB. VaccinesC. Engineered genesD. Chemical Drugs
28.A|DS is a
, A. Genetic diseaseB. Viral diseaseC. BacterialdiseaseD. Environrnental disease
29.Microbes can be useful'in bioremediation because
'tt,\,'' A. They can break down many organic compounds
/ B. They can break down rnany plants/ C. They can break down many animals
v D. They can break down many nutrients
30. Molecular biology can help the environment because
.\rf n. 'lt can create new molecules. : .-'. B. ..lt can release CO 3' '.fr- lt can release'CO 2
- D. lt can help us understand the physiology behind, the environment
A
v
i-\,6
+
L
E
h\1
{ i
lfy engineered mierobes
A- Always grow better than natural onesB. Are always usefulC- Are always widely spread around the worldD. Can ahange the loeal environment
32. Gene therapy is possible when
A.B.C.D.
The gene(s) causing the disease has been identified /
The disease is caused by a single Eene defect / 'i'
The disease is caused by multiple Eenes and environmental fg(tors(A) + (B)
// \
o
vsnow is made by
A. Dead ice- forming bacteriaB. Live ice- forming-bacteria bC. Bacteria in which the ice- nucleation gene was removedD. Non- bacteria material
34. Genetically- engineered microbes that can break down crude oil
A. Are not yet in existenceB. Are already in useC. Are plannedD- Cannot be created
35.Who is holding the patent for PCR?
A. Kary MullisB. Du PontC. CetusD. None of the above
36.The patent filed by Stanley Cohen of Stanford University and Herbert Boyer ofUC in 1974 was for the invention of
l lt-,-/
'l-r
A. Recombinapt DNA te${nology /B. Human in$1lin \C, Human grriwth horlnoheD. None of the above
s$37. DNA can be transferred into cells using biological vectors, such as _ and
or direct physical means, such as -, - and
T:,ial-
ii
--'b 1
' ! , . \
9Er E
GENES AND SOCIETYSEMESTERI2OOI/2002
, i ' r i I
f , t '
. , " i ._1 , . . . .. . ' .1. .
. - , , . " I i '
, ' , \ : - r r . i l , : ' ' i " l , '
.F j A
o\J
l .A.B.C.D.E.
Which ofthe following samples miglrtcontain DN.A?a dinosaur fossila drop of pond water iilthe backyarda chunk of a tress skina cooked)6sh dedund \Xhall of the above
Bacteriumis a single cell of organismis a prokaryote t/contains acellwall v/can be beneficial'to humanall of the above
\/'
5. DNA fingerprinting isA. a specific DNA pattern of a personB. the DNA on a person's fingerC. captured by cameraD- can be seen easily with a microscopeE. none of the above
,nL.
A.B.C.-D.E-
J
({
A
+Yt '
3.A.B.C.D.E.
Southern blot is a technique used inDNA fingerprinting J'genes hansferPCRtransformation. \ . /gel electrophoreg{
\\4- A single nucleotide Aglgllgn3t the 6e amino codon of the hemoglobin gene was
found. What will happen to the hemoglobin protein produced?A. a
"o*plet"ly diffgrettt p ill be produced,which has no hemoglobin
tuffi\ stt{e ctll qutctei^.-rtt*.B. a shortened protein will be prodXced
no protein will bs prob{ceda normal hemoglobin {vitt be pro}dceda slightly different hemoglobin will be produced
7 - J-aines WhBou and F'ranei$ €Hok diseoveredA. the struoture of PennicillirrB-. the str-ucture of DIIAC. the structure of InsulirlD. the structure of E. ColiE. the structure of }trf,V
8.A.
"B.rC.
D.E.
/9.A.B.C.D.E.
10.A.B.C.D-E.
c.D.E.
DNA cloning requires the use of rnolecutrar scissors caliedRNA polyrr,rerisesDNA ployr,r,rerisesRestriction endonucleasesHelicasesRecombinase
Which statement below applies to the technique of PCR?it is very tediousit does not require amplificationot requires the knowledge'ofrestriction enzyme cutting sitesit was co-invented by Buyer and Cohe\',-', ,', , i', ,None of the above
11. A change in DNA that affects a restriction enzyme recognition site is detected byA. phenotypic characteristicsB. genome sequencingC. difference in reshiction fragrnents
LWhich statement is true?most prokaryotic genes contain intervening sequence called in(ns evirus is a tlpe of bacteriurn that affect humans F
lNt"*'+"r,"""t1t*;e*"ti" r ^. ,-,.$ -!^r.. ni pnocrueMost proteins are generated Uy@sjlption in the nucleus tr +vqt{.Y}Pt ' tf
*Fin, .Transforrnation refers to the linkipTf trvo DNA molecules into one F
-/
D- cloningE. hansformation
//:-\ \ :'{,'.12-€-iekle cell anemia is a caused by
7 - Jarnes W+Bou and F'raricie griok d:iscoveredA. the struoture of Pennicillir*B-. the skucture of DNAC. the structure of InsulirlD- the structure o,f E. Colf,E. the structure ef ltrf,V
8.A.
.8.
"C.D.E.
/9.A.B.C.D.E.
l0A.B.C.D-E.
C.D.E.
DNA cloning requires thc use of rnolecutrar scissors caliedRNA potyr,r,rerisesDNA ployn-erisesRestriction endonucleasesHelicasesRecombinase
Wbich statement below applies to the technique of PCR?it is very tediousit does not require amplificationot requires the knowledge ofrestriction enzyme cutting sitesit was co-invented by Buyer and Cohe\'','''r.:, , , r ,None of the above
11. A change in DNA that affects a restriction enzyme recognition site is detected byA. phenotypic characteristicsB. genome sequencingC. difference in reskiction fragrnentsD- cloning (E. hansformation
tr. Which statement is true?most prokaryotic genes contain intervening sequence called inSns evirus is a type of bacteriurn that affect humans FRNAcanalsofunctionaseeneticinformationstoragematerialT- . .u r -. .rr Ah,rrr,,Most proteins are generated by franscription in the nucleus tr +vqb{(Y ipt'- '+'-< i "' 1';;i; ,Transformation refers to the linkip o-f trvo DNA molecules into one F J
' ''-tr' -
i, .lp.S,iAAe sell anemia is a caused byA. DNA mutation .../ ' ,.i..B-'Malnutrition
Ribose mutation
, i'i'n{'
' l.f
( i t . :
, . . i ' ' .1
the
l', i'. f " ,f<( ( 13. |.ecombinant DNA technology is first developed in\ \ A. ,zl950sV t96os
C. 197Os
i
D. 1980sE. 1990s
/ 14. Hybridization can occur rA- between two complementary DNA strands o{YB. between tw'o cornplementary single stranded nualeic acidsC. between two .o-pl"*"ntary single stranded XWn o\V g
D. between a protein and a single stranded DNAE. between a plasmid DNA and a chromosomal DNA only
Which statement(s) is/are'not cor,rect for the synthesis of proteins in eulqgrotes?this is a decodingprocess mediated by H-bonding between tRNA and mRNA Tproteins can be modified after translation 1matured proteins are generated by splicin-g segments of peptides after translation 7AandBNone of the above
wt
U 18. Which of the following statement is true for Sciuthern blot?qr
A. it can be performe! bV-lhe melhods of RFLrffB. it requires a labeled prolp J \ ,C. it may or may not invslve gel eleg\(PhoresisD. itinvolveshybridiiang/ 1
Y\
E. BandD(i**'''-,'';''"
19. Protein synthesis in eukaryotic cellsA. always starts from apartiiular amino acid { nrc\\;it*M"B. starts randomly 6
!
C. can start from a selected few amino acids iD. can start from 3 different amino acids -1-
15.A.B.C.D.E.
/ t0- Which of the following applications need to involve the use of restrictionJ
digestsof DNA?\AITR by PCR'p <Mapping
"{g"W" ,/
Gene clonin$/AandB -BandC
17. Antibiotic selection is an important step in gene cloning in bacteria becauseA. it helps distinguish recombinant DNA (containing insert) from the parental
relegated plasmidB. it allows selection for transformant (harboring the vector) whether the vector
contains an insert if notC. it ensures that bacteria used in research is not released to the publicD. it allows new antibiotic-resistant strain ofbacteria to be isolated nE- it is a cheap and easy way of obtaining a gene J)
7
f\
fLuX
- ,Jt ' ' ' q '
q\r ." y 7Y ly' E. doesnot start with a anrino aeid
mutation on_hgr X chromosome, what is the most accurate description of the risk . ..tosusan'd/sop)
- GF:T.^Ei;J
---ev11^ i{ frrltv^, n,"1 rrr,-,ta-{r"1,, ' ,., i f I 11 itt -r,6rst^
A. if his fathliilso carried the mutatfn,"tti*iiiai.Eutdl_g* tire disease rc-^. ru
,@\h" may get the disease inherited from his grandmothegz\9t'tre may be a carrier for the disease \--
?\. , -
'rwT\
Iri l; I
L i r .
^r rtl {t (
rT ' '
\ rV"a' ^
Y\{T \ ,
| \..
\D, he may be a carrier for the disease'but will definitely not be sick F M . b/ ' f '5
RK exact genetic make up, I cross ttrem and get 12 offsprings. I':-----_--:- .. . IA. ifthered:yellow ratio is 6:6, the yellow wd prb-bablyprne-breds and theJed a vi il'
hybridif the red:yellow ratio is 6:6, bsth were probably pure-breds pif I get I red and 4 yellow, they were probably both hybrids (i-e.one red gene in each plant)
D- if I get 8 red and 4 yellow, ttiey were probably a red pure bred and a yellowhybrid
E. if they were all red, the red was certainly pure bred, but I still don't know anymore about the yellow
24- Which of the following is/are required for transcription 'A. DNA polymerase \ f /B. A single skand of DNA for use as a template ,,/
th" gly kind sf RNA witlr activity in the'nucleus Fthe only kind of RNA wittr aetiviry in cytoplasmf6-r,,rnfu[' ,
is the only kind of RNA involved ,transe_ription i-is the only kind of RNA inv,olved fr-nslal6n Insn ofthe answers is correct
B- a hiplet of deoxyribonucleotides which is read fron 3' to 5' direction FC. a triplet otribonuchgtiges which is read from 5' to 3' directionfD. a triplet ofEnffior-iid=is which is read from 3' to 5' directionE- a triple of amino acids which rnakes up the polypeptide chain F
C. A double stranded piece ofQNA, both are used as templD. Free tsFhg"cleotides X t'E. A and D bre coFect
23. I have two plants - with yellow and red flowers respectively. I do not know theirngenotlpes, but know that red.is.,:tlEi order to determine the
one yellow andB.C.
gYlx
Y
le Y
{,,?.
v"25. The direcfion of information flow defined by the central dogma isA. Protein ---+ RNA --+ DNA
K &U'
'/ u^F^ 1' . '1.. . -
B. RNA --+DNA --_.> proteinC. DNA -.> p:otein + RNAD. RNA ----+ protein -+ DNAE. DNA -> RNA -+ protein
26- Polymerasc chain reaetion (PCR.) is very usefrrlbeoauseA. it can cut DNAB. it is patentedC. it can amplify DNAD. it is created byNobel IaureateE. it can puriry DNA
27- A recombinantprotein isA. a protein which is a combination of two other proteinsB- a protein that is produced from bacteria -C. a protein that is produced by genetic engineering methodD- a protein that is produced by virusE- not really a protein t-
28. A biological vector isA- a vehicle which can be used to ferry genes from one organisrn to anotherB. a vehicle which can be used to ferry viruses ftom one organism to anotherC. a vehicle which can carry proteins into the nucleusD. a vehicle which can carry biologieal weapons .$E. a container which can store biological specimens
Aggl"" c.qdllg Jgand is 5' ATGIACCIICTCGA 3'. Which of the following is the$t'F"dl"P IiACCITCTFCIiln:.in.se;AGd b,, ti
29.
A.B.C.D.E.
irgJlil
5' AGCUGAGGUCUA 3none of the above
$4'p"nfj:{Pr" this sene? ' .' . rir.,r f )Itew^1u,k DNHsi7.-udrqccpc{ice :;g rn c i1 r.Gl,F q i' -5,TCGAGAGGTCAT3'. . . . I . . , I I raA I j.X 4" fo it''i-5' ,TCGAGAGGfCAT3' . r ,^^t . ' l -^r .5' uccAcaccucll l'h rial dLc\ uc'r I ut" 9
. t r^ . i { , ' ^ ard$rul uedlu"q
_Y S\tt"tt bqlq\-q
/
T{ 'J '30, Which of the followingprocesses involve tRNA ?A. transcriptiM , L
B. DNA '"pr{}l( "C. Transfo.midoir.
D. Translation'-YE. tu\A sprifte Qy
Ss+ F
GEM 1527 K Quiz 20.0212003 Semzrb"0., nibcr€, frr*pl.a1b
l- Which of the following is Not a constittent of,a nucleotide?
A. Ribose / ./B. Phospha;egroup Y
C. Base '/ ,/D.Pr imer / D , /E. Carbon element ,'/ \-./
A. Southern blot is a technique that involves
A. Nucleic acid hybridizationB. DliIA ligationc. PcR. '
.D- Transformation hE. Antibiotic selection
3- A single nucleotide insertion at the 6e amino acid codon of the hemoglobin gene wasfouff-$niit wiif nappen to the hemoglobin protein produced?
A. An hemoglobin protein containing an extra amino acid will beproduced.B- No protein will be produced.C. A normal hemoglobin will be produ(dD. A sliglrtly differenthemoglobin will be producedE. A cornpletely different hemoglobin will be produced which has no
function.
4- Gregor Mg!g4-an4 Thomas Morgan discovered:
A. The antibiotic PeniciVinB. DNA is the genetic tfraieSfC. The garden pea and frui$fly -D- The law of heredity ' \
E- The chromoslQes
5. DNA cloning requires the use of carriers called
hemoglobin
/
A. VirusB. Gene.gunC. PlasmidD. AntibioticE. Template \ e
.L.1
r. I
' . I rLTl
I t { - ( i r r {1r ' , " h U\urK Jv' \ l t
I r . ,I 11 rr ' f .r f
' \ -l ( t -
t
PWtlicil ei,sr'nq"t bry
Te.tt to the tegl]:iquc of Sotther,n BIot?
lh. It is ateeh*ique based on the plasmidXB. It requires FCR amplifioationC. It*oqtr-iied gel electrophoresis . ./D: It wasico-i,nvented by tsoyer' and Cohen {E. None of the above
7 - Restriction Fragment Length Folymorpllisrn(Rl, PJ is generated by
A. Variations in phB. Variations in chroC. Difference. in individualts blood,typesD. Cloning :E. A, change in DNA sequence that affects a restriction enzynre recognition sit€
tr*8- The structure of DNA is determined in
A. t95os lqEt Vwrt:*t ait?
B. 1960sC. 1970sD. 1920sE- 1930s
9. Hybridization can occur
A. Ontybetween two complementary DNA strandsB. Between any two complernentary single stranded nucleic acidC. Onlybetween two complementary single stranded RNAD. Between a protein and a single stranded DNAE- Between a plasmid DNAand a chrornosomal DNA
{
10. Which statement(s) is/are nelg9r,r99t for the synthesis of proteins in eukaryotes?
A. This is decoding process mediated by H-bonding between tRNA and mRNA -T
B. Proteins can be modified after translation t/ ' 'f
C- Matured proteins are generated by splicing segments ofEgetr$es after translation F -
D. AandBE- None of the above
Antibiotic selection iS an imporrant step in gene eloning into a plasrnid because
A- It helps to distinguish recombinant DNA(containing insert) from the parental re-ligated plasmid
B. It allows selection f,ortransformant(harboring the vector) regari\ whethel thevector contains an insert or notIt ensures that bacteria used in research is not released to the publicIt allows new antibiotic-resistant skain of bacteria to be isolatedIt is a way to keep the plasmid clean
Proteln s1'nthesis in eukaryotic cells
C.D.E.
J:\
6(9)&
A.B.C.D.E.
Occurs in he cytoplasm',r/ a -Always stop At a parlicular amino acid f-Can stop at a selected few amino acid pRequires RNA polymerase IDoes not require rRNA I
J{K-ltnted r6e5*v&
rII\
r\wtu )
J€-"t'rq )I
t\
\
(''l
t\^1 a.cr CrH $. "te-npf rtdcn .
,Y, t"$.
John's father had mophilia which is caused by a mutation on his X ohromosome,.rrWhat is the most accurate description of the risk of John's
xl'yty i '$. ff lunn's wife is fuFig5 John's daughterwill definitely get hemophilia F'd.
John's daughter will get hemophilia inherited from John's fatherf .
9 John's daughter will definitely be a carriei for hemophilia p
.. D. If John's wife is a carrier, John's daughter may be a carrier 1"l9. John's daughter will definitely be sick fr ;'g( ;y
IRNA {7\-<\
A. Is the only kind of RNA produced in the nucleus P'B- Is the only kind of RNA produced in the cytoplasm p.C- Is the only kind of RNA involved in transcription F l
Q a triplet of ribonucleotides which is read from the 3' to the 5' directionE. A triplet of amino acids which makes up the polypeptide chain
.7
.-4
(\I
16. You were glven two plants- with yellow flower/short body and purple fl'swer/tallbody respectively. It is known that purple and - In orderto deterr'nine the exact genetic *ut and got24 offSprir,gs.
A. If u got two types of plants, the ptrple/tall: purple/short with a ration of 12:12, -Tthen the purple/tall plani must be a pure breed in the colour trait and a hybrid in {the height trait.
B. If all wire purple/tall, both plants were pure breeds 1C. If u got two types of plants, purple/tall: yellow/tall with a ratio of 12:12, then the
purple/tall plant must be a pure breed in the height trait and a hybrid in the colour -; 'trait. \
D- If pulple/short and yellow/tall plants appeared in equal numbers as theyellodshort and purple/tall plants, then the purple/tall plant must be a hybrid inboth hait. I
E. All of the abdve- N r
17 - Which of the following is/are required fsr PCR? fi f
C- A piece of double shanded DNA as ternplatesD. Free deoxyribonucleotides -,/'E. All of the above
18. The central dogma of molecular biology dictates the information flow as
A- Protein -+RNA-+DNAB- RNA >DNA > proteinC- DNA +protein-->RNAD- RNA -protein --|DNAE. DNA ____>RNA_>protein
19. A virus is
A. An organism which can live independently FB. An organism which is a parasite that lives inside a cell I .C- A DNA molecular which is very small FD- A RNA molecular which carries genetic inforrnation ?E. A container which can sore biological specimens f
A. DNA polymeraseB- Primers
-z'
(--v-,^
^I
. l -L ' \ rn I i r' r ' , r i l
! .I ' a. j . : . , i - '
\
i f
E. None of the above
^it, Which of the following is/are results gfDN+.single nucleotide mutation? 7
v,
' ' i . '
23.
1r:t ' )
?
A.B.C.D.E.
. a{.gilrv.Je J+'-'$f.{t I r I20. A gene's'Jitive strand is 5' ,{TQgCQfCffpCA 3'- Which of the following is the
_,'BNA gdffted by this ,"n"t ,,
\ I g r
A. 5'AUGACCUCUCGA 3'
llucc[Hc n{o c "'
A. Stickle cell anerHa '
B. Down's syrdrfiC. Turner's s5mdronie
CN,* e'RNff"?'
D. Huntinglon diseaseE. A&D.
rWhich of the following statement id tr,ue?
A. Introns only exist in prokaryotic gegres FB. In eukaryols, most of the time a mRNA can generate multiple nrot-ei1s 'O (I)C. In bacteria, transcription and translation cannot occur simultaneously-p-D. In human cells, transcription from a Fg.rq first generates a RNA that is different
from mRNA found in the cytoplasm\ I )E. In human cells, tRNA ana inNe ur"it/d" directly in the cytoplasm F
Lxels{gurA;{$!R (variable number tandem repeat}
\ r\f/
I
Existin oufls unique in every indivi W;4Is of a fixed lengthDiffers onlybetween male and femaleIs essential for Southern blot
€
Trrihj sor\ ' t uNfrcl '
trYm
. ' . ' ' ,1
Questions 24 to 30 refer to the following paragraph: A-'
DiseaseMisknowntobe@,a",fiJ""grrentofthechromosornethatis responsible fur this disorder is localized on cg4qa!@I Jihere there is a cofunntafonfrom the sequence of the coebst_rand of the gene M from:
./
disease?
f\ ,/LJ.r'._./ .v
/\ YxJ"%/ "rfg
x7
KIX.r
ii'p,r ^r \ r'riVd K F
3\\u)<\>-
s'-.-cAch.4te@ryf*"i 3'to5'- cAclcc4t&@{$.{ia,e.c - :'Where the kiplet grouping indicate the reading framg gene. IVIr Lee and his wife bothsuffer from this disorder although they carry onl
24- -What
is the name given to the different forms of a gene?
25- What is the mode of inheritance for the disease?
