Hand-assisted laparoscopic cystotomy for cystic calculus removal in male horses (3 cases) Orbital apex syndrome secondary to an orbital sarcoma in a dog Paroxysmal atrial fibrillation in a dog that was presented for neck wounds Evaluation of bovine respiratory syncytial virus (BRSV) and bovine herpesvirus (BHV) specific antibody responses between heterologous and homologous prime-boost vaccinated western Canadian beef calves The effect of prednisone on histologic and gross characteristics in canine mast cell tumors Validation of a point-of-care polymerase chain reaction assay for detection of Streptococcus equi subspecies equi in rostral nasal swabs from horses with suspected strangles A comparison of 4 iron supplementation protocols to protect suckling piglets from anemia Artificial insemination of gilts with bovine viral diarrhea virus-contaminated semen Long-chain LPS-based enzyme-linked immunosorbent assay to detect swine herds infected by Actinobacillus pleuropneumoniae serotype 17 Peritoneal-pericardial diaphragmatic hernia in a 6-year-old male intact pug dog The Canadian Veterinary Journal La Revue vétérinaire canadienne January/Janvier 2021 Volume 62, No. 01
Transcript
Hand-assisted laparoscopic cystotomy for cystic calculus removal in male horses (3 cases)
Orbital apex syndrome secondary to an orbital sarcoma in a dog
Paroxysmal atrial fibrillation in a dog that was presented for neck wounds
Evaluation of bovine respiratory syncytial virus (BRSV) and bovine herpesvirus (BHV) specific antibody responses between heterologous and homologous prime-boost vaccinated western Canadian beef calves
The effect of prednisone on histologic and gross characteristics in canine mast cell tumors
Validation of a point-of-care polymerase chain reaction assay for detection of Streptococcus equi subspecies equi in rostral nasal swabs from horses with suspected strangles
A comparison of 4 iron supplementation protocols to protect suckling piglets from anemia
Artificial insemination of gilts with bovine viral diarrhea virus-contaminated semen
Long-chain LPS-based enzyme-linked immunosorbent assay to detect swine herds infected by Actinobacillus pleuropneumoniae serotype 17
Peritoneal-pericardial diaphragmatic hernia in a 6-year-old male intact pug dog
The Canadian Veterinary Journal La Revue vétérinaire canadienne
GET NEW TOOLS TO MAKE WEIGHT CONVERSATIONS EASIERAnd watch Poochini’s story at EndPetObesity.ca/VetThe Hill’s logo, the Hill’s Prescription Diet logo, the S+OX SHIELD logo, Hill’s, Prescription Diet, and Metabolic are trademarks of Hill’s Pet Nutrition Canada, Inc.
ProtectingVeterinariansSince 2005A specialized insurance program for the Canadian veterinary industry.
Join now and receive preferred member pricing on Commercial Insurance and Employee Bene� ts!
Available exclusively to members of the Canadian Veterinary Medical Association. The CVMA Insurance Program offers the most comprehensive and cost-effective insurance protection for you, your employees and your practice.
1-866-860-2862CVMAinsurance.com
PROFESSIONAL LIABILITY | EMPLOYEE BENEFITS | COMMERCIAL INSURANCE
001_8176_(TOC_January2021).indd 1001_8176_(TOC_January2021).indd 1 2020-12-10 11:54 AM2020-12-10 11:54 AM
FOR SUPPLEMENTS YOU CAN TRUST, START WITH A NAME YOU KNOW.Count on Purina® Pro Plan Veterinary SupplementsTM. Our global network of resources continues to bring you breakthrough science in supplements like FortiFlora®, NEW FortiFlora® SA, Calming Care and Hydra CareTM.
TRUSTEDFrom a leader in therapeutic nutrition
TESTEDBacked by research
TARGETEDFocused on specific patient needs
For more information, visit www.ProPlanVeterinaryDiets.ca or call us at 1-866-884-VETS (8387).Have a Case consult? We are here to help.
22 Hand-assisted laparoscopic cystotomy for cystic calculus removal in male horses (3 cases)Alejandro Merchan, Elizabeth J. Barrett, Dwayne H. Rodgerson
27 Orbital apex syndrome secondary to an orbital sarcoma in a dogJayden Robert, Filipe Espinheira Gomes, Ian Porter, Julia P. Sumner
32 Paroxysmal atrial fibrillation in a dog that was presented for neck woundsSamuel J. Hornsey, Anthony P. Carr, Jennifer M. Loewen
ARTICLES
37 Evaluation of bovine respiratory syncytial virus (BRSV) and bovine herpesvirus (BHV) specific antibody responses between heterologous and homologous prime-boost vaccinated western Canadian beef calvesNathan E.N. Erickson, Adam Berenik, Herbert Lardner, Stacey Lacoste, John Campbell, Sheryl Gow, Cheryl Waldner, John Ellis
45 The effect of prednisone on histologic and gross characteristics in canine mast cell tumorsKen J. Linde, Stephen L. Stockdale, Michael B. Mison, James A. Perry
51 Validation of a point-of-care polymerase chain reaction assay for detection of Streptococcus equi subspecies equi in rostral nasal swabs from horses with suspected stranglesAndrew T. Willis, Samantha Barnum, Nicola Pusterla
BRIEF COMMUNICATIONS COMMUNICATIONS BRÈVES
55 A comparison of 4 iron supplementation protocols to protect suckling piglets from anemiaRobert Friendship, Victoria Seip, Rocio Amezcua
59 Artificial insemination of gilts with bovine viral diarrhea virus-contaminated semenGabriel Y. Storino, Marina L. Mechler-Dreibi, Eduarda B. Xavier, Artur S. Fioroto, Maria E. F. Oliveira, Edviges M. Pituco, Luis G. de Oliveira
62 Long-chain LPS-based enzyme-linked immunosorbent assay to detect swine herds infected by Actinobacillus pleuropneumoniae serotype 17Marcelo Gottschalk, Sonia Lacouture, Tim Blackwell, Janine Bossé
STUDENT PAPER COMMUNICATION ÉTUDIANTE
69 Peritoneal-pericardial diaphragmatic hernia in a 6-year-old male intact pug dogBryan T. Welch
13 QUIZ CORNER TEST ÉCLAIR
Contents Table des matières
JANUARY/JANVIER 2021
FOR PERSONAL USE ONLY
First Hybrid Convention in Canada for the Veterinary Profession
canadianveterinarians.net
IN COLLABORATION WITH:
Times are changing, and so is the
CVMA Convention
The CVMA is pleased to offer in-person and virtual passes for
2021. The Program will have over 110 hours of continuing education
for you to attend either in Calgary or from the comfort
The Canadian Veterinary Journal is indexed or abstracted in:La Revue vétérinaire canadienne est indexée ou ses articles sont résumés dans :AGRICOL, Biological Abstracts, Capsule Report, Current Contents — Agriculture, Derwent Veterinary Drug File, EMBASE/Excerpta Medica, Index Veterinarius, Index Medicus, Quarterly Index, Science Citation Index, Small Animal Practice, Veterinary Bulletin, Veterinary Reference Service, Veterinary Update.
Photo by/Photo de : Margaret Fisher, Edmonton, Alberta
Typesetting/Typographie AN Design CommunicationsPrinted by/Imprimé par Dollco Print Solutions Group Ottawa, OntarioISSN 0008-5286
Report undeliverable Canadian addresses to: e-mail: [email protected]
Subscriptions (2021). Annual: Canada $225 + applicable GST or HST; foreign $240 US; institutional $295. Express subscriptions available. Single issue/back issue: $25 each, institutional single issue = $50.00 + GST or HST, if applic able. (All prices subject to change.) Missing issues will be replaced if the Subscriptions Office is notified within 6 months (for requests within Canada) and 1 year (for requests from abroad) of the issue date. The pub lisher expects to supply missing issues only when losses have been sustained in transit and when the reserve stock will permit. Telephone (613-236-1162) or (1-800-567-2862) and fax (613-236-9681) orders accepted with a valid Visa or MasterCard number. Please advise the publisher of address changes promptly.Abonnements (2021). Annuel : Canada 225 $ + TPS ou TVH en vigueur; pays étranger 240 $ É-U; prix d’une institution 295 $. Abonnement express disponible. Anciens numéros (chacun) : 25 $, ancien numéro d’institution 50 $ + TPS ou TVH en vigueur. Les prix sont sujets à changement sans préavis. Les numéros qui ne sont pas reçus seront remplacés si l’éditeur en est informée dans les 6 mois (pour les demandes venant du Canada) et 1 an (pour les demandes venant de l’étranger) suivant la date de parution. L’éditeur s’engage à remplacer les numéros manquants seule ment lorsque les pertes ont été subies en transit et lorsque ses réserves le permettent. On peut payer son abonnement par téléphone (613-236-1162) ou (1-800-567-2862), par télé copieur (613-236-9681) ou par carte de crédit (Visa ou MasterCard). Veuillez aviser le bureau de l’éditeur de tout changement d’adresse.
Editorial policy: All published articles including editorials and letters reflect the opinions of the authors and do not necessarily reflect the opinion of the publisher.Publication of an advertisement does not necessarily imply that the publisher agrees with or supports the claims therein.The Canadian Veterinary Medical Association holds complete copyright of all articles within this issue.Politique de la Rédaction : Tous les articles publiés, y compris les éditoriaux et les lettres, représentent l’opinion de l’auteur et non pas nécessairement la position de l’éditeur.La publication d’une annonce ne signifie pas nécessairement que l’éditeur est d’accord avec son contenu ou qu’il l’appuie.L’Association canadienne des médecins vétérinaires détient le droit d’auteur complet sur tous les articles contenus dans le présent numéro.
Co-Editors-in-Chief/Co-rédacteurs en chef Dr. John Kastelic, Calgary, Alberta Dr. Tim Ogilvie, Springbrook, Prince Edward IslandAssociate Editors/Rédacteurs associés Dr. Murray Jelinski, Saskatoon, Saskatchewan Dr. Wayne McDonell, Guelph, OntarioFeature Editors/Rédacteurs des chroniques Dr. Jangi Bajwa, Burnaby, British ColumbiaDr. Tim Blackwell, Fergus, OntarioDr. Myrna Milani, Charlestown, New HampshireDr. Lynne Sandmeyer, Saskatoon, SaskatchewanDr. Debbie Stoewen, Ayr, OntarioAssistant Editors/Rédacteurs adjoints Dr. Aylin Atilla, Calgary, Alberta Dr. Marcio Costa, Saint-Hyacinthe, Quebec Dr. Robert Friendship, Guelph, Ontario Dr. Luis Gaitero, Guelph, Ontario Dr. Emily John, Charlottetown, Prince Edward Island Dr. Ron Johnson, Guelph, Ontario Dr. Shawn McKenna, Charlottetown, Prince Edward Island Dr. Shannon Martinson, Charlottetown, Prince Edward Island Dr. Javier Sanchez, Charlottetown, Prince Edwad IslandManaging Editor/Directrice de la rédaction Heather Broughton, Ottawa, OntarioAssistant Managing Editor/Directrice adjointe de la rédaction Stella Wheatley, Ottawa, OntarioEditorial Coordinator/Coordonnatrice de la rédaction Kelly Gray-Sabourin, Ottawa, OntarioAdvertising and Sponsorship Consultant/Consultante, publicité et commandites Laima Laffitte, Wendover, Ontario
Published monthly by/ Publication mensuelle deCanadian Veterinary Medical Association
The editors and staff of The Canadian Veterinary Journal are pleased to have as readers student veterinarians at Canadian veterinary colleges! The production and distribution of student
subscriptions is made possible through the generous sponsorship of Scotiabank
Les rédacteurs et le personnel de La Revue vétérinaire canadienne sont heureux de compter les étudiants en médecine vétérinaire des collèges vétérinaires au Canada au nombre de leurs lecteurs. La production et
la distribution des abonnements des étudiants ont été rendues possible grâce au généreux soutien de Banque Scotia
STUDENT SUBSCRIPTIONS/ABONNEMENTS DES ÉTUDIANTS
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 7
President’s Message Le mot de la présidente
C es derniers mois ont été difficiles. Très difficiles en fait pour pratiquement tout le monde. Quand la pandémie a
commencé en mars, mon mari m’a dit : « Ce sera particulière-ment dur pour les gens comme toi, Enid. » Son commentaire m’a blessée et m’a mise sur la défensive. Que voulait-il dire par « les gens comme moi »? Je n’allais sûrement pas me laisser abattre par la COVID!
Quelques mois plus tard, je comprends mieux pourquoi il a dit cela.
Nous avons chacun nos propres moyens de gérer le stress, et certains peuvent avoir plus de difficulté à composer avec la situation et besoin de plus de soutien que d’autres. Une étude récente de Perret et ses collaborateurs ( J Am Vet Med Assoc 2020;3:365-375) a révélé que 26,2 % des médecins vétérinaires canadiens interrogés avaient pensé au suicide au cours de la der-nière année, un taux significativement plus élevé celui observé dans la population générale (entre 2,1 et 10 %). Cela représente un de vos collègues sur quatre!
Je crois que pour faire face à ce grave problème, il est essentiel que nous devenions plus à l’écoute des gens qui nous entourent et que nous apprenions à reconnaître comment ils manifestent leur détresse émotionnelle. Autrement dit, nous devons accroître notre vigilance sociale. Cette démarche vers une plus grande prise de conscience des autres commence par une meilleure connaissance de soi, de la manière dont nous réagissons et dont nous ressentons et gérons nos propres émotions. Chercher à développer son intelligence émotionnelle est en effet un chemi-nement, mais cette démarche peut nous aider, en plus d’aider tous ceux que nous côtoyons.
J’y ai beaucoup réfléchi ces derniers temps, à la suite du commentaire de mon mari. J’ai pensé à la façon dont j’ai ten-dance à faire face au stress au travail. J’ai constaté qu’il semble que ma capacité à composer avec les difficultés est intimement liée à ma liste de choses à faire. Est-ce que j’ai été m’entraîner aujourd’hui? Est-ce que j’ai rempli tous mes dossiers avant de
T hese past few months have been hard. Very hard on most everyone. My husband said to me when COVID first
started back in March, “Oh boy Enid, this is going to be espe-cially hard on people ‘like you’!” I was really hurt and defen-sive. What does he mean, ‘people like me?’ I’ve got this whole COVID-thing covered!
I am pretty sure that I understand now why he said what he did.
We all have different mechanisms to cope with stress and some of us may be struggling differently and need more support than others. A recent study in the J Am Vet Med Assoc 2020;3:365–375 by Perret et al, found that 26.2% of Canadian veterinarians surveyed had considered suicide in the last year, which is significantly higher than the general popula-tion (2.1%–10%). That is 1 in 4 of your colleagues!
I believe that to deal with this serious issue it is critical that we become more aware of the people around us and learn to recognize their emotional cues. Simply said, we need to become more socially aware. This journey to greater awareness of others begins with learning about yourself, how we cope and how we recognize and regulate our own internal emotions. Developing emotional intelligence is indeed a journey, but one that will help not only you, but also those people whose lives you touch.
I’ve been doing a lot of thinking about this lately, thanks to my husband’s comments! I’ve been thinking about how I tend to cope with stress at work. On reflection, it seems that my ability to cope is inextricably linked to my internal list of check boxes. Did I get to the gym today? Did I complete my medical notes before leaving work? Did I manage to book that hotel? Did I get the kids to their games on time?
I am also a “forward thinker.” Here is an example of my internal dialogue: “Today was one extremely difficult day and I am emotionally exhausted, but it’s ok, I have that amazing trip we booked and it’s only a few months away, I can make it until then.” My husband’s internal dialogue, on the other hand, is
When all else fails, grab your Swiss Army knife
Quand rien ne fonctionne, utilisez votre couteau suisse
Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
L’usage du présent article se limite à un seul exemplaire pour étude personnelle. Les personnes intéressées à se procurer des réimpressions devraient communiquer avec le bureau de l’ACMV ([email protected]) pour obtenir des exemplaires additionnels ou la permission d’utiliser cet article ailleurs.
FOR PERSONAL USE ONLY
8 CVJ / VOL 62 / JANUARY 2021
LE
MO
T D
E L
A P
RÉ
SID
EN
TE
quitter la clinique? Est-ce que j’ai réussi à faire la réservation d’hôtel que je voulais faire? Est-ce que les enfants sont arrivés à leurs activités sportives à l’heure?
Je suis aussi une personne qui se projette beaucoup dans l’avenir. Voici un exemple de ce que je me dis à moi-même pour m’encourager : « Aujourd’hui a été une journée extrême-ment difficile et je suis épuisée émotionnellement, mais ça va, le voyage extraordinaire que nous avons organisé n’est plus que dans quelques mois, je peux tenir bon jusque-là. » Mon mari, lui, se dit plutôt : « Ouf, c’était une journée difficile, mieux vaut rentrer à la maison pour laisser toute cette énergie néga-tive au travail! », et il va devenir enthousiaste à propos de notre voyage SEULEMENT lorsqu’il sera physiquement RENDU à l’aéroport.
Nous sommes tous uniques, nous avons tous des personnalités différentes, et nous avons tous nos propres façons de composer avec les différentes situations qui se présentent à nous. Mais comme vous pouvez l’imaginer dans mon cas, la plupart des « cases à cocher » que j’utilise pour m’aider à faire face au stress ne sont pas cochées OU le sont très peu. Ce voyage que je prévoyais pour me ressourcer, il n’aura pas lieu cette année, et probablement pas l’année prochaine non plus! Ce n’est qu’un exemple, mais il illustre bien qu’en ce moment, nos stratégies habituelles sont plus difficiles à utiliser et nos attentes sont plus difficiles à satisfaire. Par conséquent, nous ressentons encore plus de stress et d’anxiété.
Alors, comment ai-je réussi à m’adapter? Je suis revenue aux choses de base qui ont tendance à me réconforter, celles que je sais qui me feront me sentir « normale ». Les gestes simples et routiniers réduisent mon niveau de stress. Si vous me disiez que j’ai 20 castrations de chiens et 10 stérilisations de chattes à faire aujourd’hui, je fondrais littéralement de bonheur! C’est ma boîte à outils, mon « couteau suisse » à moi : les tâches répétitives et sans surprises que je connais bien et que je suis capable de bien faire. Je sais que ces chirurgies sont généralement prévisibles, surtout si les patients sont jeunes et en bonne santé. Je connais mon équipe et je sais à quel point nous travaillons bien ensemble. Je sais comment me préparer et exactement quoi faire. C’est CONFORTABLE pour moi. Juste en écrivant ces mots, je me sens déjà PLUS DÉTENDUE!
Et vous, quels sont vos mécanismes de réconfort émotionnel? Qu’y a-t-il dans votre boîte à outils, à quoi ressemble votre cou-teau suisse? Où pouvez-vous aller ou vers qui pouvez-vous vous tourner pour obtenir de l’aide? L’ACMV a la chance d’avoir un groupe consultatif sur le mieux-être qui rassemble des ressources en ligne, qui participe au développement et à la promotion de la campagne de sensibilisation à la santé mentale de Merck et qui nous assure de garder ce sujet extrêmement important au premier plan de notre organisation. Surtout, n’oubliez jamais, et je le dis avec la plus grande sincérité, que vous êtes une seule personne, que vous ne pouvez pas tout faire, et que vous n’êtes PAS SEUL. Il y a des gens autour de vous pour vous aider.
Je dois admettre que la pandémie de COVID-19 a également eu des effets positifs. Elle nous a obligés à nous adapter rapide-ment. Elle a exigé que nous fassions preuve de RÉSILIENCE et que nous surmontions l’adversité. Elle nous a permis de démontrer que nous avons le CŒUR AU VENTRE nécessaire
more like “Ouf, that was a rough day, best get home so I can leave that negative energy at work!” He’s the kind of person who only really starts getting excited about the trip we are going on ONCE he is physically AT the airport.
Different people, different personalities, and most certainly different ways of coping. But as you can probably see in my case, most of the “check boxes” I use to help me cope are not being checked OR are being checked at a very low rate. That trip I was planning to help me de-stress, well, it’s not happening this year and likely not next! That feedback mechanism and those expectations many of us have set are harder to obtain and use. As a result, we are feeling a greater amount of stress and anxiety.
So how have I been trying to cope? I have been finding myself going back to the basic patterns that tend to give me comfort, the things I know will make me feel “normal.” Patterns and simple repeatable acts reduce my level of stress. If you were to tell me I had 20 dog castrations and 10 cat spays to do today, I would literally melt with happiness. This is my tool box, my Swiss Army knife: repeated, reliable things I know and can do well. I know that these surgeries are generally predictable, espe-cially if the patients are healthy and young. I know my team and how well we work together. I know how to prepare and exactly what to do. This is COMFORT for me. Even as I write these words, I am FEELING MORE RELAXED!
So, what are your emotional coping skills? What is in your toolbox, your Swiss Army knife?? Where can you go or who can you ask for help? We are very fortunate at the CVMA to have a Wellness Advisory Group who have set up web resources, helped develop and promote the Merck Mental Health Awareness cam-paign, and ensure we are keeping this extremely important topic at the forefront of our organization. Please do remember, and I mean this with every bone in my body: You are one person, you cannot do it all, and you are NOT ALONE. There are people there to help you.
COVID-19 has had its good points too though. It has forced us to adapt quickly. It has asked us to be RESILIENT and overcome adversity. It has asked us to demonstrate the GRIT needed to rise above this negative force. And most importantly, we are doing this together and finding tools to help each other along the way.
