Texas Tech University, Sayani Mallick, July 2016 · Texas Tech University, Sayani Mallick, July...

Texas Tech University, Sayani Mallick, July 2016 CHARACTERIZATION OF ARABIDOPSIS PYRABACTIN–LIKE ABA RECEPTOR

(PYL4 AND PYL7) AND TRANSCRIPTION FACTOR (RAV AND ABI5)

ACTIVITIES IN TRANSIENTLY TRANSFORMED NICOTIANA BENTHAMIANA

AND STABLE TRANSGENIC LINES OF COTTON (GOSSYPIUM HIRSUTUM)

By

SAYANI MALLICK B.Sc. (Honors), M.Sc.

A THESIS

IN

BIOLOGICAL SCIENCES

Submitted to the Graduate Faculty

of Texas Tech University in

Partial Fulfillment of

the requirements for

the Degree of

MASTER OF SCIENCE

Approved

Dr. Christopher D Rock

Chairperson of the Committee

Dr. Jane Dever

Dr. Jatindra N. Tripathy

July,2016

1

Texas Tech University, Sayani Mallick, July 2016

Copyright © 2016, SAYANI MALLICK

2


ACKNOWLEDGEMENTS

To begin with, I would like to thank my PI - Dr. Christopher Rock for his time,

effort, support, and guidance. I would also like to acknowledge him for his help in

shaping my thesis document. I would also like to thank my committee members, Dr. Jane

Dever her help and assistance and Dr Jatindra Tripathy for his encouragement and

support.

My cordial thanks to Dr. Densmore, Dr.Chesser and Dr. Holaday for

supporting me with a Teaching Assistantship.

I would also like to thank all my past and present lab members. I specifically

acknowledge Dr.Fan Jia, who made the UPS cDNA donor::pKYLX acceptor constructs for

RAV1, ABI5, PYL4 and PYL7 that I used in my transient expression assay studies and were

the means to make the stably transformed cotton lines studied by others in collaboration with

Dr. John Burke, Plant Germplasm and Stress Lab, USDA Lubbock. I gratefully acknowledge

Dr. Justin Fiene, who made available to me for analysis of stomatal density his epidermal

peel images of transgenic cotton lines RAV11-1-5

, ABI513-4-1

and ABI51-1-1

provided to him

as a collaboration with the Rock lab. The images were subject material for his Ph.D. studies

at Texas A&M University on stomatal dynamics of cotyledonary leaves in response to

drought stress. I also specifically acknowledge Dr. Amandeep Mittal for sharing with me his

unpublished photosynthetic parameter assay data for these same transgenic lines grown in the

greenhouse and subjected to drought stress. Chapter 5 in my thesis is drawn in part from their

gifts of data for my analysis and interpretation. Chapter 5 has been developed by me, Drs.

Fiene, Dever, and Rock into a

ii


manuscript for publication with Dr. Fiene as co-first author, and Dr. Mittal as co-author.

I hereby declare that except for these disclosed portions of my thesis drawn from co-

author contributions of data, all other work is originated by me.

iii


TABLE OF CONTENTS

ACKNOWLEDGEMENTS……………………………………………………………..ii

ABSTRACT…………………….………………………………………….…………...ix

LIST OF TABLES…………………………………………………..…………………xii

LIST OF FIGURES…………………………………………….………………………xiii

CHAPTER 1

I. INTRODUCTION, BACKGROUND, HYPOTHESIS, OBJECTIVES ............1

1.1 General Introduction ................................................................................................................ 1

1.1.1 ABA Gene Expression ........................................................................................................ 2

1.1.2 ABA Signaling ....................................................................................................................... 5

1.1.3 ABA response elements and post-translational modifications ................................. 7

1.1.4 ABA agonists .......................................................................................................................... 9

1.1.5 ABA receptors: monomeric and dimeric ....................................................................... 13

1.1.6 ABA signaling transcription factors ................................................................................. 15

1.2 Background………………………………………………………………………..15

1.2.1 Hypotheses ............................................................................................................................... 15

1.2.2 Specific Objectives ................................................................................................................ 16

iv


CHAPTER 2

II. MATERIALS AND METHODS .......................................................................................19

2.1 Plant Material ............................................................................................................................ 19

2.2 Sampling procedures ................................................................................................................ 19

2.3 Primer Design ……........................................................................... ......................... 23

2.3.1 Polymerase Chain Reaction (PCR)…………………………………………..... 23

2.3.1 GUS histochemical Assay ................................................................................................... 23

2.3.2 GUS Fluorometric Assay ..................................................................................................... 23

2.3.3 Microscopy .............................................................................................................................. 24

2.4 BLAST ......................................................................................................................................... 25

2.4.1 Total RNA Extraction and Quantification ...................................................................... 25

2.4.2 Northern Blot analysis .......................................................................................................... 25

2.4.3 Northern Probe design .......................................................................................................... 26

2.4.4 Radiolabelling ......................................................................................................................... 28

2.5 Protein Analysis ......................................................................................................................... 28

2.5.1 Total protein extraction ........................................................................................................ 28

2.5.2 Protein concentration (Bradford) Assay .......................................................................... 29

2.5.3 SDS-PAGE .............................................................................................................................. 29

2.5.4 Analyses of the relative protein concentration using western blots ........................ 30

2.6 Guard cell morphology……………………………………………………………31

2.7 Statistical Analyses ……………………………………………………………….31

v


CHAPTER 3

III. STUDIES ON THE UTILITY OF THE NICOTIANA BENTHAMIANA

TRANSIENT EXPRESSION SYSTEM

3.1 INTRODUCTION………………………………………………………….39 3.2 RESULTS AND DISCUSSION……………………………………………41 3.2.1

Pilot Experiment for transient assays: to test the system and parameters of time by GUS

histochemical assay and GFP (reporter enzyme assays)………………41

3.2.2 Control experiments for establishment of Nicotiana benthamiana transient assay

system at protein level by Immunoblot, an important parameter for interpreting effector

activities…………………………………………………………………………44

3.2.3 Validate the time point parameter of response of the effectors with an independent

vector construct p201G_Cas9……………………………………………………47

CHAPTER 4

IV. STUDIES ON PYL4 AND PYL7 AND ABA INDUCTION IN

N. BENTHAMIANA AND STABLY TRANSFORMED COTTON

4.1 INTRODUCTION……………………………………………………………49

4.2 RESULTS …………………………………………………………………….51

4.2.1 Bidirectional clustering of Arabidopsis ABA receptor PYRL gene expression

intensity and experimental treatments/genotypes…………………………………51

vi


4.2.2 ABA induction experiment: A result at a 1 hour time-point depicting ABA

induction by Northern blot…………………………………………………….52

4.2.3 Results for various effector’s activity towards transactivation of endogenous

readout NtERD10 (GV2260)…………………………………………………..54

4.2.4 Results for various effectors' activity towards transactivation of probe NtERD10

(GV3101)………………………………………………………………………57


readout TAS14 (GV2260)………………………………………………………58


readout LEA (GV2260)…………………………………………………………60

4.2.7 Summary of comparative analysis of Fold Induction quantified by Northern blots by

three ABA-inducible endogenous reporter genes………………………………..64

4.2.8 Positive Control immunoblot for c-myc Mab C9E10……………………...66 4.2.9 Immunoblot with Monoclonal antibody c-myc for effectors in protein extracts from

N.benthamiana……………………………………………………………………67

4.2.10 Approach for phenotypic segregations in PYL cotton stable transgenics…68

4.3 DISCUSSION…………………………………………………………………77

vii


CHAPTER 5.

V. CHARACTERIZATION OF RAV1 AND ABI5 DROUGHT-STRESS

PHENOTYPES IN COTYLEDONS AND LEAVES OF TRANSGENIC COTTON

5.1. INTRODUCTION, BACKGROUND, HYPOTHESIS, OBJECTIVES ................ 79

5.2 RESULTS…………………………………………………………………………81

5.2.1 Characterization of transgene protein accumulation in cotton seeds……………81

5.2.2 RAV11-1-5

cotyledonary leaves have higher stomatal density and smaller guard cell

apertures during drought stress and recovery………………………………………….84

5.2.3 RAV11-1-5

and ABI51-1-1

mature leaves have higher stomatal conductance and

photosynthetic rates under drought stress……………………………………………...86

5.3 DISCUSSION……………………………………………………………………...88

CHAPTER 6

VI. CONCLUSION AND FUTURE DIRECTIONS

6.1 CONCLUSION……………………………………………………………………92 6.2 Future Directions…………………………………………………………………..94

REFERENCES……………………………………………………………………100

viii


ABSTRACT

Abscisic acid (ABA) is a plant hormone that regulates numerous developmental

processes and adaptive stress responses in plants. Although many ABA signaling

components have been identified, understanding in the functional and structural

conservation of ABA signaling networks across species remains to be elucidated. The

family of homologous proteins encoding pyrabactin resistance (PYR), pyrabactin

resistance 1-like (PYL), and regulatory component of ABA receptor (RCAR) have been

discovered by forward genetic screens in Arabidopsis and shown to function as ABA

receptors.

The main objective of this study is to test the functions of select PYL ABA receptors

and downstream transcription factors in heterologous systems (cotton, tobacco) to gain

insight into conserved ABA signaling modules in plants. The transient expression of

Arabidopsis effectors of ABA signaling in .Nicotiana benthamiana and upland cotton,

Gossypium hirsutum, was undertaken to gain deeper insights into the utility of ABA

receptors and transcription factors for genetic engineering of agronomic traits such as stress

adaptation or stress avoidance to improve yields and seed value. The potential significance

is a deeper understanding of efficacy and molecular mechanisms of deeply conserved ABA

gene effectors. I found via RNA blot analysis that AtPYL7 overexpression results in agonist

(inductive) ABA signaling activity in N. benthamiana. AtRAV1, a known ABA

transcription factor (TF) and positive effector of ABA sensitivity also showed similar

agonist activity on endogenous ABA-inducible gene

ix


expression of Late Embryogenesis Abundant (LEA) in N. benthamiana. The results were

strengthened by comparative data analysis across three endogenous LEA target genes

with significant inductive correlations across genes that were of similar magnitude of

agonist activity as exogenous ABA treatment of N. benthamiana leaves. I further

correlated protein expression for these effectors to functional effects via immunoblots.

These data together at the transcriptional and translational levels support the claim that

Nicotiana benthamiana transient assays are a robust and facile system to functionally

characterize the various effectors of ABA signaling pathways and study their molecular

interactions.

In previous studies from the Rock lab, transgenic cotton (Gossypium hirsutum

L.) that over-express cDNAs encoding the Arabidopsis transcription factors Related to

ABA-Insensitive3/Vivivparous1 (AtRAV1/2), encoding a B3 domain class TF,and ABA-

Insensitive5 (AtABI5), a bZIP class TF, showed improved photosynthesis in the field and

greater root and leaf biomass under deficit irrigation. We investigated a subset of these

transgenic lines to further characterize RAV1 and ABI5 expression at the protein level in

seeds and to address mechanisms of drought tolerance and adaptation by morphological

and physiological assays of cotyledonary leaves and greenhouse-grown plants subjected

to drought stress. I hypothesized that the transgenic lines may have enhanced responses

to abscisic acid (ABA), resulting in greater water use efficiency under drought stress. I

measured stomatal density whereas Dr. Fiene and collaborators measured absolute and

relative sizes (i.e. pore area/guard cell area) of guard cell apertures. I characterized

transgene expression in seeds by immunoblot. AtRAV1 cotyledons had significantly

higher stomatal densities, and 26% smaller guard cell apertures than control line

x


Coker312 under drought stress, raising the possibility that smaller guard cell pores and

greater stomatal densities may contribute to water use efficiencies measured in AtRAV1

plants in the greenhouse and field. These results are consistent with the hypothesis that

over-expression of AtRAV1 resulted in an ABA-hypersensitive phenotype manifest as

lower levels of endogenous ABA in cotyledons associated with greater reductions in pore

apertures during stress and increased stomatal density. Our results further substantiate the

potential for engineering drought tolerance in agricultural crops such as cotton by over-

expression of AtABI5 and AtRAVs.

xi


LIST OF TABLES

Table 2-1 List of Primer and their Sequences used in this study

Table 4 -1 Normalized SEM for three probes to validate the expression

Table 4-2: Normalized SEM for 1 hour ABA induction blot

xii


LIST OF FIGURES

Figure 1: Summary of abscisic acid (ABA) signaling factors: Signaling

through PYR/PYL/RCAR proteins.

Figure 2: Phylogram of BetvI-PYL-MLP family in Arabidopsis,showing homology of

PYLs and available cDNA clones

Figure 3: Cre-lox recombination-ready acceptor vector for transient and stable plant

expression assays

Figure 4: Functional genomics with pUNI Arabidopsis cDNAs and General Scheme

for creating the ready-to-transform T-DNA binary vector constructs.

Figure 5: GUS Histochemical Staining of pBI121 vector (35S promoter driving GUS)

at 24 hours and at 12 hours time frame.

Figure 6: GFP expression as seen by using a compound microscope (Olympus BX41) in

pBI121-Gfp driven by 35S promoter at 24 hours and at 12 hours time frame

Figure 7: Calibration of the fluorimeter :generate a 4MU product standard curve to

know dynamic range of instrument

Figure 8: Calibration of Fluorimetric assay to GUS protein quantitation by Immunoblot

with polyclonal Antibody

Figure 9: p201G Cas9 (addgene)

Figure 10: GFP expression by using a UV-trans-illuminator showed fluorescence at

1DPI time point and higher fluorescence at 6DPI time point using GV2260 strain

xiii


Figure 11: Immunoblot with anti-GFP and anti-Cas9 monoclonal antibodies for effectors

in protein extracts from Nicotiana benthamiana

Figure 12: Bidirectional clustering of Arabidopsis ABA receptor PYRL gene

expression intensity and experimental treatments/genotypes

Figure 13: ABA induction experiment: A result at a 1 hour time-point depicting

ABA induction by Northern blot

Figure 14: Results for various effector’s activity towards transactivation of endogenous

readout NtERD10 (GV2260)

Figure 15: Results for various effectors' activity towards transactivation of probe

NtERD10 (GV3101).


readout TAS14.


readout LEA.

Figure 18: Summary of comparative analysis of Fold Induction quantified (by

Northern blots) by three independent, traceable (validated) ABA-inducible endogenous

reporter genes

Figure 19: Positive Control immunoblot for c-myc Monoclonal anitibody(Mab)

Figure 20: Immunoblot with Monoclonal antibody c-myc for effectors in protein

extracts from Nicotiana benthamiana.

xiv


Figure 21: Image demonstrates the junction between tap root and hypocotyls

Figure 22: Screening of T1 cotton seedlings on Stewart’s Germination

media supplemented with 50 μg/ml Kanamycin

Figure 23: Establishment of plantlets in soil

Figure 24: T2 Plants in Greenhouse after screening for transgene with kanamycin

Figure 25: Preliminary Physiological Phenotypes: Showed Better developed lateral

root system and longer internode lengths under greenhouse conditions for the

kanamaycin-selected transgenic lines

Figure 26: Immunoblot with Mab c-myc for effectors in seed protein

extracts from cotton stable transgenics

Figure 27: Stomatal densities on abaxial side of 13-day-old cotyledons of Coker 312

and ABI5 and RAV1 overexpressing transgenics.