E. Not enough information on whether it is dominant or recessive
26. Wlren their child is born, what is the chance of him,/her getting the
{YI.t- t' itrT| yn ys x o .f gP ra xo'i
c. 750hD. 100%E. Not enough information to predict that
If theif child were to suffer from the same disorder, what is the chance of him/herTFboring bo_th sppies pf the faulty genes?
-{-----__ _- _L
Al25Yo.,8. lz.g%"
c. 66.7%D. 100%
A. Autofmal, recessiveB. Autog{rnal, dominantC. Sex-lirit recessiveD. Sex.linlq d3rnlrr3lt .j
>(F x" s l*
-" \
whr+e A €P d,iteaov\ l\..,
I
Vtvt i*onlr , f l
Y{
E. Not'bnough information to predict it R.s
I
28. Wha,ttype of,mutatlon is this?A.. fnse,rti.ol*B- DbletionL. IransposrcronDi Pointrnutatio*E. Trar*stroeation
f t .{If M:. and Mrs- I ee had a healthy son, what is the ehance that this son will have adiseased child?
A. If this son marries a healthywife, then his children will all be healthy. JB. If this ssn married a diseased wife who car,ries two copies of the mutated geDe,
then his children will all be sick. fC. If this son marries a diseased wife who carries only one copy,of the mutaled gen6,
then his children can be either healthy or sick TIf this son marries a diseased wife who carries only one copy of the mutated gene,then ever5r new born child will have 5OYo chance 1o be sick
-l-
All of the above possibilities \ I ,vIf Mi- and Mrs. Less had a sick daughter who only carries one copy of the mutatedgene, which of the following-statement is true?
A- If this daughter marries a healthy husband, then her son will all be healthy. FB. If this daughter marries a diseased husband, the her son will all be sick FC. If this daughter marries a diseased husband, then 50olo chance her son will be sickTD. If this daughter marries a diseased husband, then 50olo chance her daughter will be F .
sick \
E. All the above possibilities
729-
YtY
'1-1I?.
L
1,ya D.
E.
30.
1f
aJ
_/
. .S-atK
IN\A\I
)-I
T\ tg
F'
1-t i l
L' . t l - , '
0lLIt '
f
,ox(\1^
rA. '
,1rr,tld'f*huY-' */"'
ddSlo'**ra 4 f;{tv\
#t
o
7s\' " / f ) ) 'r i - \ - -z- f . r . " ; ' ; f r ) - -*J J, .
'1.In which organisms are these proc6seslX -z){Utngplace?A.Bacteria . ' fJ J"B.Virus | \ { t
C. Playtdro trnlralpelis dkcrTft'D. Pro{aryo\es{S } -E. All o{p}abbve
Process X lfaUsrti{tfi_,
Process vVff'A4rc\
Questions 1-5 below refer to the followingdiagram depicting part of the central dogma ofmolecular biology. Study the diagram carefully.
Process Z {WnSl*fbn
* j urr , l /?
r ))
I
r lII
J
' t 'J
/ 2. Which of the following statement(s) is/are NOT true for Process X? This processX takes place in human somatic cells.{uses the antisense strand as the template.(involves one of the enzymes called RNA polymerase.
{determines the sequences on mRNAs, rRNAs, and tRNAs.E. AII of the above are conect.
1/\,' [ 3.,/vvhich of the statement(s) below is/are TRUE for Process Y?
\Xsynttresis of the new molecule proceeds in 3' to 5' direction a, tatt^B. Only the exons get transcribed io mature mRNAs in the prokaryotic cells. gulcnrg$v tatl oll{
C.It can happen in all six frames of th-eTaffie DllA double helix molecule. y1ruraXThe mature mRNAs have a cap and a polyA tail in the baclg!4!99!ls.E. None of the above is true.
I
I 4. Which of the following factors controls where and when Process X should take place?--
- ,A(ExonB. Special codons namely TAA, TAG and TGA (refer to the codon table on the last page)
D. Activator and repressor proteinsE. None of the above
5. Which of the following statement(s) is/are NOT true?A. Products from Process Y have a limited shelf-life.-fo s.yr'{NtttzyrahB. Products from Process Ztre further modified in all organisms such as virus. 6tttg1 e$c4yfloC. Process Z requires accurate H-bond pairing J u,D.AandBE.BandC
Questions 6 to l0 refer to the following paragraph:Disease A is known to be an inheritable genetic disorder. Thechromosome that is responsible for this disorder is localized at
D. Autosomal, not enough information on whether it is dominant or recessive.E. None of the above is correct.
v/ 7. When their son is born, what is the chance of him suffering from the same disease?A. Atleast2io/oB. At least 50%C. At least 757oD. 100%
ta
aa
fP)U
E. Not enough information to determine.).
)oAv&Xyo
xT
Y"Ar \^
f i* P'h | \" X
4YYtD
Xx xt,
XYb EX
C\ W F1* aa XpxuroYvYvY,
therp is a common mutation frog the sequence of the I{,P€rgene iflrOrTCC CCC TAA5' .. GGG GGA TCC CCC TAillq.CC G-cc...S.fo S
ccccc....3'. tfrffi5fue{nlrfnd,fr?t.??;r' ;,, ""o" ;Fil.frf,$:,t *.;',i#_ #,n" o,,,", F#Unfortunatety tiiiiiG tras also been diagilpsed tiTe suffering from the onset ofDisease A with all symptorfrs qpsociate1r&1th the disease.
Y xy &Yv
I
t
,l
i;
r r t
(f -.<-
tt-UU GqE frnh ''ecL c{6\6,rgArnChV3{5
n .:t"t ./13. What is the first three amino acid sequence of the'peptide encoded by this gene?
\r (refer to the codon table on the last page)A. Met-Glu-AspB' Phe-Lvs-Pro
E. Not enough information to determin{larou5o*ftareafu rtler,, posSi}t, ruhry -fryrg
, / 14. If the entire coding sequence above (i.e from the ATG to TAA, and excluding intron)is 636 nucleotides long, how many amino acids in the protein that this gene wouldspeciff?4.2t2B.2ll io$ t, a s,t+ ccJnc.2rcD.2t3E. Not enough information to determine
/to+ r) / (A + c)'-t
D.lVleiosis and mitosis both produce cells that are genetically identical.ftCovd4qfy-r th ̂ 486 Fflnboth mitosis and meiosis, the parental cell is Cnploid. fl
( , .^ ^.r t I f . - ,J II Pn tr k^lY'iJ
l tz -1.-A€,''<.'=v
i . : j ' :
I#":j,)v.Ai G
f \
S i,;6f1 '1))c. ii,iii,i, -r
xi i i ,wf i i , i i ,v
the first division in meiosis (meiotic division f) or mitosis. ?
4
A When their child is born, what is the chance ofhimlher zuffering from the samev disease?
A. Atleast2i%oB. At least 50%c. Af{dffitb/o-ii.... 'D. 100%E. Not enough information to determine
9. What is the type of mutation?A.InsertionB. DeletionC. TranspositionD,InversionE. Translocation
',^
/
! - ' , 4.5 '-+ J 8.5 '
c.5 'D.5'
. . E.3 '-rl
1
\ , t I10. Refer to the genetic codon table provided on the last page, *J,urrpnq*tt .Cb!represents one of the codons in the gene, what is the effect of such[rutatt6r tg]h" Jp-t"irritencodes? (', \ J
- J
A.It replaces one amino acid with another Wt /
f \ l,l /f'
UAC ! t '
B. It does not cause anv change to the protein. - \ j
C, It shortens the proiein.,.i ' -lB. It does not cause any change to thp pgotein. - \
C,It shortens the protein.r,, t , J, 'D. It lengthens the protein. {'. ,gE. No protein is exqY y} J'
a".,ti6;\,eJ*# r",rowing DNA sequence :5'.. . . . . . :AryAiff iCCCGGG..... . . . . .TTTCCCA']MGGG....f#',represents two regionsof a paiicdlar exon in a gene. Dotted lines refer to unknown sequences surrounding the
n^RND
indicated nucleotides.
l,^.,-fafz,,/rr.*u,ffi" IJfufi""tary DNA sequence?
/ 12. Which probe shgu!(be chosen for the Southe4 Blot to identify the above3',3',
C. 5' CCCTTTGGGAJEA. T3'D. 5' CCCTTTGGGA.A\r{........E.Any one of the above.
ff, fr*P,u*qAT3'& ,*t ̂ Affi
il
A \rvlo,tA^.{a
'il
{ ,, \,/r'- 17. Why do DNA polymerases only act from the"5,,r"end to 3'end to synthesize the newn, /rucleotide?
\ y A. The triphosphate at the 5' end is unstable to provide energy for the synthesis.B. There is a cap at the 5' end to block synthesis.C. The DNA polymerase will bind to the OH goxp at the 3' end first and then join itwith a new nucleotide molecule.D. A, B, and C are correct.E. A, B, and C are incorrect.
,7 rc.Different forms of the same gene are cblledA. allelesB. gametesC. pairs of geneD. homologous chromosomesE. gene locus
, tJ ..''.
I
. y't.The insertion of how many nucleotides into a geneti. ,*u"ni"b"#JrIA*JL ,"V mecode than the insertion of other numbers of nucleotides? f
t . \ J
f lJ ,A. I r i - \ J8.2 ' l
, J"c.4 t " ,D.5 r \ - . . /"E.6 f \ / '
, f ' t ) ,J)-t \ . \
V{ 20. whb f,r}nnr#O that the DNA is composed of the sugar deoxyribose, phosphate- .! gtoups,M nitrogenous bases?
A. P. A. LeveneB. Fredrick GriffithC. Herbert BoyerD. Erwin ChargaffE. Friedrich Miescher
. ,/ 21. The two pyrimidines in the DNA are ( ). The two purines are (v A. cytosine and thyminel guanine and adenine
B. thymine and guanine; adenine and cytosineC. guanine and adenine; thymine and cytosineD. guanine and cytosine; adenine and thymine
. i'Li.What is the name of the DNA replication process that produces two identical DNA
"/ molecules, each consisting of one parent strand and one daughter strand?A. Conservative DNA replicationB. Semiconservative DNA replicationC. Parent-daughter DNA replicationD. DispersivereplicationE. None of the above is correct
A/ ,t,Which of the following statements is not true?V +( Fredrick Griffith discorvered that hereditary materials could be transferred from one
bacteriumtoanother. {$ Hershey and Chase usedradioactive isotopes to label phage protein and phage DNA
and found that DNA was genetic material. IC. There are 46Qk"gggfggp! in human soilatic..nr. r3y4m FD. The condition in-EfficfiT person has an abnormal number of chromosor4es is c$led
J, r { t \ IRtffi-w-drolne people have three chromosomes 2l{ | , . \ '1 ) )z\ l t r l
24.Whodiscovered "nuclein" inside cells and f,#isrf,r\"rf; X*"r: ^l-',A.P.A.Levene r i : - \ , )*
B.Fredr ickcr i f f i th ' l
J*C. Thomas Hunt Morgan l'.
B. Restriction enzymes producing blunt ends are chosen over enzymes producingsticky ends for genetic cloning. . AC. Liposomes are lipid based systems to deliver DNA into cells. {
pf, Antibiotic markers and blue-white selection are commonly used for the selection ofqgrcmbinant plasmids.B. Viruses can deliver genetic materials and integrate them into the host's genome.
r,/ 26, Which of the statements below applies to the technique of DNA sequencing?2( lt was invented by Boyer and Cohen. 5An7+rB. It requires the use of reshiction enzymes.( It uses one of the four Sboxy-ribonucleic acids as a "stopping" reagent.}('Th" sequencing product is made from its owR 3' to 5' direction.
t
-
".:V
E. It requires the knowledge of gel electrophoresis.
f
\ t . /
S V Zl. Which of the following correctly describes a dideoxy-nucleotide?,/ A. Two oxygen molecules are missing at the 3' and 4' carbon atom positions.
B. Two oxygen molecules are nissing at the 2' anil3' carbon atom positions. r/C. Two oxygen molecules are missing atthe 4' and 5' carbon atom positions- )D. Two oxygen molecules are missing atthe2' and 4' carbon atom positions.E. None of the above is correct
-a -- ----
1
, XiY/ 28. Mr Lee's mother had a rare recessive disease caused by a mutation on both of her X
{ chromosomes but his father and his wife have the normal genotypes (they are notcaniers). What is the risk of Mr Lee's daughter?A. She will definitely be a carrier but will not be sickB. She will get the disease inherited from her grandmother.C: She may be a carrier for the disease (about 50% chance).D. She will not be a carrier.E. None of the above is correct.
{}
.{
vI')cr I
,YXXrhR F/,r:Y XY YY
1'UfXa y. ,
\ }i: 1r)
\ \? ' \
' \'Lj
oB. Huntinglon disease - neurological disorder
X Down's syndrorne - chromosome disorderD. Tay Sachs disease - blindnessE. AII the above are correctlv,matched
./
Ct/ 31. Which of these autosomal diseases is a dominant trait?Cystic fibrosisIluntington diseaseDown's syndromePhenylkeytonuria (PKU)Sickle cell anemia
A.B.C.D.E.
d) .o\"-u1$"1n*. / ,r.what is the phenotlpic ratio "r#ffirfi:r:rrr' A
on ov
f: 3;i''" ;'t'g;nd A n" '' nC. l:2:l
r ftr" s'a
D. l : lE. None of the above is correct
1V
Y
/ 33. When inheritance of a particular trait follows a pattern of ( ), individuals that areheterozygous for the trait have someylgilnldugegphenotypes of the two homozygousdominant and recessive individuali.
-
A. incomplete dominanceB. co-dominanceC. complete dominanceD. polygenic inheritanceE. None of the above is correct. \ ., I
\ \ l
J, r i t . t I
11 ,H:'fil1il'J'useturfor r,.\ 3: IB.transformat ion ?/
t \J,C. cloning r \-
\ JD. DNA sequencing ' )E. gene transfer. ( ,', J
f \ ' ) ' Ju
auestifr/s\s ryf !t+,od rouo*ing paragraph:
Diseaset')i tj*udt to be an inheritable genetic disorder. A common mutation in thesequenctdf the coding strand for the gene X from:
vvs'..A\rqA TAT CCC GGG TCT..3' to s'..A\rM TGA CCC GGG TCT..3' (referto thecodon table on the lastprage) {.-r,, {tsy
/ ,qs TJ. ?^ 6tV Sry- -r'r,/ lS. tdt&at ii thf name of'mutation?
A. Nonsense mutation.Sotr^qB. Silent mutation.C. Point mutation.D. Substitution mutationE. None ofthe above is correct.
i:':'
.:
Ft'
t,a\< 1t'"an^aalsilent mu
l0
/ tu. Which sequence(s) will give you of the eene X?UrV J.tr5'..4A,{ TAT CCC GGG TCG..3'
V y. lhich of the follgwing amino acids has the most redundancy in codon usage?
" {. Start codon -'*- l'.*.' X Stop codons 3
C. Leucine (LeuXD. Valine (Val)YE. Lysine (rv02
',at,,,/rr.whichofthefollowingisNortrue? .,r ,
t) t''. I
g. Amino acids are building blocks of a polypeptide 4t,rt "'H. r t \ I'Bi. Deoxyribonucleotides are buitding btocks of DNA an(ftx$ /, J )K e*iOL linkage is joining trvo aminJacids together. Y JD. Histones are present in eukaryotic chromosffes f \ J
aE. All are correct r l
*:- \
'Jt rJ
t '39. Which statement(s)ris/die,$OT o*,uado* genetic codons and amino acids?
X- one amino acid cpn \" s5fgn"a by more than one codon.4,O"f"4onfcgilsp\ci! #more than one type of amino acids prC. )Mr*atiohs aftht *ilr6 base of the codon have a more profound effect than th
it
Xa
V +O.I have two dogs - with green and white hair, respectively. I do not know their' genot5pes, but do know that green is the dominant color. In order to determine the exact
genetic make-up, I crossed them and get 4 offsprings. Which of the following is correct?Y if ttre green: white ratio is2:2, the green par€nt is probably pure-bred and the white a
hybridXq if I get 3 green and I white, the parents were probably both hybridsq<if I get 3 green and I white, the grean is probably a pure-bred and the white a hybridD. if they were all green, both parent dogs were probably pure bred.E. None of the answers is correct.
\^J l'^Jy'-l :
fa La {4t't't
a t , l , /q6, q '"
L"lI
3
sl
61
GcJ
ell
aia
",1 l
ar1t l
iJe
E. B antl C
{'{G
d 41. How many chromosomes are there in a humr
' has become the standard experimental organism for genetic resemchers. What is thisn' organism?
A. Garden pea plant.B. Fruit fly.C. A type ofbacteria.
. D. Yeast.E' Mouse'
, t) tt'
I
.t 43.During the Southern blot analysis, how can one in"r"ur"ffi "rl{h d["-t'- ofthedetectionprocess? (', \ J
A.Bydecreasingthetemperature.Ivt.lreadwl rr' f \ ' ) )B. By adding more probe and loadirg rponfDX* il4oihy'gefC. By reducing the salt concentration lrl ttre tryUriAllatffi buffer.indc6'4 , , /D. Bi using ra-dioactive probes ratheltha[non-ffioactive probes. frna
k0(tion
E. By increasine the \Sp{hornobgi'of
the probe to the targCt.
r / r \ [ \ -- l Siwl lau+fi4 ' f 'p-aL!.
-.2 44. ttd \r,t6rt frot *. ror meiosis?A. It occurg)oriltrn the testis and ovary.fB. It is'irrfolved in producing haploid ceihTC. It gives rise to identical cells to the parent cells. nal{ogD. It is involved in producing spenn and egg cells.E. All of the above are true
l l
4.228.23c.24D.448.46
,,/ +2. First used in genetic studies by Thomas Morgan in the early 1900's, this organism
.: ::l
r : i - \ /
t 'A t
r t r l t\ I /a5, Which of the following steps is NOT used to Feggerce a genome?
V" >4( Digest ganomic DNA into smaller fragments such as 5-10 Kilo bases.$ Clone small DNA fragments into plasmids.C. funplifi/ DNA templates for sequencing reactions.p( ferform Southern blots to construct map.E. All of the above are used.
t2
,'.:(,
V 46- IrDNA, adenine always pairs with ( ), while guanine always pairs with ( ).A. guanine, thymineB. thymine, cytosineC. cytosine, adenineD. guanine, adenineE. thymine, adenine
^n /tlU.1 47, If four nucleotides speciff one codon, how many possible reading frames can one get
I '* from a double stranded DNA molecule?
, i i
*.i &&hs+r'^' ' a')f lovc +{ta^*A ,}oC.6 t t , - ' ) , ,bD. 8 *xLE. l0
,/+9.vA.
B.C.D.
. . E.
Watson and Crick are famous for discoveringthe structure of DNA.
) ?'f jthe chemical components of DNA.the base pairing of DNA.that DNA replication is semiconryrlative.that DNA is the genetic material. ,
:'irJ J 'oc$lf nucleic acids are
?,
)] ' \
fl
rtg.A.B.C.D.E.
v 50.A.B.C.D.E.
5' A\A?TWhat is the anticodon of methionine (Met) (referto the codon table on the last page)?3'AUG 5' I r
3'ATG 5' 3 \A hc 5
3'UAC 5'3 'TAC 5'Not enough information to determine.
l3
I*
ri*:ELtrar:R'ss*'ilsGtlt3
co
Eott
(D,tft,ftf.
€{*ffir
\;*'
{i'it\'J r
Snd,base in *odun
til C. A ffi
L3FftePheL+uLa*r
Ser$g,r5,g.r5cr
TEr, ,Tfr,
STOftsTntr
,,,Glfis,,. . "
gT0trf.fO
' ,u. ,E.,,,i[G
G8.suf.eu€-cuLsu
Fro'FroFroFru
*Jls*li_s,8|fi
Sl;n
&.,19,ftrsfrtsAts
UGAF,
*ls'*le*l*il*st
T:ftrThrT*rrT,&rr
.ren
L'.Ys*-ys
5ssSsr*ru&rs
UsAffi
Gr/.u$tlla$Va*Uat
nAfa*laAla
SI fisFA$pG$.*6$u.,
trgrllf(ilvcfyG'tr
UGAB
pennf@Wwf?u/ *:, Ff-Biondsca*beft.nned: / <:
(a) duri*gDNA rep,Eeation J l'
Bf,within an RNA molecule I lfttF*1 ry-n**n DNA and,RNA,Zrf *
translati onal machinery?(a) Ribosomal RNA -(b) Transfer RNA(c) Messenger RNA(d) Srnall nuclear RNA(e) None of the above
4. Theprocess of transcription is required to produce:(a) DNA only(b) mRNA only(c) mRNA and rRNA only(d) mRNA and IRNA only(e) mRNA, rRNA and IRNA
5- lMrich of the following is not a form of gene mutation?(a) Inversion )r,-ft) Insertion# r(c) Deletion 3'., .(d) DuplicatiohJ-'(e) Replication. '
tl,i", :,
{
. { - . . cr\ ' ' I ( ' l f
i . . . r . ! lSe+ €-
,1I2.