You may ask, why do I cherish the Swiss Army knife meta-phor? Well there is a story of when I was in my late teens in Zimbabwe and my father’s Swiss Army knife came in very handy as we helped some government scouts cut out the ivory tusks from a young dead bull elephant on the Zambezi River, so the tusks would not end up in the illegal trade. Who would have thought that a tiny pocketknife could do that? Never leave home without your Swiss Army knife, wherever you may be. ■
Enid Stiles
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 9
PR
ES
IDE
NT
’S M
ES
SA
GE
pour nous élever au-dessus de cette force négative. Et surtout, nous faisons tout cela ensemble, et nous trouvons des outils pour nous entraider en cours de route.
Vous vous demandez pourquoi j’aime l’image du couteau suisse? Un jour à la fin de mon adolescence, au Zimbabwe, le couteau suisse de mon père s’est avéré très pratique pour aider des gardes du gouvernement à couper les défenses d’un jeune
éléphant mort sur le fleuve Zambèze pour éviter qu’elles abou-tissent dans les mains de trafiquants d’ivoire. Qui aurait cru qu’un tout petit couteau de poche pouvait faire cela? Ne partez donc jamais sans votre couteau suisse, où que vous soyez. ■
Enid Stiles
The Olson family founded Solvet to meet the needs of Canadian veterinarians and producers. We are a Canadian company researching and manufacturing products here in Canada to support the Canadian animal health industry. Our approach is simple: We listen to you, our customers, and deliver solutions to problems that you face on a daily basis.
We are experiencing unprecedented change around the world. At Solvet, we believe that
having a Canadian pharmaceutical company that is dedicated to Canadian veterinarians
and Canadian producers has never been more important. That’s why we will continue to
conduct research and deliver products quickly to meet the current and future challenges you face.
For a full list of Solvet products check our website Solvet.ca
Proud Canadian manufacturers of:
• Meloxicam Oral Suspension The longest lasting pain control in cattle
• Charcoal Kaolin Oral Paste
• Ivermectin Liquid for Horses
• Kaolin Pectin Oral Suspension
• Solmectin Pour On for Cattle
Left to right: Anders Olson, Production Manager, Dr. Merle Olson, Co-Owner & Director of Research, Dr. Barb Olson, Co-Owner & Director of Quality Assurance, Adam Olson, Operations Manager, Samantha Olson, Finance Manager.
A Canadian Animal Health Company with a new approach
CLIENT Solvet/AVL LtdPROJECT 20-AVL-0033-Dec.2DATE Dec 2020DESIGNER GB
PUBLICATION Canadian Veterinary JournalSIZE 7" x 6.875"BLEED N/ACOLOURS Full Colour
Thousands of paws. Hundreds of humans. One strong network.
You were made to save animals. We take care of the rest.
WE’D LOVE TO GET TO KNOW YOU.As one of Canada’s leading veterinary clinic management networks, VetStrategy has a strong presence across the country with notable emergency and specialist care in Ontario.
An ethicist’s commentary on macerating baby chicksWe are living in a world where animal abuse, perceived or real, is overwhelmingly socially unacceptable. We have looked at many of these questionable areas in this column. Rates of euthanasia of healthy animals in “shelters” has declined precipitously. Circuses, including the venerable and traditionally popular Ringling Brothers are being abolished, despite the public’s love of watching animals; similarly with dolphin shows such as Sea World. Zoos which are in essence prisons for animals, have gone from being the norm to being unacceptable societally; confining animals in small spaces to keep food prices down, most notoriously as was traditionally done in veal crates and
sow stalls is being seriously questioned; animal fighting is in its death throes, and so on.
In the egg industry, male chicks have long been an unwanted nuisance, where they were traditionally eliminated by such brutal methods as suffocation. A few years ago, it was suggested that these chicks could be eliminated by feeding them into a wood-chipper. While arguably death is instantaneous, the very thought of so disposing of living animals is repulsive. Not only is such a method of killing aesthetically unacceptable, it is bru-talizing to anyone observing it, as is hanging chickens upside down on a conveyor belt (standard practice), running electricity
Culling male chicks — A commentThere is a unit (designed and commercialized in the Netherlands) that uses N2/CO2, which is a conveyer belt type box. Chicks are placed on the top belt, and then they go into the unit and are peacefully euthanized. The euthanized chicks come out on the bottom belt. They can then be compressed and frozen for reptile food. This unit was first designed because of
the horror that the engineer of this unit felt when he learned of maceration. A number of these chick euthanasia units have been sold in North America to large poultry entities.
Submitted by Suzanne Burlatschenko, Goshen Ridge Veterinary Services, Tillsonburg, Ontario
Ethical question of the month — October 2020
Male chicks are a by-product of the modern egg industry. Unable to lay eggs and unsuitable for the broiler industry, male layer chicks are incubated and hatched out, only to be culled as day-olds. In Canada and the United States, maceration is the most common method of euthanasia, providing instantaneous death. While this may provide a humane death, the practice is cited as a welfare concern among animal activists, consumers, and industry. Significant efforts have been made in Canada and the United States to develop commercial egg sexing technologies that would allow for the elimination of this practice, but none have proven economically feasible. Is it ethical to hatch out chicks with the intention of euthanizing half of them? If dual purpose breeds are less efficient as both layers and broilers, is it ethical to raise these despite the associated additional inputs/costs?
Submitted by Megan Allore, Montreal, Quebec
Question de déontologie du mois — Octobre 2020
Les poussins mâles sont un sous-produit de l’industrie moderne des œufs. Incapables de pondre et ne convenant pas à l’industrie des poulets de chair, les poussins mâles sont abattus à l’âge d’un jour. Au Canada et aux États-Unis, la macération est la méthode d’euthanasie la plus courante. Bien que cette méthode entraîne une mort instantanée jugée sans cruauté, elle soulève des pré-occupations en matière de bien-être animal chez les défenseurs des droits des animaux, parmi les consommateurs et au sein de l’industrie. Des efforts importants ont été faits au Canada et aux États-Unis pour développer des technologies commerciales de sexage des œufs qui permettraient d’éliminer cette pratique, mais aucune ne s’est avérée économiquement réalisable. Est-il éthique de faire éclore des poussins avec l’intention d’en euthanasier la moitié? Si les races à double usage sont moins efficaces pour la production d’œufs et de viande, est-il éthique de les élever malgré les intrants et les coûts supplémentaires que cela implique?
Question soumise par Megan Allore, Montréal, Québec
Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
L’usage du présent article se limite à un seul exemplaire pour étude personnelle. Les personnes intéressées à se procurer des réimpressions devraient communiquer avec le bureau de l’ACMV ([email protected]) pour obtenir des exemplaires additionnels ou la permission d’utiliser cet article ailleurs.
FOR PERSONAL USE ONLY
12 CVJ / VOL 62 / JANUARY 2021
DÉ
ON
TO
LOG
IE V
ÉT
ÉR
INA
IRE
through their brains, and mechanically eviscerating them. Even workers in poultry slaughterhouses find the method extremely questionable, with too many birds remaining conscious through the entire process.
The first promising alternative to this brutal process has been the sexing of eggs before they are hatched and eliminating those that will be born male. This is a very recent development by a Dutch — German company (2018), and it appears to be quite successful. Another commonsensical alternative is to raise the males to market weight and using them for food.
The very fact that anyone would conceive of throwing baby chicks into a wood chipper or suffocating them in a plastic bag demonstrates the extent to which animal agriculture has moved away from the tradition of husbandry that dominated animal agriculture for most of its history. Good husbandry essentially assured that animals lived decent lives before they were slaughtered.
The fact that we are discussing this seriously shows the extent to which industry has supplanted husbandry in animal agriculture. While one may argue that such a change has been a function of industrialization, and this may be true, it is also essential that we question this change and determine whether the sacrifice of animal welfare is the price we are willing to pay for cheap food. Whereas animal farmers were once objects of
social approval for how they raised animals, we are now ever increasingly seeing huge industrialized operations that hurt the animals, the farmers, the environment, and, not least, the view of agriculture in the social mind.
Some years ago, I served as a member of the Pew Commission on industrial agriculture, which ultimately produced an invalu-able document titled Putting Meat on the Table (1), that is now available online. I would urge anyone resisting our account of contemporary agriculture to read and study this document — the product of years of work by a group with considerable expertise. Read with an open mind, in order to understand the dramatic changes that have taken place in agriculture, in all the areas enumerated above, in order to understand the degree to which our human birthright is threatened by the sort of changes exemplified in the maceration of baby chicks.
Bernard E. Rollin, PhD
Reference1. Pew Commission on Industrial Farm Animal Production. Putting
Meat on the Table: Industrial Farm Animal Production in America. c2008. Available from: https://www.pewtrusts.org/en/research-and- analysis/reports/0001/01/01/putting-meat-on-the-table Last accessed November 16, 2020.
Responses to the case presented are welcome. Please limit your reply to approximately 50 words and forward along with your name and address to: Ethical Choices, c/o Dr. Tim Blackwell, 6486 E. Garafraxa, Townline, Belwood, Ontario N0B 1J0; telephone: 519-846-3413; fax: 519-846-8178; e-mail: [email protected] ethical questions of the month are also welcome! All ethical questions or scenarios in the ethics column are based on actual events, which are changed, including names, locations, species, etc., to protect the confidentiality of the parties involved.
Les réponses au cas présenté sont les bienvenues. Veuillez limiter votre réponse à environ 50 mots et nous la faire parvenir par la poste avec vos nom et adresse à l’adresse suivante : Choix déontologiques, a/s du Dr Tim Blackwell, 6486, E. Garafraxa, Townline, Belwood (Ontario) N0B 1J0; téléphone : 519-846-3413; télécopieur : 519-846-8178; courriel : [email protected] propositions de questions déontologiques sont toujours bienvenues! Toutes les questions et situations présentées dans cette chronique s’inspirent d’événements réels dont nous modifions certains éléments, comme les noms, les endroits ou les espèces, pour protéger l’anonymat des personnes en cause.
Ethical question of the month — January 2021
Since the legalization of marijuana in Canada, your rural prac-tice has seen an increasing number of marijuana toxicities in dogs. As the clinical signs in affected dogs are not pathogno-monic and owners are often reluctant to provide a full history, you have found over-the-counter urine drug testing kits useful in establishing a diagnosis. Late in the day you are presented with a dog demonstrating unusual neurologic signs. Temperature, pulse, and respiration are within normal limits. The history provided is uninformative. You decide to check the urine for drug residues. The test demonstrates the presence of marijuana as well as fentanyl. Normally you are not one to judge people’s choice of recreational drugs; however, an acquaintance’s son recently died from a fentanyl overdose. What are your profes-sional responsibilities in such a situation?
Submitted by Stephen Scott, Perth Veterinary Clinic, Perth, Ontario
Question de déontologie du mois — Janvier 2021
Depuis la légalisation de la marijuana au Canada, votre pratique rurale a observé un nombre croissant de cas d’intoxication par la marijuana chez les chiens. Comme les signes cliniques chez les chiens affectés ne sont pas pathognomoniques et que les propriétaires sont souvent réticents à fournir une anamnèse complète, vous avez trouvé des tests de dépistage de drogues dans l’urine en vente libre pratiques pour établir un diagnostic. Tard dans la journée, on vous emmène un chien présentant des signes neurologiques inhabituels. Sa température, son pouls et sa respiration sont normaux. L’anamnèse fournie ne vous donne pas d’information utile. Vous décidez de vérifier la présence de résidus de drogues dans l’urine du chien. Le test démontre la présence de marijuana et de fentanyl. Normalement, vous n’êtes pas du genre à juger le choix des gens en matière de drogues récréatives; cependant, le fils d’une de vos connaissances est récemment décédé d’une surdose de fentanyl. Quelles sont vos responsabilités professionnelles dans une telle situation?
Question soumise par Stephen Scott, Perth Veterinary Clinic, Perth, Ontario
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 13
1. Which of the following is the most likely diagnosis for an 8-month-old shar-pei that presents with episodic fever, swelling of the hocks, and renal amyloidosis?A. Rheumatoid arthritisB. OsteoarthritisC. Inflammatory arthritisD. Type II erosive arthritis
2. Which of the following is NOT a major reason that renal function and renal lesions progressively worsen in patients with chronic kidney disease?A. Glomerular hypertension and hyperfiltrationB. Systemic hypertensionC. Renal mineralizationD. Renal secondary hyperparathyroidismE. Increased protein in the urine
3. Which of the following is the most likely diagnosis for an equine patient exhibiting blepharoptosis, enophthalmos, prolapse of the third eyelid, and miosis?A. Horner syndromeB. Laryngeal paralysisC. Protozoal myelitisD. Degenerative myelopathy
4. A cow has been in stage 1 of labor for 8 hours with no pro-gression. On vaginal examination, there is narrowing and twisting of the vagina, and the cervix is not palpable. Uterine torsion is suspected but not certain. To confirm this diagnosis, the next step should be which of the following?A. Exploratory laparotomyB. Casting and rolling of the cowC. Rectal examinationD. Ultrasonography
1. Lequel des diagnostics suivants est le plus probable pour un chien shar-pei de 8 mois qui présente de la fièvre épiso-dique, de l’enflure des jarrets et de l’amyloïdose rénale?A. Arthrite rhumatoïdeB. OstéoarthriteC. Arthrite inflammatoireD. Arthrite érosive de type II
2. Lequel des problèmes suivants n’est PAS une raison majeure de la détérioration progressive de la fonction et des lésions rénales chez les patients souffrant de maladie rénale chronique?A. Hypertension glomérulaire et hyperfiltrationB. Hypertension généraliséeC. Minéralisation rénaleD. Hyperparathyroïdisme rénal secondaireE. Augmentation des protéines dans l’urine
3. Lequel des diagnostics suivants est le plus probable chez un cheval présentant de la blépharoptose, de l’énophtalmie, un prolapsus de la troisième paupière et un myosis?A. Syndrome de HornerB. Paralysie laryngéeC. Myélite à protozoairesD. Myélopathie dégénérative
4. Une vache est en travail au stade 1 depuis 8 heures, toute-fois sans progression. À l’examen vaginal, il y a un rétrécis-sement et une torsion du vagin et le col utérin n’est pas palpable. On soupçonne une torsion utérine. Pour confirmer le diagnostic, quelle serait la prochaine étape à réaliser?A. Laparotomie exploratriceB. Coucher et rouler la vacheC. Examen transrectalD. Échographie
Quiz Corner Test éclair
quiz corner is generously sponsored by le test éclair est généreusement commandité par
NEW
YOU CAN ONLY TREAT WHAT YOU KNOW.VETERINARY LICENSED TETRACOSACTIDE
FROM THE MAKERS OF
Z Y C O R T A L®
H I D D E N D I S E A S E . V I S I B L E A N S W E R .
Z Y C O R T A L®
H I D D E N D I S E A S E . V I S I B L E A N S W E R .
Z Y C O R T A L®
H I D D E N D I S E A S E . V I S I B L E A N S W E R .
FOR PERSONAL USE ONLY
14 CVJ / VOL 62 / JANUARY 2021
TE
ST
ÉC
LA
IR
5. Evidence of atrophic rhinitis in a pig herd includes which of the following?A. Sneezing in young pigsB. Lacrimation and possible epistaxis in young pigsC. Distorted snout in pigs near market weightD. A and BE. A, B, and C
5. Les indices de la présence de rhinite atrophique dans un troupeau de porcs comprennent lequel ou lesquels des signes suivants?A. Éternuements chez les jeunes porceletsB. Larmoiement et épistaxis possible chez les jeunes porceletsC. Distorsion du groin chez les porcs qui ont presque atteint
le poids du marchéD. A et BE. A, B et C
Questions and answers were derived from Review Questions and Answers for Veterinary Boards 2nd ed., a 5-volume series including Basic Sciences, Clinical Sciences, Small Animal Medicine and Surgery, Large Animal Medicine and Surgery, and Ancillary Topics, by kind permission of the publisher, Mosby–Year Book, Inc., St. Louis, Missouri.
Les questions et les réponses sont extraites de Review Questions and Answers for Veterinary Boards 2nd ed., une série de cinq volu mes qui comprend Basic Sciences, Clinical Sciences, Small Animal Medicine and Surgery, Large Animal Medicine and Surgery, et Ancillary Topics, avec l’aimable permission de l’éditeur, Mosby–Year Book, Inc. de St. Louis (Missouri).
(See p. 65 for answers./Voir les réponses à la page 65.)
While you’re taking care of them,we’re looking out for you.
Specialized insurance programs and risk management services for CVMA members
• Professional liability insurance• Commercial insurance• Employeebenefits• Individual life and disability• Student and graduate insurance• Personal auto and home insurance
1-866-860-2862 • cvmainsurance.com
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 15
N E W S | N O U V E L L E S
2021 CVMA Convention — July 22–25 Times are Changing, and so is the CVMA Convention
The Canadian Veterinary Medical Association (CVMA) invites you and your veterinary team to join your colleagues in
the inaugural hybrid Convention for the veterinary profession. Canada’s only national, multi-species veterinary Convention is taking place in Calgary, Alberta from July 22 to 25, 2021.
The CVMA Professional Development Committee has devel-oped new program features, new registration packages, and for the first time will be offering a virtual experience for attendees to participate online from the comfort of their home or office.
Are you zoom-fatigued and miss connecting with your col-leagues in-person? Onsite registration packages include full and daily options, access to both in-person continuing education, plus the continuing education hosted on our virtual platform, plus access to the exhibit hall. Your health and safety are of the utmost importance to the CVMA. As such, we are continuously in communication with our partners and venues in Calgary to ensure we implement the necessary steps to give you peace of mind. We have compiled links with the latest COVID-19 resources (https://pheedloop.com/cvma21/site/covidfaq/).
Do you still want to experience the CVMA Convention but are unable due to travel restrictions or personal prefer-ences — the CVMA has been working diligently with partners to bring you the best virtual experience where you can obtain your continuing education, visit our virtual exhibit hall, and connect with your peers all from the comfort of your home or office. You will have access to all continuing education sessions, plus have access to the virtual exhibit hall with your registration package.
The CVMA is excited to offer special reduced rates to com-memorate this inaugural event for veterinarians, a savings of 30% for the 2021 CVMA Convention. All attendees will have access to the virtual CVMA social evening, plus access to all continuing education hosted on the virtual platform until December 31, 2021 regardless of which registration package you choose.
In addition to offering new registration packages, and in recognition of the times, the CVMA has revised our cancella-tion policy to reduce your risk in registering early by extend-ing cancellation dates along with full refunds. Please visit the
Congrès de l’ACMV du 22 au 25 juillet 2021 Les temps changent, et le Congrès de l’ACMV s’adapte
L’Association canadienne des médecins vétérinaires (ACMV) vous invite, vous et les membres de votre équipe, à vous
joindre à vos collègues pour assister à notre premier Congrès hybride pour la profession vétérinaire. Cette année, le seul congrès vétérinaire national multi-espèces du Canada se tiendra à Calgary, en Alberta, du 22 au 25 juillet 2021.
Le Comité de perfectionnement professionnel de l’ACMV a modifié le programme et les forfaits d’inscription, et offrira pour la première fois une expérience virtuelle aux participants qui souhaitent profiter du Congrès en ligne dans le confort de leur domicile ou de leur bureau.
Vous en avez assez des rencontres sur Zoom et vous vous ennuyez des échanges en personne avec vos collègues? Les forfaits d’inscription pour assister au Congrès en personne offrent la possibilité de choisir une inscription pour certaines journées ou pour tous les jours de l’événement, et comprennent l’accès à la for-mation continue en personne et sur notre plateforme virtuelle ainsi qu’au salon des exposants. Comme votre santé et votre sécurité sont des priorités pour l’ACMV, nous sommes en communication constante avec nos partenaires à Calgary pour nous assurer de mettre en place les mesures nécessaires pour vous permettre de profiter du Congrès en toute tranquillité d’esprit. Vous trouverez d’ailleurs sur le site du Congrès des précisions concernant les précautions prises relativement à la COVID-19 (https://pheedloop.com/cvma21/site/covidfaq/).
Vous aimeriez participer au Congrès de l’ACMV mais vous ne pouvez pas vous déplacer en raison des restrictions de voyage ou vous préférez ne pas voyager? L’ACMV a travaillé avec diligence avec ses partenaires pour vous offrir la meilleure expérience virtuelle possible, qui vous permettra de bénéficier de la forma-tion continue, de visiter virtuellement le salon des exposants, et d’échanger avec vos pairs dans le confort de votre maison ou de votre bureau. Votre forfait d’inscription vous donnera accès à toutes les séances de formation continue et au salon des expo-sants virtuel.
L’ACMV est ravie d’offrir des tarifs réduits spéciaux pour célébrer cet événement hybride inaugural pour les médecins vétérinaires, représentant une économie de 30 % pour le Congrès
de l’ACMV de 2021. Tous les parti-cipants pourront assister à la soirée sociale virtuelle de l’ACMV et suivre toutes les séances de formation conti-nue offertes sur la plateforme virtuelle jusqu’au 31 décembre 2021, quel que soit le forfait d’inscription choisi.
En raison des moments incertains et inédits que nous vivons, l’ACMV a
FOR PERSONAL USE ONLY
16 CVJ / VOL 62 / JANUARY 2021
N
Chaque année, dans le cadre de son programme de remise de prix, l’Association canadienne des médecins vétérinaires
(ACMV) récompense fièrement des personnes qui ont accompli des réalisations remarquables, fait preuve d’un leadership exemplaire ou démontré un engagement indéfectible envers la communauté vétérinaire canadienne. Les candidatures pour les prix de l’ACMV de 2021 sont acceptées jusqu’au 31 janvier 2021.