Figure 28: Time course over six days of drought stress and recovery of five-week old

greenhouse-grown transgenic cotton (Gossypium hirsutum L.) over-expressing

AtABI5 or AtRAV1.

xv


LIST OF ABBREVIATIONS

ABA abscisic acid

PYR pyrabactin resistance

PYL pyrabactin resistance 1-like

RCAR regulatory component of ABA receptor

TF transcription factor

LEA Late Embryogenesis Abundant

RAV1/2 Related to ABA-Insensitive3/Vivivparous1

COR Cold-Regulated

bZIP Basic Leucine Zipper

SnRK2 Sucrose Non-fermenting1-Related Protein Kinases2

PP2Cs type 2C protein phosphatases

CHLH Mg-chelatase H subunit

GCR2 G-protein coupled receptor 2

xvi


GTG1 and GTG2 G-protein coupled receptor-type G proteins

OST1 open stomata 1

SLAC1 slow anion channel 1

AREB/ABF ABRE-binding protein/ABRE-binding factor

ABI5 ABA Insensitive 5

RSL1 RING-type E3 ubiquitin ligase

DCAFs CUL4–associated factors

NO nitric oxide

DDB1 damaged DNA binding protein1

UPS Universal Plasmid Recombination Vector System

dwa DWD hypersensitive to ABA

CUL4 CULLIN4-based E3

ABD1 ABA-hypersensitive DCAF1

DWD DNA Binding1-DDB1 binding WD40

DDA1 DDB1-ASSOCIATED1

xvii


CDD COP10-DET1-DDB1

PTM post-translational modification

xviii


CHAPTER I

INTRODUCTION TO THE STUDY AND BACKGROUND

1.1 General Introduction

Plants have multifaceted response pathways for abiotic stresses such as drought,

salt, cold, as well as hormonal cues. Of the plant hormones, abscisic acid (ABA) is

one of the important plant growth regulators for stress responses and physiological

processes, which include plant vegetative and root growth as well as plant responses

to environmental stress such as drought, salt, cold, and wound, or pathogen attack

[1,2,3,4]. It has been shown that ABA response to biotic stress in plants is mediated

through RCAR3 receptor. This receptor along with PP2CA–mediated ABA signaling

modulates the plant immune system in response to infection by Pseudomonas

syringae [5]. Another significant role of ABA is in regulation of key aspects of

germination checkpoints/seedling establishment, seed development and maturation,

and seed dormancy. ABA mediates a myriad of physiological processes in growth

and development, including cell division, water use efficiency, and gene expression

during seed development and in response to environmental stresses such as drought,

chilling, salt, pathogen attack, UV and high light. Transcriptional profiling studies in

Arabidopsis have shown that 8-10% of the genes (> 2000) are either induced or

repressed by ABA at a single developmental stage and many of the same genes are

co-regulated by salt, cold, and drought [6]. The sorghum SbPYL gene family

members were down-regulated, apart from SbPYL1 and SbPYL7 which showed

substantial up-regulation in leaf tissues under drought stress conditions. Both

1


SbPYL1 and SbPYL5 were up-regulated in response to ABA, cold, high salt and

PEG-induced osmotic stress, but SbPYL4 exhibited significant up-regulation only

under cold stress [7]. However, it is not known if the PYL homologs in other species

are similarly regulated, raising questions about function conservation of PYLs across

plant clades and the utility of heterologous expression of PYLs in crops for

engineering stress tolerance.

1.1.1 ABA Gene Expression

ABA modulates the transcription of chloroplast genes by PP2C-

dependent activation of nuclear genes [8]. ABA negatively regulates elongation

of the hypocotyl by dephosphorylating plasma membrane proteins in Arabidopsis

thaliana [9]. A number of plant genes have been identified that function in

desiccation tolerance. The COR genes are cold-, drought-, salt-, and ABA-

responsive genes whose protein products are heat stable and hydrophilic; some

COR genes have structural similarities to the late embryogenesis-abundant (LEA)

proteins. LEA homologues in wheat, maize, barley, carrot, and the resurrection plant

Craterostigma plantagineum are induced by ABA and dehydration stress. The exact

roles of COR and LEA genes in cold and desiccation tolerance are not yet known,

but there is strong evidence that they have an adaptive function in desiccation,

freezing, and salt tolerance. Altered expression of ABA signaling can have

beneficial effects on stress adaptation of plants.

2


1.1.2 ABA signaling

The clan of proteins comprising pyrabactin resistance (PYR), pyrabactin

resistance 1-like (PYL), and regulatory component of ABA receptor (RCAR) has been

identified as a family of ABA receptors. ABA recognition by the PYR/PYL/RCAR

proteins results in a cascade of signaling that activates the SnRK2 family of protein

kinases through inactivation of their central negative regulators, the type 2C protein

phosphatases (PP2Cs) [10, 11, 12, 13]. Arabidopsis PYR/PYL/RCAR proteins have been

shown to play a key role in quantitative regulation of stomatal aperture and

transcriptional response to ABA [14, 15, 16 ]. In addition to the other PYR/PYL/RCAR

family proteins, numerous other candidate ABA receptors have been reported,

comprising the Mg-chelatase H subunit (CHLH) [17, 18], G-protein coupled receptor 2

(GCR2) [19], and G-protein coupled receptor-type G proteins (GTG1 and GTG2) [20].

Both CHLH and GCR2 are noted as ABA receptor protein candidates, but have been

controversially debated [13,20,21]. CHLH is one of the three subunits of Mg-chelatase

(D,H, and I subunits). PYR/RCAR receptors play a vital role for the whole-plant stomatal

alterations and responses to low humidity, darkness, and ozone [22]. Analogous to the

ABA-dependent regulation of transcription factors, ABA perception by RCAR/PYR/PYL

receptors causes inactivation of PP2C protein phosphatase ABI1 (ABA Insensitive 1), as

well as release of OST1 (open stomata 1) from ABI1 inhibition, and activation of the

slow anion channel 1 (SLAC1) by phosphorylation [23,24,25]. The structure of OST1

kinasel includes the catalytic domain and the ABA independent regulatory domain. The

latter forms an α-helix that binds to a hydrophobic patch of the catalytic domain and

stabilizes the catalytically essential α C helix conformation. The

3


structure provides the molecular basis of the ABA-independent activation of SnRK2

family of kinases. OST1 is also called SnRK2.6/SRK2E, a major SnRK2-type protein

kinase. Fixed loops of PYL1 act as a framework to interact with the PP2C domain of

ABI1 (the hydrophobic pocket accepting the Trp300

of ABI1). This ABA-dependent

interaction between PYL1 and ABI1 allows access of the β3–β4 loop to the active site

of the PP2C domain. As a result, PYL1–(1)-ABA activates the SnRK2-dependent

phosphorylation pathways by inhibiting the phosphatase activity of ABI1 (Fig. 1)[26].

4


Figure 1. Summary of abscisic acid (ABA) signaling factors: Signaling through

PYR/PYL/RCAR proteins. Reproduced from [13] ..

1.1.3 Cis-acting ABA response elements, their trans-acting transcription factors,

and TF post-translational modifications

Endogenous ABA levels increase in response to osmotic stresses such as

drought and high salinity, and ABA turns on gene expression by signal transduction

through ABA receptors. ABA binds to the PYR/PYL/RCARs which in turn leads to

the inactivation of the PP2Cs in the ABA-bound PYRs; subsequently, the SnRk2s

downstream are activated as they are relieved from the repression activity of the

PP2Cs. The activated SnRk2s in turn phosphorylate and activate the ABA-responsive

element (ABRE)-binding proteins. ABRE-binding protein/ABRE-binding factor

(AREB/ABF) transcription factors (TFs) regulate the ABRE-mediated transcription

of downstream target genes. AREB/ABF-SnRK2 pathway plays a key role as a

positive regulator of ABA and stress signaling in the course of AREB-mediated

transcription of target genes containing cis-acting ABREs in their promoters [27].

The ABA receptor PYR1 demonstrates extremely high sensitivity to external

application of chemicals thus supporting its interactive responses to ABA and other

drought tolerance conditions. The ligand binding features of PYR1 have been

elucidated from crystallographic studies that demonstrate receptor binding can be a

major target for bioengineering [28,29].

5


Many chemicals are critical for plant growth and development and play

an important role in integrating various stress signals and controlling downstream

stress responses by modulating gene expression machinery and regulating various

transporters/pumps and biochemical reactions. These are the second messengers.

As a developmental regulator, NO promotes germination, leaf extension and root

growth, and delays leaf senescence and fruit maturation. Moreover, NO acts as a

key signal in plant resistance to incompatible pathogens by triggering resistance-

associated hypersensitive cell death. In addition, NO activates the expression of

several defense genes namely, pathogenesis-related genes, phenylalanine

ammonia lyase, chalcone synthase and could play a role in pathways leading to

systemic acquired resistance. A different role for NO in the regulation of lateral

root development in tomato has been reported which probably operates in the

auxin signaling transduction pathway.68 NO has been associated with plant

defense responses during microbial attack, and with induction and regulation of

programmed cell death The expression of genes in response to NO has also been

shown to mediate via SA and JA signaling pathway. Various members of the

ABA receptor PYR/PYL/RCAR family were modified post-translationally by

tyrosine nitration or S-nitrosylation at cysteine residues, two covalent

modifications that can increase nitric oxide (NO) levels. These NO-mediated

modifications and poly-ubiquitylation, which target proteins for degradation.

This results in the formation of a complex, possibly interconnected, and receptor-

specific pattern in plants overexpressing their individual receptors. Similarly,

6


tyrosine nitration but not S-nitrosylation inhibited ABA-induced activity in

vitro, which suggests that tyrosine nitration may be a mechanism to rapidly tune

the cellular sensitivity to ABA [30]. Furthermore it is known, that hydrogen

sulfide acts upstream of nitric oxide which in turn modulates ABA-dependent

stomatal closure[31]. Phenotypic studies of PYL orthologs (OsPYL) over

expressed in transgenic rice showed PYL family members (OsPYL3 and

OsPYL9) substantially improve drought and cold stress tolerance and are

putative candidates for the improvement of abiotic stress tolerance [32]. Both

PYL3 and PP2C proteins interacted in vitro and in vivo as evidenced by

induction of their expression by exogenous ABA [33]. It is known that PYL8

positively influences the functioning of MYB77 and its paralogs MYB44 and

MYB73 to augment auxin signaling. This in turn helps PYL8 to promote lateral

root growth independently of the core ABA-SnRK2 signaling pathway [34].

Also, the turnover of PYL4 and PYR1 in the proximity of the plasma membrane

is regulated by the interaction with a single subunit RING-type E3 ubiquitin

ligase, RSL1 [35, 36].

7


1.1.4 ABA Agonists

Pyrabactin sulfonamide is an artificial naphthalene that mimics ABA [37,

38]. It is a selective ABA agonist that acts through PYR1 ABA receptor, the

founding component of a family of START proteins called PYR/PYLs (Pyrabactin-

Like), which are essential for both pyrabactin and ABA signaling in vivo [39]. Fig. 2

shows the phylogenetic relationship of START domain proteins most homologous to

PYR/PYLs. It is now known that ABA binds to PYR1, which in turn binds to and

inhibits a family of ABI1/2 (ABA-Insensitive1/2) PP2Cs (protein phosphatase 2C

PP2C), which have been shown genetically to be negative regulators of ABA

responses. Homo- and heteromerization of OST1 occurs with SnRK2.2, SnRK2.3,

OST1, and SnRK2.8, and several OST1-complexed proteins were identified as type

2A protein phosphatase (PP2A) subunits and as proteins involved in lipid and

galactolipid metabolism [40]. OST1 has kinase activity and it also functions in guard

cells. Two modules of regulatory features Ser-175 and the SnRK2-specific box are

critical for kinase activity and the mechanisms involved are probably shared by all

kinases of the SnRK2 family, whatsoever the signaling pathway in which they act. In

comparison, Ser-7, Ser-18, and Ser-29 and the ABA-specific box are required for

OST1 function in ABA responses of guard cells. These Ser residues may be targets

of upstream phosphorylation or dephosphorylation events, and the ABA-specific

motif might bind specific regulatory constituents of the pathway. These

phosphorylations and

8


interactions with upstream cohorts may regulate the function of OST1 kinase in

guard cells by controlling its activity, stability, or employment of specific

substrates. The work adds PP2A-type protein phosphatases as another class to the

interaction network of SnRK2-type protein kinases. PYR/PYLs are ABA-

receptors that function at the beginning of a negative regulatory pathway that

controls ABA sensitivity by inhibiting PP2Cs [11].

Also, PYR/PYL/RCARs hence bind to and inhibit PP2Cs when bound to

ABA, which allows accumulation of phosphorylated SnRK2s (targets of PP2Cs)

and subsequent activation by phosphorylation of ABA Response Element Binding

Factors (ABFs), encoded by a family of ABI5-like basic leucine zipper TFs. An

important recent development in this arena is the realization that PYR/PYL-

interacting C2 domain partners arbitrate a transient Ca2+

-dependent interaction

with phospholipid vesicles, which affects PYR/PYL subcellular localization and

positively regulates ABA signaling pathway [41].

9


pUNI donor construct

U15941 (Gateway®) U18080

U12806 U13617 U50118

U83484 U22850 U23619 C103436 U13623

Figure 2: Phylogram of BetvI-PYL-MLP family in Arabidopsis, showing homology of

PYLs and available cDNA clones. Cotton transgenic lines are shown in red

10


1.1.4 ABA receptors: monomeric and dimeric

ABA receptors can be distinguished on the basis of their oligomeric states:

PYR1, PYL1, and PYL2 form stable dimers in solution, whereas PYL4–PYL12 are

monomeric in solution and PYL3 is in monomer-dimer exchange equilibrium under

physiological conditions [42, 43, 44, 45]. The dimeric receptors are essentially less

sensitive to ABA than the monomeric receptors [44]. Regardless of this lower sensitivity,

genetic data suggests that the dimeric receptors are essential in all ABA responses

measured [11,16, 42].

1.1.6 ABA signaling transcription factors

The RAV (Related to ABI3/Viviparous1) family of transcription factors have the

N-terminal AP2-like (DNA Binding Domain) DBD that binds 5'-CAACA-3' sequence,

and the C-terminal Basic3 (B3)-like DBD that binds 5'- CACCTG-3' sequence in

promoters of ABA-inducible genes. Six members of RAV TFs family have been

classified in Arabidopsis [46]. The ABI5 clade of bZIP TFs (about 12 homologues from

a total of ~87 in the Arabidopsis genome) play a major role in ABA-mediated responses

at seed and seedling stages of development. ABI5 (ABA Insensitive 5) is involved in

seed-specific responses.

CULLIN4-RING E3 ubiquitin ligases (CRL4s) regulate key developmental and stress

responses in eukaryotes. It has been previously published that members of the DDB1-

CUL4–associated factors (DCAFs) clan of proteins directly bind to DAMAGED DNA

11


BINDING PROTEIN1 (DDB1) and function as the substrate receptors in CULLIN4-

based E3 (CUL4) ubiquitin ligases, which regulate the selective ubiquitination of

proteins. A particular DCAF protein -the ABD1 (ABA-hypersensitive DCAF1), has been

shown to negatively regulate ABA signaling in Arabidopsis thaliana. It has been also

shown that loss of ABD1 leads to subsequent hyper-induction of ABA-responsive genes

and higher accumulation of the ABA-responsive TF ABI5 and a retardation of ABI5

degradation by the 26S proteasome [47]. Furthermore, it has been recognized that in the

same CULLIN4-based E3 (CUL4) ubiquitin ligase complex, DWD (DNA Binding1-

DDB1 binding WD40) is also a critical element in the post translational regulation of

ABI5. Studies on dwa (DWD hypersensitive to ABA) mutants have revealed ABI5

accumulates to higher levels in these mutants and the proteasomal degradation rate of

ABI5 is highly reduced in dwa plants as compared to the wild type counterparts [48].

Both evidences point to the fact that TFs in the ABA signaling pathway (viz. ABI5) are

undergoing post translational modification (PTM) through the interaction of multi protein

complexes, regulating the ABA signaling pathway in a direct or indirect manner. From

my study, it has further corroborated the fact ABI5 is indeed subjected to post

translational modifications, as evidenced by my results is Figure 20. Besides TFs,

receptors for ABA signaling pathway like PYL8 and PYR4 have also been shown to be

post translationally modified by undergoing polyubiquitination and subsequent

proteasomal degradation. The COP10-DET1-DDB1 (CDD)–related protein complexes,

have been proposed to facilitate target recognition by CRL4. DET1-, DDB1-

ASSOCIATED1 (DDA1) as part of the CDD complex, providing substrate specificity for

CRL4 by interacting with ubiquitination targets. DDA1 has been shown to bind to the

12


abscisic acid (ABA) receptor PYL8, as well as PYL4 and PYL9, in vivo thus

facilitating its proteasomal degradation. These receptors gain stability through ABA

binding by limiting their polyubiquitination [49].