,(a)
1{b)(e)(d)(e) BandC
{d} A and C(e) A,B and C
,:,ri.l! "
.f{t')
(y
{*y
@u
,.y
3. Which of he following RNA molecules serve as a "scaffold" or support within the
I6. The process of homologous recombination during the meiosis is also best known as:(a) exchange(b) translocation(c) cross-over(d) transposition(e) none of the above
\ri7. Gene allele W encodes a non-functional protein. What is the most likely mode,of genetic
inheritance for the disease that results only from the presence of two copies of the allele Wand transmitted bv human chromosome rnlrnber 22?
/*. From the Q,uestion 7, what is thd least likely reason that could geeount for the loss of proteinfimetioneneodedbythealfeleVrt? / NUtUaNu{'O
(a) Single point rnutation in the middle of the intron for the gene \4Q/ ' , ,(b) krsertion of,three nucleotides in the fust exon of the g|(" SntCfiVm\)(.9) Deletion of one nucleotide in the fiffion of the genq,a(d) A and C {x{
Not enough infortnatisn to ptedict it
::: 'l:'La1 r
.El't:
t -
I. ,aa?-{tIIt
tt:?
€I
I.
l : -
_:
sequ€nse 5'--.AAis the first tlnee amino'aeid sequence of
V,r,tU^c1iiS.).,* is a pollmerbackbone.
(c) The pol5rrner carries a net negative charge .7(d) A and B(e) A and C
(a) Met-Glu-Asp ffrpNn r{+-{.,v<r}c,q-l'
8i Xtf:l* s'ft$u Iooclvvu@ ccc{6tc 3'
/(dFrhich of the followingr6/lt is double-stranded wi
for prope,rties is/are corrmt?
-Zr{1ip.rn1btlinked.from one nucleotide to the next bfpf;ospharen\onl,ht) r\--
W (a) the decoding process isE-ediatetl(b) proteins can be heavily modified by attachment of,sugar(c) IRNA can be recycled aud re-charged with am-ino acidsf(d) A and B
M, ( ,(e) BandC x
12. The process of exchange between two different parts of non-hornologous chromcsoms isbestlsrownas:
Question 13 to 15 refer to the following paragraph: ' r
The following figure represents the restriction map for a gene S ry{blbgj{qindicated byEt ,82and E3, generating 3 fragment A, B and C. A specificorresponding to a region that covers part ofthe fraghent C (Indic?tetlylhqlhick line) was usedto carry out hybridisation after Southem blot. Disease S results from a mutatiolin BOTH alleles ofthe gene at E2 site that have destroyed this recognisation site.
y/fl.WWeh of the following$4ternent(s) is/areTRtlE for anafysis oftliewildtlpegrtleleS?€*)€b)(e)(d)(e)
Fragment C travels theflrstcs&duling gelFragryent A andB represent*lleles of theEmyrnes'that recognise El and E2 arc called DNAThe probe m-ust be homotrogous as possible to the region of interestNone of the:above
14- Dwing ur*e prdbing, how can one inercase the specifieity.and aeeuraelr,of$edetesttoh?
!*l !y reducing the temperattxe,(b) BV increasing the temperatu$
iri gy increasin[the degree of irornology,between the probe u{td,h" target(d) A and C(e) tsandC Or \s
/(t t S-ifn" rnap above represents the map of the wildtlpe allele S. For an individual being a_@grI t/ i "f
ther@egg, how many fragments will be revealed on the blot after DNA n"striction-\7 fiatffiG enzlqres that cut Fl,Ez and E3 sites, and then followed by Southemblotting
17. Which of the bllowing organisms/cells has its RNA as the source of genetic material?(a) Certain types of bacteriaft) All human cellsi"i *lVi*""'(d) Certain mice cells(e) None of the above
18- Whieh of the fol.lowing staternents correctly describes the relative order of organization? (<sign denotes smaller than)
(a) Tissuer< Cell < Chrornosome ( Nucleus < DNA(b) Nucleotide < DNA < Nucleus < Chromosome <(c) Tissue < Nucleus'< Cell < Chromosome < DNA(d) Cell < Tissue < Nucleus < Chromosome < DN{A(e) None of the above order is conect
using ttre probeindicated abo*e?(a) IV> ; .- oho ler',4tl^ tu . .i'i : oW lq^af{t^ ,? k9'(d) 4(e) Unknown
t . /
0
cRrySA* cytosine composition of ll%o,what is its composition of its
kdGC
If a lsiriaderlifrEs?t5%20%25%35%Not enough infbrmation to determine
(a)(b)(c)(d)(e)
t^:t i+s -siugte-'
Slre<,,r.ltgcf '
(4) e
Cide
5 risq$leotide
t 'L'c \{ c{ i "l c {' t* 0., { c.f,wri,t r .
ucleotide
- : - : -a. : € I
F-t
"F4
'E
1.-9..' F* **y';ytr>* ef efuornosome$ are *iere iS t6e ski*uelX rf u$g .@$?(a) 22
[3]3i'-*tt'(d) 46(e) None
J ^t \ \ \
'
rr$*' M:20. The process of detecting the presence of one gene of interest in {f_E[n]eps of DNA
. . tuglTts by Southeyn blotting would reqtrire the following stenflj!!9(a) restriction digestsv/(b) electrophoresis . v,/'(c) transfer andprobing(d) h)&idiz4tisn,,/(e)'cloning
features:6) ;;s";freplication \'/
1U; *tiUiotic-resistant gene as a selection marker ''/ ,/(c) multiple potential sites for the insert to be ligated into ,r/(d) A andB
the bacteria that survive &e antibiotics selection still fail to give the intended/ rnsert,This is most likely because the plasmids:{a) keeps duplicating in the host(b) undergo extensive insertion in the hsst(c) self-ligate before they are transfened to the host . r f-"\(d) fail to be tansferred to the host
- /. L t,/
(") "*
no longer proceed with DNA replication l: - '
25. Which of the following enz).mes is/are NOT necessaf,)r for making a recombinant plasmidin the test tube?
(a) Reskiction endonucleases r"(b).ligases J(c) DNApolymerase(d) A andB(e) B andC
r&1n'ts' t$s
e/21. Mitssis can only take place during the process tat generates(a) sperryrc/(s(b) ovum $ls ,(c) skin c{ts,,/(d) A andB(e) B and C
22. tvfultiple types of proteins in our body can be encoded from one single gene because of:t " l@/(b) &<Ffcation of proteins after synthesis t/(c) high degree of gene duplications(d) A andB(e) ts andC
23- Agoodplasrnid used in genetic engineering must contain one ormore of the following
,y'
v
\ . "
l$- fhs,:gf€at€S is,sue that is currentXy faeed by tlte genetie gnglneering industr-y is:(a) the intellectual poperties rights(b) the social, ethicat and biosafety issues(c) the high demand of manpower
\1 t -
^. ' / ' ,
v(d) the intense conepelition frorn othen industries(e) the prospects dwing the economic down-turn
27. Missing.-
28. Evolution of a species could be driven by: /.(a) adaptation of the sppcies to new environment V
(b) gene mutation w
(c) genetic engineerin g "/(d) A and B
{e) A, B and C
29. Vlhich of the, fonowing statement(s) is/are TRUE?
e)
(a) Genorne of a{viruq allows reading of multiple frames from a sequence(b) Large proport'on:of the human gl**".obes fo.r-BroteSs F(c) Bacterial DNA is nackased hw histone nrotd.indf ; \ |(c) Bacierial DNA is packaged by histone protdin{-
f(d) A and B(e) B and C
30- All living organisms contain:(a) DNA as the genetic material(b) RNA as the genetic material(c) DNA,_rd RNA as the genetic material(d) DN,A.or RNA as the genetic material(e) proteins-as the genetic material
vr
9"eu T)
.{lnfigure I fuage 9), the strand encoded gene A inthe following sequence 3'
. -s-E.k
Elj
. t :t:t :
G.ATCCA.-.-GGTGCA 5' is ealled(I) ternplate stran{(2) coding strandJ(3) active strand{(4) inactive strand.{(5) sense strandJ
A. | &.2i B. l&3
c.2 &3D.2 &.4E. l&s
6 gc\tvq ! a.,ue i''-aS|ne
.-h,r;.rgta-{e- cv$" tetnte atth*e
t
{,J
IIt
2
{*'p
I{!
l:i
*"li.4'1.:i
tt:
ti:II?t
ff.Yasdon Figure I and Table I (pages 9 & l0), the first amino acid of the pol5peptide
f-, 4.'Cells get theiinames from a scientist calledlU A. Robert Hooke
Ta
B. GreEor Maudel' '/\(
C. James WhtrddnD. Francis CfttE. Stanlev CohenF. Alicia Xiao (opps am I the one???)
-?---->),5. How manrr(diff6repilkinds of chromosome can be found in men?A.24 1B. 23c. 25D. 22n;1
@.
6. Which statement is tq,re for mitosis?A.. It produ"u" effi;
-- et-----
B. It produces hapioid cells S | fiC. The daughter cells are identi'cal to the cell that gives rise to them ID. It produces sp6rms or eggs fE, No of the above
I
7. Which statern€nt ir:g!!gC fgr eukaryote?A. It has introns and exons \
" B. The nalne means "true cell" '
-\ -.C. The nucleus contains some 2 melers in length ofENA -fD. It has a circular bit of DNA called plasmid that encode for antibisticdesboying I
enzymesE, Afterthe fianscription, nRNA will be spliced to rernove introns f
.{:V,tttictris not the method for gene transfer to animal cells?A. Microinjectisn ,./B. Adenovirus
ich statement is nq!_.lkqgjor the requirement of geneticD\$F l[Nl!ic material?
-It rnust be able to replicatelIt must be able to control expr€ssion of tmits -T'It must be able to introducg mutations of that the organism can adapt ts the newenvironment
D. It must be able to encode the seqtrence of,proteins T infro\JNoqe g{the above . !+*utl ?\
rmatic cells taken from wornan alwaVs;paiiolx chromosorn"F
B. a pair of Y chrornosomesC. XYD. XXYE. Nsne of the above v
11. Osw,ald Avery,Cglin Macleod,&' elyn'McC#-at'ssdd the following experiment to
{ prove that DNA might be the genetic material' \ A. DNA from heat-killed virulent bacteria could pass genetic code to avirulent bacteria
B. Radiolabelliiigphosphorous (DN,A.) could pass on to a new geneftion ot@89 {s6v,ry-rhc{tC. The percentage content of each of the f,our nuclestides was)he sirme (.."'ft| 'D. DNA was labeled with heavy isotope ofnitrogen to prove that DNA was replicated
in a semi-conservative manner Mg(<[Crrrn- gtoh I
"-- . . ' . * . -"_""
4!
'A'KasL\t'{\,.RgSaNt'--
E- X-ray.crystallographic data was used to prove that DNA was-\ struefure/-\ struefure
,fu.lgnicn tectrnique is not use for DNA sequencing?'(t ,{ Gene cloning l(\_,/*B. PCR X,/
C. Dideolyinalog qf nucleotidq/D- Gel electrb-p-hb-resis y' v
E. None of the above
in a double helical
A
E13. Celera Genomics is led byn A- CraigVenter
B- James WatsonC- Francis CollinsD. Stanley CohenE. French Anderson
f ) "
L16,A.B.C.D.
which is theDollyTracyHermanMickey
?-&
dyeand sorting them by
L
t {Wnatis not tme on Bt-corn? // X. It contains a gene from Bacillus thuringi.nsis 1 v
B. The Bt gene is toxic to the European com borer f .tC- The Bt corn may produce pollen that could kill caterpillars of.the monarch butterflD- Theyhave been grown commercially./ \/
E- None of the above
Anti-sense techno)Qgy
v-r
first cloned animal
FPolly
ich statement is not true on the mutant NtfethuselahA mutant fruit fly that lives more than f dbd"Vs, a6o* one-third longer than the restA key to discover the first so called clock gene
C- The work is in progress in the laboratory of Seymour Benzer of the CaliforniaInstitute of Technology \
D- It is used to study growth genes in fish, pigs,'sheep and cowsE. None of the above
L 3j Hffi":il::,Tu the telomers and lengthen the life span of cells in cultur" l* lF ,
23. Which statement is not ftue on variable Number Tandem Repeats'(VNTRs)
v
&tt Kt or'r$ ouol nn,n
[t:l Tr'*lns hv i ntr."{r" t
18- whieh state,nremtt i n6t Euq on restrietion enzyrnes?A. Speeial proteins that cut DNA -T -
B. They ean joir* iwo DIrIA fr*gments together -
. C. They generate stieky and blunt ends"f '
* n. rtrey irapaat"ii**1-;*;,;"f;r" against ftireign DAIA TE. They
"ne sprcifi*, and able to recognize specific nNa s€qucnces
T g
lC. Which statement is not true for telomerso I A. they are the tiny ties at the end6Feach chromosomes -f
B- they shorten eae,h time the eells replicate -l'C. they can prograrn cell death {
){Vni"Astatement is not true on why pig is chosen for xenotransplantationA. They have natural htrman-like proteins so no rejection will ooour after
transplantationB. They are dornestieated, clearr and easy to breed T.C. They are the size of human .f
i
D. They are similar to human such as anatomical and physiological aspect -1 nE. None of the above ' /1
'l 7/*Anh statement is not true for cystic fibrosis (CF)' A. Patients have excessive production of abnormally thick and,stieky rnucus T
B, Digest ive enz) i ln€sofCFpat ientswi l ldestroytheirown pancreas' :C- Prevents tlre movernent of chloride ions out of the cells fD. Retrovirus is the methods of choice to deliver the CF gend f [iyosawE- Drugs such as pulmozyme and ibuprofen can reduce lung deteriolation and infection
v'NJ-i: {r - )
A- They are in introns and supply no relevant genetic information TB. Paternity testing based on VNTRs can be done when one or both of the parents are
unavailable -iEach sequence can contain Jnywhere from twenty to one hundred base pairs -(They are used to makepptes ior}$Xand RAPD for DNA fingerprintt"*No twp pggp'le, unless they,are-identicatr,hvins, [aye.the same patterns of VNTR
C.D.E.
i
24- which of ttre following protein is not produced in geneticall,y modifiedmicroorganisms? /
A. Hurnan Insulin / tB- Human growth hormone.,,/
Q- Bovine s=omatotroptrin / CuW@. u l-antitrypsin -fyataftE- calf chymosin./ u D
25. Anange the procedures of cloning human insulin into baeteria:1) Restriction enzyme {igestion I '
€) Transformation 'b' ' : , 3) L igat ion J ' .' i 4) Clones.selection using antibiotics Lf'
5) Protein expression f"'A. 1,2,3,4,5B. 2,3,1,4,5c- 3,1,2,4,5D. 1,3,2,4,5E. 1,4,3,2,5
26. Which statement is true on Type II diabetes?A- The diabetes can be treated byh-e injection of insulin F'B- Mostly develops in people bq|oge the person is 15 years old 1:-C- Ten percent of diabetes cases are\of this type f -D. The diabetes maybe due to overweightE. None of the above
C. Itcauses mastitis in cow JD. Some milk farmers will Ue iut out of business /E. All of the above
Dt:
fi- : ( i -
p,{
$r lv
ftr
,/ zs., . . ' { \ A.
what is Roundup-ready transgenic plants?Herbicide-resistant crop sPest-resistant cropsThe use of antisense RNA technology iGlyphosate-resistant crops h
' r -. \ ) ! ,
29. What isthe target gene of,Faw Saw Tomato?A. PolygalacturonaseB. Ethylene producing geneC. Flavor developing geneD. Color developi.ng geneE. None of the above
30. the coding sef}uence of,the following gene 5' nccdcn rrA ACA TGC cGT 3, ischanged to 5' AC@A TTA ACA TGC CGT 3'- The mutation is calledA- Substitution :B. N;;;-- \ Ic. Deretion \SGlv\r" t0YlGff'D.rnsert ion I k lFE. Point mutationl /
/
31. the coding sequence of thejlollowing gene 5' ACGchangcd to_5'ACG GCAFIITTA ACA TGC CGTA- SubstitutionB- NonsenseC. DeletionD- lnsertion
' ' '\ ^dd
A it is suitable fortesfing anti-HIV drugstC/ It is transgenic animals as a rnodel for hurnan diseasesD. It is used in the development ofnew &erapies for cystic fibrosisE. It is created by transplanting embryonic human irrirnune cells into a SCID mouse
Whichfechnique is not following the principle of hybridization?PCFSouthern hybridizatioq,/RFLPRAPD eRestriction digest
-/r \X What is the function of a vector in genetic engineering?{ A. Cut DNA intomany fragments
B. Carry DNA into a new cellC. Link togethernewlyjoined fragments of, DNAD. Maintain and make copies of a specific segment of DNAE- None of the above
,--TBased on the VNTRpatterns in Figure 2 (page 10) Daughter-2 (t2) isA- Ml- and Mrs. A's biological daughterB. Mrs. A's biological daughterC. Mr. A's biological daughterD, Mr. and Mrs. .{'s adopted daughterE. None of the above
36. Which. enzyme proceeds along a srrdglfande_d moleculethec@?
4. DNA polymerase. B. RNA polymerase
C. HelicaseD- TopoisomeraseE. Primase
of DltlA in order to make
Y37. Which enzl.me is responsible for initiation of the unwinding of the supercoiled DNA?A. DNA polymeraseB. RNA polymeraseC. HelicaseD. TopoisomeraseE- Primase
- . . . - ,
-SSilv1icrobes can be useful in bioremediation because
A. they can break down organic compounds ^ _ lB. they can break down plants Cr' IC- they can break down animalsD. they can break down nutrientsE- none of the above
39. Which is not one of the stepsA- Denaturation aB. Ligation 2qC- ReplicationD. Cycles repeats
in (polymerase chain reaction) PCR?
ts/ ̂ 2::l::2{t Which statementis not true for the use of gene therapy in our present time?
A.B.
C.D.E.
A patient with ADA-SCID was the first case being treated-fGene therapy was used to treat genetic diseases that are affeCted by a single-genedefect fSo far the'technology cannot replace defective gene with normal geneSomatic and germ-line cells were used for gene therapy fLiposome is used for the gene transfet
1 .0'
i t - t11t , r '
ISet B
1. Ilm trjnng to identify a natural (not genetically modiflied) cell, so use.a microscopeand see:A.-"";"l"us-:so the cell rnust bet prokffiB. a virus: so the cell must be g(okaryoteC. a virus - so the cell must be irr{aryoteD. a plasmid - so the cell rnust be eukaffticE. None of the above is correct
l:ntcfu{ttt
lry' 2- Selective breeding is:
A. based on choosing individual genes that encode for favorable phenotypesB. based on choosing=plenglpgcthat may be encoded by particular genesC. more efficient thaa genetie engineering to improve stocksD- no longer utilized as genetic engineering has taken overE. None Jrtlt above is"correct tA) F
3. The DNA double helix, as described Uy FG-o56 d:cflis made up of:A. DNA wound around proteinB. DNA and RNA wound around proteinC, One strand of,DNAD. Two strands of DNAE. None of the above is correct
i. ^"discoveryof
the DNA double helix:' A. enable scientists to understand the nature of the genetic material "
$n,,pgrurr-Eu-r cr-al/ ,q{tRj
A.B.
and amino acidsrase, hucleotides and a
rnpla
Mcf ir,*Pi *el tt'trc--
€ 3 kiv.ta tl RNfi-' I f r
templatetemplate
tt .tiaEtc_rl r, 3l ?#* ?: lH:?ffi ftsf#${ffi$# :Dl Threekjnds,oE.'{fr.;Rinds of RNA, DNA and a template
vims f ryrftcirrl15.' r=---J-)
not hrur4','1i-flltfl r rriFi.tft , rFrr$ .ie.raplafu
W
-
1- You want to replicate a piece of DNA in order to have a large quantity for analysis.What sho-uld be the ioorr. of your actions?