« Proposez la candidature d’un collègue méritant pour l’un des prix très convoités de l’ACMV », suggère la Dre Enid Stiles, pré-sidente de l’ACMV pour 2020-2021. « Notre profession est com-posée de gens qui font une différence tous les jours — aidez-nous à féliciter les médecins vétérinaires exceptionnels du Canada. »
ADMISSIBILITÉLes candidats proposés pour les prix de l’ACMV (à l’exception de ceux qui sont nommés comme membres honoraires) doivent être membres l’ACMV, mais leur candidature peut être soumise par des personnes qui ne sont pas membres de l’ACMV. Vous connaissez sans doute un médecin vétérinaire extraordinaire — présentez sa candidature pour l’un des prestigieux prix de l’ACMV ci-dessous.
Through its annual awards program, the Canadian Veterinary Medical Association (CVMA) proudly recognizes individu-
als who demonstrated significant accomplishments, exemplary leadership, and tireless commitment to Canada’s veterinary community. Nominations for the 2021 CVMA Awards are being accepted until January 31, 2021.
“Nominate a deserving colleague for one of the CVMA’s prestigious awards today,” says Dr. Enid Stiles, 2020-21 CVMA president. “Please help us recognize Canada’s exceptional vet-erinarians. Our profession depends on our colleagues who are making a difference every day.”
AWARD ELIGIBILITYAward nominees (excluding those nominated for Honorary Membership) must be CVMA members for eligibility; however, non-CVMA members are eligible to nominate. Please consider your deserving colleagues and nominate one for a prestigious CVMA award:
Established by the CVMA in 1986, and sponsored by Merck Animal Health, the CVMA Humane Award recognizes leader-
également révisé sa politique d’annulation afin de réduire le risque associé à l’inscription hâtive en repoussant les dates limites d’annu-lation et en offrant des remboursements complets. Veuillez visiter le site Web du Congrès pour consulter notre politique d’annulation mise à jour (https://pheedloop.com/cvma21/site/registerfaq/).
Restez au courant de tous les détails concernant le Congrès grâce à l’application ou au site du Congrès (https://pheedloop.com/cvma21/site/), et visitez le site Web de l’ACMV pour vous inscrire avant la date limite de la période d’inscription hâtive (30 avril 2021) pour profiter des tarifs d’inscription réduits. Nous avons hâte de vous voir en personne ou virtuellement au Congrès de l’ACMV de 2021!
(par Sarah Cunningham, responsable du Congrès de l’ACMV)
Convention website to review our updated cancellation policy (https://pheedloop.com/cvma21/site/registerfaq/).
Stay up-to-date with the latest event details by downloading our Convention app or view it online at (https://pheedloop.com/cvma21/site/home/).Visit the CVMA website to register before the early bird deadline of April 30, 2021 to receive the discounted registration fees. We look forward to seeing you whether in-person or virtually at the 2021 CVMA Convention.
(by Sarah Cunningham, Manager, Conventions, CVMA)
2021 CVMA Awards Nominations Are Open!Prix de l’ACMV de 2021 La période de soumission de candidatures est commencée!
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 17
NCréé par l’ACMV en 1986 et parrainé par Merck Santé animale, le Prix humanitaire de l’ACMV reconnaît le leadership dans le domaine des soins et du bien-être des animaux. Le prix, qui consiste en une bourse de 1000 $ et une plaque, est présenté à un membre de l’ACMV dont le travail est réputé avoir grandement contribué au bien-être des animaux.
Créé en 1996, le Prix de l’industrie de l’ACMV souligne publiquement le rôle de l’industrie en médecine vétérinaire. Il reconnaît officiellement la contribution d’un membre de l’ACMV à l’avancement de la médecine vétérinaire.
Créé en 1985 et commandité par Merck Santé animale, le Prix vétérinaire Merck est remis à un membre de l’ACMV dont le travail en productions animales, en recherche clinique ou en sciences fondamentales a contribué de manière importante à l’avan-cement de la médecine et de la chirurgie des animaux destinés à la production d’aliments, y compris la régie de la santé des troupeaux. Le prix consiste en une bourse de 1000 $ et une plaque.
Parrainé par Petsecure assurance maladie pour animaux de compagnie, le Prix du praticien des petits animaux de l’ACMV est décerné à un membre de l’ACMV dont le travail en pratique des animaux de compagnie, en recherche clinique ou en sciences fondamentales représente une contribution importante à l’avan-cement de la médecine ou de la chirurgie des petits animaux ou à la gestion d’une pratique pour petits animaux. Le prix consiste en une bourse de 1000 $ et une plaque.
Créé en 2013, le Prix de la pratique de l’année de l’ACMV comporte une bourse de 1000 $ et une plaque. Il est parrainé par la Banque Scotia, chef de file des services bancaires pour les professionnels. Le prix récompense l’équipe d’une pratique vétérinaire pour ses réalisations exceptionnelles au sein de sa communauté locale. Ces réalisations peuvent inclure des innova-tions dans la prestation de services vétérinaires, l’engagement en faveur d’un meilleur équilibre entre le travail et la vie personnelle, une implication significative dans la vie communautaire ou pour un organisme de bienfaisance, ou encore la mise en œuvre de protocoles écoresponsables pour la pratique.
Le titre de membre à vie de l’ACMV est conféré à un membre de l’ACMV pour des services exceptionnels et de longue date au sein du Conseil, du Comité exécutif ou des autres comités de l’ACMV ou pour des contributions remarquables à la profession vétérinaire. Le membre à vie reçoit un certificat encadré et est invité à assister aux réunions de l’Association. Il ne sera pas tenu de payer de cotisation, mais jouira de tous les droits et privilèges des membres.
ship in the care and well-being of animals. The award, consisting of $1000 and a plaque, is presented to a CVMA member whose work is judged to have contributed significantly to the welfare and well-being of animals.
Instituted in 1996, the CVMA Industry Award publicly acknowledges and celebrates the role of industry in veterinary medicine. The award formally recognizes a CVMA member for their contributions to the advancement of veterinary medicine.
Established in 1985, and sponsored by Merck Animal Health, the Merck Veterinary Award is presented to a CVMA member whose work in food animal production practice, clinical research, or basic sciences is judged to have contributed significantly to the advancement of food animal medicine and surgery, includ-ing heard health management. The award consists of $1000 and a plaque.
Sponsored by Petsecure Pet Health Insurance, the CVMA Small Animal Practitioner Award is presented to a CVMA member whose work in small animal practice, clinical research or basic sciences is judged to have contributed significantly to the advancement of small animal medicine, surgery, or the management of a small animal practice. The award consists of $1000 and a plaque.
Established in 2013, the CVMA Practice of the Year Award consists of $1000 and a plaque, and is sponsored by Scotiabank, a leader in banking services for professionals. The award recog-nizes a veterinary practice team for outstanding achievement within their local community. Such achievements may include innovations in the provision of veterinary services, commit-ment to work-life balance, meaningful community or chari-table involvement, or the implementation of “green” practice procedures.
CVMA Life Membership is presented to a CVMA member for long and outstanding service on CVMA Council, Executive, Boards, and Committees or for outstanding contributions to the veterinary profession. The Life Member is presented with a framed certificate and shall be invited to attend meetings of the Association, and shall not be liable to pay dues, but shall enjoy all the rights and privileges of membership.
CVMA Honorary membership is presented to an indi-vidual who has rendered distinguished service to the profes-sion, whether residing in Canada or elsewhere. The Honorary Member does not pay fees and cannot vote at meetings or hold any elected office in the CVMA.
FOR PERSONAL USE ONLY
18 CVJ / VOL 62 / JANUARY 2021
N
L’Association canadienne des médecins vétérinaires (ACMV) a célébré sa 35e Semaine de la vie animale durant la première
semaine d’octobre. Des cliniques et des hôpitaux vétérinaires de partout au Canada y ont participé malgré les défis liés à la pan-démie de COVID-19, pour montrer comment les professionnels vétérinaires du Canada occupent des positions uniques au sein de la communauté nationale « Une santé » pour soutenir la lutte contre les maladies zoonotiques et comment la protection de la santé animale protège la santé de tous.
Merci à tous les étudiants et les membres des équipes vété-rinaires qui ont communiqué nos importants messages liés à la santé. Nous espérons que vous avez apprécié cette occasion supplémentaire d’échanger avec les propriétaires d’animaux.
The Canadian Veterinary Medical Association (CVMA) cel-ebrated its 35th Animal Health Week during the first week
of October. Clinics and animal hospitals participated across Canada, despite various challenges due to the COVID-19 pan-demic, to showcase how Canada’s veterinary professionals occupy unique positions within the national One Health community to support the fight against zoonotic diseases, and how protecting animal health protects everyone’s health.
Thank you to all veterinary team members and students who celebrated while drawing attention to our important health-related messages. We hope you enjoyed this added opportunity to further engage with your clients.
Le titre de membre honoraire de l’ACMV est conféré à une personne qui a rendu des services distingués à la profession, qu’elle réside au Canada ou ailleurs. Le membre honoraire ne paie pas de cotisation et ne peut pas voter lors des réunions ni occuper un poste élu au sein de l’ACMV.
DOSSIER DE MISE EN CANDIDATURELa sélection des récipiendaires est fondée uniquement sur les ren-seignements fournis dans le dossier de candidature. Veuillez suivre les étapes ci-dessous pour vous assurer que tous les documents requis sont inclus dans le dossier de candidature.1. Soumettre un formulaire de mise en candidature dûment
rempli. Le formulaire était inclus dans le numéro de novembre de La RVC et peut être téléchargé à partir de la section Prix de l’ACMV de notre site Web (www.veterinairesaucanada.net).
2. Inclure les pièces justificatives suivantes dans le dossier de candidature :• Description des principales réalisations professionnelles du
candidat (maximum de 1000 mots)• Lettres d’appui (maximum de 5 lettres de 500 mots ou
moins chacune)• Articles de journaux (s’il y a lieu; maximum de 2 articles
datant de moins de deux ans)• Articles rédigés par le candidat (maximum de 3 liens Web
vers des articles)Les dossiers de mise en candidature doivent être soumis
au plus tard le 31 janvier 2021 par courriel (communications@ cvma-acmv.org).
Veuillez visiter la section Prix de l’ACMV de notre site Web (www.veterinairesaucanada.net) ou communiquer avec nous par courriel ([email protected]) pour obtenir de plus amples renseignements.
NOMINATION PACKAGEAward recipient selection is based solely on the nomination package’s information. Please ensure all steps are followed and required documents are included:1. Submit a completed nomination form. This form was
included in the November issue of The CVJ and is also available in the CVMA Awards section of our website, (www.canadianveterinarians.net).
2. Include the following supporting documents:• Outline of nominee’s key professional accomplishments
(1000 words maximum)• Letters of support (5 letters, of 500 words or less, maximum)• Newspaper articles (if applicable; 2 articles, less than
2 years old, maximum)• Articles written by nominee (3 article web links maximum)Nomination packages are due by January 31, 2021, via
e-mail ([email protected]).Please visit the CVMA Awards section of the website (www.
canadianveterinarians.net) or e-mail (communications@ cvma-acmv.org) for further information.
2020 Animal Health Week Wrap-UpUnderstanding Zoonotic Diseases: Community Health — Animals and You
Bilan de la Semaine de la vie animale de 2020Comprendre les zoonoses : Santé communautaire – Les animaux et vous
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 19
NNous sommes ravis de la réussite de la Semaine de la vie animale cette année malgré la pandémie! Vous pouvez consulter les publications sur les réseaux sociaux de la Semaine de la vie animale en suivant #SemainedelaVieAnimale sur Facebook, Twitter et Instagram.
Marquez votre calendrier pour la campagne de la Semaine de la vie animale de 2021, qui se déroulera du 3 au 9 octobre.
Nos généreux commanditaires font partie intégrante du succès annuel de la Semaine de la vie animale et l’ACMV est très recon-naissante de pouvoir compter sur leur soutien. La campagne de la Semaine de la vie animale de 2020 a été parrainée par les com-manditaires principaux IDEXX et Merck Santé animale, ainsi que par les commanditaires iFinance Petcard, Petsecure assurance maladie pour animaux de compagnie et Virbac. Nous tenons également à remercier l’organisation TTVAC (Technologues et techniciens vétérinaires agréés du Canada) pour leur partenariat et leur appui continu.
Visitez notre site Web (www.veterinairesaucanada.net) pour en savoir plus sur la Semaine de la vie animale.
We are thrilled with this year’s Animal Health Week success, even during a Pandemic! Check out Animal Health Week social media posts by following #AnimalHealthWeek on Facebook, Twitter, and Instagram.
Mark your calendar for the 2021 Animal Health Week cam-paign, taking place from October 3 to 9.
Our generous sponsors are integral to the annual success of Animal Health Week and deserve gracious recognition. Thank you to our 2020 Animal Health Week sponsors: Program Plus Sponsors, IDEXX and Merck Animal Health, and Program Sponsors, iFinance Petcard, Petsecure Pet Health Insurance, and Virbac. We would also like to thank the Registered Veterinary Technologists and Technicians of Canada for their continued partnership and support.
Please visit (www.canadianveterinarians.net) to learn more about Animal Health Week.
FOR PERSONAL USE ONLY
20 CVJ / VOL 62 / JANUARY 2021
N
Il ne fait aucun doute que la pandémie a bouleversé notre mode de vie. Par exemple, la façon dont nous magasinons, dépensons
et interagissons les uns avec les autres a été complètement trans-formée en quelques mois. D’ailleurs, une enquête mondiale d’Ernst & Young (1) a révélé que 42 % des consommateurs pensent que leurs habitudes d’achat vont radicalement changer en raison de la COVID-19.
Chez Moneris, nous croyons que les trois pratiques décrites ci-dessous vont perdurer après la pandémie.
Achats en ligneLa nécessité de respecter la distanciation sociale lors du maga-sinage a modifié les habitudes d’achat en ligne, comme le démontrent les dépenses de consommation en hausse de 30,1 % par rapport à 2019. Les achats en ligne de médicaments en vente libre, de produits d’épicerie, d’articles ménagers et de produits de soins personnels ont augmenté de 35 % (2).
Si votre établissement vétérinaire vend quelque produit que ce soit, des diètes spécialisées aux articles de toilettage, offrir ces articles en ligne pourrait vous donner une source additionnelle de revenus. Vos clients se tournent vers Internet pour rechercher ces produits, alors assurez-vous qu’ils sachent que vous y êtes.
Conseil : Faire en sorte que vos produits ou services soient disponibles en ligne est plus facile que jamais avec Moneris Online.
Ramassage au point de venteLe ramassage des commandes au point de vente simplifie les achats en permettant aux clients de magasiner en toute sécurité, quand et où ils le souhaitent. Permettre à vos clients de comman-der en ligne et de récupérer leur commande à votre établissement vétérinaire peut vous aider à économiser sur les frais d’expédition, à écouler vos stocks et à augmenter vos ventes totales de 23 % en moyenne (3).
There’s no doubt that the pandemic has changed our way of life. The way we shop, spend money, and interact with each
other has drastically changed in a matter of months. A global survey from Ernst & Young (1) also found that 42% of consum-ers believe the way they shop will fundamentally change due to COVID-19.
Below are 3 pandemic-driven buying habits that the people at Moneris think are here to stay after COVID-19.
Shopping onlineThe need to shop in a socially distant way has accelerated online shopping habits, with consumer spending up 30.1% from 2019. Online shopping for over-the-counter (OTC) medicine, grocer-ies, household supplies, and personal-care product purchasing has grown by 35% (2).
If your practice carries anything from specialty foods to grooming aids, getting this assortment online can provide you with another revenue source. Your customers are taking to the internet to search for these products, so make sure they know you’re there.
Tip: Ensuring your product or service is available online is easier than ever with Moneris Online.
Curbside pickupCurbside pickup simplifies shopping by allowing customers to browse through your products safely, whenever and wherever they want. Allowing customers to order online and pick up at your physical location can help you save on shipping costs, utilize in-store inventory, and increase overall sales by an aver-age of 23% (3).
Curbside drop-off and pickup is already an integral part of the new normal for veterinarians across the country. By giving your customers the ability to pick up Fluffy and a new bag of
CVMA Partner, Moneris Reviews the 3 Pandemic Shopping Habits they Say are Here to StayMoneris, un des partenaires de l’ACMV, examine les trois habitudes d’achat prises en situation de pandémie qui vont probablement rester
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 21
NLa prise en charge des animaux à l’extérieur de l’établissement fait déjà partie intégrante de la nouvelle norme pour les médecins vétérinaires partout au pays. En donnant à vos clients la possibilité de venir chercher un nouveau sac de nourriture en même temps que Fluffy, vous créez une opportunité de générer des revenus supplémentaires avec un effort minime.
Conseil : Rendez l’expérience de ramassage au point de vente aussi fluide que possible avec de la signalisation sur place et des courriels ou des textos de confirmation pour informer les clients que leur commande est prête.
Mesures sanitairesAvec une attention accrue portée à la désinfection, de nombreuses personnes appliquent davantage de mesures sanitaires dans leurs entreprises. C’est difficile à imaginer aujourd’hui, mais peu de gens pensaient à désinfecter leurs terminaux de transaction avant la pandémie.
Même lorsque la pandémie prendra fin, on peut s’attendre à ce que nous continuions d’être conscients de notre espace per-sonnel, de l’importance du lavage des mains et de ce que nous nous sentons à l’aise de toucher (poignées de porte, rampes, comptoirs, etc.).
Conseil : Parcourez notre sélection d’équipements de pro-tection sur notre site Web (shop.moneris.com) pour rendre votre personnel et vos clients plus à l’aise.
Les représentants des ventes de Moneris peuvent vous aider à répondre aux besoins de vos clients d’aujourd’hui et de demain. Communiquez avec nous au 1-888-552-0341.
1. Maya Vautier. Four consumer behavior trends emerge during the
COVID-19 pandemic, the first EY Future Consumer Index finds. Cision
PR Newswire, avril 2020. Disponible au : www.prnewswire.com/
her favorite food at the same time, you’re creating a revenue opportunity with minimal effort.
Tip: Make your curbside pickup experience as smooth as pos-sible with onsite signage, confirmation e-mails or text messages to let your customer know their order is ready.
Hygiene habitsWith a heightened focus on sanitization, many people are imple-menting more health and hygiene practices around their busi-nesses. It’s hard to imagine, but most businesses rarely thought to sanitize their POS (point of sale) devices before the pandemic.
Whenever the pandemic ends, it’s safe to say we’ll continue to be conscious about our personal space, our hand washing ten-dencies, and what we feel comfortable touching (door handles, handrails, counter-tops, etc.)
Tip: Browse our selection of protective equipment at (shop.moneris.com) to provide more comfort to your staff and customers.
Let Moneris sales representatives help you meet the needs of your customers today and tomorrow. Get in touch at 1-888-552-0341.
1. Maya Vautier. “Four consumer behavior trends emerge during the COVID-19 pandemic, the first EY Future Consumer Index finds,” Cision PR Newswire, April 2020. Available from: www.prnewswire.com/news-releases/four-consumer-behavior-trends-emerge-during-the-covid-19-pandemic-the-first-ey-future- consumer-index-finds-301045840.html Last accessed November 10, 2020.
2. Tamara Charm, Becca Coggins, Kelsey Robinson, Jamie Wilkie. “The great consumer shift: Ten charts that show how US shopping behav-ior is changing,” McKinsey & Company, August 2020. Available from: www.mckinsey.com/business-functions/marketing-and-sales/our-insights/the-great-consumer-shift-ten-charts-that-show-how-us-shopping-behavior-is-changing# Last accessed November 10, 2020.
3. The Eight Benefits of Curbside Pickup, Tecsys, April 2020. Available from: www.tecsys.com/blog/2020/04/the-eight-benefits-of-curbside-pickup/ Last accessed November 10, 2020.
FOR PERSONAL USE ONLY
22 CVJ / VOL 62 / JANUARY 2021
Case Report Rapport de cas
Hand-assisted laparoscopic cystotomy for cystic calculus removal in male horses (3 cases)
Alejandro Merchan, Elizabeth J. Barrett, Dwayne H. Rodgerson
Abstract — A technique for hand-assisted laparoscopic removal of cystic calculi in male horses is described. Three cystic calculi ranging from 5 to 10 cm in diameter were removed successfully using bilateral para-inguinal laparoscopic portals assisted by a human hand within the abdomen, effectively sealing the midline incision. Long-term follow-up information obtained from referring veterinarians and owners indicated that the patients returned to their previous activity level and had no recurrence of clinical signs in the following 6 to 12 months.
Key clinical message:Hand-assisted recumbent laparoscopy is a satisfactory surgical technique for removal of cystic calculi in horses which cannot be operated on standing or whose body condition would make the parainguinal approach difficult.
Résumé — Cystotomie laparoscopique aidée de mains pour le retrait de calculs cystiques chez des chevaux mâles (3 cas). Une technique pour le retrait de calculs cystiques par laparoscopie aidée de mains chez des chevaux mâles est décrite. Trois calculs cystiques variant de 5 à 10 cm de diamètre furent retirés avec succès en utilisant des entrées laparoscopiques bilatérales para-inguinales aidées d’une main humaine à l’intérieur de l’abdomen, scellant avec succès l’incision sur la ligne médiane. Les informations sur le suivi à long terme obtenues des vétérinaires référant et des propriétaires indiquaient que les patients étaient retournés à leur niveau d’activité antérieur et qu’aucune récurrence des signes cliniques ne fut notée dans les 6 à 12 mois suivants.
Message clinique clé :La laparoscopie couchée aidée de mains est une technique chirurgicale satisfaisante pour le retrait de calculs cystiques chez des chevaux qui ne peuvent être opérés debout ou dont la condition corporelle rendrait l’approche para-inguinale difficile.