Enhancement of crops for an assortment of traits, including disease resistance,

adaptation to abiotic and biotic stresses, and seed quality improvements such as oil,

starch or protein content, can be accomplished by introducing new or modified

transgenes into the genome. Overexpression of ABA receptors and transcription factors

responsible for drought-inducible gene expression have established the practical benefits

of synchronized activation of gene sets that confer non-specific protection by up-

regulation of stress-response pathways [50,51]. Heterologous transgene systems that

regulate hormone and stress responses as proposed in this study can be used to tap into

the natural defense and seed development processes of crop plants such as cotton, with

the potential benefits of increasing yields under stress conditions and enhancing seed

qualities. Testing the functions of these major effectors/ players of ABA pathway both

transiently in Nicotiana benthamiana and stably in cotton could help predict phenotypes

for translational applications such as engineering stress tolerance in crops and improved

seed qualities.

13


BACKGROUND TO THE PROJECT

FUNCTIONAL ANALYSES OF ABI1-LIKE PP2CS IN TRANSIENTLY

TRANSFORMED MAIZE PROTOPLASTS

Transient gene expression studies with maize and rice protoplasts in our lab and

numerous others' have shown that transient expression is a powerful, reproducible and

facile system for studying gene regulation [52,53]. Previously, Arabidopsis donor cDNAs

in the UPS (universal plasmid system) vector pUNI51 were made available to the

scientific community [54] (Fig. 4) and a set of UPS acceptor plasmids (pCR701-pCR705)

were engineered to comprise in-frame N-terminal epitope tags recognized by

commercially available antibodies (6xHis, 2xHA, 2xFLAG, 2xcMyc) and driven by the

maize Ubiquitin promoter for expression of tagged cDNA effectors [55] in protoplasts-

plant cells devoid of their cell walls. As was hypothesized, Pro35S-Ppdk:abi1-1 dominant

negative allele and ProUbi:ABI2 constructs significantly antagonized the ABA-inducible

ProEm:GUS reporter expression more than 90% for abi1-1 and 50% for ABI2

respectively , while the tested effects of more distantly related PP2C-homologous family

members ProUbi:AP2C7, ProUbi:AP2C9, and ProUbi:AP2C18 candidate PP2Cs were

substantiated as negative ABA regulators of ABA-inducible gene expression. The minor

antagonism by ABI1-clade HAB2 observed for ABA-inducible ProEm:GUS gene

expression was consistent with others' genetic results that HAB2 is a weak negative

14


regulator of ABA-induced chlorophyll loss in seedlings [56]. Interestingly, transient

expression of the PP2C test construct ProUbi:AP2C1 transactivated ProEm:GUS

expression instead of antagonizing it as hypothesized. The conserved Gly residue at

amino acid position 180 of ABI1 is critical for ABA signaling and the G180→D mutation

results in dominant-negative alleles for ABI1 and ABI2 (G168D) [57]. A site-directed

mutant derivative of AP2C1 (ProUbi:AP2C1m) containing four amino acid residue

changes, in particular G178E which is analogous to the dominant-negative allele G180D

in abi1-1, did not transactivate ProEm:GUS expression, supporting that the

transactivation effect of AP2C1 was specific.

15


Figure 3. Cre-lox recombination-ready acceptor vector for transient and stable plant

expression assays. pCR701-705 are transient acceptors driven by the maize Ubi

promoter with loxH alone, 2xHIS6, 2x-HA, 2x-FLAG, and 2x-cMYC epitope tags,

respectively, upstream (5’) and in frame with loxH recombination site to give N-terminal

fusion peptides with acceptor pUNI cDNA plasmids. From [55]

Reproducibility of several PP2C effects obtained with Cre-lox recombination-

generated constructs has been documented [55]. Altogether, the functional data

suggested that genes highly homologous to ABI1 are functionally conserved across

monocot and dicot species for ABA-inducible gene regulation and that some genes

outside the ABI1-Like clade (e.g. AP2C1, AP2C18) can also affect ABA signaling when

overexpressed. I speculate this may be because the crosstalk machineries flanked by

stress pathways may be arbitrated by PP2Cs either directly by sharing of some targets, or

indirectly by changing the homeostatic equilibria of phosphorylated signaling effectors in

regulatory cascades.

16


In my study I am using the aforementioned UPS donor vector pUNI51 containing

the various full length cDNAs comprising the PYL family of ABA receptors and a T-

DNA acceptor vector pKYLX

(https://www.arabidopsis.org/servlets/TairObject?type=vector&id=500600073) which

affords high activities in transient expression assays with N. benthamiana infiltrated with

Agrobacterium tumifaciens harboring UPS effector binary plasmids [58]. The acceptor

vector for cDNA gene donors also has a 9x N-terminal c-MYC tag for transgene

protein characterization as a chimaeric fusion. These constructs had already been

generated at the start of my project for stably transformed expression of AtPYL4 and

AtPYL7 in transgenic cotton. My work then focused on phenotypic and molecular

studies to assess the conservation of ABA receptor activities across species.

Previously in the lab, a maize mesophyll protoplast transient assay was used to show

that B3-DBD effector RAVs, and ABA effector bZIPs most closely related to ABI5

transactivate ABA-inducible gene expression and show synergy in their activities when co-

expressed [59]. Transgenic cotton expressing Arabidopsis RAVs and ABI5 have a

‘less-stressed phenotype’, which may have wide-ranging utility for engineering abiotic

stress tolerance in crop species. Functional characterization of AtRAV2 cDNA has

already been conducted on ABA-inducible reporter gene expression and interactions with

known positive effectors (ABI5, ABF3, VP1) and the dominant-negative ABA effector

mutant abi1-1 encoding a protein phosphatase type 2C (PP2C) [59]. The ABA effectors

ABI5 and ABF3 [60] resulted in transactivation of between 4- and 16-fold above the

promoter of Early-methionine-rich driving bacterial β-glucuronidase (uidA) GUS reporter

17


gene (Em:GUS) alone in the absence or presence of a saturating concentration (100 uM)

ABA, respectively. ABA treatment resulted in ~5 fold induction of the Em:GUS reporter

alone, whereas overexpression of AtRAV2 resulted in transactivation of 2-3 fold above

the reporter gene alone in both the presence and absence of exogenous ABA, values

somewhat less than overexpression of ABI5 or ABF3. Thus, past works demonstrated

that transient assays are a value-added and rapid means to characterize redundant signal

transduction pathways. I endeavored to extend the transient assay system to dicots,

specifically Nicotiana benthamiana, a model system for high-level transgene functional

genomics [61].

Evidence from fibers of transgenic cotton lines showed RAV2 and ABI5

overexpressers had significantly finer fibers, and ABI5, RAV2-L and RAV1 transgenics

had considerably longer fibers [62]. Lines of AtRAV1 and AtRAV2-overexpressing

cotton had approximately 5% significantly longer fibers with only minor decreases in

yields under well-watered or drought stress conditions. The longer transgenic fibers from

drought-stressed transgenics could be spun into yarn which was measurably stronger and

more uniform than that from well-watered control fibers. A number of the transgenic

lines showed robust vegetative growth phenotypes in the greenhouse compared to non-

transgenic controls with more number of bolls and larger plant size [62]. Further

characterization of these materials with agronomic potential are therefore warranted at

the protein level, which is facilitated by the c-myc epitope N-terminal tag engineered into

the transformation vectors.

18


Objectives:

The main objective of this study is to test the functions of ABA receptors and

downstream transcription factors in heterologous systems to gain insight into

conserved ABA signaling modules in plants.

The transient expression levels of key genes like transcription factors and

receptors in ABA signaling in a model plant species for biopharming [63] , Nicotiana

benthamiana and also to comprehend the henceforth stable expression of these very

genes in a heterologous system in upland cotton, namely Gossypium hirsutum.

To study the expression of regulatory genes (receptors and transcription actors)

genes in Nicotiana and Gossypium, we are proposing the following aim.

19


Specific Aim:

Use the robust and reproducible transient assay system of Nicotiana benthamiana

to test the activities of known ABA effectors by measuring the read-out of the effectors

as endogenous reporter (ERD10C, a LEA gene) transcripts, relative to abundance of

transiently expressed transgene effectors quantified by immunoblots. Test in the transient

system the ABA signaling activities of AtPYL7, AtPYL4, outlier control MLP423 (Fig.

2) on endogenous ABA signaling pathway ERD10C transcriptional readouts.

Hypothesis:

Nicotiana benthamiana is an established system for transient assays at both

transcriptional and translational levels. If we can exploit the rapid and robust nature of

N.benthamiana assays to functionally characterize the ABA receptors (and transcription

factors), then results can be translated to stable transformation of crops like upland cotton

(Gossypium hirsutum) to gain deeper insights into the utility of ABA receptors. Our

overall goal is for deeper understanding of efficacy and molecular mechanisms of deeply

conserved ABA gene effectors by characterization in heterologous systems (both

transient and stable).

20


CHAPTER II.

MATERIALS AND METHODS

2.1 cDNA clones of PYLs, RAVs and ABI5 and making recombinant vectors for

Agrobacterium-mediated transformation in Arabidopsis and cotton

Arabidopsis annotated expressed genes for plant functional and proteomics

studies. These plasmids are compatible with the Universal Plasmid Recombination

Vector System(UPS) of Dr. Steve Elledge. Universal Plasmid Recombination Vector

System (UPS) employs the 34 bp cre-lox site-specific recombination site-specific

system of bacteriophage P1 to catalyze plasmid fusion between the Univector, a plasmid

containing the gene of interest without promoter elements, and host vectors containing

regulatory information. Fusion events are genetically selected and result in placement of

the effector gene under the control of novel regulatory elements.

UPS eliminates the need for restriction enzymes, DNA ligases, and many in vitro

manipulations required for subcloning and allow the rapid construction of multiple

constructs for expression in multiple organisms. pUNI51-derivative full length cDNA

clones of Arabidopsis RAV family members from Arabidopsis Biological Resource

Center, Ohio State University, http://abrc.osu.edu/) were recombined to pKYLX-myc9-

loxP binary acceptor vector[58] in the presence of cre-recombinase (Fig. 5). pUNI51 has

a Neomycin Phosphotransferase NPT II kanamycin selectable marker and an origin of

21


replication (oriRK6ɣ) that can only be propagated in PIR1 host cells (Invitrogen,

Carlsbad, CA) in the absence of another origin of replication.

The T-DNA binary acceptor vector pKYLX-myc9-loxP (ABRC stock#CD3-637;

plant selectable marker is kanamycin driven by the strong plant promoter 35S from

Cauliflower Mosaic Virus) has a tetracycline selectable marker for the bacterial host and

a low copy number RK2 origin of replication that functions in E. coli strain GC10 (which

is pir- and cannot replicate the pUNI donor plasmid alone). After in vitro recombination

the products are electroporated into GC10 cells and selected genetically on kanamycin,

whereby only recombinant plasmids can replicate.

The acceptor vector has been engineered to provide 9 repeats of the c-myc epitope

(EQKLISEEDL) at the N-terminus of the donor protein that facilitates detection of the

expressed transgene expression using an immunoblot (western) assay. Expected protein sizes

from different pKYLX-pUNI cDNA recombinant constructs are as follows; Pyl7~38kDa,

Pyl4 ~36kDa, Mlp423 ~ 31kDa, RAV 1 ~52 kDa, Rav 2 ~53 kDa, Abi5~ 61 kDa,RAV2L ~

52kDa.Transformation-ready constructs were restriction digested and were confirmed to be

comprised of a dimer of one acceptor and one pUNI donor plasmid. For recombination, in a

20 μL reaction volume 500 ng acceptor and donor vector DNAs were mixed with 2 μL 10x

recombination buffer (New England Biolabs; www.neb.com), 2 μL GST::CRE recombinase

and incubated at 37° C for 20 min. The DNAs were

22


precipitated with EtOH, the pellet dissolved in 10 μL water and the DNA measured by a

Nanodrop spectrophotometer (Willmington DE; www.nanodrop.com).

About 100-200 ng of DNA products were electroporated into electrocompetent

pir- E. coli GC10 cells (Invitrogen, Carlsbad, CA) and the recombinant fusion plasmids

was selected on kanamycin containing LB plates.

After validation by restriction enzyme mapping of recombinant plasmids,

pure supercoiled plasmids were prepared by CsCl density gradient ultracentrifugation

and electroporated into electrocompetent Agrobacterium tumifaciens strain GV3101

and GV2260. Electroporation conditions were 2000 volts, at 200 Ω and 25μF.

23

http://www.nanodrop.com/


CONSTRUCTS

Figure 4. Functional genomics with pUNI Arabidopsis cDNAs and general scheme for

creating the ready-to-transform T-DNA binary vector constructs. The pUNI51 vector

containing a full length cDNA obtained from the Arabidopsis Biological Resource Center.

pUNI clones were recombined with pKYLXmyc9-LoxP binary vector in the

24


presence of cre-recombinase enzyme. The two vectors recombine at the 34 bp LOX-P

site and the resultant recombined cDNA will be under the control of 35S Promoter from

the acceptor vector and the bovine growth hormone (BGH) transcription termination

signal [55]. The resulting protein will have N-terminal 9X c-myc epitope that can be used

to detect the protein in plant extracts.

2.3 Methods for characterization of transgenes in plants

2.3.1 Plant Material

Plants were grown at 21°C temperature with a 16 hr/8 hr, light/dark cycle for

long day conditions for 4 weeks. Transient assays in tobacco plant (Nicotiana

benthamiana) is used to determine the subcellular location of a gene of interest. The root

tumor-inducing bacterium Agrobacterium tumefactions is used as intermediate to

introduce the target gene expression cassette into leaf cells.

25


2.3.2 Sampling procedures

These sections were immediately placed into microfuge tubes and frozen in

liquid nitrogen for storage at -80 °C freezer.

2.4 Generating transgenic cotton plants by Agrobacterium-mediated

hypocotyls explants transformation and regeneration

T₁ cotton seeds were collected from self-fertilized bolls of transgene- expressing

T0 parental lines and were planted in test tubes on Stewarts media (pH 6.8) containing 50

parts-per-million kanamycin and 5 gram/Liter glucose at 28° C under 16/8 hr light/dark

conditions. Lines expressing transgenes showed Mendelian segregation ratio for lateral

root growth on kanamycin medium, whereas wild type control (WT) Coker312 plants

never showed lateral root growth on kanamycin supplemented media. Plants showing

vigorous lateral roots (~ 10-12 days from planting) were transferred to pots comprising

potting soil. Pots were kept in a tub tray covered with Saran wrap to maintain a high

relative humidity environment. After a week to 10 days, well-established seedlings were

transferred to pots and moved to greenhouse. The T2 seeds from T1 plants were selected

on kanamycin to cull out the segregating T1 plants. Authentication of the presence of a

single T-DNA insertion event in progeny seeds from self-fertilized T1 transgenic lines

26


was by demonstration of 3:1 Mendelian ratio of dominant resistance trait to kanamycin

susceptible by genetic selection on kanamycin-containing rooting medium.

Primer Design

Primers were designed by using the Nicotiana benthamiana draft genome on

Solgenomics® (https://solgenomics.net). Upon performing alignment using BLAST

function and finding significant similarity (shown below), the open source software

Perlprimer® (http://perlprimer.sourceforge.net/) was used to design the primer oligos.

PerlPrimer® is a GUI application written in Perl that is aimed at automating and

simplifying the process of primer design. Primers were synthesized commercially from

Sigma Aldrich® (https://www.sigmaaldrich.com/). The list of Primers used in this work

are listed in Table 2-1.