A- Transforr* bacterial cells, select clo:res by bluelwhite and antibiotic rcsistance.,ligate into a vector, extraot the plasmidDNA from the bacteria
B. Transfurm bacterial cells, select clone by blue/white and antibiotic resistance,ligate into a vector, extract the genomic DNA from the bacteria
C. Ligate the genomic DNA, transform bacterial cells, select clones byblue/whiteand antibiotic resistance, extract the plasrnid DNA from the baeteria
D. Ligate into a plasmid, transform bacterial cells, select clones by blue/-white and" artibiotic resistance, exhact the plasmid DNA from the bacteria
,-; E. None of the above is conect,1,
t 8. j I want to PCR amplify a fragrnent of DNA whose sequence I do not know:t\ll e. I will need to seotrence the fragment first in orrler to nlan nrirner.,/* r.i.'r' I
N
I can usepniversal primers for the primers for &e PCR that bind any sequence ofDNA '/ yDNA '/ x
C. I can certainly ligate thg the fragment, after cutting them using restrictionenzymes thaigiv;--,-ffi";ky en{glto a plasirid vector cut,in fi" ;";;;;;;;;
"sequence on the ve*ctoi tE primers for the PCR /t - -1--
{ D. I can certainly li
E. A1l ofthe above could be used
then use
' .XD9. Which ofthe following isA. mitosisB. DNA replicationC. TranscriptionD. TranslationE. Atl of the above
likely to be occurring in your body at this very moment:
C. germ cells have double the number of chromosornr6s than most other cellsbody /
D. mitosis would produce 8 of 1n (haploid) daughter cells from 2 parent cellsE. mitosis would produce 8 bf 2n (diploid) daughter cells from 2 parent cells
, ' \
r C\,y
rn your
v
10. What is correct: _ Atar qrr\A. mitosis occurs only in $:im cellsB. meiosis occurs only inlglrm cells o-
'uPtlt-'
If I do not use *1". method of seleotion, the colonies carrying the DNA ofinterest will beSiqeNone of the above is correct
C_,12. Sequencrng afragr4ent of DNA is based on a reaction rnost sirnilar to:
/ \-'A. use of a sinele-seouenced onrnel-/B. use of a marker that will label newly created strands of DNAC- use of di-deoxi-nucleotides, or other special dNTPs that willD, All of the aboveE. None of the above
I l- tr'm trying to clone a piece DNA into a vector for transfor,rnation into.baoteria:A. If I use blue-white selection o-nly- all of the white colonies will definitely calry,
the DNA of interest \,/B. If I use antibiotic setegtio:n only, all of the whitei cbldnies will definitely carry the
DNA of interest. XC. I need to use both antibiotic and blue white f""rion to ensure that all of the white
colonies will definitely carry the DNA ofii/terest.D.
E.
v
stop cha
15.
x
ln transcription: -,.
ONA
A r Fmplate strgE{d is "read" in itsB. the template sfiand is "read" in itsC. Both shands are "read" in their 5'D. Both shands are !'read" in their 3'E. ETof the above could ocour
;a',*:$ob ,. t - ' (;*"- ' -
Y \}
2
5' to 3' direction by the polymerasq3' to 5'direction by thekrolffier;qto 3' direction by the polfrEEie t-to 5' direction by the polymerase
s_>Y
in elongatio, /
tA)t, 14. Boyer'and Coherrl,,\- -, A. were the,piOnC'Ers:of genetic engineering N
B. created the first transgenic otg*irtn [2.'c\]''r'"rC. created the first recombinant DNA. which they could then replicate in bacteriaD. All of the above answers are correctE. None of the answers is correct
XD
f l'loru S'.-,lct Clw"rPy11d.l!* iu +r,tq 5' --)q' r'',,5l{ Y !
I 6. Splicing of the rnRNAA. oecurs only in prokaryotesB. occuFs only in eukaryotes u/C. occurs in viruses \D. oecursinthe cytoptrasmCIflm )E. occurs only if the genome is partieularly large
c9/17. I ' ,m
A.B.C.
running a gel electrophoresis to determine the sizes of some DNA fragmcnts I'vecut, and one of rny fragments has run a little further down the gel than a knownstandard of 200 bp in length:This unknown fragment appears to be just over 200bpThis unknown fragment appears to be just under 200bpSpeed of traveling through the gel and size of the DNA do cor,relate, qo mythinking is incorrect
D- If the bands do n6t occur in exactly the sameabout the size of the unknown fragment
E. None of the above is correct
I cannot assume anything
p-\,-/
XOX^/ - / - . I\r.'{ts)Mary had disease that is caused by a mutation in one of her genes that is sex linked\
and recessive. Which of the following is correct? .rfi\Her son will defrnitely get the disease A l
IIA. Her,soq will defrnitely get the disease
B. Her daughter will definitely get the diseaseC. Ifher husband is neither a carrier nor does he have tho disease, their daughter will
definitely not be a carrierD. Irregardless of her husband, any child of hers has a 507o chanceE. None of the above is correct li
Recombination of chromosomes :A. Only occurs as a result of a mutationB. Occurs only during rnitosisC. Occurs only during,meiosisD. Ocours in both mitosis and meiosisE. Occurs in most cells, except germ cells
The ribosome:A. Takes a part in the process of replica)6/B. Takes a part in the process of transgriffonC. Takes a part in the process of spliflngD. Takes apartin the process of tranilationE- None of the above is correct
to get the disease
te) ft19.
24.
,y1
2I. DNA
D.
E-
fingerprinting is based, on the.fact that: *&">\' / A- No two individuals have the same amouV B. No two individuals have the sarne numb E;,;; ui
eftzyme produce the same nul$er ofC. In no t"wo indivi&ratrs will a sir,rgle,D\IA. fragmentg on * getIn no two individ'uals will the same FCR prirners amplify the same DNAIlagments rNone of the above is correct r)
22TSouthern blotting requires: r" v/ a- Restriction digest DNA VB. Gel electrophoresis /C. Ligation of DNA fragmfltsD. AandBE- A,BandC
B. The Phosphat6s are all diffgrentC. One of the bases is di{e/t Th4niae g UGA^ID. One of the phosphatesYs differentE. None of the above is correct
25. Antibiotic resistance genes:A. are contained only in eukaryotesB- are contained only in virusesC. are often used to select for clones that have taken up a particular short DNA
fragment of parlicular interestD. are often used to select for clones that have taken up a particular plasmid vector
containing that geneE- none of the above is correct
, /
23. As the detective investigating a crime, you ar€ interested to see if the DNA in the hairfollicle left at the scene matches any of the three prime suspects- Unknown to yiu,
-ofr6of,-the.suspects has had a kidney transplant- Which of the following is correct?A. None of the DNA fingerprintingtests will be validB. The DNA fingerprinting tests will be valid irregardless of his transplantC. RFLP would be valid, but not VNTRD- VNTR would be valid, but not RFLPE- None of the above is correct
24. 'Which of the following correctly describes the difference(s) between DNAA. The bases are alfldifferent
J. j *
26. Aplasmid is: i . ,A. alinearpiece of DNA foundinaturally in all eukary{fc cellsB. a linear piece of DNA fotrnd naturally in alt prokarylgic cells
27. Which of the following is true regarding translatjon?A. in eukaryotes it occurs in the cytoirlasm ./IB- in prokaryotes in occurs in the cytoplasm /1
D. chromosomes are folmd'inpairs in almostevery cell in the body {E. all of the above are correct t
I'
'kY { .J: t ; .1
i1
i:i
J,*
30. Which of the following statements is correct:A. chromosomes make up the genome {
-
B. chromosomes are contained in every cell in the body except red blood cell IC. chromosomes are made up of DNA and protein {
I
!InI
q!q.
t::i:.FrIE.
-'}
C- a circular piece of DNA found naturally irr some but not all eukaryotic cellsD. a circular piece of DNA found naturally in some but not all prokqryotic cellsE. none of the above is correct
4 v
bth eukandotrti C- in eukaryotes and prokaryotes it occurs in close association with the ribosome T
D- all of the above are correct . l.
E.- none of the atrove is correct
/ 28.Two cells simultanerSuslyundergo mitosis in a single organism, The result will be:' A. 4 daughter cells, each with a different geriome
B- 4 daughter cells, with a g€nome identical to either that of the first cell or that ofthe second cell
r _ C. 4 daughter'cells; eaeh with the same genome oJl a*gourJ ct$s
'o .B g daughter cells, each with the same genome r
' . 16 daughter cells, each with a different genome C
29.lf, during transcription, a single nucleotide is mistakenly copied to a differentnucleotide:
A. the protein product will necessarily be entirely differentB- the protein product could be entirely different, or could be no different at allC.. nothing will happen because the protein will be altered only if the mistakes are
rnade during translationD. the genotype will change, but the phenotype will remain unaltered f-i,: )E. none of the above is correct \'- '
& pr.ogcqol*[,"y1r,.t - y'$a3,6me-l
I i r r l\ l ' ' i
| \ . j . . ;! ,4 F'"
r)? The
l , r \ i '; '
h,1
1. What is the DNA sequence (5' to 3') determined-s
DNA samples were applied at the top of the gel.
L- l " l
i ' i,.,.,
in the following gel (Fig.
A.B.C.D.E.
! t i i
Fig. 1
2. For Fig. l, T, G, C and A represent four reactions, which of the following statementsis TRUE?
Af l reactions contain the sarne template, the same enzymq the same primer, 4deoxyribonucleotides (dNTP) and 4 dideoxyribonucleotides (ddNTP). FAll reactions contain the same template, the samd enzyme, dif&renlpriryers, +deoxyri bon ucleotides (dNTP) and 4 dideoxyribonuc I eotides (ddNT P). f-All reactions contain the same template, the same enzyme, the same primer,4deoxyribonucleotides (dNTP) and.! q|$q four dideoxyribonucleotides (ddNTP).When a ddNTP is incorporated into a chain of DNA, the chain cannot be extendedbecause the absence of af4OU group prevents formation of a phosphodiesterbond with a new nucleodde. FWhen a ddNTP is incorporated into a chain of DNA, the chain cannot be extendedbecause the absence of a 5'-phosphate group prevents formation of aphosphodiester bond with a new nucleotide. p -
Fry.
TAACGTCACCTGCTCGACTCCAATTTTCCCGGCAAA
^ ^ \
AAAGGGCCCTTT ( * INone of the above
(-
D
E.
TOAA
Ef'I
I
. lI
rx
FI
tI
rl
ig i - -
! .a
t - l
t : t r t_3. Use the codon table (given as Table I in the A ix\and det€$nine"whieh of thefo I tqlying- s-e.quenee (s) be I ow can rep resen t tlqfs en s e of th$, DNA thatEeclfiqti fher€P
1(t
: . i . j '
i i . l ' ' i
f i i i f \ , , i lI
: l\1
rr i
r t . ' . ' i
:J
tgrReptide sequence gly-ala-leu.,
X. s' - GGTpCIFTAF 3' /-
x :: egfseqET 1. ,"..,ili'i1",r",';'+*? *" i iltlc. s' - )dabcapra -:'D. A. B and C are all correct
G. (>
. t .n
E' A' B and c are all incorrect 16-1iL€ f a*le>* f +-^fl"-if W D\",*1cn'"
Which is NOT true about the genetic code? [hint: you can refer to Table l]h-
Some "#8tJlriJ*" "u*.MK='"The first 2 nucleotides of a codon are oft6n'enough to specify a given amino acid.Some codons do not specif an amino acid.f 9f"( /Nearly all organisms use the sarrie genetic code. -T \/There are six different kinds of codons for leucine and serinT l @ 4JYl
5. After ten cycles of PCR, by approximately U@afaglor will the number of DNAmolecules in a sample be increased? Assume maximum efficiency- ::
t i *J4'
\ 'L ' :
A.B.C.D.E.
A.B.C.D.E.
lo , t100f,1,000l0,0oo ' Io
100,000
6. Which of the following processes would require base-pairing?t
A. Colony hybridization '/B. Translation /' /C. DNA sequencing.u/ 1D. DNA fingerprinting using RFLP JE. All of the above require base-pairing.
.W L"
f r \
7- Fig. 2 depictsthe cloning of a foreign geneto a given plasmid and,sefection for thecorrect elones- The p-galactosidase gene encoded for an enzy-,me giving bftre oolor in thepresence of a substrate. Which are the phenotypes that you will use for selecting theclones of interest?
A.B.C.D.E.
Amp resistance, blue coloniesAmp resistance, white colonies/Amp sensit ive, blue coloniesAmp sensitive, white coloniesNone of the above is correct
\:.4 f-l}',*g$CE$A
I t t-"*Hrlgorl
i $bh.-a*'-r
,/,/--\a\f^./ \l ae*omra*vt
ll t e**/ \ /I Il \
J\
Hh smre*rrs
I;I
i,l
A.B.C.D.E.
A shortened protein will be produced if it is a nonsense mutation.lA eompletely different protein will be produced if it is a silenddmutation-A slightly different protein will be produced if it is an insertion ry'gtation.No protein will be pro{ied.None of the above is coirect.
I e't\ ,
. /,
N bh't" l
Fig.2
8. A single mutation at the l00th codon of Gene A was found. The total protein contains200 amino acids. What will happen to protein A produced?
A.B.C.
}- \
, 9. Which of the followingoptions is/are a good nnatcli?
Friedrich Mieseh nuclein fThomas Ftrunt ivd arranged in'specifie o1de1 ifihromo-sornesGeorge Beadle and Edward Tatum - one gene oontrols the! production of oneenzyme
D. Walter Sutton and Theodore Boveri - Chromosomes corne in pair and the
f A)
10. A young boy is diagnosed with a genetic disease that nelther- his father nor mother
luflers from, but his rnaternal uncle (mother's brother) is also-sic-EThe &sedeGilftlbe:
,A adominant, sex-linked disease.{ . XA X^ (O Y( g.) a recessive, sex-linked disease. '/' I
W arecessive,autosomaldisease. V , A _ Aa_ fr=X a dominan! autosomal disease.. w-' i ' . Ac" \ -E' It could be b or c'
'k ft frcr {r' c^ a*
I l .[note:
nucleic acid, which of the following statements is TRUE?equal number]
chromosomes of egg and sperm pnite at conceptionE- Al[ of the above are correct *f"h-
A. A:T, C:GB. 4 'G: f+CC. A:U, C:GD. Statements A, B and C above are alltrueE. None of the statements A. B and C above is true
restriction enzvrne you use for the most efficient cloning?
EcoRlHind///Baml/7 -r. .tHaeIIINone of the restriction enzymes in Fig. 4 is suitable.
/ e I
hY"12. You were asked to clone Gene B to a plasmid at a multiple cloning site. The codingiegion of gene B is represented by an arrow*(Ihe start codon is at the left end and the stopcodon is at the right end) and a restriction map is given in Fig. 3. The multiple cloningsite of the giv".,pdffi-td hus [email protected] riElus itig.Z. WEiitr
A.B.C.
KE. '
.N
:.:.'r.i 'r
-_i.j!#"
"{9,Tagf
Aluf
Fig.4
Y bhnt€ ,n6l'
Smaf
@gtal
o\ '1) ' i
'{-\
Whiafr shter'nent below is NOT true for the Human Cenome Project (HGP)?
HGF was begun in 1990. {BAC @acterial artifrcial chromosome) was used to break the human genome inl5OKb eaah. BIn 2000, Fresident Clinton announced that the human genome sequence could bepatented'. NDeterrnined the sequence of 3 billion bases which spent about $l per base-They have finished the genome sequencing except centromeres and telomeres. t
Which statement about bacteria is NOT true? {.*-
Bacteria lack a nucleus. {Bacteria chromosome is generally a single copy.T.Bacteria lack the ability of post-translational modification. They may not be asuitable host to
"*prts eukaryotic proteins. T
Bacteria have a smaller genome when comparing to genomes of eukaryotes.They overlap plqtein
"oJ"r (use multiple reading frames of the sarne DNA lt '
sequeffitdffinnize the numbers of open reading frame-Batteria irurr" op"rons to regulate multiple genes by using a single promoter. T .
-t'td
A.B.C.
D.
E.
[h.x*B.C.D.E.
Y"
nLJ
Which statement is NOT true for VNTR (variable nur4ber tandem repeats)?
The VNTR pattern cannot be generated by RFLP. fIt is usually located within introns.{ i
It can be 20 to 100 bases long and bd repeated in tandem 4 to 40 times. -4The VNTR pattern cannot be applied to bacteria-{ t
A(w ,rA
Describe th. "n9j"tu!!!
of -:f!f::llOi:US{!l
A.B.C.D.E.
(l) The genetic materials of the daughter cells are halved of the parent cell. {'(2) The genetic rnaterials of the daughter cells are identical as the parent cell. F
(3) Crosiing-over or recornbination:occurs between homologous chromosomed.Y:(4) Crossing-over or recombination occurs between heterologous chromosomes. f(5) Two daughter cells were produced.J.(6) Four daughter cells were produced. p
l , 3,52, 4,6,1 \2, 4,5 t1,3,6 tNone of the above is correct.
\( 17\ Which of the following statements is TRIJE?{ l\ l . /
A. An organism is called a homozygotrs if it carries ? different allefes, FB.
nt t l
\7
D.E.
i 18.
A.B.C.D.E.
If the F2 generation expressed trait in a l,:l ratiot the Fl' generatior't must beheterozygous for that trait. FMende|s Law of Segregation states that an organisr'n'inherits two alleles for anygiven trait, one from each parent. ?
g^ ccl8 r \ tflfg ( a !$t fiw<,Centraldogma of molecular biology describes how genes are modffred.pSome viruses store their genetic information as RNA molecules.
1 J
E_
Which of the following components isNOT necessary for a PCR experiment?
19. A man with a l0 Kb long VNTR on his homologous chromosome l0 marries awoman who has 0.5 Kb or 1.0 Kb long VNTR on either one of her chromosome 10.What pattems of VNTR would their son possibly have?
A. 10 Kb and 0.5 KbB. 10 Kb and 1.0 KbC. 0.5 Kb and 1.0 KbD. BorCE. A orB
,^ \ -Dj 1 i i . tE-.- '
I t r - \iL_t
20. Which of the following statements is NOT true?
A. Alternative splicing can produce multiple proteins from a single gene ineukaryotes. T
B,Modif icat iono}@mRNAsuchasaddingofpolyAtai l is toprotectthem from degradation in the cytoplasm. K
C. The TATA box and enhancers are DNA sdquences upstream of the coding region. J-D. The defective gene that causes sickle-cell disease contains a single base pair
change in its sequence. The mutated hemoglobin changes the shape of the redblood cells. They are fragile and do not transport oxygen well. T
E. All of the above are not true.
B
/.
l. Invention of pof,yrnerase chain reaction (PCR) has maj,or contribution to the
development in the areas/fields of:
I. forensic sciences.r/ Fj/t {r'9{f.'d-II. pharmaceutiaal industries ',/III. agricult*re and horticulture
A. lonlyB. II onlyC. I and II
P: II and IIIE. I , I I and III L
22- Frcmthe stepsin a bacterial host?
given below, which is the COR.RECT order of cloning a human gene
I. Transformation )Il. Ligation )*
III. Cutting DNA and vector with appropriate restriction enzymes '||
IV. Selection of colonies 1
A. I, I I , I l l and then IVB. III, II, I and then IVC. III, IV, I and then lID. II, [, iII and then IVE. IV, I, II and then lll
' Is)
::\+\ - '
23- Which of the following statement(s) does NOT correctly describes the techniques,
efforts and effects associated with sequencing the human genome?
A. New technique for DNA sequencing and assembly was developed.l -+
B. It involved both the state-funded research institutions and private companies- Ic. craig Ventor was the founding member of the celera Genomics 1D. It was intended to discover and patent allthe genes
E. It had created huge prospects in the discipline of computational biologyl
hv
Et::'
-":
24. The properties of a protein expre-ssed, in the human' cel ls could depend on :
f. The sequenae of the gene that encodes this protein
ry'- The modifieation that oeoursafter its synthesis JIII: Thc er*vironr'nent it is in.1 \
\ ..)tq \
A. I only Y.+Ni luo'* '
B. l l onlyC. I I I onlyD. t randl l , . \=
'E. I, I I and III J
Questions 25 to 30 refer to the following information. Please read it CAREFULLY.
The following information is associated with Gene W whose complete loss ol proteinfunction is the direct cause for an inheritable form of lung cancer. The gene resides at thehuman sgt chromosgme. thromosome&
-<------"-ft(CpjsJd'&-
By exam.ining the matured mRNA and converting them back to the original form of DNAsequence (termed cDNA), scientists at the National University of Singapore havediscovered that all female lung cancer patients carry fwo copies of the faulty (mutant)allele (W') that has an insertion of Intron 8 between the Exon 8 and Exon 9. This is dueto a single point mutation at the junction between Exon 8 and Intron 8. Individual femaleshowing this intron retention in only one form of the mRNA ig a carrier and is free from
-tnls cancer.
The Exon 9 is the last exon of the entire gene- The matured mRNA for healthy individualwill not have the Intron 8.
The sizes for the Exon 8, Intron 8 and Exon 9 and are given below:
Exon 8:2 kbpIntron 8: I kbpExon 9:3 kbp
The structure of the cDNA for the mutant allele W' in that region is depicted below.
\rdnr"rd\ / '
Exon 8 Intron 8/ Exon 9 ./ P'AY1^'L-'
.&lcoRI
-&7v
EcoRI
rnB Md "? c'At0w\ld I 3"2
t^, ,u"kqt: VrL 10
To develop a quick diagrrostia kit f'on this type of cancer, the scientists have identifie
gpgcifio ,"st i"tion Sitip for- EcoRJ pt"t"nt across that region- for bolh vr!!@Be and
fi"t*t;ll"lr*, urlnafut"d by the- vertiea] arrow-s above. Furthermore., the region
hGhltght"d by the thickened linl is to be chosen as the probe for Southern'blot analyses
(Frobe Q) while horizontal arrows pointing to each other refer to the positions of the
- io.waod f,rimer (beginning of Exon 't;
and the reverse primer (end of Exon 9) that they
plan to use in another test.