(Traduit par Dr Serge Messier)Can Vet J 2021;62:22–26
U rolithiasis has been extensively described in horses. Its prevalence is low with cystic calculi being the most com-
mon urolith in aged male horses (1–3). Clinical signs include hematuria, tenesmus, incontinence, dysuria, stranguria, pol-lakiuria, and oliguria. Diagnosis is based on rectal palpation, transrectal ultrasonography, and cystoscopy (2,4,5).
In contrast to mares in which a transurethral approach can be used (6), calculus removal in geldings requires a surgi-cal approach (3). Over the years, numerous techniques and approaches have been described for the treatment of cystic calculi in horses including standing perineal urethrotomy (PU) (1,2,7,8), standing pararectal cystotomy (1,9,10), lapa-
rocystotomy (11–13), laparoscopy (14,15), disruption with holium:YAG laser (16), and ballistic shock wave lithotripsy (17). No matter the approach selected, the goal of surgery is to remove the calculus completely from the urinary tract and allow the horse to return to function quickly with minimal trauma or contamination of the urinary tract and abdomen (5).
This report describes the use of a hand-assisted laparoscopic technique for removal of variably sized cystic calculi in 3 middle-aged geldings. Traditionally, a parainguinal approach could be used in these geldings wherein a 13- to 15-cm skin incision is made parallel and slightly axial to the external inguinal ring. The aponeurosis of the external abdominal oblique muscle is then sharply dissected, and the internal abdominal oblique bluntly separated before entering the peritoneum (3). The bladder is then stretched to the level of the incision using gentle traction, with or without the use of hydrodistension (18). In heavily muscled horses or those with a high body condition score, the authors have found this technique to be particularly challenging. Fragmentation through a perineal urethrotomy as an alternate technique for larger uroliths is associated with higher rates of reoccurrence (2). To circumvent the difficulties associated with either of these techniques a laparoscopic technique was described by Ragle (19) utilizing 5 instrument portals. This technique
Ontario Veterinary College, University of Guelph, Guelph, Ontario (Merchan); Davidson Surgery Center, Hagyard Equine Medical Institute, Lexington, Kentucky, USA (Barrett, Rodgerson).Address all correspondence to Dr. Elizabeth J. Barrett; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 23
CA
SE
RE
PO
RT
improved on previously described methods by providing direct visualization and tension-free manipulation of the bladder (20). Our goal was to simplify this technique by introducing an opera-tor’s hand into the abdomen at the start of surgery through a small umbilical incision (through which the calculus would eventually be removed) to aid in manipulations and decrease the required portals to 2. Abdominal contamination through spillage of bladder contents is a risk with intra-corporeal calculi removal. However, this risk can be minimized with a number of techniques, including preoperative bladder lavage, and the open-ing of the bladder over a laparoscopic retrieval pouch similar to that used in the traditional laparoscopic approach (19).
Hand-assisted laparoscopic surgery in horses has been described previously for left and right-sided nephrectomy (21–23), ovariec-tomy (24–26), ovariohysterectomy (27,28), partial hysterectomy, adhesiolysis (29), and mesenteric rent repair (30). Hand-assisted laparoscopy for cystic calculi removal has not been reported. The purpose of this manuscript was to describe the technique and report the outcome in 3 geldings with cystic calculi.
Case descriptionsCase 1A 10-year-old, 500-kg Quarter Horse gelding was evaluated at Hagyard Equine Medical Institute because of a history of strain-ing/posturing to urinate, hematuria, and frequent urination. Upon admission, the horse was quiet, alert, and responsive, and his vitals were within normal limits. Preoperative assessment included rectal examination, which revealed an approximately 10 cm-diameter firm structure within the urinary bladder. Complete blood (cell) count (CBC) and serum biochemistry were normal. No urinalysis was performed. Bladder endoscopy identified what appeared to be a type 1 cystic calculus. Prior to surgery, with the horse in standing position, the bladder was lavaged with sterile saline solution to remove any loose debris.
Feed had been withheld for 18 h. Before surgery, pro-caine penicillin (Pro-Pen-G Sterile Penicillin G Procaine; Bimeda, Oakbrook Terrace, Illinois, USA), 22 000 IU/kg body weight (BW), IM, gentamicin (Gentamicin Sulfate; Vet One, Boise, Idaho, USA), 6.6 mg/kg BW, IV, flunixin meglumine (Banamine; Merck, Kenilworth, New Jersey, USA), 1.1 mg/kg BW, IV, and tetanus toxoid (Tetanus toxoid; Zoetis, Charles City, Iowa, USA), 1 mL, IM, were administered.
The horse was sedated with xylazine (Anased; Vet One), 1.1 mg/kg BW, IV, induced with ketamine (Narketan; Vétoquinol, Fort Worth, Texas, USA), 2.5 mg/kg BW, IV, and diazepam (Diacepam; Pfizer, New York, New York, USA), 0.05 mg/kg BW, IV, placed in dorsal recumbency, and maintained with isoflurane (Isoflurane; Piramal, Lexington, Kentucky, USA) in 100% oxygen. The penis was exteriorized, cleaned and directed caudally away from the surgical field but was not catheterized. The horse’s hind limbs were secured to a wide wooden bar with straps around the pastern region. The wooden bar maintains separation of the hind limbs and is attached to a hoist allowing the hind end to be lifted off the surgical table into a Trendelenburg position.
The surgeon was positioned on the left side of the horse and the assistant on the right side. After aseptic preparation
and draping, a 5- to 10-cm skin incision was made, just large enough to allow passage of the surgeon’s arm, centered over the umbilicus through the skin, subcutaneous tissue, and linea alba (Figure 1A). Following this midline incision, two 15-mm skin incisions were made paramedian (Figure 1B) and parainguinal (Figure 1C) on the left side for the instrument portal and lapa-roscopic camera, respectively. With a hand in the abdomen to guard against trauma, a laparoscopic sleeve with a sharp trocar unit (11-mm diameter, 100-mm length) (Karl Storz Veterinary Endoscopy, Goleta, California, USA) was inserted through the parainguinal incision perpendicular to the musculature followed by a second laparoscopic sleeve with a sharp trocar unit (11-mm diameter, 100-mm length) (Karl Storz Veterinary Endoscopy) in the paramedian region. A 0° 10-mm diameter, 30-cm long laparoscope (Karl Storz Veterinary Endoscopy) was inserted through the parainguinal cannula. Next, with the left hand within the abdomen effectively sealing the midline inci-sion, the abdominal cavity was insufflated directly through the laparoscope with CO2 to an intra-abdominal pressure of 10 to 15 mmHg to provide further visualization. This pressure was easily maintained as long as the surgeon’s hand was within the abdomen. Re-insufflation was performed as necessary whenever the surgeon removed the hand from the incision for various reasons throughout the procedure. The horse was placed in Trendelenburg position using the hoist as described earlier to displace the abdominal viscera cranially.
The apex of the bladder was grasped with the surgeon’s right hand and urine was aspirated using a 50-cm long laparo-scopic injection needle (Injection needle; Karl Storz Veterinary Endoscopy) through the paramedian portal. Laparoscopic scissors (Clickline Scissors, rotating, robust, serrated, single action jaws, size 10 mm, length 43 cm) (Karl Storz Veterinary Endoscopy) were then placed through the paramedian canula and used to perform intracorporeal cystotomy beginning at the location of
Figure 1. Patient in dorsal recumbency showing ventral abdominal incision over the umbilicus (A), left paramedian laparoscopic instrument portal (B) used in Case 1, left parainguinal laparoscopic camera portal (C) used in the 3 cases, right parainguinal laparoscopic instrument portal (D) used in Cases 2 and 3.
FOR PERSONAL USE ONLY
24 CVJ / VOL 62 / JANUARY 2021
RA
PP
OR
T D
E C
AS
the defect created by the laparoscopic needle. The cystic calculus was then manually removed (Figure 2). Minimal abdominal con-tamination, considered to be a few milliliters of urine, was noted. The cystotomy was sutured with hand assistance using a 2-layer continuous Lembert pattern with 2-0 poliglecaprone on a tapered needle (Monocryl; Ethicon, Blue Ash, Ohio, USA) (Figure 3). The suture pattern was started with a modified Roeder knot and final knot was tied intra-corporeal. The suture was carried into the abdomen through the midline incision, and then grasped with 5 mm, straight handled needle forceps (KOH Macro Needle Holder, jaws straight, size 5-mm, length 43-cm) (Karl Storz Veterinary Endoscopy) within the abdomen to suture the blad-der. The linea alba was closed with USP 3 polyglactin 910 on a reverse cutting needle (Vicryl; Ethicon) in a simple continuous pattern and the skin was sutured with USP 0 poliglecaprone on a reverse cutting needle (Monocryl; Ethicon) in a continuous hori-zontal mattress. The skin of the laparoscopic portals was closed in a simple continuous pattern with USP 0 poliglecaprone on a reverse cutting needle (Monocryl; Ethicon). Topical antimicrobial gel (Biozide; Performance Product, St. Louis, Missouri, USA) was applied over the incisions. Anesthesia and surgery times were 100 and 80 min, respectively. After surgery, the patient was administered trimethoprim-sulfamethoxazole (Equisul-SDT; Aurora Pharmaceutical, Northfield, Minnesota, USA), 25 mg/kg BW, PO, q12h for 2 wk. The horse was returned to normal feed-ing within 8 h of recovery from anesthesia. No postoperative discomfort or fever occurred. On the 2nd day, there was minor incisional swelling that did not require treatment. The horse was discharged 2 d after surgery. He was restricted to stall rest with hand walking for 2 wk, followed by small paddock turnout for a further 6 wk before beginning a gradual return to exercise. The horse lived at pasture, so no long-term feeding recommendations were made.
The ventral abdominal incision and laparoscopic portals were monitored for swelling or discharge. The referring veterinar-ian repeated the rectal palpation every 4 to 6 mo to check the bladder for the development of another calculus. The horse was also monitored for recurrence of hematuria, stranguria, or pollakiuria.
Long-term follow-up information obtained from the referring veterinarian and owner indicated that the horse had returned to its previous activity level and had had no recurrence of clinical signs in the following year.
Case 2A second 10-year-old, 500-kg Quarter Horse gelding was referred to Hagyard Equine Medical Institute for cystic calculus removal. The referring veterinarian evaluated the horse for signs of stranguria and diagnosed an approximately 9-cm calculus via rectal palpation. A urine culture performed by the referring veterinarian did not yield any bacteria.
Upon admission, the horse was quiet, alert, and responsive. Preoperative assessment included physical examination; on rectal examination an approximately 10 cm-diameter firm structure was palpable within the bladder. The CBC and serum biochem-istry were normal.
The owners were offered hand-assisted laparoscopic cys-totomy for removal of the calculus under general anesthesia and they elected this procedure.
Prior to surgery, the horse was sedated, and the bladder was irrigated standing with sterile saline until it ran clear. The pre-surgical treatment and positioning of the horse was identical to that of the patient in case 1. However, the surgeon was posi-tioned on the right side of the horse and the assistant on the left (Figure 4). The abdomen was entered as in the previous case. In contrast to the previous surgery, in this animal the 15-mm skin incision for the laparoscopic camera was made in the left parainguinal region (Figures 4C and 1C) and the instrument portal was placed in the right parainguinal region (Figures 4D and 1D). This allowed the assistant to control the viewing window, leaving the primary surgeon free to use both hands to complete the operation. The horse was placed in Trendelenburg position to displace the abdominal viscera cranially. The sur-geon’s left hand was placed in the abdomen and the urinary bladder and associated structures were identified.
In contrast to the previous surgery, the apex of the bladder was grasped with the surgeon’s left hand, the needle to aspi-rate urine and the laparoscopic scissors were placed through the right-sided portal. The cystic calculus was then manually removed en bloc. In this case, some small fragments of the calcu-lus were shed into the abdomen. These were carefully removed from the abdominal wall with saline-moistened 4 3 4 gauze. The cystotomy was sutured with hand assistance with a single layer of continuous Lembert pattern using USP 0 poliglecaprone on a tapered needle (Monocryl; Ethicon). The linea alba was
Figure 2. Laparoscopic image showing the bladder and cystotomy site prior to removal of the calculus.
closed with USP 3 polyglactin 910 on a reverse cutting needle (Vicryl; Ethicon) in a simple continuous pattern and the skin was sutured with USP 0 poliglecaprone on a reverse cutting needle (Monocryl; Ethicon) in a continuous horizontal mattress. The skin of the laparoscopic portals was closed in a simple con-tinuous pattern with USP 0 poliglecaprone on a reverse cutting needle (Monocryl; Ethicon). Anesthesia and surgery times were 90 and 70 min, respectively.
After surgery, the patient was administered trimethoprim-sulfamethoxazole (Equisul-SDT; Aurora Pharmaceutical), 25 mg/kg BW, PO, q12h, for 2 wk and flunixin meglumine (Banamine; Merck), 1.1 mg/kg BW, PO, q24h, for 3 d. The horse was returned to normal feeding within 8 h after recovery from anesthesia and was discharged the day after surgery. He was restricted to stall rest with hand walking for 2 wk, followed by small paddock turnout for a further 6 wk before beginning a gradual return to exercise.
Long-term follow-up information obtained from the referring veterinarian and owner indicated that the horse had returned to its previous activity level and had had no recurrence of clinical signs in the last 6 mo.
Case 3The final patient was a 17-year-old, 300 kg mixed breed pony gelding. He was presented to Hagyard Equine Medical Institute for hematuria after exercise and stranguria.
Upon admission, the pony was quiet, alert, and responsive. Preoperative assessment included physical examination, and on rectal palpation, a small firm structure was palpable within the bladder. Rectal urinary bladder ultrasonography and cysto-scopic examination confirmed that the mass identified on rectal examination was a calculus. Rectal ultrasonography confirmed
the presence of an approximately 5-cm diameter calculus. In addition, cystoscopic images revealed marked injury of the mucosal surface of the urinary bladder. The CBC and serum biochemistry were normal; the bladder was flushed with 1 L of sterile saline after endoscopic examination.
Hand-assisted laparoscopic cystotomy for removal of the cal-culus under general anesthesia was offered and accepted by the owners. Pre-surgical and surgical procedures were identical to those for case 2. However, overall anesthetic and surgical times were significantly decreased to 45 and 30 min, respectively.
After surgery, the patient was administered trimethoprim- sulfamethoxazole (Equisul-SDT; Aurora Pharmaceutical), 25 mg/kg BW, PO, q12h, for 2 wk and flunixin meglumine (Banamine; Merck), 1.1 mg/kg BW, PO, q24h, for 3 d. The pony was returned to normal feeding within 8 h after recovery from anesthesia and was discharged within 2 d after surgery. Twelve hours after surgery he experienced a mild febrile epi-sode (39.2°C) that responded to flunixin meglumine and did not reoccur. He was restricted to stall rest with hand walking for 2 wk, followed by small paddock turnout for a further 6 wk before beginning a gradual return to exercise.
Long-term follow-up information obtained from the referring veterinarian and owner indicated that the horse had healed well and was still on small paddock rest 6 wk after surgery.
DiscussionIn this report, a hand-assisted laparoscopic approach to bladder stone removal in 3 geldings is described. This technique was developed due to concerns within our practice about the ability to easily break up and remove calculi fragments without undue trauma to the urinary tract, as well as to mitigate the awkward-ness associated with the limited access of other abdominal approaches (2,3,11–14). Hand-assisted laparoscopic techniques give the surgeon the advantage of having tactile sensation during surgery and do not require the bladder to be stretched as with previously described techniques (3,11). The surgeon’s hand can be used as a retractor, elevator, dissector, and hemostatic instrument. In horses, the use of traditional laparoscopic instru-ments may not be the most efficient method of manipulating large soft tissue structures (31). In these geldings, the bladder was a small viscus to handle. The placement of a hand in the abdomen allowed for easy and efficient intra-corporeal work, especially for suturing.
Advantages of this technique over traditional surgical approaches include better visualization of the bladder and no trauma to the urethral mucosa. The hand-assisted laparoscopic technique allows manipulation of the bladder with minimal tension.
The technique also avoids known disadvantages of laparocys-totomy, especially the need to reflect the prepuce or use a para-preputial skin incision to expose the ventral abdomen (3,11). For these approaches, the location of the external pudendal and caudal superficial epigastric blood vessels necessitates careful dissection and ligation. In this case, the celiotomy incision on the ventral midline was limited to a size large enough for the surgeon’s hand. No hand access ports were required; capnoperi-toneum was effectively maintained when the surgeon’s hand was
Figure 4. Case 2 showing surgeon positioned on the right side of the horse and the assistant on the left. The abdomen is entered through a midline incision with the surgeon’s left hand (A). The laparoscopy instrument (laparoscopic needle driver) is on the right parainguinal area (B), and the laparoscopic camera is on the left parainguinal area (C).
FOR PERSONAL USE ONLY
26 CVJ / VOL 62 / JANUARY 2021
RA
PP
OR
T D
E C
AS
within the ventral midline incision. Positioning a hand within the abdomen facilitated protection of viscera during laparoscopic portal placement and stabilization of the bladder during urine aspiration and suturing.
Röcken et al (14) postulated that the laparoscopic technique reported by Ragle (19) had disadvantages such as the need for specialized instruments, experience with intracorporeal suturing, and the risk of potential peritoneal contamination. While our technique attempts to simplify the traditional lapa-roscopic approach, intra-abdominal contamination during urolith removal is still a major concern. Although none of our horses experienced post-operative complications, a culture of the urine is recommended prior to surgery. Additional measures to prevent or reduce the risk of abdominal contamination would include the use of a retrieval pouch placed under the bladder during calculi removal, lavage of the abdomen prior to closure, and placement of an abdominal drain to lavage the abdomen after surgery.
Limitations in our study include the low number of cases. The technique was adjusted after the first case, changing posi-tion of the surgeon from the left side of the horse to the right and moving the paramedian instrument portal from the left side to a right parainguinal portal. Surgery time was consider-ably reduced in cases 2 and 3, which was partly due to using a single layer closure of the bladder. Although a double-layer closure is traditionally performed, the second layer was omitted in these cases to decrease surgical time in the Trendelenburg position. There is an ex-vivo study in equine bladders that found no difference in a single- versus a double-layer clo-sure (32). Similar studies exist for canine and feline bladders as well (33). Additional variations to improve the procedure could include automatic suture devices or the use of barbed suture to help decrease surgical time and still perform a 2-layer closure (32,34,35). The authors admit there is a moderate degree of technical difficulty associated with this technique, but feel it is less than the difficulty associated with the traditional laparoscopic technique.
AcknowledgmentsThe authors gratefully acknowledge Jenna Donaldson (Rotenberg Veterinary Professional Corporation) and Marcos Pérez-Nogués (University of California — Davis) for their assistance and support. CVJ
References 1. Hackett R, Vaughn J, Tennant B. Diseases of the urinary bladder.
In: Mansmann R, McAllister E, eds. Equine Medicine and Surgery. 3rd ed. Santa Barbara, California: American Veterinary Publications, 1982:912–921.
2. Laverty S, Pascoe JR, Ling G V, Lavoie JP, Ruby AL. Urolithiasis in 68 Horses. Vet Surg 1992;21:56–62.
3. Beard W. Parainguinal laparocystotomy for urolith removal in geldings. Vet Surg 2004;33:386–390.
5. Duesterdieck-Zellmer KF. Equine urolithiasis. Vet Clin North Am Equine Pract 2007;23:613–629.
6. Firth EC. Urethral sphincterotomy for delivery of vesical calculus in the mare: A case report. Equine Vet J 1976;8:99–100.
7. Hanson RR, Poland HM. Perineal urethrotomy for removal of cystic calculi in a gelding. J Am Vet Med Assoc 1995;207:418–420.
8. Kelmer G. Perineal urethrotomy in males. In: Wilson DA, Kramer J, Constantinescu GM, Branson KR, eds. Manual of Equine Field Surgery. St. Louis, Missouri: Saunders. 2006:211–214.
9. Van Dongen PL, Plenderleith RW. Equine urolithiasis: Surgical treatment by Gökels pararectal cystotomy. Equine Vet Educ 1994;6: 186–188.
10. Abuja GA, García-López JM, Doran R, Kirker-Head CA. Pararectal cys-totomy for urolith removal in nine horses. Vet Surg 2010;39:654–659.
11. Watts AE, Fubini SL. Modified parainguinal approach for cystic calculus removal in five equids. Equine Vet J 2013;45:94–96.
12. Lowe JE. Surgical removal of equine uroliths via the laparocystotomy approach. J Am Vet Med Assoc 1961;139:345–348.
13. Wright J NP. Laparo-cystotomy for urinary calculus in a gelding. Vet Rec 1960;72:301–303.
14. Röcken M, Stehle C, Mosel G, Rass J, Litzke LF. Laparoscopic-assisted cystotomy for urolith removal in geldings. Vet Surg 2006;35:394–397.
15. Katzman SA, Vaughan B, Nieto JE, Galuppo LD. Use of a laparoscopic specimen retrieval pouch to facilitate removal of intact or fragmented cystic calculi from standing sedated horses: 8 cases (2012–2015). J Am Vet Med Assoc 2016;249:304–310.
16. Judy CE, Galuppo LD. Endoscopic-assisted disruption of urinary calculi using a holmium:YAG laser in standing horses. Vet Surg 2002;31:245–250.
17. Koenig J, Hurtig M, Pearce S, Henderson J, Morris T. Ballistic shock wave lithotripsy in an 18-year-old Thoroughbred gelding. Can Vet J 1999;40:185–186.
18. Russell T, Pollock PJ. Local anesthesia and hydro-distension to facilitate cystic calculus removal in horses. Vet Surg 2012;41:638–642.