27

https://www.sigmaaldrich.com/


Table 2-1: List of Primer and their Sequences used in this study

Primer Name Sequence

NtERD10C_2_F GATGAGGAGGAAGAAATAGG

NtERD10C_2_R CTTCAGTCTTTGAGTGGTAT

*NtLEA-Q_F TTGTTAGCAGGCGTGGGTAT

*NtLEA-Q_R CTCTCGCTCTTGTTGGGTTC

Ntom_F AGCTAGAGCTGTCGGATCGA

Ntom_R GGCACAATACAACGAGGGATA

Nsyl_F CAGAGAACTTACAGAGCTAG

Nsyl_R AGCATCTTGATAAGGTAAAGA

*Yongjin Huo et al . Plant Cell, Tissue and Organ Culture (PCTOC) September 2015

28


Probe for ERD10C gene Query: 310 agtgatgaggaggaagaaataggagaggacgggcagaaaatcaagaagaagaaaaagaag 369

||||| || ||||||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 44025 agtgacgacgaggaagaaataggagaggacggacagaaaatcaagaagaagaaaaagaag 43966 Query: 370 ggtttgaaggataaaatcaaggataaaatatctggagaacacaaggaagaagagaaggcg 429

|||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 43965 ggtttgaaggataagatcaaggagaaaatatctggagaacacaaggaagaagagaaggca 43906 Query: 430 ggtgaggacacggctgtaccagtggagaaatacgaggaaacagaggagaagaaaggattc 489

| ||||||| ||||| ||||||||||||||||||||| |||||||||| || ||||||

Sbjct: 43905 g---aggacacagctgttccagtggagaaatacgaggaagcagaggagaaaaagggattc 43849 Query: 490 ctagacaagattaaggagaagttgccaggtggcgggcaaaagaagacagaggaagtggcg 549

|||||||||||||||||||||||||||||| |||||||||| || ||||||||||| ||| Sbjct: 43848 ctagacaagattaaggagaagttgccaggttgcgggcaaaataaaacagaggaagtagcg 43789 Query: 550 cctccaccaccgcctgcggcggagcacgaggctgagggaaaagagaagaagggatttttg 609

|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 43788 cctccaccaccggctgcggcggagcacgaggctgagggaaaagagaagaagggatttttg 43729 Query: 610 gacaagattaaggagaaattaccaggatatcactcaaagaccgaag 655

||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 43728 gacaagattaaggagaaattaccaggataccactcaaagaccgaag 43683

29


Query - Nicotiana Tabacum ERD10C

Subject – Nicotiana Benthamiana draft genome

Score = 523 bits (264),

Expect = 1e-146

Identities = 326/346 (94%),

Gaps = 3/346 (0%), Frame = +1 / -1

N. tabacum genome comprising two subgenomes from Nicotiana sylvestris and Nicotiana tomentosiformis

N. tabacum genome comprising two subgenomes from Nicotiana sylvestris and

Nicotiana tomentosiformis. Nicotiana tabacum (tobacco) is a 5–6 million year old

allotetraploid species derived from ancestors of N. sylvestris, the maternal S genome

donor, and N. tomentosiformis the paternal T genome donor. As a species, N. tabacum

evolved through the interspecific hybridization of the ancestors of Nicotiana sylvestris

(maternal donor) and Nicotiana tomentosiformis ( paternal donor).

30


Probe 1 for TAS14 gene

Query: 100 gaaagagatggcacaatacaacgagggatacggtagccaggggcaaatgcgccagactga 159

|||||| |||||||||||||||||||||||||||||||||| ||||||||| ||||||||

Sbjct: 10692 gaaagaaatggcacaatacaacgagggatacggtagccaggagcaaatgcgacagactga 10751

Query: 160 tgaatatggaaaccgggtccaagaaagtgggggcatgggcagtactggtgcctatggaac 219 ||||||||||||||| |||||||||| |||||||||||||| |||||||||||||||| Sbjct: 10752 tgaatatggaaaccgtgtccaagaaactgggggcatgggca---ctggtgcctatggaac 10808

Query: 220 tcagcaag------gtatggggggcataggtggtggagaatatggaacccaaggccaagg 273

|||| | |||| |||||||| |||| |||||||||||| |||||||||||||| Sbjct: 10809 tcagggtgataccggtattgggggcatgggtgctggagaatatggcacccaaggccaagg 10868

Query: 274 tactggtatggggaccactggtggtggagcctatggaactcagggtggtactggaatggg 333

||||||||| || | |||||||||||||||||||||||||||||||||||||||||

Sbjct: 10869 tactggtataggtatg---ggtggtggagcctatggaactcagggtggtactggaatggg 10925

Query: 334 ggctatgggtggagatcagtatggaacccaaggtactggaatgggtatgggtactggtgg 393

||| |||| |||||| |||||||||||||||||| |||||||||||||||||||| || Sbjct: 10926 ggccatggatggaga---gtatggaacccaaggtaccggaatgggtatgggtactggggg 10982

Query: 394 tatgcatactcagcaccatgagggccaacaacagcttcgtcgatccgacagctctagctc 453

||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| Sbjct: 10983 tatgcatactcagcaccataagggccaacaacagcttcatcgatccgacagctctagctc 11042

Query: 454 tgtaagtt 461 ||| ||||

Sbjct: 11043 tgttagtt 11050

Query - Nicotiana tomentosiformis TAS14 gene


Score = 418 bits (211), Expect = 1e-114

Identities = 330/368 (89%), Gaps = 15/368 (4%),Frame = +1 / +1

31


Probe 2 for TAS14 gene

Query: 20 gtgaaagagatggcacaatacaacgagggatacggtagccaggggcaaatgcgccagact 79

|||||||| |||||||||||||||||||||||||||||||||| ||||||||| |||||| Sbjct: 41423 gtgaaagaaatggcacaatacaacgagggatacggtagccaggagcaaatgcgacagact 41364

Query: 80 gatgaatatggaaaccgggtccaggaaactgggggcatgggcactggtgcctatggaact 139 ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| Sbjct: 41363 gatgaatatggaaaccgtgtccaagaaactgggggcatgggcactggtgcctatggaact 41304

Query: 140 cagggtggtaccggtattgggggcatgggtgctggagaatatggaacccaaggccaaggt 199 ||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct: 41303 cagggtgataccggtattgggggcatgggtgctggagaatatggcacccaaggccaaggt 41244

Query: 200 actggtatgggtatgggtggtggagcctatggaactcagggtggtactggaatgggggcc 259 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 41243 actggtataggtatgggtggtggagcctatggaactcagggtggtactggaatgggggcc 41184

Query: 260 atgggtggagagtatggaacccaaggtactggaatgggtatgggtactggtggtatgcat 319 |||| |||||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 41183 atggatggagagtatggaacccaaggtaccggaatgggtatgggtactgggggtatgcat 41124

Query: 320 actcagcaccatgagggccaacaacagcttcgtcgatccgacagctctagctctgtaagt 379 |||||||||||| |||||||||||||||||| |||||||||||||||||||||||| ||| Sbjct: 41123 actcagcaccataagggccaacaacagcttcatcgatccgacagctctagctctgttagt 41064

Query: 380 tttgtaacatcaataaaagttcaagaaagaaaattttttgcacgtatcaaaaagtattac 439 |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| Sbjct: 41063 tttgtaacatcaataaaagttcaagaaagaaagatttttgcacctatcaaaaagtattac 41004

Query: 440 tcctcttagagaataattggtaggtttaaacgtgtcatcacatttttatgactataaaat 499 ||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||| Sbjct: 41003 tcctcttagag---aattggtaggtttaatcatgtcatcacatttttatgactataaaat 40947

Query - Nicotiana sylvestris TAS 14 gene


Score = 910 bits (459),

Expect = 0.0

Identities = 624/675 (92%),

Gaps = 18/675 (2%),

Frame = +1 / -1

32


Polymerase Chain Reaction (PCR)

PCR were performed using an Eppendorf thermocycler for 30 cycles and bands

were analyzed on a 1% agarose gel by electrophoresis. The annealing temperature was

60°C.

GUS Histochemical Assay

β-Glucuronidase GUS assays. Plant samples were developed at 37°C for 12 h

with a 1 mM solution of the indigogenic GUS substrate 5-bromo-4-chloro-3-indolyl b-D-

glucu-ronide (X-Gluc; Rose Scientific) in 50 mM KH2 PO4 (pH 7.0), 0.1 mM EDTA, 0.5

mM ferricyanide, 0.5 mM ferrocyanide, 0.05% sodium azide, 0.1% Triton X-100. After

staining overnight, samples were immersed in 70% ethanol overnight.

GUS Fluorometric Assay

Although spectrophotometric substrates for GUS are available, GUS activity in

solution is usually measured with the fluorometric substrate 4-methylumbelliferyl-β-

D-glucuronide (MUG). Fluorometry is preferred over spectrophotometry because of its

greatly increased sensitivity and wide dynamic range. The assay is highly reliable and

33


simple to use. After hydrolysis of methyl-umbelliferyl-glucuronide (MUG) substrate by

GUS enzyme, the reaction first must be terminated with basic solution. This not only

stops the enzyme reaction, but also causes the fluorescence.

Total RNA Extraction and Quantification

Tobacco total RNA was extracted from leaves using liquid nitrogen and processed with

the Spectrum® Plant Total RNA Kit ( SIGMA ALDRICH, St. Loius MO). The extraction

process was carried out step-by-step as described in the protocol manual of the

commercial extraction kit. Extracted total RNA was then quantified using the Nanodrop

quantification instrument (Thermo Fisher Scientific, www.thermofisher.com).

RNA Blot analysis

For RNA (Northern) blot analysis, 6 μg total RNA was loaded on 1.2 % denaturing

agarose gel and subjected to electrophoresis. One of the most frequently used denaturants

for RNA agarose gel electrophoresis is formaldehyde. Since RNA is a single-stranded

nucleic acid and tends to form secondary structures, a standard agarose gel will not give

an accurate size separation of your total RNA or mRNA sample. Therefore a denaturing

agent like formaldehyde must to be added to the agarose gel and the RNA to ensure the

molecules remain single-stranded. Afterwards, the RNA gel was blotted to a Hybond-N+

nylon membrane (GE healthcare, Piscataway, NJ) according to the manufacturer’s

34


instructions. An RNA molecular weight marker was also used as reference to estimate

mRNA transcript sizes (Ambion Millenium Marker, cat# AM7151). The probes used for

labeling in the Northern hybridization were synthesized using Random Primer DNA

Labeling Kit Ver.2® (TAKARA, Shiga, Japan). The radioactive isotope used in the

process was [α-32P]-dCTP (PerkinElmer, Waltham, MA). Membranes were

prehybridized briefly in the PerfectHyb® Plus hybridization buffer (SIGMA

ALDRICH,Saint Louis, MO) and then subjected to hybridization in the same buffer

according to the manufacturer’s instructions. For auto-radiographic detection, a storage

phosphor screen (GE Healthcare, Piscataway, NJ) was used and it was scanned using a

Personal Molecular Imager™ (PMI™) System (Biorad).

Quantification of Northern Blots

Ethidium bromide-stained total RNA was quantified by imaging the intensity of

ribosomal rRNA bands using Quantity One® software (Biorad). A rectangle was drawn

around bands for each lane in total RNA and area was measured. The Northern blot band

intensity of each lane was quantified similarly using the same Quantity One® software.

The ratio of value for blot and gel gives us the desired quantitative result for each lane.

35


Immunoblot Analysis from Nicotiana benthamiana and Cotton (Gossypium

hirsutum)

Total protein from both N. benthamiana leaves and cotton seeds was extracted

using lysis buffer (10 mM EDTA, 0.1% (v/v) Triton X-100, 40 mM sodium phosphate

buffer (pH 7.0), 10 mM β-mercaptoethanol, 1 mM PMSF) and the lysate was quantified

using Bradford Coomassie assay (Pierce; www.piercenet.com). 10 μg of total protein

was loaded onto a mini vertical SDS-PAGE gel (Thermo Fisher Scientific;

www.thermofisher.com) and blotted on to Immobilon-P PVDF transfer membrane

(Millipore; www.millipore.com). For detection of protein, Monoclonal mouse anti c-

myc primary antibody (Pierce, 1:2000 dilutions), anti GFP primary antibody (Invitrogen,

1:3000 dilutions) and anti Cas9 (Novusbio,1:2000 dilutions) were used. Horseradish

peroxidase-labeled anti mouse secondary antibody (1:20,000 dilution) was then used to

detect the primary antibody. ECL Advance chemiluminescence detection method

(Amersham Biosciences; www.gehealthcare.com) was used to detect protein and images

were captured using ImageLab® software (ver. 5.2) (Biorad). To validate lane loadings,

blots were reprobed with anti-Ubiquitin primary antibody (PD41 Cell Signaling) was

used as internal control and Coomassie blue dye was used as loading control.

36


Analyses of the relative protein concentration

Quantity One® software (Biorad) was used again for determining the relative

protein concentration. A rectangle was drawn around bands for each lane in ubiquitin and

area was measured. The band intensity of each lane was quantified similarly for every

other detected protein of interest using Quantity One®. The ratio of value for these

proteins and ubiquitin gives us the desired quantitative result for each lane.

Guard cell morphology

Guard cell morphology was analyzed by a modified technique described by

Travaglia and others (2010). A layer of clear nail polish (nitrocellulose in ethyl acetate)

was brushed on the abaxial side of a cotyledon, allowed to dry for 15s, and then carefully

extracted with forceps and mounted on a microscope slide. The slide was examined using

a standard compound microscope, and digital photomicrographs taken of the abaxial leaf

impression. The photomicrographs were then imported into Image-J (Rasband, 1997-

2012), and the numbers and area (μm2) of guard cells (i.e., individual stoma) and their

pore (i.e., aperture) were analyzed. Stomata measurements were chosen at random from

those that could be clearly focused as to avoid distortion in the measurements. Because

of variation in the clarity of individual guard cells in images, the

37


number of guard cells per cotyledon characterized for aperture ranged from 15-20

stomata per cotyledon, and the total number of stomata counted per genotype was from

300 to 440, with 12 individual plants for each genotype sampled from seven to eight

times. The area of guard cells and pores were summed to produce a single data point for

that cotyledon, and then scaled to 15 to correct for the uneven number of guard cells

collected per cotyledon. We also investigated the area of guard cell pores relative to the

size of guard cells (pore area/guard cell areas) by dividing the total areas of 15 guard cells

by the summed areas of the pores. Stomatal area (μm2) and apertures (μm

2), met

assumptions of normality and were analyzed separately using ANOVA.

Statistical analysis

Comparative analysis of Fold Induction quantified by three independent, traceable

(validated) ABA-inducible endogenous reporter genes.The error bars indicate the ±

S.E.M.(Standard Error of Mean) values for the biological replicates of northern blots

from these probes (n=3). For statistical significance analysis, a two-tailed Student’s t-test

was applied with unequal variance assumed.

To determine the effects of each transgenic event on responses to drought-stress

and recovery, we conducted pair-wise analyses of Coker312 against each transgenic cotton

line under specific treatment conditions. This was done using a two-tailed

38


Student's t-test, assuming equal variance except for the ABA quantitations, where a one-

tailed t-test was used on grounds prior work [59, 62] showed the test genotypes were

drought tolerant/ABA hypersensitive. The same one-tailed method was applied to

analyze the effects of drought-stress (versus well-watered controls) and drought recovery

(peak drought vs. drought recovery) independently within each cotton line.

39


CHAPTER III.

STUDIES ON THE UTILITY OF NICOTIANA BENTHAMIANA TRANSIENT

GENE EXPRESSION SYSTEM:

3.1 INTRODUCTION

An opening step to my work was to select a time point which can be reproduced

for various experimental parameters. Since we want to interpret the readout of an

endogenous ABA-inducible gene reporter, and ABA responses are expressed in plant

cells in seconds to minutes, therefore we want to establish the shortest possible window

for relevant time-points of response. It's a kind of a trade-off, where we have to

experiment with different factors or parameters so that the effector and reporter genes

that are being assayed as ABA response gets interpreted without knock-on/indirect

effects over time. Pilot Experiments for transient assays were conducted to test the

system and parameters of time by GUS histochemical assay [62] and GFP reporter

enzyme assays. Both assays show good expression at 1 DPI (days post infiltration) / 24

hours, I chose 1DPI (24 hours) as my experimental time conditions.

40


I studied the efficacy of the Nicotiana benthamiana transient gene expression

system with the following three approaches using the utility of N.benthamiana model

system (as evidenced by GUS, GFP, and CAS9.

i) Pilot Experiment for transient assays: to test the system and parameters of time by GUS

histochemical assay and GFP (reporter enzyme assays)

ii) Control experiments for establishment of Nicotiana benthamiana transient assay

system at protein level, an important parameter for interpreting effector activities:

Calibration of Fluorimetric assay to GUS protein quantitation by Immunoblot

with polyclonal Antibody

iii)Validate the time point parameter of response of the effectors with an

independent vector construct p201G_Cas9

41


3.2 RESULTS AND DISCUSSION

3.2.1 Pilot Experiment for transient assays: to test the system and parameters of time

by GUS histochemical assay and GFP (reporter enzyme assays)

Since the construct that we are using is the pKYLX binary vector

(https://www.arabidopsis.org/servlets/TairObject?type=vector&id=500600073) which

has a 35S CaMV promoter driving donor cDNA expression, therefore we tested our

time parameters using pBI121 (35S:GUS) [64, 65] and pBI121_GFP as vectors for high

level transgene protein expression .