1s.A.El. ,{/D.E.
A.B.C.
A
What is the most likely mode of transmission for this form of lung cancer?
Autosomal, dominantAutosomal, recessiveSex-linked, resessiveSex-linked, dominantNot enough information to determine
26. Usine the primers indicated above and tested onsi.e of th"et'6$ products on the sample from Emily,
v no nZLd {b tU+
ttre@hat is/are the expecteda fema-iE-carrier for this cancer?
27 . IJsingthe primers indicated aboyi4pwhat is/are the expected size of thq"C$
L<o
4 kbp only I5 kbp only6 kbp only4 kbp and 5 kbp5 kbp and 6 kbp
4 kbp only5 kbp only6 kbp only4 kbp and 5 kbp5 kbp and 6 kbp
NffiE.
rit{\wsl)(YP,|^^!-.{-diested on the eenomic DNA but not the cDNA,
products on the samPle from EmilY?
a/drr"'ld
11
28.lfthe PC.pfioducts frorn the analyses on Question26 above is/are rg$@lggllb'enzryfoaififand then subjeoted to Southern blot analysis, what is/are the expectedsizeft) of the DNA detected by the Probe Q?
A. 3 kbp onlyB. 4 kbp onlyC. 5 kbp only
($ 3 kbp and 4 kbpE. 4 kbp and 5 kbp
29. Which of the following statement(s) islare FALSE?
I. It is not possible for a boy to get this disease from his father who is sufferingfrsmthir form of lung
"uo"", J T F'ftfl^cv s4ty 4iv{ Y
I l .Thereis50%chancethatagir lwi l lget th isdiseasei fh isfather issuffer ingJ<from this form of lung cancer while her mother is a carrier for this disease Z z
III. lf the PCR diagnosis of the cDNA for a man shows a 6 kbp band while the ZoSouthern blot analysis of the cDNA as conducted above shows a 4 kbp band, ..,then'there is a very high chance that he would develop this form of lungcancer
I and IlII and IIII and IIII , I I and IIIStatements I, I[ and III above are all correct V
30. Why a single point mutation at the junction between Exon 8 and Intron 8 could havecaused this disease?
A.B.C.D.E.
B.C.D.E.
This leads to higher level of gene transcriptionThis leads to higher level of protein synthesisThis leads to oomplete absence of protein synthesisThis leads to the production of a mutant form of proteiVNot enough information to predict
12
, Al. In designing DNA primers for PCR anal5lses-, orl4 earl estinratethe annealing" temperhture for the reaction. A general rule is based'on oafeulatingthe G+C contents and,
A*T contents. Each G or C pair is estimated to contribute te 4 degrees Celsius, while'
G:5A:5T:6C:44,
_4,'B.C.
' . t (
\ l " r .
' i r . i .
each A or T pair contributes 2 degrees Celsiannealing temperature (in degree Celsius) frcompositions:
j \ i ,
ld b'e the nearest estimatedhas the fullowing nucleotide
ti
nucleotides;nucleotides;nucleotides;nucleotides.
2535455565
": ' , 1{ i? lxtJ.;
*, -1 ' 'LL,\ l
"cEJv,
{":\,J-'
r r , i r t rd l ' t, . r r i , r . i
i , , ' t r i ' i '
tt-
:i
,\, J 32. How many types sf nucleotides (i.e G, A, T or C) can possibly exist in a double-stranded DNA?A. -aGtvB. 4 onlyC. 2 to4V 2or47. Ecq
f r
(f9)lWtrictr of the following statements is/are TRUE for n1q!9gis?
It only takes place in gamete cells TII- After each process, one parental cell generates 4 daughter cells that are
haPloid a -,----------III. JranslocationFquently-bccurs between non-homologous pairs of
chromosom.t:S-: -/
I and [llI aafd III{ \I and IIII , I I and IIIStatements I, II and III abb( are all false to
k:B.C.D.E.
IJ
34. Which of the following statement(s) below is/are FALSE for the organization andfunction of a bacterial DNA?
I. Some of their plasmids carry antibiotic-resistance genes =y'tl. Their chromosomal DNA has honrJlogous pairs f' *:T- q^lY ttV$'ttY _*^ ,III. Their DNA is packaged tightly witn fri:tojllqjleins F X
' &t'tFT^4
r and rr *c,nL";,5y' errita*Yf e{'tlFuw>..*
A.
@C.D.
nE.
I I and IIII and IIIl, II and lllStatements I,II and ill above are all
tt.f*i-lfsF
b.fr,
B
35.
A87CDE "K9
,4_/-
James Watson - solved the structure of DNA \/ AStanley Cohen - discovered a method foX,PNA cloning J ?^ -Craig Venter - ventured into the t rr"n#ffipcing pr6;ec t fi TKary Mullis - invented the PCR technique 'l '1Griffith- confirmed the genetic material was DNA and not protein ,l -y
I
Which of the following options is a misrnatch?
Questions 36 to 40 refer to the following diagram for the synthesis of a protein-
Csdon Codon ,e<rdsn'Csdon, Codotl Gsdgn Codonaar a€2 8ab AE4 aa5 i6t ' af l i
4ttq
36. Whieh of the f6llo,wing statements INCORRECTLY dcscribes the mofeeule that islabeled X?
A.B.C.D.E. t37. Which of the followins statements CORRECTLY describes the molecule that islabeled Z? oflgt i&,
This molecule carries the exact sequence (except that U is in place of T) as the IvAl
I nls molecule carrles me exact sequence ((active/ternppg sirand of a gene fr ).urkJ^iliffi;;ffir;;;;;;"';;;hAis eJn take place anywhere along the sequenfe F ffi+This moleoule can only exisiin eukaryote but not in prokaryote B i
., Its stability can determine how much a polypeptide can be made from it i ): It remains mainly double-sfgrded during the process of making the polypeptiAg i D
38. What is the sequence of the polypeptide corresponding to the amino acid number 4 tonumber 7 encoded by molecule labeled Z? [Refer to Table l]
" '
It is trar,rscribed from a gene but cannot be translated to protein IIt can be recydled I .€It forms h.ydrogen bonds between different part of itself IIt forrns hyd'rogen bond,s with the molecule labeled *2"1
It can cany diffe:9ry1ypes o{amino acid, but one type at a time F
+'B.C.
@E.
A.@
C.D.E.
Cly-Pro-Asp-Met.Gly-Lys-Ser-ValLys-Gly-Asp-ValPro-Phe-Ser-GlnNot enough information to determine
39. The complex that is labeled Y is crucial for this process because it provides:
I. the physical support for the process { '
Il. the iight environment for the molecule X to come in contact with molecule Z 1Ill. the origins of protein replication
-
I i \ . i i ' , i \ r " u ,J I
A. I and IIB. I l and IIIC. I and IIID. I , l l and HIE. Statements I.ll and
tn to ' r t tc lIII above are albaercet
A
15
<F-
,tI
9l:.5: tst
L Which of the following organelle(s) or cornpa,rtment (s) in the-cukaDtotic_cell'
doesNOT containDllA?
A. nucleus j , . CB. cytoplasm NC. mitochondriaJD. nucleus and cYtoPlasrnE- cytoplasm and mitochondria
2- Which of the following processes does NOT involve formation of Hydrogen (H) -
Which of the following statement (s) is/are CORRECT for the Human genome?
Most of the DNA codes for Proteins \:'Most genes contain introns I VExonsdefine where and wheh genes are to be ac$dbt".d tr .->
/
for making a recombination
Aand BBandC
Which of the following cnzymes is/are NOT usedplasmid?
Restriction cndonuclcascs rr/ligases
-/DNA polymeraseqAandBBandC
\Wf,ut is the chanc€ of Mary's daughterhaving at least one copy of the mutated
alldle?
A.25%8.33.30c.66.7%D. 100%E- Not enough information to predict it
-9gdsi/i \ .
B.C.D.E.
3.
A.B-C.D.E.
4.
A.B.C.D.E.
replication J '1,translation] . '/
.
;;;6;,i v ,'-lprotein folding]*: *L*q, tqtto^.f ,}- &v'dtvrt'/':J/ir! have rl uz:"* {
All the above processes involve H-bonds
V
pVhich of the lollowing descripaions BEST describes the health status of Mary'sher?
A. Lte is a carrie4 hence nothing happens to h'irnB. He is free of disease H as he carries no faulty allele of the geneC. He is going to develop the disease as the allele he carries is very likely to mutateanytirneD. He is likely to have suffered from the diseaseE. llis health
IKRefer to the genetic codon table provided in the appendix, and assume that fuqArbplesents one of the codons in the gene, what effect would such a mutation have ondreprotein it encodes?
A- Itreplaces one.anfino acid with another typeB. It lengthens the proteinC. It shortens the proteinD. It dses not cause any change to the proteinE. No protein is expressed at all
1l- In the cukaryotic system, a complimentary or:op_y O_*{frPUa/"arries thesame sequence information as its matured and spliced mRlfA of a gene- The lengthsfor the two exons and one intron for a particular gene P are given as below.
\Th" polymer carries a nbt(i6sit'ivb charge due to the charges in its bases
D,. A and BE.BandC
14. Which of the following types of RNA is NOT involved in theprocess oftranslation?
A. Ribosomal RNA fB. Transfbr RNA Y ,C. Messenger RNA JD. Small Nuclear RNAE. All the above involved
15. Which statement (s) is/are TRUE for the synthesis of proteiFs in cukaryotes?
A. This is a deooding process'meditated by H-bondingbetween IRNA and mRNA T
v
B. Proteins can be modified after translation IC._tsN$ ctn be translated'into a polypeptide pD- AandB IE. BandC
16- $Ihich of the following human chromosomes does nothave its true homologousoounterpart?
A. Chromosome IB. Chrornosome 21C. Chromosome 13D- Chromosome X )AirE. Chromosome Y
,.l
Question 17-20 refers to the following paragraph:
The following figure represents the linear restriction map for a gene with therestriction sites indicated by Sl, 52 and X, generating 3 fragments A, B and C. Thesizes of these fragments (in kilobases) are indicated in brackets. A specific probe(made by radioactive labeling) corresponding to a region that covers part of thefragment B and C (indicated by the thick line) is used to carry out hybridization afterSouthern blot and DNA digests with enzymes that recognize sites sl, 52 and X.
A pointggtatign-in Grt* at 52 site (that would destroy thisrecognition site) is suffiFent to cause the disease M-
..)")
\ l \, .L,\ 'g
B (2kb)
+r\
J?- What mode of genetic inheritance is for the disease M?/.
A- Autosomal, recessiveB. Autosomal, dorninantC. Sex-linked, recessiveD. SexJinked, dominantE. Dominant. but cou,ld be autosomal or sex-linked
18. During the prribing, how can one increase the speeificity and accuraey of the'detection process?
/A. By increasing the temperatur e/B. By reducing the the temperaXre ,,C.Byincreasing the degree ofhomol+gy of the prlpdto the targetD.AandC
D
v
E.BandC
19. The map above represents the map of the single wildtype allele M- For an individualwho is heterozygous on the locus (with one wildtype and one rnutated allele| what wouldbe the fragment size revealed on the Southem blot after the analysis by restrictionenzymes and using the same probe above?
A. 5kb,2kb and 3kbB.2kb and 3 kb onlyC.2kb onlyD.3kb onlyE- unknown20. A similar Southern blot analyses on a person's DNA shows the presence of a single
, band at 5kb- Which if the following statement below is TRUE?
/A. The person is homozygous at the locus M VB, The person's child is definitely going to get the disease,,C, The person's father is suffering from the disease also 1D. The person's mother is suffering from the disease also /
E. All the above are correct
21. Tralggjptiou is a process of malqng
A. DNA onlyB. mRNA onlyC. rRNA onlyD. IRNA onlyE. mRNA, rRNA and IRNA
tr't-
L/
22-lf a single-stranded DNA has aof its adenineRr-
A. ts%B.2A%c.25%D.3s%E. Not enough information to deterrnine
25- How many types
4.278.23c.24D.46E. None
24. Which of the following statements below correctly describes
C. Tissue < nucleus < cell < chromosome < DNA < nucleotide
D. Nucleotide < DNA ( chromosome < nucleus < cell < tissue
E. None of the above is correct
the relative order of
of chromosomes ar€ there in a healthyhuman ovum (egg) ?
$ftosone composition of l57t what is'the cor'nposition
\A
rV
h- -f
dc
e23. Which of the following statements below correctly describe (s) the organization of
DNa in various species?r-Wuffgg tyr"k)
A- Viral genomes are very compact and can utilize different Eaffe"s for synthesis of
different proteins TB. Human genome *linty consists ,t@fp,Fl**o-C. Histolfrare found in bacterial chroFosome's 1- '
D- A and'B \;.;ff; uor.n* u*u$ fl*\"t'
v
26. Theproperties of a protein rnainly depends on:
A- the sequence of the arnino acids {B- the composition of the amino acids fic. the environment it is in h,.,f,Wtnm* /h,$r^rphil.r"D-AandBE.AandC
27 .More than 100,000 proteins can still be generated from the
the human genome because of
p35,000 genes predicted in
If'
A. alternative RNA splieing 1B. modifi cation of proteins aft er their sy.nthesis
-f
C. gene duplicationsD. A and,BE.BandC
3'; what is the
ANR .r3\
I
' . \ Ij l lnr
. a ' lu( lt_ lv. l
f t , /where the mRNA nu{
{- }nnn \
t tT \ r
g
.-/
28. If the sequence of an mR\A is 5' ... CCQCCd,aLlooocorrespondinelcodine setififfiof the DNA? |
I I\__:+"
'f i, 33$33ffiffi::1; a G(,,c,[cc({rrlC. 5'.. . TTTAJq.AGGGCCC...3'D. 5'. . .UUUAAAGGGCCC...3'E. None of the above j
29. From the question 28 abovo, what is the template sequencebeen synthesized from? .-
D. 5'. . . AAATTTCCCGGG...3'
D,/
E. None of the above
>/30. The process of exchanging two regions ofnon-homologous chromosomes is alslknown as:
A- mutationB. translocationC. cross-overD. transpositionE. none of the above
0 rugnt'ul "{nc,' tn1u,
. | -
r\ rtifinvrl ^^Atuonhr VaYY"rw', / \ ,
, iv
u9 u6
b g E;PT P:6E 6FE P ! .E
6z o<o) oz:x :oa! 3. :\ '= \ tsOE O;
o: ! o
!o no
s€ siEF 5EuX !XUO UO
;E ;Eo6 06
-g' .' 12'-'o; o;oo ou-o -oo> o>
E: E:9.: i 9 j joc oc
o.- ! -
F9 F!i6 E6
€.e €.e6- O-
.'f f .i: 9'6d
<U diEaa
L"EL.Ea. i
y v\la r'tv 'r
Ino otc'tIIIt f rl> 'IG
l rt ,ct , .
tc
lstoI bnn.I SF
I ;?
I .s.> 'I f i 'EI Ep| *3I -YI <;| ,1 trI 11 EI o{r /I PAI O?I ASII oFI r i ) l
I Eg| * r] ;J
I av
:1 FEI f j '| - t
f iF:S
NlriSt$,,:'F
tnu
j
:
hfi *
t
r__B
EcssL;"
-X=i3
o5*ecS
E<-z
' f iu
a. . s*'s o€c a5
; : )1
3 r- \* Ee!JE cEb!b4 u S 5 S* s L+ u
4 L: i - -k gl , .s;
T d;!€; -e: 9,9.h
-*cs; : c**; ,gpLE" iEEif !E: : i 5 = > Ei ; . : ;h 6 > * : .* i f rn i = ! E E Ef gqiE* P € * r - -u d a.a.a ' : ; i l * =* I '539x : E * '* ' * -= q-Atr i Et {ddda < ni d c i u i{ d 3c c i i
-
c:-- : t L [ . { . ( . . La S l+=** i d d c i , , i
Efl
aa::&s$
$t*e, , : : i:*
ld
Jt:i
rxiaB
in]A
?
::.1:e$
f l ,
*:l::','* I:iLlt r I :
Sl l
6{::
gr*€,f:t l t
boo6+
;a\ae- l -c b*- lP rf3s.{
x L-"sou:. : + .y o
I E 5 vS 5E E g e - :q a/ , Q E = ! r - v '
V o 9 u \ ,E ;r - : e : EJU OF; ioh72
: E . i JTT .E{0 t .9 o=.= .YU ! E E -9 o? o P 9*{-E i3 c .Y b $+ s
I ' E g 3:E El *ccrf4
H q i i r t EE 6 I y=\14 oE q o l lE 'g l E
' i v u
{ E E bE.EnbD.r 3 ! c!2 s l rc$ j I I 93 9l 9
ET € € Ee €t€b; N N sr i q 'o
: fr < ni Lj: d 'j3 i : F
*H L \ . " iE! L
?g i d d . i ' , i
Li
coc0
ui
L.
li
(t'=
c
b{'t
Llauk
\,
r\
z
EG6;
Eo
ci :' ->5o =
gl>:
>o;:@Y
E.g:i oE;
7. .8E:>s.>6.:=EE::Osoddo
soou-
i r E 3 3<' :?<d)uo
F.. { - { , " LAi d d r i
9o! I- iq=
*x* Et . i * e
foY; 9
. (42 € u
. t * - o o H
A.r* P + ! . :H gE ! o ! l :
Ei? 3 R; *
ix# stae"sis E E E 36; i E: l i = I 9E.q? t o E n i rg
a'- i ; i s I ; it : : F 0 yr !u o:F.*: ; E h X6#; i ; 8. 8" 3 ;E *:3u * s.q :5 E:1; 2 v v do b,*ESFPPHf;.EE* F F B E3 s*El . ts, ts c o. I 9i fnE c c c c l i E
ls i E E E ## e;e; * * i EH;i , . - , - ; f f r o:69: I o o o +o EsqE c < c
-o o
c * .^ F F F Fc Z
E-arr , < ( I ) (J O! uiko-
.= L ! \ I O L
r jEE < . d . i ' , i
g3SJ*:7
= 1. tl '.;*5 o / r€ r- . r IQ=a:g
6D^q
f t !pTF +: *
. . d t r a:2 ! j t H* E-8e{e E9Ht",L: 'J 0* s X;: . I z:6<3P n?5'r- . F-I I I af tp- ! tur^-oc - i
! * Xl l
; 4/ *T- $3
-- : E*5 : ; e a*
i Es*; ;q 4Z ! ! .n
>. 2+v?2: =: id.v I
2 LIFN-. rvt6Fl :. : -=?)!?
& ; E-8 F.*D a j3. , , ,UHiaFcAmAAm
i (<:F- j { j j r , i=qlrpH
i -* , ; r . . .
q j Ei { I r i d
-e- <ddddoi 'LLL. |
; i i l idr id
I
h',&,:,:3
"::s:6z
',,9- !
*$?
..)x\
6
fi,q
;67
g
ffi
)rd$..s
,ri$l*a
,g
$g
,!: : ts$
'ti:.:*.lr:4
ll$
fr':s]
g
s3
,s
+Et
$fis
.u*{ii
t
e
l,,i;. , .
l,&::ii::t:FF;:::::::
:F,f,lj
TA
:*:t.t
L:J
ig
{ii
ra{
! 'g iao.aqn
m :rr q.rr=i;a-:E '* f 'Rs 6: =; .a a) -A= ui i Po" 6o -d=
F E9 gO
; $q XE6 o=' ;9o *-- E. 1.
; i ls qgF sF FF
3I iqxo
E3 P3lq 1:-=Fn p.B3F qq
d-gF;.*t { laE.d i Fo- d-
< ;9
; f ldt 4.ctr
ii nLrt.i:H
li{l
3.i
t i l
&li"I,{
I 'li ik;
5:t )
$|pitr|dlq:ir,:36,x:,:::gdF:d
ts:
J:i i!1.r i :4
i i ts*::ii
t,ftt :::4't::::rata| ,:s
l {l :s!: ir:*:t::::€lr Bl , :s
l' i{lP il&l : g
Epl; s'l! r :ElI td l
i5 l;81F r l,i. \il;g l
i : l& sr lg:" 4t31:: :1e..4..'$
,-t:
l : : , :u :s
[ '::: ':gl i l r i , d:
[''r,,. 't$!nt :9
l : : i
i l o 6 o > H .{*
1O + g 1 1 _1 sq
- o- o^ - * - r! " g! ,
^1,3 r *H
z i r in 4= - -
gto o - i_ o o ,* -r a ; .? : =o o =t I o o :4e, 4 '= P I :a4 o l : o < ?:o7 E 3 * = x+
o o 4L
S i o E q cf i ': o + =
-' li '<,
; a o - =. gro o f F.-
a = o o g "u: 6 : * < 33b q o J. @ =:r E = B I t ,gI -a d < e ! rr r o 6 e 6 dS
<+=,v.4o O J X ! : .= o o P {?=;o9: a Ei :u ;" i34 g a l :=6d5
o4J
y9.o-F.OOoo{ra! !€3-o;o-od
oa*={7
f=O^(D6'9o3' :
@-1og-F-<xoo
! i e o F | *A.Si ;c-r a 1 ) n ; F+
m g cr @ > S " ;' C CGz. < F I z k :pFq Z F d g i *Fo p I o o * +f
3 s F = 3 r ; ie = = = e r \d' - F 8 'E g p lqtP : : i ; f a i, id_= j '=€ qA6'o -* 4,6 s 5*q :- o
'6 I t :i 4
: H i E E A i ;aad#4? sj
;<=d41=^4i i c f l f P:
.9 I : i5o, €. t i :F-=*J-
_Q
a H 1 XhI < o ' * t -= = e #5F e i ErE , i f :o
- st
-
H r . -* .