19. Ragle CA. Dorsally recumbent urinary endoscopic surgery. Vet Clin North Am Equine Pract 2000;16:343–350.
20. Lund CM, Ragle CA, Lutter JD. Laparoscopic removal of a bladder urolith in a standing horse. J Am Vet Med Assoc 2013;243:1323–1328.
21. Keoughan CG, Rodgerson DH, Brown MP. Hand-assisted laparoscopic left nephrectomy in standing horses. Vet Surg 2003;32:206–212.
22. Röcken M, Mosel G, Stehle C, Rass J, Litzke LF. Left- and right-sided laparoscopic-assisted nephrectomy in standing horses with unilateral renal disease. Vet Surg 2007;36:568–572.
23. Hilton HG, Aleman M, Maher O, Peterson TS, Whitcomb MB, Galuppo LD. Hand-assisted laparoscopic nephrectomy in a standing horse for the management of renal cell carcinoma. Equine Vet Educ 2008;20:239–244.
24. Goodin JT, Rodgerson DH, Gomez JH. Standing hand-assisted lapa-roscopic ovariectomy in 65 mares. Vet Surg 2011;40:90–92.
25. Ragle CA, Southwood LL, Hopper SA, Buote PL. Laparoscopic ovari-ectomy in two horses with granulosa cell tumors. J Am Vet Med Assoc 1996;209:1121–1124.
26. Rodgerson DH, Brown MP, Watt BC, Keoughan CG, Hanrath M. Hand-assisted laparoscopic technique for removal of ovarian tumors in standing mares. J Am Vet Med Assoc 2006;220:1503–1507.
27. Delling U, Howard RD, Pleasant RS, Lanz OI. Hand-assisted laparo-scopic ovariohysterectomy in the mare. Vet Surg 2004;33:487–494.
28. Janicek JC, Rodgerson DH, Boone BL. Use of a hand-assisted laparo-scopic technique for removal of a uterine leiomyoma in a standing mare. J Am Vet Med Assoc 2006;225:911–914.
29. Delling U, Stoebe S, Brehm W. Hand-assisted laparoscopic adhesiolysis of extensive small intestinal adhesions in a mare after breeding injury. Equine Vet Educ 2012;24:545–551.
30. Witte TH, Wilke M, Stahl C, Haralambus R, Straub R. Technique for closure of an extensive mesojejunal rent in a horse. J Am Vet Med Assoc 2013;243:1166–1169.
31. Dechant JE, Hendrickson DA. Standing female equine urogeni-tal endoscopic surgery. Vet Clin North Am Equine Pract 2017;16: 301–315.
32. Major DS, Duff AH, Cohen ND, Hardy J. Ex vivo comparison of single-layer and double-layer laparoscopic closure of equine bladders with 2 types of barbed sutures. Vet Surg 2017;46:1145–1153.
33. Thieman-Mankin KM, Ellison GW, Jeyapaul CJ, Glotfelty-Ortiz CS. Comparison of short-term complication rates between dogs and cats undergoing appositional single-layer or inverting double-layer cystotomy closure: 144 cases (1993–2010). J Am Vet Med Assoc 2012;240:65–68.
34. Ruzickova P, Burns P, Piat P, Frasch MG, Beauchamp G, Elce YA. Ex vivo biomechanical comparison of 4 suture materials for laparoscopic bladder closure in the horse. Vet Surg 2016;45:374–379.
35. Duffy DJ, Kindra CG, Moore GE. Comparison of initial leak pres-sures after single- and double-layer cystotomy closure with barbed and nonbarbed monofilament suture material in an ex vivo ovine model. Vet Surg 2019;48:424–430.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 27
Case Report Rapport de cas
Orbital apex syndrome secondary to an orbital sarcoma in a dog
Jayden Robert, Filipe Espinheira Gomes, Ian Porter, Julia P. Sumner
Abstract — A 12-year-old castrated male cocker spaniel dog was presented with a 4-week history of left episcleral injection and pawing at the face. Clinical examination findings included left internal and external ophthalmoplegia, left dorsal strabismus, pain opening the mouth, and intermittent amaurosis. Imaging studies revealed a left orbital apex mass with adjacent sphenoid bone lysis and extension into the cranial cavity. A left exenteration was performed and histopathology confirmed an orbital soft tissue sarcoma.
Key clinical message:This report describes an orbital tumor causing orbital apex syndrome. This condition should be differentiated from cavernous sinus syndrome as the latter does not course with optic neuropathy.
Résumé — Syndrome de l’apex orbitaire secondaire à un sarcome orbitaire chez un chien. Un épagneul mâle castré âgé de 12 ans fut présenté avec une histoire d’injection épisclérale gauche et frottage de la face d’une durée de 4 semaines. Les trouvailles de l’examen clinique incluaient une ophtalmoplégie interne et externe à gauche, un strabisme dorsal à gauche, de la douleur lors de l’ouverture de la gueule et une amaurose intermittente. Les examens par imagerie ont révélé une masse dans l’apex orbitaire gauche avec lyse de l’os sphénoïde adjacent et extension dans la cavité crânienne. Une exentération gauche fut effectuée et l’histopathologie confirma un sarcome des tissus mous orbitaires.
Message clinique clé :Ce rapport décrit une tumeur orbitaire causant un syndrome de l’apex orbitaire. Cette condition devrait être distinguée du syndrome du sinus caverneux étant donné que ce dernier n’évolue pas avec une neuropathie optique.
(Traduit par Dr Serge Messier)
Can Vet J 2021;62:27–31
T he orbital apex is defined by the bony margins of the orbital fissure and optic canal and serves as the attachment point
of the periorbita (1–7). In human medicine, there are 3 types of orbital apex disorders: orbital apex syndrome (OAS), superior orbital fissure syndrome (SOFS), and cavernous sinus syndrome (CSS) (1–9).
Orbital apex syndrome (also known as Jacod syndrome) is characterized by a set of clinical signs caused by the impaired function of cranial nerves III (oculomotor), IV (trochlear), VI (abducens), ophthalmic branch of cranial nerve V (mandibu-lar), and eventual deficits of cranial nerve II (optic) (1–8). The clinical signs associated with OAS include proptosis, ophthal-moplegia, visual deficits, pain or hypoesthesia of the ipsilateral forehead, upper eyelid, and cornea (1–5,8). The SOFS (also
known as Rochon-Duvigneaud syndrome) is characterized by a lesion immediately anterior to the orbital apex that results in clinical signs consistent with OAS without visual impair-ment (1–5,8). The CSS is characterized by a group of clinical signs that are similar to OAS and maxillary hypoesthesia or pain due to involvement of the maxillary branch of cranial nerve V (1–5,8–12). In addition, CSS-affected patients are visual and, in some cases, may be affected with Horner’s syn-drome due to involvement of the sympathetic chain adjacent to the cavernous segment of the internal carotid artery (1–3,9–12). Neoplasia is the most common etiology for these syndromes, though inflammatory, infectious, traumatic, and vascular condi-tions have also been implicated (1–5,8–12).
Magnetic resonance imaging (MRI) and computed tomog-raphy (CT) are considered the diagnostic modalities of choice for orbital disorders; however, additional testing or biopsy is often necessary to determine a definitive underlying etiol-ogy (1–4,6,9,10,12). In veterinary medicine, the prognosis of CSS is generally guarded; however, this is dependent on whether the underlying cause can be identified and appropriate treatment initiated (9,10,12). In human medicine, the prognoses for CSS and OAS, though dependent on etiology and ability to reach an early diagnosis, can be considered to be good and vision is fully restored in some cases (3,4,6,8).
Cornell University — College of Veterinary Medicine, Ithaca, New York, USA.Address all correspondence to Dr. Filipe Espinheira Gomes; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
FOR PERSONAL USE ONLY
28 CVJ / VOL 62 / JANUARY 2021
RA
PP
OR
T D
E C
AS
Orbital apex syndrome is well-documented in human medi-cine, but to the authors’ knowledge, OAS and SOFS have not been described in veterinary medicine (1–5,8,12). Therefore, the goal for this case report is to describe the clinical presentation of a dog affected with OAS.
Case descriptionA 12-year-old castrated male cocker spaniel dog was presented to the Cornell University Hospital for Animals with a 4-week history of left exophthalmia with intermittent redness and pawing at the face. Approximately 3 mo earlier, the dog was diagnosed by the referring veterinarian with keratoconjunctivitis sicca of the left eye, which was being treated with cyclosporine (Optimmune; Merck Animal Health, Madison, New Jersey, USA), 0.2% in the left eye, q12h, and artificial tears in the left eye, at an unknown frequency. Several years ago, the dog had been treated for Lyme disease with an unknown dosage and frequency of doxycycline at a different veterinary hospital.
A complete ophthalmic examination was performed, includ-ing slit lamp biomicroscopy (Kowa SL-17; Kowa American, Torrance, California, USA), indirect ophthalmoscopy (Omega 500; Heine USA, Dover, New Hampshire, USA) with a 28D indirect ophthalmoscopy lens (Volk Optical, Mentor, Ohio, USA) and applanation tonometry (Tonopen XL; Reichert, Depew, New York, USA). Both eyes were comfortable. There was distichiasis on all eyelids and 2 small pedunculated eyelid masses in the left eye. Readings from the Schirmer tear test were 19 mm/min and 18 mm/min in the right and left eyes, respec-tively. The intraocular pressures were 8 mmHg and 6 mmHg in the right and left eyes, respectively. The cornea was fluorescein negative and the lens contained senile nuclear sclerosis in both eyes. No abnormalities were identified during the ophthalmic and neuro-ophthalmic examinations of the right eye.
There was moderate episcleral injection in the left eye (Figure 1), mild axial corneal fibrosis and pigmentation, and superficial vascularization in the superior, inferior, and nasal cornea. Neuro-ophthalmic examination of the left eye revealed absent dazzle, direct pupillary light reflex, and menace response. A normal palpebral reflex was present in the left eye. Consensual pupillary light reflex from the right to the left eye was absent; however, there was a questionably negative consensual pupillary light reflex from the left to the right eye in which a minimal response was noted once, but could not be consistently repro-duced. The pupil was dilated in the left eye; ocular motility was severely diminished and there was mild dorsal strabismus and exophthalmia. Fundic examination revealed normal vascular pattern with a slightly darker optic nerve head in the left eye. In addition, corneal sensation was severely diminished in the left eye as determined by touching both corneas with a similar amount of force using a cotton tip applicator. On general physi-cal examination no concerning abnormalities were noted except for a mildly enlarged left mandibular lymph node and moderate periodontal disease.
Blood analysis [complete blood (cell) count (CBC), chem-istry, SNAP 4DX, Cryptococcus antigen, Toxoplasma gondii, and Neospora titers] and urine analysis (Blastomyces antigen) were performed. The dog was positive for Lyme disease on
SNAP 4DX, but all other results were unremarkable. The dog was placed under general anesthesia for CT of the head (Figure 2A), which revealed a contrast-enhancing left orbital apex mass (2.2 cm length 3 1.0 cm width 3 1.5 cm height) with poorly defined margins, focal lysis of the sphenoid bone immediately dorsal to the optic canal and orbital fissure, exten-sion into the cranial cavity, and extension into the adjacent temporal muscle. The roots of the maxillary incisors and canine teeth had irregular margins and small areas of resorption. The left medial retropharyngeal, mandibular, and parotid lymph nodes were mildly enlarged. Based on the CT results, an ultrasound-guided fine-needle aspiration of the left orbital apex was completed. Cytology showed predominantly neutrophilic inflammation with rare intracellular bacteria. Fine-needle aspi-rate of the enlarged lymph nodes was consistent with reactive lymphoid hyperplasia. Results from atlanto-occipital cerebro-spinal fluid collection were unremarkable. Abdominal ultraso-nography and thoracic radiography did not identify any abnor-malities. An orbital exploratory surgery to collect biopsy samples from the orbital mass was declined by the owners. The dog was discharged to the care of the owners for medical management with a topical lubricant (Optixcare; Aventix Animal Health, Burlington, Ontario,), applied to the left eye 4 to 6 times daily, and cyclosporine 2% (Novartis, East Hanover, New Jersey, USA; compounded at the pharmacy, Cornell University Hospital for Animals) applied to the left eye q12h.
Over the following 5 wk, the dog continued with medical management and had 3 ophthalmic examinations performed at multiple veterinary ophthalmology practices, which showed waxing and waning internal ophthalmoplegia, external ophthal-moplegia/paresis, and menace response. Episcleral injection and exophthalmia did not change from the initial presentation. On physical examination it was consistently noted that the animal had pain opening his mouth.
Four weeks after initial presentation, follow-up head CT at Cornell University Hospital for Animals (Figure 2B) revealed
Figure 1. Clinical photograph of the dog upon presentation showing 2 upper eyelid masses, episcleral injection, and mild dorsal strabismus in the left eye.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 29
CA
SE
RE
PO
RT
that the orbital apex mass had slightly increased in size (2.5 cm length 3 1.5 cm width 3 1.5 cm height) but lysis of the sphe-noid bone had not significantly changed (Figure 3). Magnetic resonance imaging revealed that the orbital mass had a poorly defined margin, was mildly T2 hyperintense, T1 isointense, had strong contrast enhancement, and had involvement of the adjacent pachymeninges (Figure 4).
Ultrasound-guided fine-needle aspiration was repeated; cytology was non-diagnostic. An endoscopic biopsy was done to obtain a definitive diagnosis and preserve the eye. The dog was placed under general anesthesia and a modification of the pre-caruncular transorbital endoscopic approach used in humans was used to access the left retrobulbar region (13). A 2.7-mm 30° rigid endoscope fitted with a cystoscope working sheath was
used to perform the biopsies with the aid of a blunt suction-dissector and fluid ingress. A partial temporary tarsorraphy was performed after surgery to mitigate exophthalmia caused by the swelling/edema following the endoscopic biopsy procedure. The dog was discharged on oral meloxicam (Ceva Animal Health, Lenexa, Kansas, USA), 0.1 mg/kg body weight (BW), PO, q24h for 5 d, topical neomycin-polymyxin B-bacitracin ophthalmic ointment (Bausch & Lomb, Laval, Quebec), was applied to the left eye, q6h, for 7 d, and treatment with cyclosporine and topical lubricant as previously prescribed. Histopathology results were non-definitive.
Eight days after the biopsy, the 3rd eyelid became elevated and exophthalmos became progressively worse. At that time the owners elected to have a left orbital exenteration performed as it appeared that the pain when opening the mouth wors-ened 4 to 6 d after the orbital endoscopy. The procedure was competed without complications. Retrobulbar samples were collected for histopathology, fungal, and bacterial (aerobic and anaerobic) cultures. A single colony of Streptococcus hali-choeri grew in the anaerobic culture. The dog was sent home on oral meloxicam, 0.1 mg/kg BW, PO, q24h, for 5 d and amoxicillin-clavulanic acid (Henry Schein, Columbus, Ohio, USA), 17 mg/kg BW, PO, q12h, for 7 d.
The histopathological diagnosis was a poorly differentiated orbital grade II soft tissue sarcoma with incomplete surgical margins. Palliative radiation therapy (18 daily fractions of 3 Gy for a total of 54 Gy to the left side of the face and lymph nodes) was initiated approximately 5 wk after exenteration (10 wk after initial presentation). Pain on opening the mouth resolved approximately 2 wk after initiating radiation therapy. Sixteen months after initial presentation, the owners reported that pain associated with opening the mouth was absent and there was no recurrence of clinical signs as noted by full body CT scan (Figure 2C).
DiscussionA diagnosis of orbital apex syndrome was made in this dog on the basis of a combination of cranial nerve deficits associated with CSS (such as internal and external ophthalmoparesia/
Figure 2. Transverse, post-contrast CT images in soft tissue window, of the left retrobulbar lesion from the initial visit (A), 4-week recheck (B), and at 16-month follow-up (C). The images show mild progression in the size of the mass (2) in the initial 4-week recheck interval and a region of lysis in the sphenoid bone (*). At the 16-month follow-up recheck there is no evidence of recurrence of the mass. The arrows (1) indicate the optic canals and (3) indicates the coronoid process of the left mandible.
Figure 3. Segmented, surface rendered CT reconstruction of the eye and periorbita (blue), the mass (yellow), and the skull, showing the spatial relationship of the mass to the periorbita and skull.
FOR PERSONAL USE ONLY
30 CVJ / VOL 62 / JANUARY 2021
RA
PP
OR
T D
E C
AS
plegia and corneal hypoesthesia) and the presence of visual deficits of the ipsilateral eye. In canine CSS, a disease that shares many clinical signs with OAS in humans, the major presenting complaints are mydriasis and ophthalmoplegia, which dramati-cally differ from the presentation in this case (9,10,12). To the authors’ knowledge OAS has not been described in the veteri-nary literature, although several case reports of CSS with visual deficits have been published that may better fit a diagnosis of the syndrome described here (14,15).
In the present case report, the dog’s presenting complaints were pawing at the face, exophthalmos and intermittent red-ness. On ophthalmic examination, the dog had visual deficits, ophthalmoparesia/plegia, and mild dorsal strabismus upon presentation. These latter findings initially went unnoticed by the owners, supporting the notion that some clinical signs can be missed if the animal is still visual in the contralateral eye. It is possible that the animal was pawing at the face due to changes in facial sensation as is seen in some human and veterinary patients affected with CSS (3,4,8–12); however, further studies of OAS in veterinary medicine are warranted to support this hypothesis (8–12).
The pain upon opening the mouth that was exhibited in this dog, before and after exenteration resolved approximately 2 wk after initiating radiation therapy. Although pain can be useful in localizing diseases, it is often non-specific and can be challenging to detect and interpret in veterinary patients. Pain on opening the dog’s mouth was likely orbital in origin as orbital pain is a common feature of OAS in humans (1–4,8,11), and can be explained by the intimate relationship of the temporoman-dibular joint with the orbit. However, pre-existing periodontal disease, which is commonly seen in geriatric patients, can be
a potential confounding factor when localizing this clinical sign. Nevertheless, pain associated with periodontal disease is not expected to resolve with radiation therapy, which supports that in the case reported here the pain was associated with the neoplasm.
As endoscopic biopsy was unsuccessful in reaching a diagnosis and exenteration was necessary to obtain deep orbital tissues for histopathology, leading to the diagnosis of grade II soft tis-sue sarcoma. Although neoplasia is the leading cause of orbital apex disorders in geriatric animals, various other causes have been identified in humans and veterinary patients (1–5,8–12). The initial fine-needle aspirate of the left orbital apex showed inflammatory changes associated with rare intracellular bacte-ria. Additionally, bacterial and fungal cultures taken from the orbital mass grew an isolated Streptococcus halichoeri colony on anaerobic culture. These results were confounding and of unknown significance as there was no other evidence to support an active infection. Additionally, the dog’s clinical progression of waxing and waning vision and ophthalmoplegia despite the lack of a targeted treatment is less consistent with a neoplastic etiology and more characteristic of inflammatory or metabolic processes. Inflammatory, metabolic, and neoplastic etiologies have been identified in human OAS cases (1–4,8), although the fluctuation of clinical signs in this dog could be attributed to local inflammation that subsequently affected the orbital apex cranial nerves.
Common orbital apex neoplasms in humans, cats, and dogs include carcinomas, lymphoma, melanoma, and sar-comas (1–4,8–10,12). Treatment options include radiation therapy, chemotherapy, and surgical resection (2–4,8–10,12). Surgical resection followed by adjuvant palliative radiation
Figure 4. Transverse T2-weighted (A) and post-contrast T1-weighted with fat saturation (B) MRI images of the left retrobulbar lesion at the recheck visit. The image shows the ill-defined margins of the mildly T2 hyperintense, moderately contrasting mass (2), the region of lysis in the adjacent sphenoid bone (*). The arrows (1) indicate the optic nerves, arrows (4) indicate thickened, contrast enhancing pachymeninges, and (3) indicates the coronoid process of the left mandible.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 31
CA
SE
RE
PO
RT
therapy were selected in this case. Soft tissue sarcomas tend to be locally aggressive with rare metastasis (3). Although there’s been no evidence of regrowth in this case over the last 16 mo (alive at the time of writing this case report), the likelihood of recur-rence is high based on histopathologic findings. Nevertheless, this dual treatment approach may provide a reasonable survival outcome as in other veterinary patients affected with CSS (12).
To the authors’ knowledge this is the first case report in com-panion animals defining orbital apex syndrome. This condition should be differentiated from other cranial nerve disorders such as cavernous sinus syndrome. Surgical treatment combined with radiation therapy may be considered to treat neoplasms affecting the orbital apex. CVJ
References 1. Thurtell MJ, Tomsak RL, Daroff RB. Syndromes of the orbital apex,
superior orbital fissure, and cavernous sinus. In: Neuro-Ophthalmology. 1st ed. Oxford, UK: Oxford University Press, 2011:169–174.
2. Yeh S, Foroozan R. Orbital apex syndrome. Curr Opin Ophthalmol 2004;15:490–498.
3. Goyal P, Lee S, Gupta N, et al. Orbital apex disorders: Imaging findings and management. Neuroradiol J 2018;31:104–125.
4. Warburton R, Brookes C, Golden B, Turvey T. Orbital apex disorders: A case series. Int J Oral Maxillofac Surg 2016;45:497–506.
5. Jin H, Gong S, Han K, et al. Clinical management of traumatic superior orbital fissure and orbital apex syndromes. Clin Neurol Neurosurg 2018; 165:50–54.
6. Ettl A, Zwrtek K, Daxer A, Salomonowitz E. Anatomy of the orbital apex and cavernous sinus on high-resolution magnetic resonance images. Surv Ophthalmol 2000;44:303–323.