42


Figure 5: GUS Histochemical Staining of pBI121 vector (35S promoter driving GUS)

at 24 hours and at 12 hours time frame.

GUS histochemical assay [57] is a technique that is used to test and evaluate the

activity of a promoter (with respect to expression of a gene under that promoter) through

visualization of its activity in tissues. The assay is based on reporter gene beta-

glucuronidase (uidA). The most common substrate for GUS histochemical staining is 5-

bromo-4-chloro-3-indolyl glucuronide (X-Gluc).The product of this chromogenic

reaction is a blue precipitate.

35S CaMV promoter is a strong constitutive promoter in plant tissues. It drives high

levels of gene expression in both monocot and dicot plants. Nicotiana benthamiana being

dicot plant (is an ideal candidate) and also the promoter under study is the 35S promoter

both for the abi1-1 effector challenge experiments (pBI121) and experimental

constructs(pKYLX),we found high signals for this assay 24 hours post-infection (Fig. 6).

43

https://en.wikipedia.org/wiki/X-Gluc


Figure 6: GFP expression as seen by using a compound microscope (Olympus BX41) in

pBI121-Gfp driven by 35S promoter at 24 hours and at 12 hours time frame.

Findings: Since both GUS and GFP (Figs. 6 and 7) show good expression at 1

DPI (days post infiltration) / 24 hours, I chose 1DPI(24 hours) as my experimental

time conditions.

44


3.2.2 Control experiments for establishment of Nicotiana benthamiana transient assay

system at protein level, an important parameter for interpreting effector activities.

Another way of conducting GUS reporter enzyme assay is GUS fluorometric

assay. GUS activity in solution is determined with the fluorogenic substrate 4-

methylumbelliferyl β-D-glucuronide (MUG).The enzyme stability and the high

sensitivity of the GUS assay to qualitative (histochemical assay) and to quantitative

(fluorometric or spectrophotometric assay) detection underlie extensive use of uidA gene

in plant genetic transformation [58].

I endeavored to unify the readout parameters for a seamless interpretation of

"high level" gene expression. In short, how much chromogenic product (from GUS

histochemical assay) correlates to how much fluorescent product which in turn

correlates to how much protein signal that can be quantified in a western blot using a

polyclonal antibody and chemiluminescence (Fig. 8).

45


Figure 7: calibration of the fluorimeter :generate a 4MU product standard curve to know

dynamic range of instrument

46


Figure 8: Calibration of Fluorimetric assay to GUS protein quantitation by Immunoblot

with polyclonal Antibody. How much of blue colored product (in GUS histochemical

assay) correlates to how much of activity of fluorescent product which in turn correlates

to how much protein that can be quantified in a western blot. Experiment was conducted

in GV2260 strain.

47


3.2.3 p201G Cas9 (addgene)

We also wanted to validate the time point parameter of response of the effectors

with an independent vector construct p201G_Cas9 (https://www.addgene.org/59178/)

[66]. The vector p201G_Cas9 consists of two genes: namely Cas9 and GFP- both being

driven under the effect of the constitutive 35s (2x) promoter.

Figure 9: p201G Cas9 (addgene)

Jacobs et al BMC Biotechnology. 2015;15:16 https://www.addgene.org/59178/

48

https://www.addgene.org/browse/article/7014/

https://www.addgene.org/browse/article/7014/


Figure 10: GFP expression by using a UV-trans-illuminator showed fluorescence at

1DPI time point and higher fluorescence at 6DPI time point using GV2260 strain. GFP

expression as seen by using a UV-transilluminator. p201G Cas9 (addgene)

49


Figure 11: Immunoblot with anti-GFP and anti-Cas9 monoclonal antibodies for effectors

in protein extracts from Nicotiana benthamiana. Ubiquitin was used here as an internal

control and Coomassie stain were conducted as the loading control.

(A) Immunoblot with Mab anti-GFP in protein extracts from Nicotiana

benthamiana infiltrated with p201G_Cas9

(B) Immunoblot with Mab anti-Cas9 in protein extracts from Nicotiana benthamiana

infiltrated with p201G_Cas9

50


CHAPTER IV.

STUDIES ON PYL4 AND PYL7 AND ABA INDUCTION IN N. BENTHAMIANA

AND STABLY TRANSFORMED COTTON

4.1 INTRODUCTION

PYR/PYLs are ABA-receptors that function at the beginning of a negative

regulatory pathway that controls ABA sensitivity by inhibiting PP2Cs.

PYR/PYL/RCARs hence bind to and inhibit PP2Cs when bound to ABA, which allows

accumulation of phosphorylated SnRK2s (targets of PP2Cs) and subsequent activation by

phosphorylation of ABA Response Element Binding Factors (ABFs), encoded by a

family of ABI5-like basic leucine zipper TFs[11]. We are studying PYL4 and PYL7

selectively among the Pyrabactin like receptors activities in transiently transformed

Nicotiana benthamiana and stable transgenic lines of cotton (Gossypium hirsutum). We

are also studying the transient RAVs and ABI5 as references for PYL7 inductive activity.

We want to correlate their activities with respect to ABA induction effect.

We have consistent and reproducible results in both strains of Agrobacteria:

GV3101 and GV2260. I wanted to validate the system with yet other ABA –inducible

endogenous transcriptional readouts.

51


From our results we can infer and conclude AtPYL7 overexpression results

in agonist ABA signaling activity in N. benthamiana.

It is known from literature that the sorghum SbPYL gene family members were

down-regulated, apart from SbPYL1 and SbPYL7 which showed substantial up-

regulation in leaf tissues under drought stress conditions. This is turn is corroborated

by our findings [7].

52


4.2 RESULTS

4.2.1 Bidirectional clustering of Arabidopsis ABA receptor PYRL gene

expression intensity and experimental treatments/genotypes.

Figure 12: Bidirectional clustering of Arabidopsis ABA receptor PYRL gene

expression intensity and experimental treatments/genotypes.

The figure shows Bidirectional clustering of Arabidopsis ABA receptor PYRL

gene expression intensity and experimental treatments/genotypes: showing down

regulation (green) of pyl 1/4/6/14(mlp423) by 2 and 10 hr aba and drought and up-

regulation of PYL7 (red). Data extracted from A. thaliana Microarray Gene Expression

database [6].This was the rationale underlying PYL7, PYL4 and mlp423 focus for

transgenic work.

53


4.2.2 ABA induction experiment: A result at a 1 hour time-point depicting ABA

induction by Northern blot

0

0.32 1 2.33 Norm. Relative Abundance

± 0.09 ±0.03 ±0.03 ±0.04 Normalized (± S.E.M)

Figure 13: ABA induction experiment: A result at a 1 hour time-point depicting ABA

induction (by Northern blot) by probe ERD10C (a traceable and validated ABA-inducible

endogenous reporter gene) in GV3101 strain.

54


In our transient assays, we used the same readout probe that we used in our

preliminary study. We used Nicotiana tabacum ERD10C as Query and performed

BLAST alignment in sol genomics.com against N. benthamiana database and found

99% homology, verifying that interpretation of hybridization experiments would be

straightforward.

The probe was designed for NtERD10 gene.ERD10 dehydrin gene in Arabidopsis

thaliana encodes a gene induced by drought stress and belongs to the dehydrin protein

family. It is widely known that all NtERD10 genes were weakly expressed under the

normal growth conditions like that in the control plants and strongly induced by drought

and cold stresses. NtERD10 genes are target stress-inducible genes of DREB1A in

tobacco and are possibly accountable for the stress tolerance of the transgenic tobacco.

Transformation of Arabidopsis DREB1A genes in tobacco under the control of

constitutive 35S or stress-inducible rd29A promoter resulted in enhanced drought and

cold stress tolerance and constitutive expression of NtERD10, a family of genes encoding

group 2 LEA proteins [59].

55



readout NtERD10 (GV2260)

Strain GV2260: 1DPI Post Infiltration: 1DPI treatment

Size ~ 1kb

Probe:

ERD10C

0 0.72 1 2.22 0.90 1.24 1.75 0.61 0.44 Normalized Relative Abundance

± 0.05 ±0.04 ±0.05 ±0.03 ±0.04 ±0.10 ±0.04 ±0.03 ±0.09 Normalized (± S.E.M)

(A)

56


(B) Biological Replicate 2 – ERD10C probe

Biological Replicate 3 –ERD10C probe

57



readout NtERD10.

(A) The experiment was conducted in GV2260 strain of Agrobacterium. The

timescale for this experiment being 1DPI/24 hours. This experiment was repeated

for three independent biological replicates for the same probe. The normalized

relative abundances and standard error of the mean values was performed on the best

of three replicates, and this replicate was also considered for comparative analysis.

The normalized relative abundances for effector readouts are presented as the ratio of

normalized abundance that from respective ethidium bromide-stained RNA samples.

(B) These results were consistent across two more biological replicates.

58


4.2.4 Results for various effectors' activity towards transactivation of probe NtERD10

(GV3101)


Probe: ERD10C

Figure 15: Results for various effectors' activity towards transactivation of probe

NtERD10.The probe that is being used encodes a gene induced by drought stress and

belongs to the dehydrin protein family. The experiment was conducted in GV3101

strain of Agrobacterium. The timescale for this experiment being1DPI/24 hours. This

experiment was repeated for three independent biological replicates for the same probe

(data not shown).

59



readout TAS14 (GV2260)


(A) Probe: TAS14

0 0.94 1 2.4 0.47 0.90 1.90 0.94 0.66 Normalized Relative Abundance

± 0.05 ±0.06 ±0.07 ±0.03 ±0.07 ±0.04 ±0.03 ±0.09 ±0.10 Normalized (± S.E.M)

60


(B) Replicate 2 –TAS14 probe


readout TAS14.

(A) The experiment was conducted in GV2260 strain of Agrobacterium. The





The normalized relative abundances for effector readouts are presented as the ratio of

normalized abundance that from respective ethidium bromide-stained RNA samples.

(B) These results were consistent across one more biological replicate. 61


We further validated our work by using another probe namely, NtLEA [67].Late

Embryogenesis Abundant proteins (LEA proteins) are proteins in plants that protect the

plants from desiccation stress or osmotic stresses associated with low temperature.

4.2.6 Results for various effector’s activity towards transactivation of

endogenous readout LEA (GV2260)


Probe - LEA

0 0.13 1 2.35 1.45 1.95 2.36 1.77 1.36 Norm. Relative Abundance

± 0.14 ±0.02 ±0.12 ±0.02 ±0.06 ±0.02 ±0.04 ±0.03 ±0.13 Normalized (± S.E.M)

62

https://en.wikipedia.org/wiki/Protein

https://en.wikipedia.org/wiki/Desiccation

https://en.wikipedia.org/wiki/Osmotic_shock

https://en.wikipedia.org/wiki/Temperature



readout LEA.

The experiment was conducted in GV2260 strain of Agrobacterium. The





The normalized relative abundances for effector readouts are presented as the

ratio of normalized abundance that from respective ethidium bromide-stained RNA

samples.

63


Table 4 -1

Normalized SEM for three probes to validate the expression

Normalized Normalized Normalized Mean SEM ttest

Relative Relative Relative of

Abundance Abundance Abundance probes

LEA TAS14 ERD10C

0.00 0.00 0.00 0.0 0 -

0.13 0.94 0.72 0.6 0.24 -

1.00 1.00 1.00 1.0 0.08 -

2.35 2.40 2.22 2.3 0.05 0.000016

1.45 0.47 0.90 0.9 0.28 -

1.95 0.90 1.24 1.4 0.31 -

2.36 1.90 1.75 2.0 0.19 0.00544

1.77 0.94 0.61 1.1 0.35 -

1.36 0.66 0.44 0.8 0.28 -

64


Table 4-2:

Normalized SEM for 1 hour ABA induction blot

Normalized Relative Abundance SEM

0 0.09

0.32 0.03

1 0.03

2.33 0.04

65


4.2.7 Summary of comparative analysis of Fold Induction quantified by Northern blots by

three ABA-inducible endogenous reporter genes.

Figure 18:

(A) Summary of comparative analysis of Fold Induction quantified (by Northern

blots) by three independent, traceable (validated) ABA-inducible endogenous

reporter genes (ERD10C, TAS14, LEA) at 1DPI (with reference to Tables 4-

1 and 4-2).

The error bars indicate the ± S.E.M.(Standard Error of Mean) values for the

biological replicates of northern blots from these probes (n=3). For statistical

significance analysis, a two-tailed Student’s t-test was applied with unequal

variance assumed. Three asterisks (***) indicates significantly different (P < 0.001)

and (**) also indicates significantly different (where P < 0.01) compared

66


to vector only. Both PYL7 and RAV1 had significantly different readouts than

vector only control. These results were consistent across all three probes and their

biological replicates.

(B) ABA induction experiment: An independent result at a different time point (1

hour) depicting ABA induction (by Northern blot) by probe ERD10C (a

traceable and validated ABA-inducible endogenous reporter gene).

(C) Both Figures A and B in conjunction validate that the fold induction depicted by

vector +ABA is comparable to the fold induction of effectors of ABA signaling,

viz, RAV1 (transcription factor) and PYL7 (receptor) per se.

67


4.2.8 Positive Control immunoblot for c-myc Mab C9E10

PROTEIN QUANTITATION by Immunoblot: to validate and substantiate our

transient assay system

1 2 3

Lane 1 – RAV1 construct, Nicotiana benthamiana total protein extract

Lane 2 - Untreated /non infiltrated Nicotiana benthamiana total protein

Lane 3 – Thermo Scientific Pierce c-Myc-tagged Positive Control 1mg/mL, E. coli extract

containing c-Myc tagged GST fusion protein(26kDa in size)

Figure 19: Positive Control immunoblot for c-myc Mab C9E10. 15 % SDS PAGE gel –

15ug loading each lane

68


4.2.9 Immunoblot with Monoclonal antibody c-myc for effectors in protein extracts from

N.benthamiana

69


Figure 20: Immunoblot with Monoclonal antibody c-myc for effectors in protein

extracts from Nicotiana benthamiana. Ubiquitin was used here as an internal control and

Coomassie stain was conducted as the loading control

4.2.10 Approach for phenotypic segregations in PYL cotton stable transgenics

PYL stable transgenics - Transformation and regeneration of the Pyrabactin gene

constructs in the elite Coker312 variety of cotton completed. Our aim is to conduct c-myc

Western assays for cotton tissues to establish the post translational molecular phenotypes

for correlation between effector expression in independent events and any observed

phenotypes. We also want to study the potential impact of these transgenes on agronomic

traits in cotton. Screening of T1 cotton seedlings was done on Stewart’s Germination

media supplemented with 50 μg/ml Kanamycin .Wild type Coker 312, showing no lateral

root development in all control seedlings, whereas ~ 3:1 segregation for kanamycin

resistance gene in the transgenic lines.

70


Figure 21: Image demonstrates the junction between tap root and hypocotyls

71


Figure 22: Screening of T1 cotton seedlings on Stewart’s Germination media

supplemented with 50 μg/ml Kanamycin

72


Figure 23: Establishment of plantlets in soil

73


Figure 24: T2 Plants in Greenhouse after screening for transgene with kanamycin

74


Preliminary Physiological Phenotypes: PYL stable transgenics

(A)

75


(B)

76


(C)

77


Figure 25: Preliminary Physiological Phenotypes: Showed Better developed lateral root

system and longer internode lengths under greenhouse conditions for the kanamaycin-

selected transgenic lines. Also increased weight of fiber with seed (grams) and increased

number of bolls.