= * *4o { 5s
q a i>l4 i ;d Y:?.ixG' ; r
I5H,a!
> X " :g
> :* '-
€ l !
- A*
o :$a
c :TsO PE
€ g*=. *ad {aata-o i .>o q-.
o *c
oqc
< *gr : .* .
. PQ
o<€ p"'
os"
o*
:8.
o:t
3 '_;+o
! ,9Fta^!O\O
,Y'=to,o
r" !p ! r - , ie 5a ; : t ; f= *1f l iq*?n?J so 6 'c : iJ +; =3 :E 1A Ig gfr;4 flf a6 Eo l ro ! tq -F d3 BA I :e 3F d U6' e
g io =x <l
o vo =
B F=. =6. :: id =: aR z)e I io= id: oo o
x Fa 3389EE=.o9=
ioo
,E*-Ergo-
o
<=- dg>st8 *3 a-;5. g
= Y Ea:
i ioarse. ni . , 3.A r53:5 U q ) ' :2>i i = r, ; ' f t !
i2 f l :qE, i : : 3 f EE F F fr{ s; -<! -UGEZ'a'=- f - i *Sci iF<;.
*Er EaEF:F 5t*t ip E9i; I 9a; I I qI + +O +
- +
: : F rc F -
F
: " n9 c; C ,,.;
3 i l { -Er- r* r - '0< i d r i ! i
to60
14gE>t
u; ->35 Fx=z
aa ::>>. i ioooF-Eooeor
€€.38iEEEE=odLO
s€€tE: s $: sg;eFekr ' i , ia;
iSgsg<coUoEi
LLLL{*i idci l i
\,
ffi:it
,s:'x
,,,ai
a
:1€#
kq
Ei
I
$
:2i?!i
g,$
g
{E
t
IF,i
F,F,'
! ' e o F I F*gFp*1 ) n * t 1 ' 'Yof i f r'3;5C5
rn o c ' @ > Fff i ' *3r r = r i g?lgl? 3 i ; = *Ea; ig :
- 'H d.q.6€;H
o s d. , . = o f tg<vgn-3a3 *s*330'P aa;5$;r {€.r}*q xqFHlx [ f i : r ' :A H€i : jo$j 6*- i3og g o o P*
I * o. , 06
g *Bfr i f i '6 tu_Roi lg
*da no r a0 o
s &fr ' nci=*tSqna;Cio*=r 6 UX P$tFfr i , i- .q+isS'vo r< e
Foa;I :5og;; ga*-co +5of i . i f i -
- : l * x
A*oAJC $ Iq**;: - icov. 1{
F | $6d*
( !>;i
2= 3PP ?
6-
g
F
:6'
f*
c
E;;J,s,€
ITPOP>P*octoo=.
3.oP^O: , f
:.-
d
vses
$
a:tt:.]
#f
rPr:st;ta;rr.:w
n iri*- iei:f flfgigi
HiEFUFiFiiTgiFSliliF$iFie*iir*slil tH t F$ + [$; ie
HlE$$$$ga${elil Ffi irFli'rlsl ; l i l [ a r i r€tt i ; t i Pi iaU o * 3q*: '
! r9n""} ,') i1
3I
i:Bl+s,
fI '
s:q
E
I
g
$rR::::
fi,$
d ::4
*E1l
r$l.{,f.;sgt*rF6: i
gd5 ..:
$*;h$l?$..qea:6;{
$,e.; : : t l
ii,*i
,{trli *i: t6
'$l,. ,::::1,,€1
ll
$$'rt$,,.sll:
g:
$ls,vs,
s..--
'D
F 5{l
ds
.6 1,f ,asn:c
agIT
a.gg
ST
x;
5boAq
4>5c
'Us'E f.
i , ; :
1ae,i:
AEsi i
Hri^!}
itI
Iil
It
I
I
$i!ii
k
t2
$
: : : l
F5q
'5
D"q
g
;
Eg
e
x0
, ixo.9
i :gs.5
8.3bU g
5
4
E5ti
;I
F^*{9,o i t l
ssfo to
g=s I t
.g > ; i
e; *'g t *
tnSgb
qo ;gtuu
: o * f r
e" 3 3rT: f i u, t90 9a?c e-d f uraaa- .g uq6 EEFg
'E
-D.- th.gc F9?i l i 'XY>a *gi ic d:
' ; .? i 'n ';1 , :E :o
* =7 3: - - r :a u.-r :11. E 5 5 >;? i . ; sH' ; o: > a,J 9| : , . ?4 = = a - E
, i ! **€:Y 6 " p E E; e 3:rE = E F j =l . **=-2: : ! ' - H H'a
i ;5F*3 F = E 1Hi E!-g{t J * ' - '=;i €8?tE < di L i c j u j' : 6b"9RLjcc,t d* x v
a f -=.5=l
i i d . i 'd
si
9lI l
EIl ; I
x-sd
fJ
€fr
5e+
F'^ i r ;+6d
! 'NNNv{.g<didciuj
\,
<.
-
na,cP
.€ s6l I+9b e
eN i.=.y!<; : :z>g
:us 9.E*=-E.S 6 PPEE;
. .=.=.NFPHEp63eE,bfFo6>E-co!!+ ' -xYqJE R
- ts;E6e:oea3;;tE95E
Pt-:es9:E' ,6;
I t igEdldldld)m
<didciuid*, t"L,L{;
i r idr i r ifL*{"*r"
sf{ id. id
*"
il; Es l lE gF f 'r. l -o l l
3 $! l l:
' "8; i1 -
;q l lt , '€; J: : E; l " lI * tF g p F; s$* f i E H g El l ls SF: q I H H Fls lE i t€ = $ s u gl '11< =24 i : i : i16l* =fre s s * fr el$lE:, . i r g H F = ut ' rt ; . I i r * F E J Hl : : l?E'*E*: E u s gkli * !Ys' : i : : : i l i l.E€<rXlg :,o{ iF h h in iD hlgl*ai idI < d; L j d, , j [31
;€ ' IEE ( L L * L l le= Hlr ,5s i
- d d d
::&x
s{{$iii
fii
sd
p
iEpsE:tlg
5
$,:aIJ*
o-. )qOrOfiE;tsXa€g
i rE:8*rgi ! ,Hoq:6600q9=6' t ,
-EU=gE.eU.8f l=F6LlOC
iy .od. :o9.=
3c.gS
4crUEE#Eeg*EF"EEPE;EFEXCEEde89o*3:.E€EFE*'- i E E ;n-"* .= .- e =i t yr E B 6 u* i Y i t ro Err i e 9 9: G
* 's -g
iE ; i aU a iE .E€b <' : coE u o ui- -v! !, ,4. \ - .= 1. . -c i - L (
ai€ i r i d Gi r i
s:qJ.F
' *onoq^
rtF. ; ;
e*va36
oF€p
.sEg8t toi-il t
: r 6 I
1; : 'F
5r g h E F.e4.! o X ! ! ; I
ro -
Y ,L ? =,*F
2- < cr i L j c i ' l iEe
; ts! \ . .+!(
a i l3 . . d d c i l i
\/
!
sv-
ha-I
'4 t
b6
;>, ,9
{ ; i ; , i i, ' ) . r
m o o @ d> +=' s
P @ S f FS r .n o d o l ;o iwfJ=:J&
Poooo: i lxa)oooIe B e e: i .
: -E s e 'a.i f
ooof_o-ogfr3i3OOO^ooo*
+7ioo'ocoooqooo, i , ,ooo5,ooos
6' 6' 6'6@Aooo
aa aooo
oooooo
dd a
xo6o-*dt- ; t4q
<(D; '-o-
9it,u l
-Ooo@-
6cio
o{D
! r 9 r p t jec\EaoaE\Ja- l
-ndm Eo ln Eo Q>l : s : q: s: 3: R:c AI dE Aq EE 6Ji . f+. o i . f=. : i .
3E '& 5E 'E i5Eo@ o eo o 60
:= : -= = -:J 3 E3 J 3=q
-
Xo q q
Eq q Eq q q66 r / i dui d of o o Co o \
- on
f r s :s d 3aaaaFohoofl i r l
oa;: ;3S H &E B63E,.689,+R=dEPSPd3tu=<€==ooio=oo
ofHH6Q.@_o^=q=tJb,i<ot:
f i 5 8E f ;B0"16=oiX<-,E'+r63fo-10
o:
s3E+dioox'-av
o- '<d
@
! i 9 r ' F p ! Sg
F I i ' F P sf t : .= e q q I $ i :a d 6 6 6 t '93
3 =; 1 1 ;ssE a F a q rr{5 q o + r . 7 iTl :q 3 q l -d lqsd A i s H" : :3 ii i i i 3 ; :*rf r { o o o h{; f ,q s+i ?ZiE 39q t t '?3 fr s g Sf !t= H i i Slr ,.^ l -6 i
O--*6 =; z!2o o ; : :*
- G X * 'a
3 d ; . r :s d * qgo 5 Cd
oA*:: d . ' i :
9' t*^*{ k)
x ef,*1 ' '4 '
| :L,J**
*
-(
3;
[]dfl:
q: *:E
Etl&
s.i
* l
t*:#:iii
Ig
a3
d$::?E
1
.*:+&A:'iE:
r$
.B:r:,$*
:;i
agG:s,f,i
.g
q*
::ixE
3ft
F
{,4la*Sl
8'si
! i p n F | 6 '3Er:c)?113: i?-1?^] . !1q
o O O O U a La!
fn 3o 3o 8q 3> =Ea:
ea;Eaagetriiii !+q qi ii : !c s :d ' t : igg 3r i i i t fg?; ; i i ipx :x l4 H:a e. : ; ieqi * ta eqf; *?€
E!; d!E ?Fi
3aE Ear i r l+ € g ! : ;?.g t -E H Ea:'a F s := .#llr g E E -o.X s o { : i '- I s { Io;@ .o f ra- -c;5
7 f 3
iL
{
i
s:
s*:t&3x
g
'?
f
.a
3
!$
! i 9 n F > I P,g = o = o
^F. i . i - " +EgSgBg*' 'F e o P P i lE:r ,X1::6 B B s 6 *EHHBaSSl * o, F o o oE:ts=tspB-I e E E E ==E=h=E6'
= = = = : *r [Fg.Fs:a o o o o X6Jt; .#E*:-3 R e 3 3 sg"Fu*uf4tr9!nPP€aab {9 a
66 Pln a; i N5e 5'q* 3g5 J6'B t .:+ +E5od 5
t
! (F 0a
^^+
5X A
F; g&a rq9 o-<d {SsOE
I
*
'
::*'agii{
FA
i
riii
7:
1i
! r 'eFFr{, !3.}3 ' , )3-13-)31;ooooo=Fr" g 'p E'p E'F Ep ;
5=- =+ =- =- =- aot of o= ot ot 5oo oo oo oo uo 4
d;aaae'o6oo6=
E€EEE'
3 3 3 I 3:a. i .dI t . f :
OOOOOO
qryF:\qEoooooo
B- a a a eAulqqqtr ,
q q q q qaqdrqg
3 g 3 e erg I E * Po99999*
!€pEE':9oooo;s. o. 9. 9. 9. . I
ooooo
6d,d,66,ooooo
ooooo
2cl99Pq@@@a
qqqqEdddddo-oooFF-F-odooq
Oooooxxxxx
€ci6o@ooooo
211
: l ;
l,{: 'l.t'1 i,
l !ta
t i !t*tx
:::::I4::::I:fr
ls.
i : i : l ;A
l ;t*I+t,5,,,,1,*
'rlg' : ls
IF
F
v&
'1.F' <:)
t ' 9 o r r i rEFi . f g'] -1 ,^r -'r r llSiii !
! . ,1 r j { s
IN 9 P F P iHFq F
t l -=99.+Fg-oeroH:: ZE 9 ig**foc+.J-: <=r 1 [ 5f e e: : ;<=A;i
"4scI
;1€_sF e o r | ?FF-g$
, ; i r i+F+3 5;- ;
r P o P P ,E iQ.* al . E . l - r . : r ip**F - H H g n
-c.6 f ,
- H H --
o yr l :5 s
E; s i = 13*8?g a 1I g s; ign3 i 5 5:= t ; ; i 'E3 g. _3
-1 e$f i .a< ' ; ' 1F;gds"*.6 : a€x-1FagF; E I
{q f , ;€j ?:I eES i . :t d?
d::+6X
e;F,
aggr, i
a-
, ia
+;r :d
; I jin:si;9...,3 l l
; .*gEnia;PqTE5:! ie
di
6&?;
2d
*4
3Ue,sI?
a
_d.
a
;
:
!n 9 o p r i : iF l1 .1 - \ ) - ) ?1?d
m o . , @ > i igtr- = r- r. * $c+fF = = = 3
- : i :- H O ia:c"g
H o : : F ; { : ; ,q
: :=EiF": i i ll<o6Yi i i r r$s 3
- ' -a ni t :
' E I '1 3".5;iu
s3
$*tg
g
E
\f
&C
--..1
! r 9 p r r I i+": ] r r - r rE*gi
rnpOpprt i$-c5FH=H
-H=3 s 3-oo-+€FleE:oo
: ; : -<a9:<:
!r e n r r rFIl fr S'1 -r 1 -) ,1 8B'Eq F -
FgNFPFE-i Fep i I
*L ' -eeE=5-;E5 H H i : td aH o q * * ;E 3=aa== n s3 >=9 e I^\HarIe e: : - i<=1 : t' : : g
iic
gE
c
+:t
_ec
! r I n e r iF: ; 4 ga \ a a r * t?r l 6r tn8* =.
! t5: lm o o (D > E;;q* E
5 s. . l . E : rg: ; i HF = H 3 : i l iA* [H o o o
* Siad ; i
= : : - = ;s?, ; ;^,
* - <
^ " l i : . iiEEe=. i ;e* i^ = < iJ: : ;n
=:Y<?:?:r : : ;<==r i - : : . . ;
qi:*
T: i iJ rs i -6. i i i. : * ; i ;Tri6
a=i
45
i
3::
F
s
d
.R!
*:q
L:fr{s
?
rn3l
i
g
t,-ri{- J'1
- "t]
!n9i 'Pl*;
""':j ') ) :')
mu.)@>
of:afl **g(
<oo1^=l<f<<
a
::i
i
! i 9 rr P | (Elv
" I I i_ ' ' i
' r t { ' l' i ; i i iAm o O @ > i4 ia
- - *
- * : ' t : :
= = 3 s g f i ' ;
i '8 . ;<= I=H=oY1o<+=-->o:{5 ' :>1 i l
:
g
:i
53
:ii. i
I3
t
'i
x
a
Eo8.ogE60,f=--z
8
E
o
do
€o
Io
;d
pa5
o
d
o
x
7ra. :a. : \
F P o F P AF e'1 1 1 1 - l gE'
t i p !-) P P El
t E g g F r$H. E. 13o 6 =-5'' I Em
etqf i3
s$E
oo
xi
,€
d
o6o
aE'z
F F O F P ESrt' ) ' ) ' ) a a g:
r8FJPAFP6PFgE'1'26eoddg$APFT6 Ro.F. i i a. a. g
A H E E0"H7E'E.g'E' Pd66EgXxO+EESR55=-e_s*-=os B+ gE fr i ;5; 'q gF13 q*FdF'5 'qe I dPSBE:3SAao: 'f Fa ?g,e,F g!ESE'tEB l 'F F* E
ES' 6 '9a
+H E+= s"E"93.'E:
to
o
{oq
o
ooo
o
zF
€o
F
€o
d
s.:
38-
I ' r F O F P gQl.1 a 1 1 1 ?FH
E'u t
! r , g o tr P *g€q " t q q q pga.
: ; : : i E$:i i : : . i f fs ' -I h h t E H'mLF i j H 3 3 *Egxc-1 J: iFaaxt i:{ Fi d A Fi eflnEgsnnggn: : : : : atg:
: i : i ' 9F:EhBIFf i : :jHI6I R ej A R i i=^I H e 3 F $gFI F E d t ;A'rP H U O O E.FOI X ? A R $*R
z. 'q: : - ip i " : E:. : q g' :
€"€I
-It6
F p n F >Elca.r . ] - ]nt
eSsNpp909.t : rPF
.@
oo
.p.ao
1O
o'
No
ooaoq-
F 4 {,(b6'a! tqo
qre' ,s,=E. Io='cd6
sgHd-58.6r
F5( '
cgoF{
6o=E
o
i !oFE66F=.,L
U)
o
ea
{o
tr
{o
5'P
?'3.=<PLt<
o
I
E.oa
so@
6
o
I
o'oo
iII
:(t(
36'8.agE56r3
g
o
eo
!'
do
oE
{o
( l
:C)c)
-t.1
ii')o
! l-!-1Er)
i\
3.i'8.oggoore
g
o
o
oa
P
{o
ao
v5I
;;I\
3p*
.rQa
FE60rE
g
o
aa
{o
4o
-Fo
g
F 9 O F P =FEFa ' ' ! '1 ') 1 Ft"E A
F'ppFPBseE.='BaHL E;-="= H. Fs 6F B' e e F g* EFa:=98=7
i .+ q E5- aq' F cac d' . t r B5'* @g? HSF F_=. i
Efi €s'F sd; g9.) i E
c€ E.qg' cFEF
€E.EE6o
FBfEg
3"EEH'
F F O F P Ag91r -) ' ) *$.8 '
F P A F P, :F.E E E .? .? ggE. E 4 E F ITFcsE.E'd3E H EE E FFf T: * HqE F *g Fgi!EeT
5sglg sg +S.EF gtS 9,F' o6sTH 3ss.FE H# Fge $; sfoFtr .6SSF+qg sF gr s s HEF-qB' l
6o
;to
F
E 8i ,g8 <; <.2
FFH6 $FEqqBFE3"8'g
!1 9'Etx
E€L=
9tfgaa*6:.g66e.EOo-
;B
$F€ate
EE'B'5o<*$e1
FY(')FP31111 a
! .Jpatr
*E Sgge6EEEoPqqE'€ i ln 'a '
{a'i iFLE.X
ssg,a t{, ;r,xxxaiE*gEoo6
8AaaaFEEgs.gExxE
x.22aEat
€fts.'E gAEa6s*
o
q
6lRnEgoora
8
o
do
€o
=6
6
Foaop
oa
o
c.6oo
ts.o
o
x
F F O F PEF;€91 1E r r B r LYX
ts. O o Er:r" 9 9O F FP HE:a=€==3=ftFg ; FB B g$ EliEESE1FF$aEi g , l "3 6"s EigFB EE-gg$ga E g B FIEg €g BE * s s Et+E ET 1 gBEg R g E s$6
I E $ F srEe * E B gr l
za
toQa
sgoo7fE
g
o
do
{o
{o
t 'e=-.J-
5S9.{do9d
6'o
x
!
o
GI
{oeE6g
'oae
q*o-: - .t36<HgE9e
-oaxgE
F
"-fo
Eo
:oe.oa6pq
s
d
!-lF
e
o'&oSE607f=
a
o
oo
{o
{o
!!
Eoad
m
oaUEE
0e
oE:o
o
ts
!rr
!a
od
F
6aonao
p
oE,=16
Foo
Eq-
\.-.