7. Reymond J, Kwiatkowski J, Wysocki J. Clinical anatomy of the superior orbital fissure and the orbital apex. J Craniomaxillofac Surg 2008;36:346–353.
8. Aryasit O, Preechawai P, Aui-Aree N. Clinical presentation, aetiology and prognosis of orbital apex syndrome. Orbit 2013;32:91–94.doi:10.3109/01676830.2013.764439.
9. Theisen SK, Podell M, Schneider T, Wilkie DA, Fenner WR. A retro-spective study of cavernous sinus syndrome in 4 dogs and 8 cats. J Vet Intern Med 1996;10:65–71.
10. Rossmeisl JH, Higgins MA, Inzana KD, Herring IP, Grant DC. Bilateral cavernous sinus syndrome in dogs: 6 cases (1999–2004). J Am Vet Med Assoc 2005;226:1105–1111.
11. Overbeeke JJV, Jansen JJ, Tulleken CA. The cavernous sinus syn-drome an anatomical and clinical study. Clin Neurol Neurosurg 1988;90:311–319.
12. Jones AM, Bentley E, Rylander H. Cavernous sinus syndrome in dogs and cats: Case series (2002–2015). Open Vet J 2018;8:186–192.
14. Hernández-Guerra AM, López-Murcia MDM, Planells A, Corpa JM, Liste F. Computed tomographic diagnosis of unilateral cavernous sinus syndrome caused by a chondrosarcoma in a dog: A case report. Vet J 2007;174:206–208.
15. Murphy CJ, Koblik P, Bellhorn RW, Pino M, Hacker D, Burling T. Squamous cell carcinoma causing blindness and ophthalmoplegia in a cat. J Am Vet Med Assoc 1989;195:965–968.
Vytelle adds genetic analytics to its portfolioVytelle announced the exclusive licensing of the Synomics Insights Platform to increase the accuracy of predicting cattle performance using phenotype and genomics data. By bringing this new capability in-house, Vytelle is uniquely positioned to fast forward cattle genetic progress — bringing certainty to producers’ high-stake management decisions.
“Vytelle will now be able to offer cattle producers the ability to correlate elite phenotype performance to unique genetic trait combinations. Combining this capability with our GrowSafe Systems phenotype data capture platform, Vytelle will offer cattle producers new intelligence to correlate genome to phe-nome. As a result, producers can more rapidly multiply their elite genetics using our modern in vitro fertilization system providing them a complete solution,” commented Kerryann Kocher, Chief Executive Officer for Vytelle.
The revolutionary Synomics Insights Platform can process thousands of diverse datasets and analyze large-scale genotypic, phenotypic and environmental data.
“We’re excited to work with the Vytelle team to help them unlock individual animal performance for cattle producers,” said Steve Gardner, Founder of Synomics. “We’ve already dem-onstrated that we can more accurately explain the correlations among genomic, phenotype and environmental data driving new insights for health, production and fertility traits for producers.”
Contact: GrowSafe, #300–151 Canada Olympic Road SW, Calgary, Alberta T3B 6B7; phone: 1-866-620-3015; e-mail: [email protected] website: https://growsafe.com or https://vytelle.com
Industry News Nouvelles de l’industrie
FOR PERSONAL USE ONLY
32 CVJ / VOL 62 / JANUARY 2021
Case Report Rapport de cas
Paroxysmal atrial fibrillation in a dog that was presented for neck wounds
Samuel J. Hornsey, Anthony P. Carr, Jennifer M. Loewen
Abstract — A 12-year-old spayed female German shorthaired pointer dog sustained extensive bite wounds around the neck. At presentation, atrial fibrillation was identified with a rapid ventricular response rate of 300 beats per minute (bpm). The ventricular response rate rapidly decreased to 130 bpm following administration of hydromorphone and oxygen. Based on the rate, antiarrhythmic therapy was not initiated. The heart rhythm converted back to sinus rhythm by the time of the first recheck evaluation 2 days later, and the dog remained in sinus rhythm at all subsequent evaluations. With the resolution of the arrhythmia, paroxysmal atrial fibrillation was suspected. The underlying etiology of the arrhythmia was not determined; however, imbalances in autonomic tone associated with trauma and/or direct trauma to the heart were hypothesized.
Key clinical message:This report indicates a possible role of imbalances in autonomic tone due to trauma in the development of paroxysmal atrial fibrillation and suggests that it should be a differential diagnostic consideration in patients with atrial fibrillation following trauma. Primary treatment of atrial fibrillation may not be needed in these cases if the ventricular response rate is not rapid, or if there is spontaneous conversion to sinus rhythm.
Résumé — Fibrillation atriale paroxysmique chez un chien présenté avec des blessures au cou. Une femelle braque allemand stérilisée âgée de 12 ans a subi des blessures extensives de morsure autour du cou. À la présentation, une fibrillation atriale fut identifiée avec un rythme de réponse ventriculaire rapide de 300 battements par minute (bpm). Le rythme de réponse ventriculaire diminua à 130 bpm à la suite de l’administration d’hydromorphone et d’oxygène. Sur la base du rythme aucune thérapie antiarythmique ne fut initiée. Le rythme cardiaque était retourné au rythme sinusal lors de la première réévaluation 2 jours plus tard, et le chien est demeuré en rythme sinusal à toutes les évaluations subséquentes. Avec la résolution de l’arythmie, une fibrillation atriale paroxysmique fut suspectée. L’étiologie sous-jacente de l’arythmie ne fut pas déterminée; toutefois, des débalancements du tonus autonome associés avec un trauma et/ou un trauma directement au cœur furent émis comme hypothèses.
Message clinique clé :Ce rapport mentionne un rôle possible de débalancements du tonus autonome dus à un trauma lors du développement de fibrillation atriale paroxysmique et suggère que cela devrait être un diagnostic différentiel à considérer chez les patients avec fibrillation atriale à la suite d’un trauma. Le traitement initial de la fibrillation atriale pourrait ne pas être nécessaire dans ces cas si le rythme de la réponse ventriculaire n’est pas rapide ou s’il y a une conversion spontanée au rythme sinusal.
(Traduit par Dr Serge Messier)
Can Vet J 2021;62:32–36
Department of Small Animal Clinical Sciences, Western College of Veterinary Medicine, University of Saskatchewan, Saskatoon, Saskatchewan S7N 5B4.Address all correspondence to Dr. Samuel Hornsey; e-mail: [email protected]. Hornsey’s current address is 22 Old Green Road, Broadstairs, Kent, CT10 3BP, United Kingdom.Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 33
CA
SE
RE
PO
RT
A trial fibrillation (AFib) is a rapid supraventricular arrhyth-mia, and has been reported to represent 14.7% of all
arrhythmias seen in dogs (1). Electrocardiographic features include irregular R-R intervals, narrow QRS complexes, absence of P-waves, with undulating fibrillation waves (2,3). Dogs with AFib typically have a rapid, irregular heart rhythm heard on auscultation. This is accompanied by beat-to-beat variability in pulse strength, frequently resulting in pulse deficits (2). Atrial fibrillation is commonly associated with cardiac diseases that result in dilation and fibrosis of one or both atria, such as myxo-matous mitral valve disease or dilated cardiomyopathy (3–5). Systemic factors (hypothyroidism or drugs) can increase sus-ceptibility to the development and maintenance of AFib due to changes in autonomic tone (2). Atrial fibrillation is a permanent and persistent arrythmia (2) which is repeatedly noted over multiple ECG readings and does not resolve spontaneously. Paroxysmal AFib or intermittent AFib is rarely reported in the veterinary literature (6,7). It typically has a short duration, and resolves spontaneously within 4 d (2). Structural and electrical remodelling of the atria typically occurs once AFib is initiated and predisposes to permanent AFib; however, early conversion to sinus rhythm will prevent these changes (8). Two treatment strategies exist in veterinary medicine, which include rate control and rhythm control. The goal of rate control is to optimize the patient’s heart rate and prevent a fast ventricular response rate, while rhythm control aims to convert the patient to a normal sinus rhythm (9). Rhythm control can be challenging in most dogs with AFib as structural remodelling limits conversion to sinus rhythm but may be selected in patients in which the heart rate cannot be adequately controlled or the patient does not have underlying structural heart disease. Rate control is more commonly used, as it can optimize cardiac output and control clinical signs associated with AFib (3).
The current report describes a case of suspected paroxysmal AFib in a dog after sustaining a dog bite wound to the neck.
Case descriptionA 12-year-old, spayed female German shorthaired pointer dog was presented to the Veterinary Medical Centre, Western College of Veterinary Medicine Emergency Service for evalua-tion of neck bite wounds sustained from a dog attack 1 h before presentation. The dog was on levothyroxine (Thryo-Tabs; Lloyd Laboratories, Peterborough, Ontario), 0.4 mg, PO, q24h. The dog also received meloxicam (Metacam; Boehringer Ingelheim, Burlington, Ontario), 0.1 mg/kg body weight (BW), PO, q24h for osteoarthritis. The patient had no other significant medical history.
On presentation, the dog was unable to walk and had a respi-ratory rate of 60 breaths/min, increased effort, and stridor. No abnormal lung sounds were detected; however, this was limited due to referred upper respiratory tract sounds. The heart rate was approximately 300 beats/min (bpm), with an irregular rhythm and poor pulse quality; no murmurs were detected. A 6-lead electrocardiogram (ECG) diagnosed AFib (Figure 1), with a calculated ventricular response rate of 300 bpm. It was also noted that the dog’s abdomen was distended, but no fluid was seen with a point-of-care abdominal ultrasound. There was a
3-cm full thickness skin wound on the dorsum of the neck with subcutaneous pocketing extending 5 cm caudally and 10 cm laterally to the left. There was no communication with other anatomic structures or the thoracic cavity.
An intravenous catheter was placed, and oxygen was provided via a mask. On presentation, a blood gas analysis was within normal limits, with a packed cell volume of 48% [reference range (RR): 36% to 55%] and total solids of 76 g/L (RR: 50 to 74 g/L). Hydromorphone (Sandoz, Boucherville, Quebec), 0.1 mg/kg BW, IV, was given to provide analgesia. Shortly after hydromorphone had been injected it was noted that the heart rate decreased to 130 bpm; however, AFib was still present on the ECG. The patient’s stridorous breathing and increased effort improved after administration of hydromorphone and pulse oximeter readings of . 95% were obtained on room air; oxygen supplementation was discontinued.
Three-view thoracic radiographs (Figure 2) were taken to assess for thoracic injuries. An interstitial to alveolar pattern in multiple lung lobes was present. Differentials included atel-ectasis, pulmonary contusions or, less likely, pneumonia. No communication between the neck wounds and chest was noted. There was no radiographic evidence of cardiac disease, with an unremarkable cardiac silhouette and normal vasculature. A ver-tebral heart score of 10.2 was recorded (RR: 9.7 1/2 0.5) (10).
Once the dog had been stabilized, she received additional sedation [hydromorphone (Sandoz), 0.05 mg/kg BW, IV; mid-azolam (Sandoz), 0.2 mg/kg BW, IV; acepromazine (Boehringer Ingelheim), 0.01 mg/kg BW, IV] so the wounds could be clipped and cleaned. The wounds were then sterilely explored and flushed with sterile saline (0.9% Sodium chloride; Hospira,
Figure 1. Six-lead ECG at presentation at 50 mm/s, 10 mm/mV (HR 300 bpm), showing evidence of atrial fibrillation.
FOR PERSONAL USE ONLY
34 CVJ / VOL 62 / JANUARY 2021
RA
PP
OR
T D
E C
AS
Montreal, Quebec). A penrose drain was placed and the wound was closed with simple interrupted sutures using Polybutester 3/0 suture (Novafil; Covidien, Mansfield, Massachusetts, USA). The dog recovered well from sedation without complication.
The owners declined overnight hospitalization and opted for close monitoring at home. On discharge, the dog’s breathing rate and effort had returned to normal with no stridor noted. The dog was discharged with 10 d of cephalexin (Apotex, Toronto, Ontario), 22 mg/kg BW, PO, q12h. Meloxicam was continued at the same dosage (0.1 mg/kg BW, PO, q24h). No anti-arrhythmic drugs were started at this time.
Follow-up appointments were made with our surgery service 2, 7, 12, and 22 d after the attack for continued wound manage-ment and monitoring. At each visit a 6-lead ECG tracing was obtained (Figure 3) and normal sinus rhythm was noted. On the first recheck, skin necrosis had developed in several areas around the wound, and the drain was removed. At the second recheck, the neck wounds were healing well, and a further 7 d of cephalexin were prescribed. On day 12 the wounds were debrided, and necrotic skin was removed. At the visit 22 d after
the attack, the wounds had completely healed, all sutures were removed, and no further recheck was required.
During the last visit, an ECG performed by a Board-certified radiologist revealed a normal heart with no evidence of struc-tural heart disease. Blood for analysis was submitted to Prairie Diagnostic Services (Saskatoon, Saskatchewan); a free T4 was 17 nmol/L (RR: 12 to 40 nmol/L); canine thyroid stimulating hormone (TSH) was also within normal limits (0.04 ng/mL; RR: 0.03 to 0.58 ng/mL).
DiscussionThis case report describes a dog with spontaneously resolving AFib noted after sustaining neck wounds during a dog fight. The cause of the paroxysmal AFib was not determined during the first visit or at subsequent rechecks. It was hypothesized that imbalances in autonomic tone associated with trauma and/or direct trauma to the heart played a role in the development of this arrythmia. Primary structural heart disease was ruled out as a cause for the arrhythmia based on echocardiography. Blood analysis revealed that the dog was euthyroid and had no electrolyte abnormalities.
Paroxysmal AFib is defined in human literature as AFib that terminates spontaneously with or without treatment within 7 d, and may reoccur with variable frequency (9). Autonomic ner-vous system activation can play a role in the initiation and main-tenance of paroxysmal and permanent AFib in humans (11,12). One study showed that either an increase in sympathetic tone or decrease in vagal tone was observed shortly before the onset of post-operative paroxysmal AFib (13). It has also been sug-gested that an initial increase of adrenergic tone followed by a shift towards vagal tone is associated with the development of paroxysmal AFib (14). It is likely that the dog had high sympa-thetic tone due to pain following the dog attack. This dog may have also had increased vagal tone as a consequence of stridorous and forced respiration. There have been 2 case reports of the development of atrial fibrillation in the context of high vagal tone (15,16) and in both reports the dogs were successfully converted to sinus rhythm with lidocaine.
In human medicine, thoracic and cardiac trauma have been associated with the development of arrhythmias (17). Atrial fibrillation is not uncommon in humans admitted to an ICU. Rates as high as 19% of over 8000 admissions to an ICU were documented with half of the patients having a history of prior AFib (18). Incidence reported within the general human population is lower at around 3% (19,20). The prevalence of trauma-induced AFib in dogs is unknown. A dog with humeral fracture likely secondary to being kicked by a horse was pre-sented with a rapid atrial flutter which converted to a slow AFib with an injection of diltiazem (21). Electrical cardioversion was performed under general anesthesia resulting in conversion to sinus rhythm in this dog. It was hypothesized that development of AFib in this previously reported case may have been due to changes in autonomic tone, abnormal cardiac perfusion, or damaged myocardial cells leading to abnormal conduction. The pulmonary pattern identified on thoracic radiographs could be a result of pulmonary contusions sustained during the attack, and therefore it is possible that this patient also experienced
Figure 2. Thoracic radiographs at presentation. Ventrodorsal view (a) and right lateral view (b). The radiographs reveal a moderate, unstructured, interstitial to alveolar pulmonary pattern, in the right cranial and middle lobes and the caudal segment of the left cranial lobe. This pattern is likely due to pulmonary contusions or atelectasis.
(a)
(b)
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 35
CA
SE
RE
PO
RT
traumatic myocardial injury. There was no other evidence of thoracic trauma, however, and therefore it remains unclear if altered myocardial perfusion and direct myocardial injury were contributing causes of AFib in this case.
Dogs with AFib have a higher frequency of hypothyroidism compared to control dogs without AFib (22). Several studies have reported concurrent hypothyroidism with AFib (23,24), with 1 reporting that conversion of AFib to a normal sinus rhythm was achieved in a hypothyroid dog after treatment (25). In our case, the dog had been receiving levothyroxine daily for 6 mo and clinical signs of lethargy and weight gain had reportedly improved. Blood analysis indicated that this dog was currently euthyroid. T4 concentration was 17 nmol/L and canine TSH concentration was 0.04 ng/mL, both of which were within normal range. It was therefore suspected that uncon-trolled hypothyroidism was not likely to have been related to the development of AFib.
Goals of therapy for atrial fibrillation include converting the rhythm to a normal sinus rhythm or controlling the rate of ventricular depolarization. This dog was assessed as not requir-ing medical therapy for atrial fibrillation since the heart rate was considered as acceptable after administration of analgesics. Further interventions such as rhythm control with electrocon-version were limited by owner finances and pharmacological cardioversion with amiodarone was not pursued as the premixed product Nexterone (Baxter, Deerfield, Illinois, USA) is not
available in Canada. The 50 mg/mL amiodarone (Sandoz) that is available is associated with complications such as acute allergic reactions and anaphylaxis suspected due to the polysorbate 80 and benzyl alcohol carrier solvents (26–28). In addition, at the time of the initial treatment, the severe wounds sustained by this dog were a priority, since with a normal heart rate the AFib was not causing clinical signs.
The prompt recognition and classification of arrhythmias in the emergency setting is important in assessing a critical patient. Steps should be taken to determine any possible underlying dis-ease, including structural heart disease, electrolyte imbalances, pain, autonomic imbalances, among others. This case report suggests that when managing a patient that has undergone trauma and has concurrent AFib, the presence of paroxysmal AFib should be considered, with repeat ECG indicated to fur-ther characterize this condition. CVJ
abnormal cardiac arrhythmias and conduction disturbances in the dog. A clinical and pathologic study of 3,000 dogs. Am J Vet Res 1961; 22:355–369.
2. Côté E, Ettinger SJ. Cardiac arrythmias. In: Ettinger SJ, Feldman EC, Côté E, eds. Textbook of Veterinary Internal Medicine: Diseases of the Dog and the Cat. 8th ed. Vol 2. St. Louis, Missouri: Elsevier, 2017:2898–2936.
3. Saunders A, Gordon S, Miller M. Canine atrial fibrillation. Compend Contin Educ Vet. 2009;31:E1–9.
Figure 3. ECG tracing of lead II at 50 mm/s, 10 mm/mV on (a) Day 2, HR 144 (b) Day 12, HR 168 (c) Day 22, HR 120. Normal sinus rhythm is present in each tracing.
FOR PERSONAL USE ONLY
36 CVJ / VOL 62 / JANUARY 2021
RA
PP
OR
T D
E C
AS
4. Saunders AB, Miller MW, Gordon SG, Van De Wiele CM. Oral amiodarone therapy in dogs with atrial fibrillation. J Vet Intern Med 2006;20:921–926.
5. Guglielmini C, Chetboul V, Pietra M, Pouchelon JL, Capucci A, Cipone M. Influence of left atrial enlargement and body weight on the devel-opment of atrial fibrillation: Retrospective study on 205 dogs. Vet J 2000;160:235–241.
6. Porteiro Vazquez DM, Perego M, Santos L, Gerou-Ferriani M, Martin MW, Santilli RA. Paroxysmal atrial fibrillation in seven dogs with presumed neurally-mediated syncope. J Vet Cardiol 2016;18:1–9.
7. Bolton GR, Ettinger S. Paroxysmal atrial fibrillation in the dog. J Am Vet Med Assoc 1971;158:64–76.
8. Shinagawa K, Shi Y-F, Tardif J-C, Leung T-K, Nattel S. Dynamic nature of atrial fibrillation substrate during development and reversal of heart failure in dogs. Circulation 2002;105:2672–2678.
9. January CT, Wann LS, Alpert JS, et al. 2014 AHA/ACC/HRS guideline for the management of patients with atrial fibrillation: A report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines and the Heart Rhythm Society. J Am Coll Cardiol 2014;64:e1–76.
10. Buchanan JW, Bucheler J. Vertebral scale system to measure canine heart size in radiographs. J Am Vet Med Assoc 1995:194–199.
11. Chen P-S, Chen LS, Fishbein MC, Lin S-F, Nattel S. Role of the autonomic nervous system in atrial fibrillation: Pathophysiology and therapy. Circ Res 2014;114:1500–1515.
12. Coumel P. Paroxysmal atrial fibrillation: A disorder of autonomic tone? Eur Heart J 1994;15:9–16.
13. Dimmer C, Tavernier R, Gjorgov N, Van Nooten G, Clement DL, Jordaens L. Variations of autonomic tone preceding onset of atrial fibrillation after coronary artery bypass grafting. Am J Cardiol 1998;82: 22–25.
14. Bettoni M, Zimmermann M. Autonomic tone variations before the onset of paroxysmal atrial fibrillation. Circulation 2002;105:2753–2759.
15. Moïse NS, Pariaut R, Gelzer ARM, Kraus MS, Jung SW. Cardioversion with lidocaine of vagally associated atrial fibrillation in two dogs. J Vet Cardiol 2005;7:143–148.
16. Pariaut R, Moïse NS, Koetje BD, et al. Lidocaine converts acute vagally associated atrial fibrillation to sinus rhythm in German shepherd dogs with inherited arrhythmias. J Vet Intern Med 2008;22:1274–1282.
17. Ismailov RM, Ness RB, Redmond CK, Talbott EO, Weiss HB. Trauma associated with cardiac dysrhythmias: Results from a large matched case-control study. J Trauma 2007;62:1186.
18. Moss TJ, Calland JF, Enfield KB, et al. New-onset atrial fibrillation in the critically ill. Critical Care Med 2017;45:790.