(A) Growth of plants after 4 months of full irrigation - All ten PYL4 lines, showed

such phenotypes

(B) Growth of plants after 4 months of full irrigation - All ten PYL7 lines, showed such

phenotypes

(C) Growth of plants after 4 months of full irrigation - All ten mlp423 lines, showed such

phenotypes

78


4.3 DISCUSSION

We have consistent and reproducible results in both strains of Agrobacteria:

GV3101 and GV2260 .Traditionally, Gv2260 strain is used for N. benthamiana and

GV3101 is used for Arabidopsis. However, in recent years, there has been several

studies conducted in N. benthamiana well with the GV3101 strain [60, 62, 64].

But, I wanted to validate the system with yet other endogenous transcriptional

readout. I designed a probe for TAS14 marker gene.TAS14 is a dehydrin gene that

accumulates in response to mannitol, NaCl or ABA treatment [65, 66, 67]. We used

Nicotiana tabacum TAS14 as Query and performed BLAST alignment in sol

genomics.com against N. benthamiana database and found significant

homology matches.

AtPYL7 overexpression results in agonist ABA signaling activity in N.

benthamiana. This is further substantiated by the fact that PYL7 overexpression results in

similar agonist activity as the ABA induction effect in Figure 17B.This is also validated

by comparative data analysis showing statistical significance. For PYL7 agonist activity,

the results were significantly different at P < 0.01.Similar results were obtained in terms

of AtRAV1 (a known ABA effector by our prior work), which also showed similar

agonist activity as the ABA induction effect. For the RAV1, the results were significantly

different at P < 0.001.These data suggest as evidence that these effectors result in agonist

ABA activity in N.benthamiana assays and hence enables us to functionally characterize

the various effectors of ABA signaling pathway in this transient system.

79


The results support and is validated by previous literature that SbPYL gene

family members were down-regulated, apart from SbPYL1 and SbPYL7 which showed

substantial up-regulation in leaf tissues under drought stress conditions[7].

Protein expression for these effectors to functional effects via immunoblots

confirmed that - these data together at the transcriptional and translational levels support

the claim that Nicotiana benthamiana transient assays are a robust and facile system to

functionally characterize the various effectors of ABA signaling pathways and study their

molecular interactions.

For further future work, the stable cotton transgenics could be characterized for

further insightful studies at the molecular level. Molecular characterization of the PYL

(PYL4, PYL7 and mlp423) stable transgenic cotton lines by analyzing readouts both at

the transcriptional (via northern blots) and translational level (via western blots) could be

carried out

If we can exploit the rapid and robust nature of N.benthamiana assays to

functionally characterize the ABA receptors (and transcription factors), then results can

be translated to stable transformation of crops like upland cotton (Gossypium hirsutum) to

gain deeper insights into the utility of ABA receptors. Our overall goal is for deeper

understanding of efficacy and molecular mechanisms of deeply conserved ABA gene

effectors by characterization in heterologous systems (both transient and stable).

80


CHAPTER 5

CHARACTERIZATION OF RAV1 AND ABI5 DROUGHT-STRESS

PHENOTYPES IN COTYLEDONS AND LEAVES OF TRANSGENIC COTTON

5.1 INTRODUCTION TO THE STUDY AND BACKGROUND

Restricted water availability is one of the major abiotic factors impacting

crop production worldwide. Significant efforts have been taken to enhance drought

tolerance (high water use efficiency, osmotic adjustment) and avoidance (early flowering,

increased root biomass) traits [68, 69] in crop plants through two main approaches: 1)

traditional plant breeding at the scale of whole plants (so called ‘top-down’ approaches),

and 2) advanced bioengineering at the scale of individual genes (so called ‘bottom-up’

approaches) [70] .While advances have been made in the development of drought-

tolerant cultivars, knowledge about the metabolic and physiological traits that

functionally contribute to the drought-tolerant phenotypes remains limited.

Understanding how genotypes produce a given phenotype will contribute towards closing

the gap between the top-down and bottom-up approaches [71], and may facilitate

development of efficient protocols for screening candidate drought-tolerant cultivars [72].

Genomic and genetic analyses primarily of the model plant Arabidopsis thaliana (L.

81


Heynh.) have elucidated the biosynthetic and signal transduction pathways of abscisic

acid (ABA) and its roles in stress response. Similarly, transgenic cotton (Gossypium

hirsutum L.) lines have been generated that over-express the basic leucine zipper domain

transcription factor AtABA-INSENSITIVE5 [73] and Basic3/APETALA2-domain

transcription factors of the Related to ABI3/Viviparous1 (RAV) clade AtRAV1,

AtRAV2/TEMPRANILLO2, and AtRAV2L/TEMPRANILLO1.

The resultant cotton transgenics expressing AtRAV1, AtRAV2, and AtABI5 showed

many genetic and morphological responses, including altered environment-regulated and

fiber-associated gene expression, delayed flowering time, increased water use

efficiency, and greater root biomass and fiber length under drought irrigation stress in

the greenhouse and field [59, 62].

Hypothesis:

Our initial hypothesis was the transgenic lines would exhibit drought tolerance

through an enhanced responsiveness to ABA, because previous research has shown that

these transgenes are effectors of (i.e., downstream respondents to endogenous) ABA.

Hence, the hypothesis is that over-expression of AtRAV1 resulted in an ABA-

hypersensitive phenotype manifest as lower levels of endogenous ABA in cotyledons

associated with greater reductions in pore apertures during stress and increased stomatal

density. Therefore, the transgenic lines may have enhanced responses to abscisic acid

(ABA), resulting in greater water use efficiency under drought stress.

82


Objective:

To characterize RAV1 and ABI5 expression at the protein level in seeds and to address

mechanisms of drought tolerance and adaptation by morphological and physiological

assays of cotyledonary leaves and greenhouse-grown plants subjected to drought stress.

5.2 RESULTS

5.2.1 Characterization of transgene protein accumulation in cotton seeds

Previous work showed high levels of mRNA expression in leaves and

developing ovules for the ABI5 and RAV1 transgenes driven by the 35S promoter

[59, 62], so we endeavored to validate transgene protein accumulation in the events

under study.

Immunoblot of proteins extracted from seeds of transgenic ABI5 and

RAV1 overexpressing lines and from leaves of Nicotiana benthamiana transiently

transformed with Agrobacterium harboring the same T-DNA vector for production of

RAV1 stable cotton transformants. Immunoblot probed with monoclonal anti c-myc

antibody. c-myc:ABI5 protein expected size is 61 kDa; c-myc:RAV1 protein expected

size is 52 kDa. Same blot probed with anti-ubiquitin antibody, as loading control.

Coomassie-stained gel.

83


84

0 126.7 121.1 1 3 1.2 14.1 58.1 100 Norm Relative Abundance

± 0.03 ± 0.02 ±0.01 ± 0.07 ±0.03 ±0.01 ±0.09 ±0.12 ±0.01 Normalized(±S.E.M.)

± 0.03 ±0.02 ±0.01 ±0.07 ±0.03 ±0.01 ±0.09 ±0.12 ±0.01 Normalized (± S.E.M)


Figure 26: Immunoblot with Mab c-myc for effectors in seed protein extracts

from cotton stable transgenics. Study of established cotton lines as in [59,61] for protein

level allelic variations. The normalized relative abundances for effector protein readouts

are presented as the ratio of normalized abundance that from respective ubiquitin control

samples. Whereas there is not much quantitative variation between each of the

independent events of ABI5 and RAV1 cotton lines. There seems to substantial variation

in the expression profile of the three independents events pertaining to RAV2L lines.

This may be correlated with our previous work at the physiological level [59,61].Cotton

seed plus fiber yield/plant (in grams) of transgenics compared to wild type under well-

watered greenhouse conditions was highest in 40-24-2-1 >40- 4-2-1> 40-23-4-4.Also in

studies of Late boll cracking in transgenic lines 99 days after sowing (DAS) treatments in

the field – it was found that the percent Cracked Bolls was significantly higher in 40-24-

2-1 both in under well watered (WW) and deficit irrigation (DI),and the percent cracked

bolls was lowest in 40-23-4-4 (40-24-2-1 >40- 4-2-1> 40-23-4-4).

85


5.2.2 RAV11-1-5

cotyledonary leaves have higher stomatal density and smaller guard

cell apertures during drought stress and recovery (data contributed by Dr. Justin Fiene)

Guard cell pores (i.e., stomatal apertures) are the primary means of water loss and

CO2 uptake in plants. Recent work has revealed that guard cell ABA sensitivity increases

as the leaf ages, and ABA controls plasticity of stomatal patterning in cotyledons [74, 75,

76, 77]. Since our prior work with these ABI5 and RAV1 transgenic cotton lines found

transgene effects on photosynthesis and stress response physiology, we measured

stomatal density and apertures in cotyledons. Figure shows that the RAV11-1-5

overexpression line had significantly more stomata on the abaxial side of cotyledons than

Coker312, and that ABI51-1-1

genotype trended toward higher stomatal density.

Drought stress conditions cause guard cell pores to shrink in size (literally area as

measured, μm2) to minimize water loss, and to increase in size during drought recovery

to promote uptake of CO2, thereby enhancing photosynthetic capabilities. Guard cell

pores can change in two different ways when observed in two dimensions by microscopic

analysis of epidermal casts: (i) the area (μm2) of the guard cells (i.e., stomata) per se

could change by fluctuations in plant turgor pressure, with the pore area (μm2) changing

proportionally, or (ii) the area (μm2) of guard cell pores might change differently with

respect to the overall size of the guard cells. To tease apart the two different possibilities

86


for changes in guard cell pores, we quantified the area of both guard cells and their pores,

and analyzed the relationship between pore size and guard cells (i.e., pore area / guard

cell area).

Figure 27: Stomatal densities on abaxial side of 13-day-old cotyledons of Coker 312 and

ABI5 and RAV1 overexpressing transgenics. Bars represent mean density ± S.E.; n= 11-12

individual plants per genotype, seven to eight images per plant. Asterisk (*) indicates

87


significantly different (P < 0.00001) from Coker312 control (this data is contributed

by Dr. Justin Fiene)

5.2.3 RAV11-1-5

and ABI51-1-1

mature leaves have higher stomatal conductance and

photosynthetic rates under drought stress (data contributed by Dr. Amandeep Mittal)

To extrapolate the working hypothesis from cotyledonary to mature leaves, we

directly measured photosynthetic parameters including stomatal conductance in five-

week-old greenhouse-grown plants, and the results are shown in Fig. 28. Coker 312

(wild-type) plants had a strong wilting phenotype in the afternoon of day four after

withholding water (data not shown). This strong drought stress resulted in significant and

progressive inhibitory effects on stomatal conductance and photosynthesis, which were

partially relieved after two days of re-watering. The ABI51-1-1

transgenic line showed

significantly higher stomatal conductance (95% higher; P < 0.05) and photosynthetic

yields (75% higher; P < 0.05) at six days of drought (Fig. 28) and under drought stress

did not show wilting symptoms (data not shown), as previously shown [59] .The RAV11-

1-5 transgenic line at six days of drought showed a significantly higher stomatal

conductance rate (80% higher; P < 0.05) and higher photosynthetic rates (34% higher)

than Coker 312. Photosynthesis at six days of drought in ABI513-4-1

was strongly

88


inhibited, similar to that of Coker 312, while stomatal conductance trended higher

than Coker 312, consistent with lower ABI5 protein levels seen in seeds (Fig. 26).

89


Figure 28: Timecourse over six days of drought stress and recovery of five-week old

greenhouse-grown transgenic cotton (Gossypium hirsutum L.) over-expressing AtABI5

or AtRAV1. (A) Stomatal conductance rates and (B) photosynthetic assimilation.

Abbreviations: nD-Drt, n= 3,5, or 6 days of drought; nD-Rec, n days recovery from

drought after re-watering. Bars represent means ± S.E.; n = 3-6 on control, 3D-Drt, 5D-

Drt and 1D-Rec; n = 6-12 on 6D-Drt; n = 2-6 on 2D-Rec. Asterisk (*) indicates

significantly different (P < 0.05) than Coker312 (this data is contributed by Dr.

Amandeep Mittal)

5.3 DISCUSSION

Among the three transgenic lines, RAV11-1-5

had the lowest ABA levels during

drought stress compared to control Coker312. The evidence showing RAV11-1-5

plants had

higher stomatal conductance and photosynthesis rates. Our initial hypothesis was the

transgenic lines would exhibit drought tolerance through an enhanced responsiveness to

ABA, because previous research has shown that these transgenes are effectors of (i.e.,

downstream respondents to endogenous) ABA. Somewhat unexpectedly, despite smaller

pore spaces and stomatal opening, the cotyledons of AtRAV and AtABI5 transgenics had

90


increased stomatal conductance, transpiration and hence transpirational cooling. We

found evidence of a drought tolerance phenotype in ABI51-1-1

based on lower ABA

levels, lower LST, and higher stomatal conductance and photosynthetic rates than control

Coker312. However, we were unable to strictly correlate this phenotype with apparent

ABI5 protein expression (in seeds, Fig.26) or changes in stomatal density (Fig. 27) or

guard cell pore sizes , which suggests there may exist alternative mechanisms for drought

tolerance/avoidance in ABI51-1-1

than postulated for AtRAV1 in this study. The results

of this study suggest that over-expression of RAV11-1-5

can result in drought tolerance

through adaptive hypersensitive responses of guard cells to endogenous ABA. Given that

[59, 62] also found drought avoidance in RAV11-1-5

through greater root dry biomass, it

is possible that over-expression of RAV11-1-5

influences multiple plant traits which each

contribute to different facets of a complex of drought adaptation phenotypes. Since over-

expression of capsicum RAV1 in Arabidopsis results in enhanced resistance to a

pathogen known to infect hosts through guard cell pores, RAV1 may be a promising

target to impact crop resistance to biotic and abiotic stresses.

91


CHAPTER VI. CONCLUSION AND FUTURE DIRECTIONS

6.1 CONCLUSION

To summarize my findings, I would submit that to develop a transient assay

system for ABA induction in the shortest possible time frame allows us to functionally

characterize effectors of ABA signaling pathway and the modules or switches. This

system can be useful in many ways to study various ABA responsive genes. From the

very onset of the project, the idea was to conduct the experiment in the shortest possible

time as ABA responses are elicited in matter of seconds. Hence it was a trade off from

the very beginning, where I had to balance and weigh various parameters and factors so

that the effector and reporter genes that are being assayed as ABA response gets

interpreted without knock-on/indirect effects over time.

PYR/PYLs are ABA-receptors that function at the beginning of a negative

regulatory pathway that controls ABA sensitivity by inhibiting PP2Cs.

PYR/PYL/RCARs hence bind to and inhibit PP2Cs when bound to ABA, which allows

accumulation of phosphorylated SnRK2s (targets of PP2Cs) and subsequent activation by

phosphorylation of ABA Response Element Binding Factors (ABFs), encoded by a

family of ABI5-like basic leucine zipper TFs[11]. We are studying PYL4 and PYL7

selectively among the Pyrabactin like receptors activities in transiently transformed

Nicotiana benthamiana and stable transgenic lines of cotton (Gossypium hirsutum). I

92


have also studied the transient RAVs and ABI5 as references for PYL7 inductive

activity. I wanted to correlate their activities with respect to ABA induction effect.

We have consistent and reproducible results in both strains of

Agrobacteria: GV3101 and GV2260. I wanted to validate the system with other

ABA –inducible endogenous transcriptional readouts.

We got interpretable results of this transient assay at the protein level as well.

This was a very important exercise as until effector proteins were quantified, the activity

is not normalized to the cellular context, In that case, the transient assay will not help us

much in this aspect. If effector proteins were unstable or poorly expressed, this could

reflect unwanted pleiotropic effect, possible post translational modifications. In the

future, this established system will allow us to test various genes and effectors of the

ABA signaling pathway at a transient level, before moving on to stable transgenics. This

would be immensely beneficial in terms of understanding transcriptional and

translational read outs, in turn allowing us to interpret and propagate the results in stable

transgenics properly.