7
FP PFP811*1-)" 'E
f r ' , p Eo F pFa * F* * *EE EEErg s rqqs ssi
FF $FFss esH3F trg+3Ug <l !F'agE. i l
$g 36p{ 5. Ag H3s tgEF* €E$FE gE€; g ?i aH At
! rx
<i'8.ogE56f ,R
g6o
€6
c
{o
F: ':<uE.! rsE6-a'7NE
o
o
at?
o
t6t
o
E! 'x<
F.g5o
a.gaa
o
$
o
(t
8s
so
€{
EI6'
o
F p p F rEFS€1 1 1 "1 a 3EF
3'6 "F e o t r F tgg
7####?q.3E I E 1 a Fl*6e;Efr t* i
s I 1 F e €EHE g s- 9. *^ =-.2.6 F e E {o
s i g d sAE Hgs *FF i i g 1 FHg q a g1
EE F agN 2 2. qEg E F BEg il EE
ox<;Et?o
ad8Xoa)/
?6:8.ocgoox=
rt)
o.do
€o
E
{o
(r)G
€
o
6
ti
o
o
6
oF
aP.t)
o
{A6
o
t6
o
o
0
€=
t6
o?f
\
5 U'=55
|J A'! t;Rb6-g'€F.ofJo
ox
p
{
oi 'a
@
='a'o
F=
T i I I t*aigf lqi Y i : I ggFHSxE H g H E "6s=sps= ; . F ; ; grErEr
f-) rsuraoz_s11,/GEK1s27_sll I tsttsozX.2rcextszz _stzJl-J ceRs & $sciety-S€lt-Revis eu$$ons'.gtt t ./t - t
\_/Assessment Title : Gens & sciety...5elf-Review euesiisns-.Set I
studsrit Matric trtc. iestaft Fat€ asd Time :
-Fs€tior 1
1) Seje{lire [rr'*ei*nlt is:
a. :'' a. beied on shs*sing indiyidunt gecs that encqfilo.abte ph*notyp6.E. : B. b$eed on {hsosing Eiyorabt€ plruwtypc fif-.g}e €nc$ded by parti{uta, gens.C. C, br$*d ou cho6$irq fflvorable ervirorment that mry iilttuen* trvorable phsrctyps.o. I tl. htred os choosiilg fauo.abls genatyps that en@da for favorable phenst?pgE. : f. nsrre 0f th* shove is covert,
il{nlber of Attempts : I cot or litJrnrt€c ttt'
Ouratlon: 17ir1 52slolsl l.tffrks i 15 sui 0f 20
nmturral elkctisrn t3 ., *r,,"}"r" nt,'l "' !-*il|\f-'*'{yg4,rorn hr/r
K$_rnr1,
Df,lri are irund ir: ihe talloNvifig comircnenls/oiqanel$ :n llie {:e!l
I . aJaleJs.I l - 6i i*h. i r i , i i ,a.l l I - chlsigplast-l ! ' . qclgi igf-rar8t i r$.
A. I and 1: *nly.
B. I and $I *nly,
c. I. It snd ilr onb
D' t, rr 6nd tv onty,
E. I! II, III ANd IV,
A.
B.
cD,
E.
'fhe pxrcess oI'lrnnslalion re{luiIts the ltillowirrgt
. &. *NA t*mplate, ONt polymeB$es, ail *JtAs and amtno rcids.:. B. DtlA t€sFl*e, tHA Sclymerss and t*Tp$,
C. riboslme, mattA, ttHAs asd t'tTp$,
D. rRHA, tRilts, ffRt{t an.l N?p$,
' F. .ihossfie. mRltA, tnNA aFd amins acid$,
+1 Which of the following statements iVare NOT true for mitosis?
a. A. lt ta*s place in alt tytes of cellsA. B. tt generates dauglrter cdl$ thrt ar€ id€nfical,C- C, The proces Invotr* Kombinetion heiw*n homologous paiK of c|rromdsmeg.D' D, a and c.
E. E. B and c.
\,
s)lf rhe coding sequence of a DNA is 5'...GGGCCCTTTAAA...3'; what is theconesponding sequence for its template?
r A5'...c6€cccrrraAA.,.3'B- B,s'.,.€€ccccuuuAAA...3,c c-s'...TT?aAAG€cctc,,.3'lL o.s'.,.uuuAAAGGGccc...t.E- [- a*rre o, ttE alrove.
6)
Tlc rext four questions are realted and based on the following paragraph.frisease T is a form of heritable kidney cancers that develops during the early childhoodofan individual. It is caused by the loss offunction for a protein T that normally works asa turpr srppressor. Scientists discover that the exon I ofgene T in all patients sufferingftmr this di5sase garries a mutation from the wildtype sequence -. /a.{[email protected]"-5' . _ AAAGCGACGGATGAGAAG... .3' to 5'... AAAGCGACGGA6IGAGAAG... .3'.Kerin aged 30, does NOT develop kidney cancer despite that one ofits alleles for gene Tcari€s a mutation as depicted above.
$'hr is the mode of such mutations?
t A- lnygsicn.
l- B. tn*rtion,
S, B. basecl cn chssins fivorable ph€rotygs thai may be encDded bv nenicelar nenes./Corect Anfwer i 3. based cn chmsing favc€ble phenotyas tlai fiay be encoded by panictrlar een*.
Coarect Arsser , riboicme, mRF{A. IRNA and afiiro acids,
Ycur Marks : loutof i
'rbur Afi$lver ). $, A al :d C. i f
Coirtrt AnsBer I A sniJ C
-ubur MDrkri ort of ,
c. c. 5'...lTrAAAcccccc...:,t'Coirect Arsw€r c. 5'...iTIAAAGCCC|C..._1',
Your l4*rks loutof i
I of4
C. {. Deletior.lf,Corect Aiswel ). Inse*:on,
Ycu. Marks )o$tof1
IVLE Assessment
?)(Related Question)Kevin's wife is free from this disorder and diagnostic tests confrmed that both heralleles T have no such mutations. What is the chance oftheir children getting the diseaseT in the future? 7L 7-
sl (Related Question)What is the chance ofKevin's brother having one copy ofthe mutated allele?
A, 'ii t'. 2$o/a.
B. :' 8, $Oole,
C. .:. {, 75.tn,
o, D" loco/o,
E' r" E, Hat €nough infsrmatlotr to Fredi€1.
e)(Related Question)Which ofthe following des€riptions BEST describes the role or properties ofprotein T?
a. :: a" $rildtype prstein T is found in kidney Rncer cells^
B. ' B. l,lutant protsln T i9 nct found In Kevifi's kldney a€lls'
c. ': C, Mutant frotsin T ciuics formatlon of canrffi only when itF wiltltype cdunterpart is abs€nt in cells.
D. ::- D, tlvitd tirpe Frotein T partlally iltrffi c€tl gswth and froliferstlon whs its miltant $unt€rFa* i* prffitt lf a€lls,
E. :', E. flone of the ebove d*dption is aortect.
10)Which ofthe following statements below correctly describes the relative order of
organization? (< sign denotes smaller than)
A. :' A, Tlsue < celt { €hrcmsme < nuclcus < Dt*a < nu€lmtids
B. B. c€ll < tiss{e < ntrcle$ < chrofioffim€ < DNt < nucldotide.
C , c. Tisue < nuclew < cedl < €hsmo$m€ < Ol*A < nuclmtide.
D. g. Rmlmtide < {hromosome { ONA < n[cleus { cell < tisse.
E. E. t{otre of the lbcv* it In the corr€rl srd€r'
11)
If the non-template strand of a DNA is 5'... ATATGCCTATAJqA...3'and it contains a start codon, what is the two amino acids that is adjacent/next to the amino
rcd coded by the start codon (refer to the genetic code table from your notes)?I- IleII. LeuIII. Metry. ProV, Cys
A - A,3 and XIL
B- B. tu and rv.
C €. IandV.
D. D. I acd nt.
C. - E. r: snd V"
tzt141t+ determtr*<! thal l&e amilu*tpf pr:rirre is equal td the anrdrunt of pyrimidite in a dr.rubl* sfiand$d DNA'?
Your Ars!9er I : . C. Sttq".}(
Cdireel Ariswer 4,O'rc,
Your Flarks I oul of :l
E, R. t,iot €boilqh intoffi6tion i-o predict./
Core(t Answer l :. Nct €nouaih ind).rnatior to 9*1iit.v.cur Mailis : lar tof l
D. $. lrJild tyFe prct€ifl T celi crowih ard o.oliferction when its filtart cou[terpe.t is presert in cet;s X
n I caus* farsation of *ncen arlY whetr ;ts lvildtYlH cotJoi'srpBit is ahserlt In c*lis
Y.0uf Ais!.rer E. None of the above is in the cenei order'd
Ccirect Ariswet . N6ne of lh€ above is in llie cortst ofder.
Which ofthe following statements below conectly describe(s) the organization ofDNA in various species?
A' :' A, Virat S€noms are very ompact and can utilice rverlappirg frem*g for gynthesis of diffe.ent Erot€ire.B. '': *" liufian g€rome mainly consists of non-6ding *qsenc*,C. - C, tlistons ars found in culGryotic (hroHosoms only,D. :rj Er. A, and I snty,
A' r: A" the tuarti$4 or itrustute €f the prateln pruduct will bg chtngsd,B. :' a, lhr fuilctio* or structure of thc psteln prcdqct may dr miy soi b€ chang€{.€. ':: g, 11r* nunotype witl bc f,lrnrged, b[t ttre photrotype ilay or may not be changed.D. :' D. the st.rcture of tha prolei! Frcduct will bc changed but the fumtion may or may not €hafiged,E.':: g. 16gr**r*ype snd the phenatype m|y changed.
A.
B.
c,
D.
E.
!Vhich *f the lirlb*'ing correttly describes the diff'erenoe{s) betu,e*n DN:\ and R}sA:I tlnc ol'1he pvrirn:idine base i: rIil.fbrenl.Il. Urre of the purine hssa is dit'lerenl.if l. --lle sugat is <liil'*r*nt.IY Ihe plrosphale is drlferen{
A. A. ! and III 0nty.
B' E. aI asd trI anty,
c , c. r. ur and rv anly.
D. D. Ir. ttt Bnd rv onty.
E. E. I, II. ItI and IV,
A t, III onty.
B- 8. tI ang It: cnly,C C. t II and tII only.
lL B. tr. trr a(d rv onty,E. g. r, It rrr and Iv.
17)
Which ofthe following statement(s) is/are TRUE for human (normaVhealthy) cells?I. All gamete cells (mature sex cells) are haploid.II Somatic cells have at least 22 pairs ofhomologous chromosomes.IlI. Somatic cells have the same genetic make-up.IV. Gamete cells (mature sex cells) have disimilar genetic make-up
A. A, I and II 0nly,
B. B.na*dIt Ionty,
C C. I. tI frrd ltl only.
D. o, Ij ur pnd rv only
E. : E. I, II, TTI ANd IV,
I
y'xtwiici or ths lilllolviig siijterneFis is/ere true?l. Dlnog DNA .eFiicaiioi, cne strtsrd is rud in a 3' to 5' dircctlan ard arother st€nd is read in a 5'to 3' dirtrtion. .r::- Drring transffiilli$n, the {:odi!19 si€rd is ie?d in 3'tn 5' rjirtrJion, x: lL i ,u ' ,q! t ranslairgn, the mRNA ;s read , t a 5' to l 'Cire(-t ion. - /-r iudc9 t .ai l t iat ioj1. the rsiyoept i . le chari l is 5vnthe:;r?e in I ' tdf f di iRl io{.
/ ,
1t -. -- ----**3 |
I\TKNR
F. l l , S end C.{
foire{t Arswel A,B6ndC
You r f'lerkS loutof :
B, the fuactisn or $trlctu€ of the tietein treduct be cherqed.d
aoirect Afrswgr lhe function or strilctur€ ct the tietein troduct nev sa mav rct be chs*sed.tic! r Merks loutof l
Y?uf Answer \. A, I ind t f t onlv.r t l
lsrst AFswer I anC l t l or ly.
Ycur Marks lout0f i
>. t). I1, l i i and IV oniv.XCoirect Arsw€l \ ,111 only.
l'our f4e.ks ; icut6f l
Y.our Angwer l \ . A, 1 anc 1I orty,*{
Csryect Answ€f : L i i . I I I ;nd:V,
Y0ur fq8rks i i " ! tsf l
3 of4
18) Ti'e C€ntr$l DiE.na Of !ts:m:u:ar Bisi$gy Ces{i'bes
f i l212A091056
IVLE Assessment http: //ivle.nus.edusg/assessment/result detai ls.aspx?ass essmentid I
A. rrr A. l*w genetic lnforildtion |3 trtnssitted In the cell.B. ir 8. how gffiftic informatioft i3 arganlted in ths celt.C' : C. how g€n€tic isformatios is clEnged or mutttgs ln the cell,D. 1L S. how qen€ti{ informatioa is Srcdured or manuftctured in tfte cell,E. 'l E. none of th€ aboy& i3 (orret.
re]
Which of the following statement(s) iVare FALS regarding the human genome?l. Most genescontain exons.II. Introns define regions between two genes that do not code for protein.lll. A diploid genomi is abouEli[dfiiej€-pairs. lr.fr-.IV fie estimated number of genes in the human genome is about 35,000. I t
- l(F
a. 'r A, !I and trl only,B' ::r F, It ard tv only,c. ':r c, r, flr ard rv ontyD. :'' D, II, tll and Iv rnty.E. , F. & tr, rxr asd Iv.
201Which ofthe following processes involves complementary base-pairing ?
A. : t.OtiA Rc$ilcation"
a. L Tr€nscription,
C. l: {. T.anslaticn.
D. 'D,AandRonty.
E, I ' E, A. g and c,
:,€-= *i!
101212009lA:56
I'{otr Aiswer i 4, how genet ic infcrmation is t€nsmrt{ed in tne cdl .d
fo{ect Aasws : \ . how genetrc intcrmation is tnnsmit ted in the ce! i .Yolrr l4arks cut 0f 1
i , D. 1I, i i i arct tV orrly,dC$.r&t Answer I I , I l l and Iv only.
v, cu r l"larks lcutof i
€, E. A, S and C.dCo.,ect Arswer E. A, g af i i C.
A. A replica cfthe bacterial cobties is cbtaited on an alxorbent disc.It. Au1fi"di*gr:rphv {rl- the dis* r*v*nls prob* o*mplcrm*ntarr- },}NA.l) ll$-\i bactena $'ith plasmid are plated and alloued ta grorv overnight.ll. Jhc lucteria a.re lvs*;l and rh* IINA a1{: d*narirred on the disc.lr. -l-he di"sc is reactcd nith iabrled pnrbe.
,d, {t, n, B" rJ
{1, A. [, I], B
{t. ti, A, n, a.}
{.ri A. l:. 11" }
ft, A, ti, g, B
Ycur AEsl lc, ::. C^ r\. D. E, B
Cirect Acswef l , A,I), !:1. I]
Y.ott Merki i 1 cut cf :.
I rr r linuilil a lpl i:l+ctr'.rphilresis to .l$:e nnifie the tizes r:f sr:rme DN.{ lialgt,ti:ntli l ve
1rilr'.'
A. i. This unknswr f.Bgment apteaB to be Jrst over fOS bp.B. , L This $nknown frasment np$*affi t$ ba jsst unde. 2(t0 bp.
C. ' *, This uilkr$wil grasment is nearcr to tlle n*gative el#trod*.D. D, $ the bands ds nct otcur in exa{tly the sme tffitionf t cannot mrun* rnythinB tbout the si:e st the [nknown f.agmeilt,E. E. N0ne of the abc*s is corrst^
Spiicing rd'ihe nrllNA :
t. cccsrs ssly ltr €ukaryot6.g. can occu. siffiultaneassly du.inS translation of RtrltA.
C. tan oacsr in tht nucleus oa (ytcplasm.
D,tand6only,
E. AJ A nnd C,
c; 1r't> nrrmr:l erlls sirlrih*nt orsiv *ndergr nritosis in a siaEle ilrgan;sm.
I \ ierul l i r i l l be:
L a, 2 datrghae. cellsr each with a dlff*rena g€some,
A. B. 2 daughtei cell$. wlth th* identiGl gtroms,
C c. 4 dasghter *ells. with a genotsre idehtlcal to either that of the {irst celt or th.t of the ffcod cell.
D. o. 4 dauqhter {ells. ffih with the id€stiffil genof,e.
E. F, I daught*r eell$, each with the identi€l gemfie,
ti
3)
A.
B.
cD.
E.
oLwin nrdlrrl
l. B. Thi5 ilrknovrn f.aqment atfieis ir be jl:rt tnrler ?0.3 .Jp. d
Corect P.rs!*r : ). ThiS urkrawi fraon€nt tscBeari to be ilst !ndsr t00 irc.
Your Marks i loutof i
\ . A. #i i l r5 gnl ' i i r s i lksryoies.}1
{:o.rect Af;swer i {ai l r ! cn, l i r eukaryois,
Ycur f,1ar'rs : aut of i
). D, 4 eidurjhter ce,l$, each wi$ tile jdeF,"icsl Sun,urr*.dCoryst Answer : 4 derohtei cei16. *ch er ih rhe rCent ic i l
Your Mirks : lcutof l
li'h;ch trf Lhc iirllottiir* is true r*ganjin,e lranslalion?
! in cularrirles ii i.rci:urs ilr tlie {t lop}asrn.in rrokal,trtes it tr:curs in the cytr:plastn.in euksnotes and prdialvr{es il ocr*rs iri cl*se aisi:{..ia1ior} with thi-1 1trlvribosrrme.!n eulanotas and prokan'otes it occrrs onlv n']rcn th; ntl{NA has finished pror:esslng.
A A. I and It enty,
B. B. tE! and IV snl?.
c- C, t, II and IIt only.
D. D. t , uand wonly,
E. E. I. !:, l:I and Iv.
l of-l
v,cur Afswet i C. I . r l ard I I I only.di:o{srt Answer : . l , l l a$d i l l +nly,
6)You rysnt to rcplicale a piece cfl]NA in ordi:r irr have a large quantitl. tiri analysis.!\"h*l shoull b* the o{}rrNrci socluen+*.,coLrrsc. ofvo*r ac$ii:ns?
A' a, Transform bactcrial {ell6' seltrt clones bv blre/white and antlbi*lic resistancs li*ate lr*o a vector, nnd extracl thc plasmid DNA feom ilre bac]terie,B' B' Transfs.m bact€rial ells. wle$ ttanes bY blG/whit€ and anttblotlc rsistanc€, ligHtr lr|to a }wt{r, and e*rart the senrHie DllA fros th€ ba(teris,C' {. Lig*te into the genofii€ stta, transform bs€tetlal celk: sl€t clsns by btuelwhit€ and antibiotte resistarce, stra€t thc pksmid frfia frsfi ale bact*ri8D. D" Llsate i*to B ptaseid, transfotm bacterlil cell+ *tect clans by blse/whitf and fftlbi$tic rststnffiq ertfa{t the Ftasmid Dl,lA from the bacteria.E' e, ilone cf the aboye ts rorrs€t.
' lras a diseasc ihi.t is i:aused by a ftutr{tion iil +ne rrfher gen*s t}ial is sex linheds r;ie:;sivs. lVlri*h oi'1he fbllnrving is cnrrer,1?
i, tter sn wlll rl€finit€ly get the di*ffi.
G, tler daughter will defi*itely gee ihe diffi*.
{. If h€r h$sbaftd doB nst have the diffisr their d*ughler will d€finit€ly rot *e a ranier,
B. Regardles sE tt€r husband, any child of herc hrs a Soolo chasce td get the di*ase,
' €, uone st the rbcvr is csrrffit.
alis lhe d*te*iive tuvrlsti{.tirtir}I, d ori!:B*_ },!ru ar* *rtereslecl l{t see iilhe DN.A i* Lii* irairtbilicic ieli at the srdna lratcllds an.v of the three prine suspects. lJnknorv* tn v*u. one oIthe susp:*is hls hari a trri*rrerv lrnrsplarrt. lVhir:h rf tlrr,r t'nlloll.irrli i:l conr:crl
A' A. taane $l ttts Df..i tlngerprintitrg tests wilt bs vfrtid.A. B, The DNA fiftgerprlnting tests wifi bc yatid r€gardls ot his tratrsptant.c ' e, RFLP wg[ld he vdtid, hrt Fot VNTR"D. ' D" VNTn would be vfftid, but not nFLF,E. E. None of the absr* is corrst,
9]! ' I: i 'vinlltt} i i5ef13pie.reDN,4i*loap1asriidtectorrvjthalccijarlanti i] i$ticresistanc*gen*t.tr
a- A. ;f I lse btue-white sl€tisn silty - all cf the whlte mlonis will definitely ca.ry the oua of intersl,B. B. !t ! !$e sn*iblotic *lectisn only, all of the whit€ c*lonis will dfdinitely {*rf the [rNA of inter6t,c c, r need ts uR both atrtibloti€ and blue white *leetion to ensu.e thst all af the whlte cotonies will deiltrltely €arry the pffA of interes!D' D' tt t nat da not {se €itk€r msthod sf slecticn, the cslsnie$ carryins the Dila st lsterst will be b!us,E. E, n$ne of th€ aboc€ i$ c0rrect,
1r):o*hen biotting require-r :: ?.g,tn.ii$n enzvne {$VdiEest of Dl'lA,:1. Gei 3!€ct isphnre: l r .: : : - Pfq3;nE cf Df.Jr i l rnErr lel ts.: j Aililliia3ticn cf DN,A fi€gtrent9.
A.
B-
c.
D-
E.
A, 3 and :I 0nly
B^ ll asd lXl onl?.