19. NHS Digital. Quality and Outcomes Framework (QOF) 2015–16: Prevalence, achievements and exceptions at region and nation level. Atrial Fibrillation. Health and Social Care Information Centre. Leeds, UK. 2016.
20. Adderley NJ, Ryan R, Nirantharakumar K, Marshall T. Prevalence and treatment of atrial fibrillation in UK general practice from 2000 to 2016. Heart 2019;105:27.
21. Cocchiaro MF, Kittleson MD. ECG of the month. J Am Vet Med Assoc 2010;236:836–838.
22. Gerritsen RJ, van den Brom WE, Stokhof AA. Relationship between atrial fibrillation and primary hypothyroidism in the dog. Vet Q 1996;18:49–51.
23. Seo J, Singh MK. Electrical cardioversion in a dog with atrial fibrillation and hypothyroidism. Vet Rec Case Rep 2018;6(1):e000583.
24. Phillips DE, Harkin KR. Hypothyroidism and myocardial failure in two Great Danes. J Am Anim Hosp Assoc 2003;39:133–137.
25. Chow B, French A. Conversion of atrial fibrillation after levothyroxine in a dog with hypothyroidism and arterial thromboembolism. J Small Anim Pract 2014;55:278–282.
26. Cober RE, Schober KE, Hildebrandt N, Sikorska E, Riesen SC. Adverse effects of intravenous amiodarone in 5 dogs. J Vet Intern Med 2009;23:657–661.
27. Pedro B, López-Alvarez J, Fonfara S, Stephenson H, Dukes-Mcewan J. Retrospective evaluation of the use of amiodarone in dogs with arrhyth-mias (from 2003 to 2010). J Small Anim Pract 2012;53:19–26.
28. Oyama MA, Prosek R. Acute conversion of atrial fibrillation in two dogs by intravenous amiodarone administration. J Vet Intern Med 2006;20: 1224–1227.
LET’S CONNECT
Do we have your current information? If you’re a veterinarian in Canada, take a moment to update your information in the CVMA national database. You can stay connected and we’ll keep you informed with time-sensitive news and relevant communications.
ONLINE: Go to canadianveterinarians.net and click My Portal (email address and password required). You’ll find your information under My Account > My Profile.
CALL US: 1-800-567-2862 between 8AM – 5PM (ET). We’ll update your information for you.
New address? New job? Haven’t heard from the CVMA lately?
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 37
Article
Evaluation of bovine respiratory syncytial virus (BRSV) and bovine herpesvirus (BHV) specific antibody responses between heterologous and homologous prime-boost vaccinated western Canadian beef calves
Nathan E.N. Erickson, Adam Berenik, Herbert Lardner, Stacey Lacoste, John Campbell, Sheryl Gow, Cheryl Waldner, John Ellis
Abstract — Bovine respiratory disease (BRD) is an economically important cause of morbidity and mortality in beef calves. Control of BRD is most often addressed through “homologous” vaccination utilizing the same injectable modified-live viral (MLV) vaccine for both priming and boosting. Heterologous prime-boosting uses different routes and antigenic forms for priming and boosting. Three vaccine protocols were compared: an injectable (IJ) MLV (IJ-MLV) group (IJ-MLV priming at 48 days and boosted with IJ-MLV at weaning), intranasal (IN) MLV (IN-MLV) group (intranasal priming with MLV at 24 hours, boosted twice with an IJ-MLV), and intranasal killed viral (IN-KV) group (primed with an IN-MLV at 24 hours, boosted twice with an IJ-KV). Serum antibody concentrations determined by enzyme-linked immunosorbent assays (ELISAs) were compared and the IN-KV group had significantly higher BRSV-specific antibody concentrations after boosting compared with the 2 homologous groups. No differences in BHV-specific antibody concentrations were observed between any of the groups.
Résumé — Évaluation des réponses spécifiques en anticorps contre le virus respiratoire syncitial bovin (BRSV) et l’herpèsvirus bovin (BHV) chez des bovins d’embouche de l’Ouest canadien vaccinés en primo-vaccination et en rappel de manière homologue ou hétérologue. Les maladies respiratoires bovines (BRD) sont une cause économiquement importante de morbidité et de mortalité chez les veaux d’embouche. La maitrise des BRD fait appel le plus souvent à une vaccination « homologue » utilisant le même vaccin injectable de virus vivant modifié (MLV) pour la primo-vaccination et le rappel. La primo-vaccination et le rappel hétérologue utilisent différentes voies et formes antigéniques pour l’amorçage et le rappel. Trois protocoles de vaccination furent comparés : un groupe MLV injectable (IJ) (IJ-MLV) (amorçage avec IJ-MLV à environ 48 jours et rappel avec IJ-MLV au sevrage). Un groupe MLV intranasal (IN) (IN-MLV) (amorçage intranasal avec MLV à environ 24 heures, deux rappels avec IJ-MLV), et un groupe avec un vaccin intranasal de virus tué (IN-KV) (amorçage avec IN-MLV à environ 24 heures, deux rappels avec IJ-KV). Les concentrations d’anticorps sériques déterminées par épreuves immuno-enzymatiques (ELISAs) furent comparées et le groupe IN-KV avait des concentrations d’anticorps spécifiques contre BRSV significativement plus élevées après le rappel comparativement aux deux groups homologues. Aucune différence dans les concentrations d’anticorps spécifiques contre le BHV ne furent observées entre les groupes.
(Traduit par Dr Serge Messier)Can Vet J 2021;62:37–44
Introduction
V eterinarians and producers vaccinate calves to prime their immune systems against pathogens associated with bovine
respiratory disease (BRD) and as one method to manage the impact of the disease. Commonly used viral vaccines contain modified-live viruses (MLV) including bovine respiratory syn-cytial virus (BRSV), bovine herpes virus type 1 (BHV1), bovine
parainfluenza virus 3 (BPIV3), and bovine viral diarrhea virus types 1 and 2 (BVDV1 and 2) (1). Bovine respiratory syncytial virus, BHV1, and BPIV3 target respiratory epithelia and are directly associated with respiratory disease development. Bovine viral diarrhea virus types 1 and 2 are included in the vaccines due to the virus’ ability to suppress the animal’s immune sys-tem (2).
Department of Large Animal Clinical Sciences (Erickson, Berenik, Campbell, Gow, Waldner), Department of Microbiology (Lacoste, Ellis), Western College of Veterinary Medicine, University of Saskatchewan, 52 Campus Drive, Saskatoon, Saskatchewan S7N 5B4; Department of Animal and Poultry Science, College of Agriculture and Bioresources, University of Saskatchewan, 51 Campus Drive, Saskatoon, Saskatchewan S7N 5A8 (Lardner).Address all correspondence to Dr. Nathan Erickson; e-mail: [email protected] of interest: Dr. John Ellis has performed contract research for Zoetis Canada and Boehringer Ingelheim.Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
FOR PERSONAL USE ONLY
38 CVJ / VOL 62 / JANUARY 2021
AR
TIC
LE
Attesting to the validity of this approach, a recent meta-analysis of the impact of vaccination on feedlot calf BRD morbidity and mortality indicated that vaccinating for viral pathogens resulted in a protective effect, reducing both morbid-ity and mortality (3). However, despite the adoption of routine vaccination, BRD still has a negative economic impact on cattle feeding operations across North America through calf morbidity and mortality, and production losses (1,4). The less than optimal effectiveness of vaccination in commercial settings may in part be due to how vaccines are applied, including factors such as vaccination in the face of maternal antibodies (IFOMA) and at the time of “stress” associated with weaning.
Improper application is partly due to timing of the prim-ing dose of vaccine; most producers vaccinate neonatal calves when it is convenient to handle cattle at spring “turnout,” when the calves are approximately 2 mo old (5). Administration of injectable immunogens to calves is one of the most common methods of vaccination in cow-calf operations; initial priming being the intention (5). The priming vaccine dose is frequently applied when calves are 2 mo of age, followed by a booster at 6 mo of age (5). However, at 2 mo of age calves with good passive transfer will still have high maternal antibody concen-trations (6), and maternal antibodies can interfere with the immune system’s ability to respond to a parenterally adminis-tered vaccine (7–9). Determining a specific time to vaccinate is difficult, as maternal antibody concentrations decrease at dif-ferent rates depending on a variety of factors, most notably the level of passive transfer of maternal antibodies (MatAb) (6,8,10). Mucosal vaccination can stimulate an immune response in the face of MatAb, effectively bypassing this inhibitory effect (11). Moreover, mucosal vaccination can also prime for systemic immunity (12,13).
Another possible challenge to vaccine effectiveness may be that most vaccine protocols utilize a homologous approach (5); priming and boosting with either the same type of antigen, or with the same route of administration. Homologous vaccina-tion tends to drive one type of response by the immune sys-tem (14,15). In comparison, heterologous vaccination protocols utilize different routes of administration usually together with presenting different forms of antigens to stimulate a broader immune response of increased duration (15,16). The current study compared antibody responses to BRSV and BHV1 in beef calves that were vaccinated using either homologous or heterolo-gous vaccination protocols, and then examined whether there were any associations between the immunological responses and a primary production parameter, average daily gain.
Materials and methodsSeventy-five neonatal crossbred singleton heifer calves, born to cows that were second or greater parity, were enrolled in the study at the Western Beef Development Center (WBDC) research facility, near Lanigan, Saskatchewan. Prior to breeding, the cows from this herd were vaccinated annually with antigens for Clostridium spp. (Covexin Plus; Merck Animal Health, Kirkland, Quebec), anthrax (Anthrax Spore Vaccine; Colorado Serum Company, Denver, Colorado, USA), and viruses associ-ated with respiratory and reproductive disease (Bovi-Shield Gold
FP5; Zoetis Canada, Kirkland, Quebec). At birth, calves were individually identified by unique dangle and radio frequency ID (RFID) tags. The cows calved in paddocks (15 acres in size) and the pairs remained as a single group through the calving and pasture season of 2017.
Within 24 h of birth the calves were enrolled into 1 of 3 treatment groups; injectable modified live viral (IJ-MLV) group, intranasal modified live viral (IN-MLV) group, and intranasal killed viral (IN-KV) group (Table 1). Calves were enrolled into 1 of the 3 groups using a spreadsheet (Excel; Microsoft Corporation, Redmond, Washington, USA) and randomization formula. Calves were block randomized into 1 of the 3 experimental groups in groups of 3 animals based on birth order. At enrollment either an IN vaccine (Inforce 3; Zoetis Canada) or sterile water was administered intranasally, one 10 mL vacuum tube of blood was collected, and weights were recorded. Serum was separated within 4 h and stored at 221°C. At 48 d 6 8 d [6 standard deviation (SD)] of age, investigators administered sub-cutaneous MLV or KV booster vaccinations according to the calf ’s allocated protocol (Bovi-Shield Gold FP5; Zoetis Canada) (Triangle 5; Boehringer Ingelheim, Burlington, Ontario), weighed calves, and collected and stored a second set of serum samples. The vaccination at 48 d of age will be referred to as “turnout” vaccination. Two weeks after “turnout” vaccination, a third set of serum samples was collected and body weights were recorded.
One calf in the IN-MLV group died within 48 h of birth. A post-mortem examination was conducted by a veterinarian; no cause of death was determined and there was no evidence of respiratory disease. Also, 1 calf from the IJ-MLV group was removed from the study due to a chronic lameness of its dam. The pair had to be removed from pasture midsummer and there-fore the calf was no longer managed with the rest of the trial calves. Finally, at weaning 20 calves: 9 from the IN-MLV group, 9 from the IN-KV group, and 2 from the IJ-MLV group, were removed from this trial to a BRSV challenge study comparing homologous and heterologous vaccine protocols (17). For the remaining 53 calves (IJ-MLV = 22, IN-MLV = 15, IN-KV = 16), a subcutaneous MLV or KV booster vaccine (Bovi-Shield Gold FP5; Zoetis Canada) (Triangle 5; Boehringer Ingelheim) was administered at weaning as directed by the calf ’s allocated pro-tocol. Serum samples were collected, and calves were re-weighed. After weaning, calves were moved to a backgrounding lot at the WBDC. Two weeks after weaning a serum sample was collected and body weight was recorded. The calves were then placed in a single pen for feeding and observation of health for 60 d. A final body weight was collected 87 d after weaning. The weights were collected when the calves were being processed for other purposes to reduce the number of movements through handling facilities, in compliance with the University of Saskatchewan’s Animal Research Ethics Board (animal care protocol number 20170003). If a calf died during the trial, a necropsy was per-formed within 24 h to determine the cause of death.
Calves were observed for morbidity due to BRD by the WBDC staff and treated as required, based on written protocols. Clinical disease due to BRD was reported if calf rectal tempera-ture was above or equal to 40°C and at least 2 of the following
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 39
AR
TIC
LE
signs were observed: moderate depression (drooping head and ears), reluctance to move, tucking of the flank/abdomen, rapid shallow breathing or, increased respiratory effort.
Enzyme-linked immunosorbent assays (ELISAs) were used to determine antibody concentrations for BRSV and BHV1 with minor modifications (11). Ninety-six well plates (Immunolon 1B; Thermofisher, Waltham, Massachusetts, USA) were coated with viral antigens purified from virus-infected cell lysates, as well as uninfected cell lysates prepared simi-larly. Serum, diluted to 1:40, was applied to the plate. After incubation and washing, bound antibody was detected using horseradish peroxidase conjugated recombinant Protein G (Zymed, ThermoFisher) and o-Phenylenediamine dihydrochlo-ride (OPD) substrate (Sigma Aldrich, St. Louis, Missouri, USA). A spectrometer was then used to determine the concentration of antibodies that attached to virus in the wells. This optical density was compared to a control, giving the concentration of antibodies in ELISA units as a percentage of the control.
Data were imported into the SPSS version 25 statistical software (SPSS v.25, IBM, Armonk, New York, USA). A Shapiro-Wilk test of normality, with a significance value of P , 0.05 was used to assess the normality of the data. The serum antibody concentration data for BRSV and BHV1 were analyzed using generalized estimating equations. The models used a normal distribution, with an AR1 working correlation matrix. Treatment group and time were included in the model as main effects and treatment with time as an interaction term. Pairwise comparisons were estimated to determine differences between treatment groups at different time points.
Average daily gain (ADG) was calculated using weight values from birth, turnout, weaning, and final trial day. Differences in average daily gain among treatment groups at different time points were analyzed using a linear regression, with treatment, time, and a treatment by time interaction as fixed effects in the model. Differences were considered significant with a P-value of , 0.05.
Figure 1. Comparison of mean BRSV-specific antibody concentrations within treatment groups at different time points.a,b,c,d denote significant differences between time points for the IJ-MLV group.e,f,g denote significant differences between time points for the IN-MLV group.h,i,j,k denote significant differences between time points for the IN-KV group.
The IJ-MLV group received an injectable MLV vaccine at turnout and weaning. The IN-MLV group received an IN-MLV vaccine within 24 h of birth and an MLV injectable vaccine at turnout and weaning. The IN-KV group received an IN-MLV vaccine at birth and a KV injectable vaccine at turnout and weaning.
Mea
n B
RS
V (E
LIS
A u
nits
)
Treatment
Time pointTurnout2 Weeks post-turnoutWeaning2 Weeks post-weaning
IJ-MLV IN-MLV IN-KV
150
100
50
0
FOR PERSONAL USE ONLY
40 CVJ / VOL 62 / JANUARY 2021
AR
TIC
LE
ResultsThe predicted means from the BRSV antibody comparison model revealed significant differences in antibody concentra-tions between treatment groups at various time points (Table 2). When the calves were vaccinated at 48 d of age (turnout), there were no significant differences between any of the treat-ment groups (P $ 0.9); however, 2 wk after vaccination, the predicted mean BRSV antibody concentration for the IN-KV group was significantly higher than the concentrations for both the IJ-MLV (P , 0.01) and the IN-MLV (P = 0.03) groups (Table 2). There was no statistical difference in the BRSV antibody concentrations for the IJ-MLV and IN-MLV groups (P = 0.2).
At weaning (6 mo of age), the BRSV antibody concentra-tions for the IN-KV group were again significantly higher than for the IJ-MLV (P , 0.01) and IN-MLV groups (P , 0.01), respectively. Also similar to the observations at 2 wk post-turnout vaccination, the BRSV antibody concentrations in the IJ-MLV and IN-MLV groups did not significantly dif-fer (P = 0.3). The same pattern was observed again at 2 wk post-weaning. The BRSV concentrations for the IJ-MLV and IN-MLV groups were not significantly different from each other (P = 0.6) and the concentration for the IN-KV group was significantly higher than for both IN-MLV (P , 0.01) and IJ-MLV (P , 0.01) groups at 2 wk post-weaning.
Differences in antibody concentrations within each group over time were also observed to determine if a response to vac-cination had occurred (Figure 1). All 3 groups had high BRSV antibody concentrations at turnout vaccination and this is likely due to MatAb. Between the turnout vaccination and 2 wk post-vaccination, the IJ-MLV group had significantly decreased BRSV antibody concentrations (P = 0.02), the IN-MLV group had no significant change in antibody concentrations (P = 0.7), and the IN-KV group had significantly increased antibody concentrations (P , 0.01). Between the 2 wk post-turnout vaccination and weaning, all 3 groups had significantly reduced BRSV antibody concentrations (P , 0.01) (Figure 1). Between weaning and 2 wk post-weaning, all 3 groups had significantly increased BRSV antibodies (P , 0.01) (Figure 1).
At each time point the predicted mean BHV1 antibody con-centrations were also compared among the 3 groups (Table 3). At turnout vaccination (P . 0.7) and at 2 wk post-vaccination (P . 0.5), there were no significant differences in BHV1 anti-body concentrations among any of the groups (Table 3). At weaning, BHV1 antibody concentrations in the IN-KV group were significantly higher than in the IN-MLV group (P = 0.04). The BHV1 antibody concentrations in the IJ-MLV group were not significantly different from the IN-MLV or IN-KV groups (P = 0.1, P = 0.7) at weaning (Table 3). At 2 wk post-weaning there was no significant difference in BHV1 antibody concentrations between the IJ-MLV versus IN-MLV (P = 0.2), IJ-MLV versus IN-KV (P = 0.6), and IN-MLV versus IN-KV groups (P = 0.6).
Differences in BHV1 antibody concentrations were also compared among time points within the treatment group to examine response to vaccination (Figure 2). As with the BRSV,
Table 3. A comparison of the mean difference of BHV-1-specific antibody concentrations between groups at each of the different time points.
Mean difference of BHV1 antibody concentrations
Relative difference (95% CI) P-value
Treatment Treatment
IJ-MLV versus IN-KV versus IN-KV versus IJ-MLV versus IN-KV versus IN-KV versus Time point IN-MLV IJ-MLV IN-MLV IN-MLV IJ-MLV IN-MLV
Figure 2. Comparison of mean BHV1-specific antibody concentrations within threatment groups at different time points.a,b,c denote significant differences between time points for the IJ-MLV group.d,e,f denote significant differences between time points for the IN-MLV group.g,h,i denote significant differences between time points for the IN-KV group.
The IJ-MLV group received an injectable MLV vaccine at turnout and weaning. The IN-MLV group received an IN-MLV vaccine within 24 h of birth and an MLV injectable vaccine at turnout and weaning. The IN-KV group received an IN-MLV vaccine at birth and a KV injectable vaccine at turnout and weaning.
Mea
n B
HV
1 (E
LIS
A u
nits
)
Treatment
Time pointTurnout2 Weeks post-turnoutWeaning2 Weeks post-weaning
IJ-MLV IN-MLV IN-KV
50
40
30
20
10
0
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 41
AR
TIC
LE
the BHV1 antibody concentrations were high for all 3 groups upon turnout vaccination indicating MatAb presence. Between turnout vaccination and 2 wk post vaccination all 3 treatment groups had significantly lower concentrations of antibody post 48-day vaccination (P , 0.01). From 2 wk post-turnout vaccination to weaning, all 3 treatment groups again had sig-nificantly lower BHV1 antibody concentrations (P , 0.01) (Figure 2). However, between weaning and 2 wk post-weaning, all 3 treatment groups had significantly increased BHV1 anti-body concentrations (P , 0.01).
Average daily gains were calculated for calves from each group between the important time points (Table 4). No differ-ences in ADG were observed among treatment groups during the birth to turnout vaccination time period: IJ-MLV versus IN-MLV (P = 0.7), IJ-MLV versus IN-KV (P = 0.6), IN-MLV versus IN-KV (P . 0.9). From birth to weaning there were also no significant differences observed between the treatment groups: IJ-MLV versus IN-MLV (P = 0.6), IJ-MLV versus IN-KV (P . 0.9), IN-MLV versus IN-KV (P = 0.6). Finally, the ADG from weaning to 87 days post-weaning was not significantly different between the treatment groups: IJ-MLV versus IN-MLV (P = 0.4), IJ-MLV versus IN-KV (P = 0.4), IN-MLV versus IN-KV (P = 0.9).
DiscussionThis study compared the effectiveness of 3 vaccination proto-cols in stimulating systemic (IgG) antibody responses against 2 important viral pathogens in BRD, BRSV, and BHV1. To our knowledge, this is the first study to directly compare heterolo-gous and homologous vaccination protocols using commercial vaccines, in a commercially operated cow/calf research herd.