ABA directly affects guard cell physiology, and in our study guard cell pores of

RAV11-1-5

were 26% smaller than control Coker312. Interestingly, after correcting for

the size of the guard cells, the guard cell pores were disproportionally smaller (19%) than

control Coker312 . Hypersensitivity to ABA through over-expression of RAV1 showed

that exogenous ABA applied to Arabidopsis lines over-expressing a heterologous RAV1

resulted in ABA-hypersensitive inhibition of germination and root elongation. This result

is intriguing in light of our data showing smaller guard cell pores in over-expressing

93


AtRAV1 cotton plants, and begs the question of whether smaller guard cell pores in

Arabidopsis lines over-expressing RAV1 explain their enhanced resistance to pathogen

infection. Moreover, guard cell pores serve many critical functions in plants (i.e., water

loss, CO2 uptake, and pathogen susceptibility) .RAV1 transgenics may have value for the

development of drought-tolerant and pathogen-resistant crop varieties.

The “less stressed” phenotypes observed for AtRAV11-1-5

could be due to better

water use through disproportionally smaller guard cell pores. In [59,62] found an

additional mechanism of drought avoidance in RAV11-1-5

by showing that drought-

stressed plants grew ~80% more root dry biomass in the greenhouse than Coker 312. We

have also observed a late flowering phenotype of these AtRAV1 and AtRAV2 over-

expressing cotton lines [59, 62], supporting the drought avoidance mechanism. Taken

together, the “less stressed” phenotype by RAV11-1-5

may therefore be due to multiple

mechanisms of drought avoidance (late flowering, greater root biomass) and drought

tolerance (improved water use efficiency through stomatal regulation and attendant

increases in photosynthesis) (Fig. 28). Evidence of drought-avoidance traits in ABI51-1-1

[59, 62]. Under drought-stress conditions in the field, ABI51-1-1

had larger leaf area, root

biomass, and in greenhouse conditions longer internode length and greater yield than

control Coker 312, respectively. Furthermore, stacked transgenic lines from crosses

between ABI5 and AtRAV1 and AtRAV2 showed synergy in plant yield, among other

responses. It seems possible therefore that multiple mechanisms of drought tolerance and

avoidance exist in ABI5 and RAV1 lines studied here, which could potentially explain

why stacked transgenic lines of ABI5 plus RAVs showed synergies in some, but not all,

characterized phenotypes.

94


6.2 FUTURE DIRECTIONS

Approach to study functional interactions of ABI1 (ABA-INSENSITIVE 1) with PYL4/7

Future studies can be conducted to validate the observed candidate AtPYL4/7

activities as specific for ABA signaling per se by functional interaction with an

engineered abi1-1 dominant negative effector construct in transient assays, like has

been done before in protoplasts [55, 59].

Functional interaction studies of ABI1(ABA-INSENSITIVE 1) with PYL4/7 in

Nicotiana benthamiana by co-infiltration, and then getting the read outs both at the

transcriptional and translational level. In this study, my goal is to test the abi1-1 T-DNA

effector construct in pBI121 backbone [86].Arabidopsis ABI1 gene encodes a member of

the 2C class of protein serine/threonine phosphatases (PP2C), and the abi1-1 mutation

strikingly reduces ABA responsiveness in both seeds and vegetative tissues. However,

this mutation is dominant and has been the lone mutant allele accessible for ABI1 gene. A

loss of ABI1 PP2C activity leads to an enhanced responsiveness to ABA. Hence, the

wild-type ABI1 phosphatase is a negative regulator (suppressor) of ABA responses [87].

PP2Cs being monomeric enzymes can be more easily used for functional characterization

studies. Scores of Arabidopsis PP2Cs have the conserved Glycine amino acid residues

(aa174 and aa180 of ABI1 protein) that are necessary for phosphatase and ABA signaling

activity [88, 89], signifying that they too could function in ABA and/or stress responses

in plants. Previously, the phosphatase active site has been mutated (G174D) to express a

null mutant [57].The conserved Glycine residue at amino acid location 180 of ABI1 is

95


vital for ABA signaling and the G180→D mutation results in dominant-negative alleles

for ABI1 (G168D) .This means that G180D point dominant-negative mutation is

functionally negative but phenotypically dominant. In others words, this mutant when

functional it should behave like the wild type, but phenotypically its activity should be

low, due to the mutation being present. The semi-dominant abi1-1 alleles is a missense

mutation of a conserved Glycine residue to Aspartic Acid (G180D in abi1-1) that result in

a dominant negative phenotype in vivo and reduced phosphatase activities in vitro [57,

88].

The point mutation of PYR1 P88S severely compromises the physical interaction

between PYR1 and HAB1, but it does not hamper the ABA binding to PYR1 – which

establishes the fact that ABA binding can be uncoupled from PP2C inhibition [11].

Structural biology studies are consistent with this – which shows that Proline-88 (which

is invariant in the family and is located in the PYR1’s gate domain) is positioned to

make direct interaction with PP2Cs in response to ABA [26, 89, 90]. Moreover, the

dominant/hypermorphic abi1-1(ABI1^G180D) and abi2-1 (ABI2^G168D) encoded

mutant proteins do not bind PYR1 in response to ABA. This observation suggested that

their hypermorphic activity arises because they cannot be inhibited by PYR/PYL/RCAR

proteins in response to ABA. Also, the mutations in the hypermorphic ABI proteins map

close to the docking site of PYR/PYL proteins as revealed by X-ray structures.

96


Future Study of tissue-specific expression of the transgenes of RAVs and

ABI5 established cotton lines

An interesting area of study can be to characterize by immunoblot the

established AtRAV1, AtRAV2, AtABI5, and AtRAV2L transgenic cotton lines

described in [58] for effector protein level allelic variations, in order to test for

correlation to observed physiological phenotypes of multiple transgene events. For

established RAV & ABI5 cotton lines, try tissue-specific expression of the transgenes in

seed (already completed), stem, root and leaf in cotton.

A Computational Approach to characterize selective interactions of GhPYL4

and GhPYL7 with GhPP2C members:

Another approach of study can be to try computationaly to characterize selective

interactions of GhPYL4 and GhPYL7 with GhPP2C members: To demonstrate that

GhPYLs bind to GhPP2Cs in wide-ranging manner and with divergent intensities and to

show that the ABA-sensing machinery is preserved among diverse plant species. Now

that the tetraploid upland cotton genome has been recently published, we can

computationally predict the Pyrabactin Resistance-Like PYL4 and PYL7 Abscisic Acid

Receptor in Cotton. This will also help us to characterize their tissue-specific and stress-

responsive expressions compared to the results from other species like Arabidopsis.

97


Molecular characterization of the PYL (PYL4, PYL7 and mlp423) stable transgenic

cotton lines

The stable transgenic cotton lines can be characterized and studied. Molecular

characterization of the PYL (PYL4, PYL7 and mlp423) stable transgenic cotton lines

by analyzing readouts both at the transcriptional (via northern blots) and translational

level (via western blots).

Test in the transient system the ABA signaling activities of other Arabidopsis PYL

family members

Other effectors can be functionally characterized for their readouts in this

transient system. Test in the transient system the ABA signaling activities of other

Arabidopsis PYL family members AtPYR1 (univector donor U15941), AtPYL1

(U18010), AtPYL5 (U13617), AtPYL6 (U50118), AtPYL8.2 (U23619), AtPYL9

(U22850), and AtPYL10 (C103436) on endogenous ABA signaling pathway

ERD10C transcriptional readouts.

Co-immunoprecipitation experiments to show that PYL7 binds a PP2C

Co-immunoprecipitation experiments could also be designed to show that

PYL7 binds a PP2C. A co-immunoprecipitation approach to validate the PP2C subunit

binds with PYL7 in transient Nicotiana benthamiana assays.

98


Regulation of ABA catabolism and ABA sensitivities per se in the RAV and ABI5 cotton

transgenic lines

Among the three cotton transgenic lines, RAV11-1-5

had the lowest ABA levels

during drought stress compared to control Coker312. The evidence showing RAV11-1-5

plants had higher photosynthesis rates (Figure 28), and support a “less stressed”

phenotype under drought stress, which agrees with previous results [59,62]. However, all

three transgenic lines had higher ABA levels than Coker312 during drought recovery,

raising questions about regulation of ABA catabolism and ABA sensitivities per se and

activities of known ABA homeostatic feedback loop Further studies using 18

O2 to

quantify metabolic fluxes to and from ABA in the transgenics could shed light on this

issue.

99


References:

1. Leung J., Giraudat J.(1998) Abscisic acid signal transduction. Annual Review of

Plant Biology.1998;49(1):199–222.

2. Fan, W., Li, J., Jia, J., Wang, F., Cao, C., Hu, J., & Mu, Z. (2015). Pyrabactin

regulates root hydraulic properties in maize seedlings by affecting PIP

aquaporins in a phosphorylation-dependent manner. Plant Physiology and

Biochemistry, 94, 28-34.

3. Finkelstein, R. R., Gampala, S. S. L., & Rock, C. D. (2002). Abscisic Acid

Signaling in Seeds and Seedlings. The Plant Cell, 14(Suppl), s15–s45.

4. Antoni, R., Gonzalez-Guzman, M., Rodriguez, L., Peirats-Llobet, M., Pizzio, G.

A., Fernandez, M. A.,& Rodriguez, P. L. (2013). Pyrabactin resistance1-like8

plays an important role for the regulation of abscisic acid signaling in root. Plant

physiology, 161(2), 931-941.

5. Lim, C. W., Luan, S., & Lee, S. C. (2014). A prominent role for RCAR3-

mediated ABA signaling in response to Pseudomonas syringae pv. Tomato

DC3000 infection in Arabidopsis. Plant and Cell Physiology

6. Matsui A., Ishida J., Morosawa T., Mochizuki Y., Kaminuma E., Endo T. A., et al.

(2008). Arabidopsis transcriptome analysis under drought, cold, high-salinity and

ABA treatment conditions using a tiling array. Plant Cell Physiol. 49 1135–1149.

7. Monika Dalal , Madhuri Inupakutika (2014) Transcriptional regulation of ABA

core signaling component genes in sorghum (Sorghum bicolor L. Moench). Short

Communication. Molecular Breeding, Volume 34, Issue 3, pp 1517-1525 100


8. Yamburenko, M; Zubo, Y; Boerner, T (2015) Abscisic acid affects transcription of

chloroplast genes via protein phosphatase 2C-dependent activation of nuclear

genes: repression by guanosine-3-5-bisdiphosphate and activation by sigma factor

5 .Plant journal volume: 82 issue: 6 pages: 1030-1041

9. Hayashi, Y; Takahashi, K; Inoue, S (2014) Abscisic Acid Suppresses Hypocotyl

Elongation by Dephosphorylating Plasma Membrane H+-ATPase in

Arabidopsis thaliana Plant and Cell Physiology Volume: 55 Issue: 4 Special

Issue: SI Pages: 845-853

10. Ma, Y., Szostkiewicz, I., Korte, A., Moes, D., Yang, Y., Christmann, A., &

Grill, E. (2009). Regulators of PP2C phosphatase activity function as abscisic

acid sensors. Science, 324(5930), 1064-1068.

11. Park, S.-Y., Fung, P., Nishimura, N., Jensen, D. R., Fujii, H., Zhao, Cutler, S.

R. (2009). Abscisic acid inhibits PP2Cs via the PYR/PYL family of ABA-

binding START proteins. Science (New York, N.Y.), 324(5930), 1068–1071.

12. Santiago, J., Rodrigues, A., Saez, A., Rubio, S., Antoni, R., Dupeux, F. &

Rodriguez, P. L. (2009). Modulation of drought resistance by the abscisic

acid receptor PYL5 through inhibition of clade A PP2Cs. The Plant Journal,

60(4), 575-588.

101


13. Cutler, S. R., Rodriguez, P. L., Finkelstein, R. R., & Abrams, S. R. (2010).

Abscisic acid: emergence of a core signaling network. Annual Reviews

Plant Biology, 61, 651-679.

14. Lim, C; Baek, W; Jung, J (2015) Function of ABA in Stomatal Defense against

Biotic and Drought Stresses International Journal of Molecular Sciences

Volume: 16 Issue: 7 Pages: 15251-15270

15. Yoshida, T; Mogami, J; Yamaguchi-Shinozaki, K (2015) Omics Approaches

Toward Defining the Comprehensive Abscisic Acid Signaling Network in

Plants Plant and cell physiology Volume: 56 Issue: 6 Pages: 1043-1052

16. Gonzalez-Guzman, M., Pizzio, G. A., Antoni, R., Vera-Sirera, F., Merilo, E.,

Bassel, G. W. Rodriguez, P. L. (2012). Arabidopsis PYR/PYL/RCAR Receptors

Play a Major Role in Quantitative Regulation of Stomatal Aperture and

Transcriptional Response to Abscisic Acid. The Plant Cell, 24(6), 2483–2496.

17. Shen, Y. Y., Wang, X. F., Wu, F. Q., Du, S. Y., Cao, Z., Shang, Y. & Fan, R.

C. (2006). The Mg-chelatase H subunit is an abscisic acid receptor. Nature,

443(7113), 823-826.

18. Wu, F. Q., Xin, Q., Cao, Z., Liu, Z. Q., Du, S. Y., Mei, C. & Zhang, X. F.

(2009). The magnesium-chelatase H subunit binds abscisic acid and functions in

abscisic acid signaling: new evidence in Arabidopsis. Plant physiology, 150(4),

1940-1954.

102


19. Liu, X., Yue, Y., Li, B., Nie, Y., Li, W., Wu, W. H., & Ma, L. (2007). AG

protein-coupled receptor is a plasma membrane receptor for the plant hormone

abscisic acid. Science, 315(5819), 1712-1716.

20. Pandey, S., Nelson, D. C., & Assmann, S. M. (2009). Two novel GPCR-type G

proteins are abscisic acid receptors in Arabidopsis. Cell, 136(1), 136-148.

21. McCourt, P., & Creelman, R. (2008). The ABA receptors–we report you decide.

Current opinion in plant biology, 11(5), 474-478.

22. Merilo, E; Laanemets, K; Hu, H (2013) Pyr/Rcar Receptors Contribute to Ozone-

, Reduced Air Humidity-, Darkness-, and CO2-Induced Stomatal Regulation

Plant Physiology Volume: 162 Issue: 3 Pages: 1652-1668

23. Geiger D (2009) Activity of guard cell anion channel SLAC1 is controlled by

drought-stress signaling kinase-phosphatase pair. Proc Natl AcadSci USA

106(50): 21425–21430

24. Brandt, B; Brodsky, D; Xue, S (2012) Reconstitution of abscisic acid activation of

SLAC1 anion channel by CPK6 and OST1 kinases and branched ABI1 PP2C

phosphatase action Proceedings of the National Academy of Sciences of the

United states of America Volume: 109 Issue: 26 Pages: 10593-10598

25. Demir, F., Horntrich, C., Blachutzik, J. O., Scherzer, S., Reinders, Y.,

Kierszniowska, S. & Kreuzer, I. (2013). Arabidopsis nanodomain-delimited ABA

signaling pathway regulates the anion channel SLAH3. Proceedings of the

National Academy of Sciences, 110(20), 8296-8301.

103


26. Miyazono, K. I., Miyakawa, T., Sawano, Y., Kubota, K., Kang, H. J., Asano,

A. & Yoshida, T. (2009). Structural basis of abscisic acid signalling. Nature,

462(7273), 609-614.

27. Fujita, Y; Yoshida, T; Yamaguchi-Shinozaki, K (2013) Pivotal role of the

AREB/ABF-SnRK2 pathway in ABRE-mediated transcription in response to

osmotic stress in plants Physiologia Plantarum Volume: 147 Issue: 1Special Issue:

SIPages: 15-27

28. Park, SY; Peterson, F.; Mosquna, Assaf (2015) Agrochemical control of plant

water use using engineered abscisic acid receptors Nature Volume: 520 Issue:

7548 Pages: 545

29. Zhang, X L.; Jiang, L; Xin, Q (2015) Structural basis and functions of abscisic

acid receptors PYLs Frontiers In Plant Science Volume: 6 Article Number:88

30. Castillo, M. C., Lozano-Juste, J., González-Guzmán, M., Rodriguez, L.,

Rodriguez, P. L., & León, J. (2015). Inactivation of PYR/PYL/RCAR ABA

receptors by tyrosine nitration may enable rapid inhibition of ABA signaling by

nitric oxide in plants. Sci. Signal., 8(392), ra89-ra89.