C. I. Il rnd III only,
D. II, Ili a*d IV snly.
E. I, II, ttl and IV"
111 Rjhar ir the anticodon olrnethionine (Meti tRl"ef t{ the cod*n tahle)','
a- .{. s' AllG "3'B. B.5 'G1JA J 'c (:. 5' {.'Ali 3,D. I). 5. &r{i 3'E. E. lioni: ofthe abrx* is cerrect,
I . t. l.igate ixio a plessid, tmnsflrF baLleii*l cells, sele.jt clqnes bV hir+lwitii€ snil $rltifiiatj(
Coirect Answ€r : ). i.igate into a plasrflii, tian:fcrft ilacleria! c€l:s, s€iec dsres by bllelwhite ard 6ntib;ati.: resistarce, extis{:t lhe tjlaajrnid i-\iiA {(rrn the
\.'c!r Plerks i loutof i
\ . A. Her $on wi l , det iF' te:y get the Cissss.d
Coireal rlri$wer ; Her son wrl l defrn,teiy {e-t the diseeseY€ur l4ark9 : loutef !
: r{ tests wi l l be val id
tsts wi l l be v3l id fecardless cf his
:. i. I r&d t! $5e iloth antitiiotic ancj blue white selecticr t€ ensv!€ thnt all 6f th€ riirite rolsnies riii, d€liliielv cirry th* Dt{A ri :.1.:rc- i //
C0ifect F.ns!.Jef l. I red ts use both antibioiic aid blue white seleC{ion io ensuie thEt sll sf tlie wiriae colonies r,,iil definit€ly r$r.}, tie DNA of ilt.restYour Flarks lsut0f !
{ : . C. l . I l a ic l l l l only. /
Ccir?at Atswer : I . I I 6nd l I I only.
Your Merk5 I out of :.
c. t,' 5' , { - 'At . :3 'dd0ireat Answ€r : r.l. i ' r.lAli 3 k$ o,c r
t ?l Ih* i'undementai difterencej t?etween RN.4 End Df'lA ni*:
a' | .d, the organie bases onlv
B. - Fr, h*$e$, silg*r utrits, and the phosphodi*sler linkage
c' ' tl" b*s*s, sugar unitso and the glycoridic bond typr
o' ' lt. brser *nd th* sugar units n*lv
E. .i Ii. base$, sngar and the phosphato units only-
t4) \iJhii:r ol the fcll6w:I9 gtatesietk !9lare trre iegatdlig genomes ct varigug orgoi!:,ffi-cl
A. A" Some Gfthe larsest gs*oileg belon$ ts plant aild amphibians.
B' g. Lsg tben lOVq ot the huma* genome cods for a proiein.
C. {. A plasmid ls not part 6f the hacterlsl chmmosme.
D. -, F, A and f osty,
E. E. A, * nnd *.
13) '$thi(ir ot the filllow;rq stsjternents corrtrtly !deriifies a icstrii:tian €ndilnuclsse/enr'rne?
A' , A. Thef work on boih Dt*t and RNA,
B' ' B" fhey rmgnlre a paliildromic sequentr atrd cut just bgfsre the palindromia sequence,
C. C. T3!e r€sult of endonu€l&se c$t is alwas blunt ended.
D' $, They degrade St{A by $shqquef,tly removirg lrffi fmm Hch ef,d,
E. e. tlrey rut SilA only ad sits with spe{itlc nrctestld€ *qsencs.
u. D. hales and th* sugar units onb C
Csrre{t AFsBer : D. bas*s;:*d th* slrliar **its o*1.vw,cur f"larks l lautof?.
i . E. :hey cui UNA orlv at s i ieg wi i l i spff , j { r i t nuciwl. ide;*qu*"a"s.f
C0irctl Ariswgr :. Thev aut Di\iA o.ilv 5t sits witil soeclii.r cLileotide seoden.+q.Yi$r l"tarks 1 cut of :l
F. A, B and C.daoirect Afiswer .A,BandC,
Ycur M?rks : lcr tsf :
[ ,**
15)
Which of the following descriptions for the DNA structure is TRUE?
I- It is double-stranded helix and the strands are parallel.IL It contains many nucleotides linked from one nucleotide to the next by phosphodiester bonds.lII. It carries a net negative charge due to the charges on its bases.IV It contains both major and minor grooves.
A, , t. x and rI Gnly"B. I B, It a*d IV cnly.
c- : c. t, lI 4nd rv sf,tY"
D. ", D" l, tI and IXI 0rly
E. E. I, II, ttl and Iv.
8,9. I l and tV ontr,.NfCorre( Af-qw*a : B. I I ar ld lV anl) ,
Your Mar1,6 lcutof !
rsl A circular plasmid has two EcoRV, three BamHI and three EcoRI sites which are loacted at a distant from each other. How many stained fragrnents/bands dosou expect to see by gel electrophoresis if you completely disgest the plasmid using both BamHl and EcoRV?
A- A. Fout,
L E. Five.
c g six.
D. D. s€ven,E. E. Eight.
t7l': r- t€:ll to c{xltjrm if v$u havc succesi Perli'm RIrl,P ou the [pn*mii: l.]NA to detecr rhe frr*:ign geue .l: ?erlbnn IrCIR using spec.ific plirners rhat t&rgets the f-trreign ge:re.lti
), t, 11 arid B oEiylf( :orredl Answer: ) .4 $nd B anly
Your Marhs : 1 olit of i
13.!!!h:i(h *rr.rle$uli:t i)k Nrxljiem bh:ri:s used to it?ei:ti&.?
A. ,i, &. *f,tA.
B. : B. nfiA.
C. '. c, Frotei*"
D. , D,aandBonly,
€ ' -E.a,6andc.
l. g. nnn.#Ca.i€ct Answer i ). Rtia
Ycur l"lark : 1 out of i.
20) 'llre F{)ll {pol1'nr*rase ca hi:rl sFrjng insiile Yelloq.slrintt !-unctior even olter it has b*en healed to 9j deg:e*s f . Wh-v xruld such a heat slahls p*l.vmercse be i:ereficial irr tlCR',?
a. A' gach cltcte inclsds a "hst" saturation p*ffi (95oc), which atlsws the primes tc annetl t* the ta.get DH,A.B- B. Fach *Ycle incl*ds a "hot" de*atu.atisn phas qgSec; whictr sewes to sparate the primsrs frsm bindins ffich fther.c. {. Effih cy*tq includes a "bo*- denaturafion pbffi (gSbC}, which activats th. Trq pctymem*.D' P. rach cYcle i{cl{d# * "hot" detrat*ration phas {tSoC}, which *ps€tffi the t}}drogen bo.ds th*t hold tlre strand$ af th€ teflFlaie ONa tnfieth*r"E. ' 6, &6ne 0f the [bove i$ correct,
Ycur Ars$€f :). D. Eijch c'lcle inchrdes 3 "h$i" denatsratioa phase (95o{:i, whh:il separates the hydiogRf; bofld:; thal h{tcl *}e st$nds af ir.? tqryliilni* t.}Nr\
osether,gd
Cd.rect Anslver l. sash {ycie includs a "hot" deilstilististi thasg i95cc}, whi{}i sepaetes tiie hvdrog*n hot-.ds ths'. icld il-.e str"nd$ of lt* i+nip:ate $ii,40gernsr.
v,cur Flarks : !outof l
a; ' : { }
4 of l
@l
[\l-E A.isessment
lsM 13O2_SL1/GEK1527_SL1/r.sM 13O2_SL2/GEK1527_SL26srs & gociety..Self tr*yiew Qs*tio6 Set III
2)llrru'iloes gent-: tlt*rapy ilifier lionr lr*rlitional lherap;' ir temrs ol'trealing 1*uelic disorders in ii piiti*:nt?
A' A.lt lnyolvs int.odsdng norm*l allels inlo the sm.tlc cel* of an aff€ct€d indiyids*|.
B- B, !t involvs ir|troduclf,g sstilal alleltr irto th* g$m cells of an atf€ft€d indivldoal.
c. : e. if invcber transfrrring t<lrxr*l g*ne pr*aln{is in an affe*ttd per*n.D. '- n. a *nd B onty"E. .:, €. A. s and c.
Coirect Anse/€r : i.It invclves intrrduain{ normal ellel{s !nig the somatic cel's of en affecied irdivid[alv,o(r l'1ark-s i loutof l
3]The lollowing rcqrrence {io!11 IDNA san}ples is to bc targeted {h,vlrridizsd) b"v a prrhe *n a nricroarruv chip:5' .{'i GAztrACCCGC|]... ... ... .]"ilCCC;\AACAC.. ..-?'tt\rted1:ne're{erta5€qu€nCesIOl5horrrrs'uirrrundittgrit jr'l
a. A.E'.."..,...aucAAAccc€ce,...,,,,.uuucccAtAG€c.,,3'B. B. s',,....",,TAc?Tysc€ccc.......,.tAAcccTTTcGc...3'c c.s'....",,,,cccryr6ccAAA,,,......fcccc€r rcA"...3'D.' B. g'....,,..,cccu{,IUGGGAAA..,,,..,,cccc€€uuucau,..t'
E'' r. s'...,,.,,^eccGGsrr"cAT"^.","...cccrrrGGgaaa.,,3'
Csrrect Arslrer i :. 5' ..... CaCT|T$GGAAA.... .. riCCtititiTTfC,AT...-?',e, cur Marks 1 orit of i
4lilcrrt nran_r Lllrrlll{}soill*s ilre llrele ir a }urman ferti}iz-*d egg?
a- a.22.
B. B, ?3,
c c.al 'D. D,46.
E' €.4a.
CoiJe(* Ar:gw*r l D.46.Y.our Marks : tcut0f i
5t
i4idn ct ihe lbllosiirg iietem€n!s are tnie?
r. .\gd>acterirm iujccts Ti plasnid i*1ri plant cells up*n infbclion,ll R:trtrviru-< is uscd iri human gene drarap,l because il can detiver gtrro into certfiifi t-yperj olhrimlrn cu:l|s.l i i i ..zl iplasr:: id:crinbi:u*:dftircl*nin{nndexpressi:rgihreigngenesin,': i :r:r l i .l\ . 3kleftrrlha:-lejilhn:.{c ar!' vinrsr.s tlrul ca}} jnf!.ci bactr'da
-t?A a. r and Er onty. Y II g. :. tt and tI! orly
C c.1 tt l.*d Iv only.
D- D. tI, III asd Iv of,ty"
E. E, r, tr,ttr and rv
J
Cgrrecf Ar-.syer E. l , : i . I l I and lV
Ycur l4!irks ouf sf :
6il)*r+g ihe Stuthern blot airalv-ris, horv can +*e irrcrease the specrficily and accuracy rrfthe detectir.rr proce:;s I
C C, ay rcduaing the slt csnc€*tratlon In the hytridi:atlon bsffe..
D. D. Ey increff$is$ the p$be htbridimtion tlile"
C. E. By ircrssing th€ degru nf homslsgy ot the prob'e ta the ta.get.
Coarcct Answ€r i the cf cf tne irobe t0 in€vsur Flerk i ll cut +f :.
r) \'!iiny geneticaiSv-mo<iiiieil l'*nd cr*pr *ill he *nrering 1he lrurnan fo*d chain in lhr" y*ari to rorneFrclicallv nroililled fo*d is safe li:r huma* i:onsurr:piion'l
\Vhjch of i:he fbil*wing is/are likelv inpirta*1 1{1 ensrlre thut
@',? !
I of4
IVLE A$sessment http://ivle.nus.edu sg/assessment/result detai ls. aspx?assessmenti d
I
A. . A, f;ach g*netirslly moditied tood *rop i$ ffireencd for its ffiistanre tc ailtibiotics.E. ', B. Earh genetically moditi€d food crsp is sresed fsa its diffitr rsistance.c' 'l C. Each genetically modified food crop i$ sr€n€d fo. toxacltr.D, i E.FendCstr ty.
E.:E.A, i latrdc.
Ct{ect Answer : :. Each gereircallv modifred fsd cros:s scr€ned fo. toxjcitv,Ycur fnlarL€ : lautof l
8)I hitvs tNLl {li:r!F -ordet to ileieimine the exs.ct genetic luahe-up, I crossed tlrenr and set 4 cll springs. lVhich otlthe fbll+rung is liktlv ronectli
A' a^ if the greenrwhit* ratio is 2;& th€ Sr*n pare*t i$ frcbabty pure br*d {homo:}gote} and the white * hyb.lrl thetefsr?gote}a. '. B. if t pet 3 gr#fi .nd 1 whitor the parents wcre probalrly hoth hyb.ids {heterozyg6t#}.C' - C' if I get 3 Ereen and I white' the gre€n is prstoab,ly a pur*bred tb*morygote) a*d the white fr hybrtd {heterozygcte},D. .::: n" if they were all grcer, hoth parent dogs were probalrly pure bred {homo:ygats},E, r, 6. Nst enrugh irfsrmation to determine,
Coarect Ana,urEr D. if lhey *erc ali grefi. both paront dogs were probobly i?uiE bred (hon-.o:vqoteslv, o$r f'larkc lsutof l
!'N l Rs arel
a. :, A. vari*ble numlre. of tandem amiils acid repeatr ihat are hlghtt heterogseous.B. " B, variable fiumhe$ af tandrm repffits that vrdes {hyperpolymorphic} in the pfputatior,c. i C. Bariable numb*rs of ta**em nscftrtide$ ttlat are tran*ribed feFstddly and varis in tire Fofulation,D' ' D" vnriable number$ of ta,ldem .epeats that are highty unitorm in the pofllatioil,E. E, variable numfer$ of tandem repeats of lmino arid .eseets that a{e unifcrm in the popul|tlon.
CGi reci Aesvief va.isble nunile6 of tanden ppqsls that varies (hyFe.polymapiic) in the FgDulat;cn.\jour l4€rkg l lout0f i
1oli r1 iLoe.smrl tht : rhadar*rgreoessiveldiseaseca*sedhvn$uta1i0n$nl ]0t ino1 can irfli. What is rhe risl of Mr l.*e 's da*ghter?
A. t. ghe will {tefinit€ly be a rarrier but will drt be $ick.B. '.' F. She witl Set the diffie inherited frcff h€r graf,dtroiher,
C. C. She may be a csrrietr fo. the disffi {abaut SO!/o €hanqe}.D. s. She *ilt nft be a sarrier.E' E. Hct enough information io determine.
Coirect AnsBer r \. Sie vrill detinitel_v be a sfder hlit will nc{: be si{k.vsur Merk! loGtof i
1r)Gene T is made up of3 exons and 2 introns with their length indicated below,exon 1: 267 nucleotidesintron l: 1002 nucleotidesexon 2: 603 nucleotidesintron 2: 3000 nucleotidesexon 3: 126 nucletodesAssuming that there is only one start codon at the begining ofexon I and one stop codon at the end ofexon 3, what is the total length ofthe protein encoded by geneT?
a t, i33 aHiso trids,
B' B. 313 amitro trid$.
C- C.33:. atriHa a€ids.
D' D.936.nlno acids"
E. €, 1333 amlls acids
{o:recl .Ar lwer ' lC l l1 dniro acidj .'four M3rks : | 1 out €f :.
1:)l\'iich ol' the lbllcwirrq *orrertly ilescribes a. cldN lip?
A A. The .spective 3' and 4" 6r.ban atom poFitions ot the sugar ltrk$ oxyg{n mcl€ulG
B- B, The r€pective 2' and 3' r*rbon at*m Fqsl$ons of the suGar Ircks orygen molsql*
C C. Th€ rs'trtlve 1'asd 3" carbsr afos Fositions of the suga. lack$ axygen iloltrFles
D. B. The rspa€live Z' rnd 4' ffirbon atos pogitisng of ih€ sugar trcls oxfg€n mclsul€9
E. E. Tn€ spectiv* 3' ard 5' carbon alom po$itisns of the $ugar lacks oxygen froltrules
Cs.re{t Aflswer I ). The rsp€ctlv* ?'tsrd l'i?rbot ato.r psitions of the s$Ear llcks caygen moiecuiesYcur MarNi : 1 crit of i
13)l1'ha! are the advan'{*ges ot'edihle vaiJcines have $ver traditinnal v;:ccines?I iher.. are *ruch morrr **'ectivr: ihan lraditio*al r,accines.ii, l.her erg e,asier to;*dlrrifti-(tei.l j t. Srlnr.i cl th{rlr ar* suiiable lirr hrng tr:rm storage.li:. -fhei crn b+ harrcst*d in l3rgc quarlut!.
A. a. I afid II onlf_
B. B. I, II afld III anly.
C C. r, Xil arld Iv oFty,D. D, l!, tlt ax: Iv *nlyE. e. r. fi, IIt asd w.
Coirect Answer i . i . l l , l ! : anC lV onlyY.our l4erks I loutsf :
1q)
Vji:icl of the filllo:lirg uee eilhef iiFLPs, VN ! Rs or S iRs?
I- Fe€nsi! $aaence.I I . Archdelo$y,I l l . Art isetse t€qhnol0gyIv. Prbl i r i h* i l th.
\/ A. A" t and !r onty"
B. r B. t aod XV $*ly.
A c. r, rr and rrr onlv"
I D.r , r tandlvontyE. ':r E. r. ur rrr and ry.
Corect Anslver D. l . 1l and lV 6nly
Your plarks : rcutof l
1s)
$Jhi.r af the follswing sratsfients i: tril€ iegardiilg tie liEt geie therapy trcatment?
l . The t : . i t at tempts at Cene the€p9 b€Can in 1990,lI. :t was pirfrrmed
'y ilrench Arlijeffiotr'$ gisup,
lII, :he discfder is krov{n a3 Cysric Fibrosij,j\./ lt ri,lolved iorreci]lljg a defe{( SCIi) qene.
-,6 a1tA/ a. ! and i I onlv"YA. B. r, It ind III arty,
c c. t, rr and rv only.D- D, II, III aild IV anly,
E. , E. r. r!, trr afd rs.Coirecl i,risw€r I A. I Bn.: : I I only.
Your !l3rk5 0cutof i
!6}qSsUm€.hatacjrc! |€rp|asmid!5] '6c8bas€peirs in lengthandha5rStr i ( t jcn9i tes€tthenuclet idep0si t j0n54|cand12c.3,Gi\ ,etheeKF:Egnerts fcllorling rc6Fle'.e rliggstion.
I 4!3 lir,I i - 9C0 bp.Ir t . 1_?40 hr?.: . , ; . 15i13 3p.
a. a. : or ly,
a. B. rr cnty_
c. C. I aFd tr o*$.
D. D. I, II and ItI *sly,
E' : E, t, rr, rn and Iv ontY.
Coirmt Answef i g.1i 0nly"
-!'3ur Marks loutsf i
17)
-"+;4s fluores(ert labelled-ddN]lis, asi:oaated i)NA striuencirg ruiis or tl:e foll$Binq;
i 3tandard 4i t i iPs.i I 3irerI I : , - :aq DFJA po:yf ler4selV ad eiatrcpllc.€si!
A. A, t and ttl onty,
B. E. I and Iy qnly.
c c, r. rr and rtr only.D. D. ! ttand Iv only,E. E. r. tr, ttr and rv.
../ '*,
CoireCa Arswer r ! , I I anC Iv onlv.Y-our f'larks i loutof i
<et-*-aruses sre it$eful ir ggile ih+rary iiecarrsel
i- :t €i deiiv*r a gelre trto specific c€li tyFS.Il- :t.an he:t lo ir:tegrate a ij€ne ir*c ihe ftji's geitome.l l i . : t car act i .Jate i*pl icat lon af the gen4 in th€ cei i ,iY. !t sgntairi in aetive virsl Frcrnoter thai can Crive trnescription of tii* iJerie ;t: the (eii
l- t. I and tI cnty"
B- B. II a*d Iv only"
C C. t, ll and IrI anly,
D. D, r, u and w onty,
E. r E, r. II, r$ aRd rv.
Core{t Aeswer : \ , I and I I o i ly .
Your Marki loutof !
19)
i?-lici cf the foll$rviiE sre nrqumelits ihat ere agsinst patentins gene er Sene pJadu*?
L teeting enc0uragls secr€cv.II- %teFting incres€s rffit that v{iil i!ts$$ed dawe !s coilsutrer$.!I1. Paterting encouiaqes innsvetion anC !nvestmert,IV. Coii a5ssiatsl wiih il-cin! patrf,led^rss€6r*t ilata (un irnpeie Leitairi r$e6rc*i .jevelcp.nent
lffi_0_?_11
F\43 of4
IVI--E AssessmentC-
A.
B.
c.D,
E.
A. :I only.
F. I and ll anly,
C. 1I and XII only.
P. It and IV only,g. I: 11 and IV cf,ly.
ht*: /i ivle.nus.edu sg/assessmenVresult detai I s. aspx?assessme nti d
I
Corrcct AFswer D. I I ard lV or iy.
Ycur Marki lo l tof i
2s)
Whicr sf th€ fallswitg procedures niust j.vslse efibryenjc $te!r cells?
I- GeieFtion of a krock-out mauselL Gene therapy.l1I . F.errod!ct ive clonins,lV. Tne*peul:( c lo0i tg.