31. Scuffi, D., Álvarez, C., Laspina, N., Gotor, C., Lamattina, L., & García-Mata, C.

(2014). Hydrogen sulfide generated by l-cysteine desulfhydrase acts upstream of

nitric oxide to modulate abscisic acid-dependent stomatal closure. Plant

physiology, 166(4), 2065-2076.

104


32. Tian, X; Wang, Z; Li, X (2015) Characterization and Functional Analysis of

Pyrabactin Resistance-Like Abscisic Acid Receptor Family in Rice. Rice

(New York, N.Y.) Volume: 8 Issue: 1 Pages: 28

33. Wang, Y. G., Yu, H. Q., Zhang, Y. Y., Lai, C. X., She, Y. H., Li, W. C., & Fu, F.

L. (2014). Interaction between abscisic acid receptor PYL3 and protein

phosphatase type 2C in response to ABA signaling in maize. Gene, 549(1), 179-

185.

34. Zhao, Y; Xing, L; Wang, X (2014) The ABA Receptor PYL8 Promotes Lateral

Root Growth by Enhancing MYB77-Dependent Transcription of Auxin-

Responsive Genes Science Signaling Volume: 7 Issue: 328

35. Vilela, B., Pagès, M., & Riera, M. (2015). Emerging roles of protein kinase CK2

in abscisic acid signaling. Frontiers in plant science.

36. Bueso, E., Rodriguez, L., Lorenzo‐Orts, L., Gonzalez‐Guzman, M., Sayas, E., Muñoz‐

Bertomeu, J. & Rodriguez, P. L. (2014). The single‐subunit RING‐type E3 ubiquitin ligase RSL1 targets PYL4 and PYR1 ABA receptors in plasma membrane to modulate abscisic acid signaling. The Plant Journal, 80(6), 1057-1071.

37. Van Overtveldt, M., Heugebaert, T. S. A., Verstraeten, I., Geelen, D., & Stevens,

C. V. (2015). Phosphonamide pyrabactin analogues as abscisic acid agonists.

Organic & biomolecular chemistry, 13(18), 5260-5264.

38. Benson, C. L., Kepka, M., Wunschel, C., Rajagopalan, N., Nelson, K. M.,

Christmann, A.,& Loewen, M. C. (2015). Abscisic acid analogs as chemical

105


probes for dissection of abscisic acid responses in Arabidopsis thaliana.

Phytochemistry, 113, 96-107.

39. Joshi-Saha, A., Valon, C., & Leung, J. (2011). A brand new START: abscisic acid

perception and transduction in the guard cell. Science signaling, 4(201).

40. Waadt, R; Manalansan, B; Rauniyar, N(2015) Identification of Open Stomatal-

Interacting Proteins Reveals Interactions with Sucrose Non-fermenting1-

Related Protein Kinases2 and with Type 2A Protein Phosphatases That Function

in Abscisic Acid Responses Plant physiology Volume: 169 Issue: 1 Pages: 760

41. Rodriguez, L., Gonzalez-Guzman, M., Diaz, M., Rodrigues, A., Izquierdo-

Garcia, A. C., Peirats-Llobet, M., & Mulet, J. M. (2014). C2-domain abscisic

acid-related proteins mediate the interaction of PYR/PYL/RCAR abscisic acid

receptors with the plasma membrane and regulate abscisic acid sensitivity in

Arabidopsis. The Plant Cell, 26(12), 4802-4820.

42. Nishimura, N., Hitomi, K., Arvai, A. S., Rambo, R. P., Hitomi, C., Cutler, S.

R.,& Getzoff, E. D. (2009). Structural mechanism of abscisic acid binding and

signaling by dimeric PYR1. Science, 326(5958), 1373-1379.

43. Hao Q, et al. (2011) The molecular basis of ABA-independent inhibition of

PP2Cs by a subclass of PYL proteins. Mol Cell 42(5):662–672.

44. Dupeux, F., Santiago, J., Betz, K., Twycross, J., Park, S. Y., Rodriguez, L.,

& Holdsworth, M. (2011). A thermodynamic switch modulates abscisic acid

receptor sensitivity. The EMBO journal, 30(20), 4171-4184.

106


45. Okamoto, M., Peterson, F. C., Defries, A., Park, S. Y., Endo, A., Nambara, E.,&

Cutler, S. R. (2013). Activation of dimeric ABA receptors elicits guard cell closure,

ABA-regulated gene expression, and drought tolerance.Proceedings of the National

Academy of Sciences, 110(29), 12132-12137

46. Kagaya, Y., Ohmiya, K., & Hattori, T. (1999). RAV1, a novel DNA-binding

protein, binds to bipartite recognition sequence through two distinct DNA-binding

domains uniquely found in higher plants. Nucleic Acids Research,27(2), 470–478.

47. Seo, K. I., Lee, J. H., Nezames, C. D., Zhong, S., Song, E., Byun, M. O., &

Deng, X. W. (2014). ABD1 is an Arabidopsis DCAF substrate receptor for

CUL4-DDB1–based E3 ligases that acts as a negative regulator of abscisic acid

signaling. The Plant Cell, 26(2), 695-711.

48. Lee, J. H., Yoon, H. J., Terzaghi, W., Martinez, C., Dai, M., Li, J., & Deng, X. W.

(2010). DWA1 and DWA2, two Arabidopsis DWD protein components of CUL4-

based E3 ligases, act together as negative regulators in ABA signal transduction.

The Plant Cell, 22(6) 1716-1732.

49. Irigoyen, M. L., Iniesto, E., Rodriguez, L., Puga, M. I., Yanagawa, Y., Pick, E.,&

Rodriguez, P. L. (2014). Targeted degradation of abscisic acid receptors is

mediated by the ubiquitin ligase substrate adaptor DDA1 in Arabidopsis. The

Plant Cell, 26(2), 712-728.

107


50. Jaglo-Ottosen, K. R., Gilmour, S. J., Zarka, D. G., Schabenberger, O.,

&Thomashow, M. F. (1998). Arabidopsis CBF1 overexpression induces COR

genes and enhances freezing tolerance. Science, 280(5360), 104-106.

51. Kasuga, M., Liu, Q., Miura, S., Yamaguchi-Shinozaki, K., & Shinozaki, K.

(1999). Improving plant drought, salt, and freezing tolerance by gene transfer of a

single stress-inducible transcription factor. Nature biotechnology, 17(3), 287-291.

52. Sheen, J. (2001). Signal transduction in maize and Arabidopsis mesophyll

protoplasts. Plant Physiology, 127(4), 1466-1475.

53. Marcotte, W. R., Russell, S. H., & Quatrano, R. S. (1989). Abscisic acid-responsive

sequences from the Em gene of wheat. The Plant Cell, 1(10), 969-976.

54. Yamada, K., Lim, J., Dale, J. M., Chen, H., Shinn, P., Palm, C. & Ishida, J.

(2003). Empirical analysis of transcriptional activity in the Arabidopsis

genome. Science, 302(5646), 842-846.

55. Jia, F., Gampala, S. S. L., Mittal, A., Luo, Q., & Rock, C. D. (2009). Cre-lox

Univector acceptor vectors for functional screening in protoplasts: analysis of

Arabidopsis donor cDNAs encoding Abscisic acid insensitive1-Like protein

phosphatases. Plant Molecular Biology, 70(6), 693–708.

56. Yoshida, Y., Kuroiwa, H., Misumi, O., Nishida, K., Yagisawa, F., Fujiwara,

T &Kuroiwa, T. (2006). Isolated chloroplast division machinery can actively

constrict after stretching. Science, 313(5792), 1435-1438.

108


57. Sheen, J. (1998). Mutational analysis of protein phosphatase 2C involved in

abscisic acid signal transduction in higher plants. Proceedings of the

National Academy of Sciences, 95(3), 975-980.

58. Guo, H., & Ecker, J. R. (2003). Plant responses to ethylene gas are mediated

by SCF EBF1/EBF2-dependent proteolysis of EIN3 transcription factor. Cell,

115(6), 667-677.

59. Mittal, A., Gampala, S. S., Ritchie, G. L., Payton, P., Burke, J. J., & Rock, C.

D. (2014). Related to ABA‐Insensitive3 (ABI3)/Viviparous1 and AtABI5 transcription factor coexpression in cotton enhances drought stress adaptation.Plant biotechnology journal, 12(5), 578-589.

60. Finkelstein, R., Gampala, S. S., Lynch, T. J., Thomas, T. L., & Rock, C. D.

(2005). Redundant and distinct functions of the ABA response loci ABA-

insensitive (ABI) 5 and ABRE-binding factor (ABF) 3. Plant molecular

biology, 59(2), 253-267.

61. Llave, C., Kasschau, K. D., & Carrington, J. C. (2000). Virus-encoded suppressor

of posttranscriptional gene silencing targets a maintenance step in the silencing

pathway. Proceedings of the National Academy of Sciences, 97(24), 13401-

13406.

62. Mittal, A., Jiang, Y., Ritchie, G. L., Burke, J. J., & Rock, C. D. (2015). AtRAV1 and

AtRAV2 overexpression in cotton increases fiber length differentially under drought

stress and delays flowering. Plant Science, 241, 78-95.

109


63. Pêra, F. F., Mutepfa, D. L., Khan, A. M., Els, J. H., Mbewana, S., van Dijk, A.

A., ... & Hitzeroth, I. I. (2015). Engineering and expression of a human

rotavirus candidate vaccine in Nicotiana benthamiana. Virology journal, 12(1),

1.64. Jefferson, R. A. (1987). Assaying chimeric genes in plants: the GUS gene

fusion system. Plant molecular biology reporter, 5(4), 387-405.65. Cervera, M.

(2004). Histochemical and fluorometric assays for uidA (GUS) gene detection.

In Transgenic plants: Methods and protocols (pp. 203-213). Humana Press.

65. Cervera, M. (2004). Histochemical and fluorometric assays for uidA (GUS) gene

detection. Transgenic plants: Methods and protocols, 203-213.

66. Jacobs, T. B., LaFayette, P. R., Schmitz, R. J., & Parrott, W. A. (2015).

Targeted genome modifications in soybean with CRISPR/Cas9. BMC

biotechnology, 15(1), 16.

67. Kasuga, M., Miura, S., Shinozaki, K., & Yamaguchi-Shinozaki, K. (2004). A

combination of the Arabidopsis DREB1A gene and stress-inducible rd29A

promoter improved drought-and low-temperature stress tolerance in tobacco

by gene transfer. Plant and Cell Physiology, 45(3), 346-350.

68. Choi, H. W., Kim, Y. J., & Hwang, B. K. (2011). The hypersensitive induced

reaction and leucine-rich repeat proteins regulate plant cell death associated with

disease and plant immunity. Molecular plant-microbe interactions, 24(1), 68-78.

69. Heschel, M. S., & Riginos, C. (2005). Mechanisms of selection for drought stress

tolerance and avoidance in Impatiens capensis (Balsaminaceae).American Journal

of Botany, 92(1), 37-44.

110


70. McCann, S. E., & Huang, B. (2008). Drought responses of Kentucky bluegrass

and creeping bentgrass as affected by abscisic acid and trinexapac-ethyl.

Journal of the American Society for Horticultural Science,133(1), 20-26.

71. Sinclair, T. R. (2011). Challenges in breeding for yield increase for drought.

Trends in plant science, 16(6), 289-293.

72. Miflin, B. (2000). Crop improvement in the 21st century. Journal of

experimental botany, 51(342), 1-8.

73. Fiorani, F., & Schurr, U. (2013). Future scenarios for plant phenotyping.Annual

review of plant biology, 64, 267-291.

74. Brocard, I. M., Lynch, T. J., & Finkelstein, R. R. (2002). Regulation and role of

the Arabidopsis abscisic acid-insensitive 5 gene in abscisic acid, sugar, and stress

response. Plant Physiology, 129(4), 1533-1543.

75. Chater, C. C., Oliver, J., Casson, S., & Gray, J. E. (2014). Putting the brakes on:

abscisic acid as a central environmental regulator of stomatal development. New

Phytologist, 202(2), 376-391.

76. Pantin, F., Monnet, F., Jannaud, D., Costa, J. M., Renaud, J., Muller, B., &

Genty, B. (2013). The dual effect of abscisic acid on stomata. New Phytologist,

197(1), 65-72.

77. Serna, L. (2014). The role of brassinosteroids and abscisic acid in stomatal

development. Plant Science, 225, 95-101.

111


78. Tanaka, Y., Nose, T., Jikumaru, Y., & Kamiya, Y. (2013). ABA inhibits entry

into stomatal‐lineage development in Arabidopsis leaves. The Plant Journal,74(3), 448-457.

79. Kagale, S., Uzuhashi, S., Wigness, M., Bender, T., Yang, W., Borhan, M. H.,

&Rozwadowski, K. (2012). TMV-Gate vectors: Gateway compatible

tobacco mosaic virus based expression vectors for functional analysis of

proteins.Scientific Reports, 2, 874.

80. Geng, C., Cong, Q. Q., Li, X. D., Mou, A. L., Gao, R., Liu, J. L., & Tian, Y.

P. (2015). Developmentally regulated plasma membrane protein of Nicotiana

benthamiana Contributes to Potyvirus Movement and Transports to

Plasmodesmata via the Early Secretory Pathway and the Actomyosin System.

Plant physiology, 167(2), 394-410.

81. Orsini, F., Cascone, P., De Pascale, S., Barbieri, G., Corrado, G., Rao, R., &

Maggio, A. (2010). Systemin‐dependent salinity tolerance in tomato: evidence of specific convergence of abiotic and biotic stress responses. Physiologia plantarum, 138(1), 10-21.

82. Munoz-Mayor, A., Pineda, B., Garcia-Abellán, J. O., Antón, T., Garcia-Sogo, B.,

Sanchez-Bel, & Bolarin, M. C. (2012). Overexpression of dehydrin tas14 gene

improves the osmotic stress imposed by drought and salinity in tomato. Journal

of plant physiology, 169(5), 459-468.

112


83. Dammann, C., Rojo, E., & Sánchez‐Serrano, J. J. (1997). Abscisic acid and jasmonic acid activate wound‐inducible

genes in potato through separate, organ‐ specific signal transduction pathways. The Plant Journal, 11(4), 773-782.

84. Huo, H., Dahal, P., Kunusoth, K., McCallum, C. M., & Bradford, K. J. (2013).

Expression of 9-cis-epoxycarotenoid dioxygenase4 is essential for

thermoinhibition of lettuce seed germination but not for seed development or

stress tolerance. The Plant Cell, 25(3), 884-900.

85. Chen, P. Y., Wang, C. K., Soong, S. C., & To, K. Y. (2003). Complete sequence

of the binary vector pBI121 and its application in cloning T-DNA insertion from

transgenic plants. Molecular breeding, 11(4), 287-293.

113


86. Gosti, F., Beaudoin, N., Serizet, C., Webb, A. A., Vartanian, N., &Giraudat, J.

(1999). ABI1 protein phosphatase 2C is a negative regulator of abscisic acid

signaling. The Plant Cell, 11(10), 1897-1909.

87. Leung, J., Merlot, S., &Giraudat, J. (1997). The Arabidopsis Abscisic acid-

insensitive2 (ABI2) and abi1 genes encode homologous protein phosphatases 2C

involved in abscisic acid signal transduction. The Plant Cell,9(5), 759-771. 88.

Robert, N., Merlot, S., N’Guyen, V., Boisson-Dernier, A., & Schroeder, J. I.

(2006). A hypermorphic mutation in the protein phosphatase 2C HAB1 strongly

affects ABA signaling in Arabidopsis. Febs letters, 580(19), 4691-4696.

89. Melcher, K., Ng, L. M., Zhou, X. E., Soon, F. F., Xu, Y., Suino-Powell, K. M.,&

Kovach, A. (2009). A gate–latch–lock mechanism for hormone signalling by

abscisic acid receptors. Nature, 462(7273), 602-608.

90. Yin, P., Fan, H., Hao, Q., Yuan, X., Wu, D., Pang, Y., & Yan, N. (2009).

Structural insights into the mechanism of abscisic acid signaling by PYL proteins.

Nature structural & molecular biology, 16(12), 1230-1236.

114

Date post:	10-Aug-2020
Category:	Documents
Upload:	others
View:	1 times
Download:	0 times

Texas Tech University, Sayani Mallick, July 2016 · Texas Tech University, Sayani Mallick, July...

Documents