In the beef cattle industry, many calves receive what is meant to be a priming dose of vaccine at approximately 2 mo of age, either at branding or when cow-calf pairs are moved to summer pasture, often referred to as turnout. This initial vaccination is intended to be followed by a boosting dose of vaccine at weaning at approximately 6 mo of age (5). However, parenteral vaccination at turnout/branding may be ineffective primarily because of the likely interference by MatAb (9,18). Indeed, this inhibitory effect of MatAb on priming by paren-
teral administration of vaccines to young calves with MatAb has been documented in challenge studies with BVDV, BRSV, and BHV1 (19–21). The effect of MatAb presence on T-cell responses is more controversial; however, previous work has shown that T-cell responses can occur to BRSV antigens (22). Avoidance of the effect of interference by MatAb on vaccine response is an important area of research and the current study shows that this avoidance may be achievable through use of a combination of mucosal priming and heterologous boosting.
The possibility that MatAb interference can be avoided through use of mucosal vaccination has been demonstrated, previously, in the case of BRSV (11). The results of this study support those observations. This study compares the vaccine protocols in the presence of MatAb, as all calves in this study had high antibodies for both BRSV and BHV1 before their turnout vaccination at approximately 48 d of age (18). Maternal antibody persistence at variable concentrations for months after birth is known to occur in calves (6). However, it should be noted that the evidence of MatAb interference to the BRSV anti-body response in the IJ-MLV group is not direct. The IJ-MLV group was the only group shown to have decreasing BRSV antibody concentration after the first subcutaneous vaccination (48 d of age) and this may indicate an absence of antibody response. In comparison, the IN-KV group had significantly higher antibody concentrations at 2 wk post-turnout, while the IN-MLV group had no change in antibody concentrations. The IJ-MLV group had lower antibody concentrations, suggesting the vaccine administered at turnout did not successfully stimu-late an immune response against BRSV. At 2 wk post-turnout, the antibody concentrations of the IN-MLV group remained static suggesting that systemic priming may have occurred with the IN vaccine and that the boosting vaccine, at turnout, was successful at stimulating an immune response. Had there been no response to the booster, a decrease in antibody concentration, as occurred with the IJ-MLV group, would be expected since MatAb wanes at a steady rate over time (6). The IN-KV groups had a clear increase in antibodies post-turnout vaccination, sug-gesting that the IN vaccine primed the calves at 24 h, and that the heterologous booster stimulated a greater immune response
Table 4. A comparison of mean difference of the ADG of each group.
Mean difference
Relative difference (95% CI) P-value
Treatment Treatment
IJ-MLV versus IJ-MLV versus IN-MLV versus IJ-MLV versus IJ-MLV versus IN-MLV versusTime point IN-MLV IN-KV IN-KV IN-MLV IN-KV IN-KV
Birth to final 20.025 20.024 0.0011 0.4 0.4 0.9 (20.086, 0.035) (20.082, 0.036) (20.64, 0.64)
CI — Confidence interval.
FOR PERSONAL USE ONLY
42 CVJ / VOL 62 / JANUARY 2021
AR
TIC
LE
than the homologous booster. However, the differences in antibody response between the IN-KV group and other groups could also reflect the effect of adjuvant type or even antigen mass between the vaccines used.
Interestingly, in terms of differences in the antibody responses, the heterologous route of administration of MLV vaccine was not significantly different from the homologous route of MLV vaccine administration, whereas the heterologous antigen stimulated greater response than homologous antigen. This may indicate that changing route of administration may not be as important as changing the form or type (MLV versus killed or inactivated) of antigen when considering heterologous vaccination, in regard to BRSV antibody response.
While the antibody response at 2 wk post-turnout vaccina-tion may not appear to be immunologically relevant, additional evidence of the clinical significance of the difference between heterologous and homologous antigen type vaccination was documented in a BRSV challenge (17). Subsequent to BRSV challenge, a difference in response was observed between a subset of the IN-KV and IN-MLV groups with 2 IJ-MLV calves serving as non-IN primed controls. The challenge study demonstrated that homologous prime-boosted (IN-MLV) calves had higher clinical disease scores and significantly lower PaO2 concentra-tions, indicative of reduced pulmonary function, than did the heterologous group (IN-KV) (17).
In contrast to the BRSV response, there were no significant differences among the antibody responses to BHV1 over time among the vaccine groups. In other words, there was no indica-tion of an advantage to either the homologous or heterologous protocol. Nevertheless, while there were no apparent differences between vaccine groups, there were still significantly increased antibody responses within each group after each vaccination, indicating that each group responded equally to the vaccines. The effectiveness of each protocol was indicated by the high antibody concentrations 2 wk after the weaning vaccination. The BHV1-specific antibody concentrations after weaning vaccina-tion clearly show that an antibody response occurred; the BHV1 antibody concentrations were negligible before the weaning vaccination and significantly higher at the 2 wk post-weaning vaccination, for each vaccine group. The BHV1 antibody response at weaning indicated that the calves vaccinated through any of the 3 protocols had increased antibody concentrations after vaccination, and that an immune response occurred. It is not clear whether the IN vaccination or the turnout vaccination had a priming effect.
The BHV1 antibody responses are consistent with a study that showed an absence in response to subcutaneous vaccination IFOMA (23). However, the same study also showed that an anamnestic response occurred following a subsequent vaccina-tion at 190 d of age. It is possible that priming of B-cells and/or cell-mediated response occurred to the initial vaccination, which engendered a memory response to the next vaccination (23). The results of the current study may indicate this, as at 2 wk post-weaning all groups had a significant increase in BHV1-specific antibodies. However, it is not clear whether this is an anamnes-tic response or a primary response. A limitation of the current study is the absence of measurement of cell-mediated responses
and future work should consider this, or proteomics to provide further evidence of differences in immune response.
Why there were differences in responses to the 2 viruses in the same vaccine was not apparent. Certainly, antibody concen-trations alone do not necessarily equate with susceptibility to, or protection from disease (13,24). Whether or not there were treatment-dependent differences in parameters of cell-mediated immunity or, more importantly, whether there would be a differ-ence in response to BHV1 challenge were not examined in this study, but are worthy of further investigation. The overall health and lack of a difference in ADG among the treatment groups in this study could be indicative of a low level of pathogen exposure and hence no real challenge of vaccine-stimulated immunity.
The current study shows that vaccine responses to BRSV and BHV1 antigens are variable and not equivalent. The antibody response to BRSV antigens shows potential for bypassing MatAb interference through mucosal administration of the first vac-cine; however, this potential was not demonstrated in the case of BHV1, and indicates that response to vaccines is likely not uniform across different viruses. As well, difference in response to heterologous boost was not shared across the 2 viruses, and further indicates that antibody responses to different methods of antigen presentation are not the same across viruses. These results were somewhat counterintuitive because MLV BHV1 would be expected to have more widespread and systemic rep-lication compared to BRSV. Nevertheless, it can be stated that calves primed through IN vaccination IFOMA have variable antibody responses to heterologous vaccination depending on the virus.
While the results of this study suggest that heterologous administration of vaccine may stimulate a different antibody response compared to homologous administration, there are explanations, other than route of administration for differences in antibody response. For example, in addition to increased anti-genic mass, killed vaccines typically have an adjuvant, whereas MLV vaccines usually do not. This study used an MLV vaccine with an adjuvant, so all treatment groups received an adjuvanted vaccine. However, the adjuvants were different, which could have contributed to the outcome. Overall, the results of this study should be tempered with the understanding that using a different group of vaccines, or MLV vaccines without adjuvants, may result in a different outcome. Previous work has shown that different killed and MLV vaccines result in different antibody responses (25); therefore, future work should compare more combinations of commercial vaccines to investigate whether the same differences will be found using various combinations of routes of administration.
As well, antibody responses of calves within the different treatment groups could have been modified by the shedding of vaccine virus, since the calves were housed as a single unit on pasture. This is especially important when considering the IJ-MLV group that was housed with the calves vaccinated IN at 24 h of age. There is evidence that vaccine virus may be shed after administration of modified live virus vaccines (26). However, in those studies there was no evidence of induction of an immune response when negative control calves were housed with recently vaccinated calves, suggesting there is a minimal
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 43
AR
TIC
LE
immunizing dose. In fact, one previous study did demonstrate that immune responses, to BRSV antigen, were not induced in unvaccinated control calves housed with IN vaccinated calves (27). Also given the young age of the calves, in the cur-rent study, and the fact that they were managed on 15 acre paddocks, it is unlikely that the calves had enough contact on pasture to immunize one another. Despite this, the risk of immune response induction of non-vaccinated calves through contact with vaccinated calves should be considered when reviewing the results of this study.
Two previous studies demonstrated an apparent benefit of a homologous prime-boost vaccination over traditional injectable vaccination at weaning (28,29). Building on this earlier work, the results of the current study demonstrated that heterologous vaccination increased BRSV antibody concentrations compared to homologous vaccination. Currently, there is little published research concerning heterologous prime-boost protocols in cattle, in general (17,24), and no studies regarding this type of vaccination for the control of BRD in the field. However, given the plethora of data from experimental models that are being used to apply heterologous prime-boost protocols in human medicine, this approach to vaccination should be explored further in beef cattle production. Studies such as this, that use currently available vaccines, are promising for the cattle industry, but more research is needed to develop vaccines for heterolo-gous prime-boosting, including studies to improve upon the limitations of the current study. Future vaccine development may include combination vaccines with modified-live BVDV and BHV1 portions and antigens from inactivated BRSV, or inactivated BRSV and BHV-1 to reduce the potential for feto-pathology associated with the latter virus. Future work could also examine the effectiveness of heterologous BVDV vaccina-tion in the control of acute BVD infections in recently weaned beef calves.
AcknowledgmentsThe authors acknowledge support from the Saskatchewan Agricultural Development Fund, Saskatchewan Cattlemen’s Association, and the University of Saskatchewan. We also thank Krystal Savenkoff, Leah Pearce, and the staff of the Western Beef Development Centre in Lanigan, Saskatchewan for their assistance with the project. A special thank you to Karen Gesy of the Department of Large Animal Clinical Sciences at the Western College of Veterinary Medicine for her help with sample processing and storage. CVJ
References 1. Miles DG. Overview of the North American beef cattle industry and
the incidence of bovine respiratory disease (BRD). Anim Health Res Rev 2009;10:101–103.
2. Ridpath J. The contribution of infections with bovine viral diarrhea viruses to bovine respiratory disease. Vet Clin North Am Food Anim Pract 2010;26:335–348.
3. Theurer ME, Larson RL, White BJ. Systematic review and meta-analysis of the effectiveness of commercially available vaccines against bovine herpesvirus, bovine viral diarrhea virus, bovine respiratory syncytial virus, and parainfluenza type 3 virus for mitigation of bovine respiratory disease complex in cattle. J Am Vet Med Assoc 2015;246:126–142.
4. Smith RA. North American cattle marketing and bovine respiratory disease (BRD). Anim Health Res Rev 2009;10:105–108.
5. Waldner CL, Parker S, Campbell JR. Vaccine usage in western Canadian cow-calf herds. Can Vet J 2019;60:414–422.
6. Chamorro MF, Walz PH, Haines DM, et al. Comparison of levels and duration of detection of antibodies to bovine viral diarrhea virus 1, bovine viral diarrhea virus 2, bovine respiratory syncytial virus, bovine herpesvirus 1, and bovine parainfluenza virus 3 in calves fed maternal colostrum or a colostrum-replacement product. Can J Vet Res 2014;78:81–88.
7. Niewiesk S. Maternal antibodies: Clinical significance, mechanism of interference with immune responses, and possible vaccination strategies. Front Immunol 2014;5:446.
8. Munoz-Zanzi CA, Thurmond MC, Johnson WD, Hietala SK. Predicted ages of dairy calves when colostrum derived bovine viral diarrhea virus antibodies would no longer offer protection against disease or interfere with vaccination. J Am Vet Med Assoc 2002;221:678–685.
9. Tizard I. Veterinary Immunology. 10th ed. St. Louis, Missouri: Elsevier, 2017.
10. Fulton RW, Briggs RE, Payton ME, et al. Maternally derived humoral immunity to bovine viral diarrhea virus (BVDV) 1a, BVDV1b, BVDV2, bovine herpesvirus-1, parainfluenza-3 virus bovine respiratory syncytial virus, Mannheimia haemolytica and Pasteurella multocida in beef calves, antibody decline by half-life studies and effect on response to vaccina-tion. Vaccine 2004;22:643–649.
11. Ellis JA, Gow SP, Mahan S, Leyh R. Duration of immunity to experi-mental infection with bovine respiratory syncytial virus following intranasal vaccination of young passively immune calves. J Am Vet Med Assoc 2013;243:1602–1608.
12. Mahan SM, Sobecki B, Johnson J, et al. Efficacy of intranasal vac-cination with a multivalent vaccine containing temperature-sensitive modified-live bovine herpesvirus type 1 for protection of seronegative and seropositive calves against respiratory disease. J Am Vet Med Assoc 2016;248:1280–1286.
13. Hill KL, Hunsaker BD, Townsend HG, van Drunen Littel-van den Hurk S, Griebel PJ. Mucosal immune response in newborn Holstein calves that had maternally derived antibodies and were vaccinated with an intranasal multivalent modified-live virus vaccine. J Am Vet Med Assoc 2012;240:1231–1240.
14. Bolton D, Santra S, Swett-Tapia C. Priming T-cell responses with recom-binant measles vaccine vector in a heterologous prime-boost setting in non-human primates. Vaccine 2012;30:5991–5998.
15. Lu S. Heterologous prime-boost vaccination. Curr Opin Immunol 2009;21:346–351.
16. Jung SY, Kang KW, Lee EY, et al. Heterologous prime-boost vaccination with adenoviral vector and protein nanoparticles induces both Th1 and Th2 responses against Middle East respiratory syndrome coronavirus. Vaccine 2018;36:3468–3476.
17. Ellis J, Gow S, Berenik A, Lacoste S, Erickson N. Comparative efficacy of modified-live and inactivated vaccines in boosting responses to bovine respiratory syncytial virus following neonatal mucosal priming of beef calves. Can Vet J 2018;59:1311–1319.
18. Windeyer MC, Leslie KE, Godden SM, Hodgins DC, Lissemore KD, LeBlanc SJ. Association of bovine respiratory disease or vaccination with serologic response in dairy heifer calves up to three months of age. Am J Vet Res 2015;76:239–245.
19. Ellis J, West K, Cortese V, Konoby C, Weigel D. Effect of maternal antibodies on induction and persistence of vaccine-induced immune responses against bovine viral diarrhea virus type II in young calves. J Am Vet Med Assoc 2001;219:351–356.
20. Ellis J, Gow S, Bolton M, Burdett W, Nordstrom S. Inhibition of prim-ing for bovine respiratory syncytial virus-specific protective immune responses following parenteral vaccination of passively immune calves. Can Vet J 2014;55:1180–1185.
21. Lemaire M, Schynts F, Meyer G, et al. Latency and reactivation of a glycoprotein E negative bovine herpesvirus type 1 vaccine: Influence of virus load and effect of specific maternal antibodies. Vaccine 2001;19: 4795–4804.
22. Chamorro MF, Woolums A, Walz PH. Vaccination of calves against respiratory viruses in the face of maternally derived antibodies. Anim Health Res Rev 2016;17:79–84.
23. Kirkpatrick JD, Step DL, Payton ME, et al. Effect of age at the time of vaccination on antibody titers and feedlot performance in beef calves. J Am Vet Med Assoc 2008;233:136–142.
24. Walz PH, Givens MD, Rodning SP, et al. Evaluation of repro-ductive protection against bovine viral diarrhea virus and bovine herpesvirus-1 afforded by annual revaccination with modified-live viral
FOR PERSONAL USE ONLY
44 CVJ / VOL 62 / JANUARY 2021
AR
TIC
LE
or combination modified-live/killed viral vaccines after primary vaccina-tion with modified-live viral vaccine. Vaccine 2017;35:1046–1054.
25. Fulton RW, Burge LJ. Bovine viral diarrhea virus types 1 and 2 antibody response in calves receiving modified live virus or inactivated vaccines. Vaccine 2001;19:264–274.
26. Walz PH, Newcomer BW, Riddel KP, Scruggs DW, Cortese VS. Virus detection by PCR following vaccination of naive calves with intranasal or injectable multivalent modified-live viral vaccines. J Vet Diagn Invest 2017;29:628–635.
27. Timsit E, Le Drean E, Maingourd C, et al. Detection by real-time RT-PCR of a bovine respiratory syncytial virus vaccine in calves vac-cinated intranasally. Vet Rec 2009;165:230–233.
28. Stoltenow D, Cortese V, Seeger J, Stokka GS, Weigel D. Immunologic responses of beef calves to concurrent application of modified-live viral vaccine and systemic administered Mannheinia haemolytica bacterin-leukotoxoid. Bov Pract 2011;45:132–138.
29. Stokka GL, Neville B, Seeger JT, Stoltenow C, Dyer N, Gaspers JJ. Serological effect of two concurrent IBRV, BVDV, BRSV, PI3V and Mannheimia haemolytica vaccination protocols and time interval between the first and second dose on the subsequent serological response to the BRSV and M. haemolytic fractions in suckling beef calves. Bov Pract 2016;50:21–27.
New Products Nouveaux produits
New Pet Hero App to locate lost petsIntroducing the future of pet rescue! Pet Hero is the world’s first and only global pet real-time locator recovery rescue as a cellular phone app. Created in Canada, the Pet Hero app is a technical revolution in locating lost pets.
When a pet is lost, time is a pet’s greatest threat and every second matters! The quicker a lost pet is located for recovery reduces the chances of it being killed in an accident, stolen or lost forever. The free Pet Hero app is a pet owner’s answer to a missing child’s Amber Alert system! Neighbors looking out for neighbors can help keep pets safe within their local community
with a simple Hero Photo! The Pet Hero app gives users control of their own notification parameters (i.e. 1 to 10 km) for both outgoing and incoming alerts within their own (circle) commu-nity. No inserted chip or tracking device required! No personal information, not even an e-mail address, is required to register a pet or to use the Pet Hero app.
You don’t even have to own a pet to be a Pet Hero! The company would like to encourage all pet lovers to participate by downloading the app so that they can become part of the community that keeps an eye out for lost pets.
Contact: Website: https://www.petherorescue.com
Dermcare Malaseb — Now Available in CanadaDechra Veterinary Products is pleased to announce the signing of an exclu-sive distribution agreement with Dermcare-Vet for the Canadian rights to Dermcare Malaseb, a medicated shampoo for dogs and cats with 2% Chlorhexidine Gluconate and 2% Miconazole Nitrate.
Founded in 1981 by Professor Kenneth Mason, Dermcare-Vet has focused on developing a limited range
of very high-quality products: Malaseb is no exception. The product has been a global market leader in veterinary dermatol-ogy for over 20 years and consistently outperforms the competi-tion in clinical studies.
Malaseb’s unique antibacterial and antifungal formulation allows for the effective treatment of seborrheic dermatitis asso-ciated with infections by Staphylococcus pseudintermedius and Malassezia pachydermatis. Furthermore, it is recommended by the World Association for Veterinary Dermatology as an adjunct therapy in the treatment of generalized ringworm.
Dechra Veterinary Products is proud to add Malaseb to its dermatology portfolio including DermAllay, DermaLyte, MalAcetic, DermaChlor 4, Isaderm and more. We look forward to partnering with you for all of your veterinary dermatology needs.
Contact your Dechra Sales Representative or our Customer Service at 1-855-332-9334; e-mail: [email protected]
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 45
Article
The effect of prednisone on histologic and gross characteristics in canine mast cell tumors
Ken J. Linde, Stephen L. Stockdale, Michael B. Mison, James A. Perry
Abstract — The objective of the study was to determine whether neoadjuvant prednisone therapy affects histological features of cutaneous and subcutaneous mast cell tumors. Twenty-eight dogs with a treatment naïve . 1-cm diameter mast cell tumor (MCT) were randomly assigned (Random number generator; Random.org, Dublin, Ireland) in a blinded fashion to receive either prednisone or placebo (Quality Food Center Pharmacy, Kirkland, Washington, USA). Volumes of mast cell tumors were calculated before incisional and excisional biopsies. Following incisional biopsy, patients received either prednisone (1 mg/kg body weight) daily or a placebo for 7 to 14 days leading up to excisional biopsy. Tumor grade for cutaneous MCT, and mitotic count and atypia for all tumors were reported. Perioperative treatment with prednisone had no significant effect on tumor grade, atypia, or mitotic count. Tumor volume was significantly decreased with prednisone treatment. The use of neoadjuvant prednisone to decrease MCT volume in order to facilitate tumor excision, can be considered without significant concern for change of tumor histologic features in the common population of low- to intermediate-grade MCT.
Résumé — Effet de la prednisone sur les caractéristiques histologiques et macroscopiques des mastocytomes canins. L’objectif de la présente étude était de déterminer si une thérapie néoadjuvante avec de la prednisone affecte les caractéristiques histologiques des mastocytomes cutanés et sous-cutanés. Vingt-huit chiens avec un mastocytome (MCT) ayant un diamètre . 1 cm avant le traitement furent répartis de manière aléatoire (Random number generator; Random.org, Dublin, Irlande) à l’aveugle pour recevoir soit de la prednisone ou un placebo (Quality Food Center Phamacy, Kirkland, Washington, USA). Les volumes des MCT furent calculés avant les biopsies d’incision et d’excision. À la suite des biopsies d’incision, les patients reçurent soit de la prednisone (1 mg/kg de poids corporel) quotidiennement ou un placebo pour 7 à 14 jours menant à la biopsie d’excision. Le grade des tumeurs pour les MCT cutanés, ainsi que le dénombrement mitotique et l’atypie pour toutes les tumeurs furent rapportés. Le traitement préopératoire avec de la prednisone n’a pas eu d’effet significatif sur le grade des tumeurs, l’atypie ou le dénombrement mitotique. Le volume des tumeurs était réduit significativement avec le traitement à la prednisone. L’utilisation néoadjuvant de prednisone afin de diminuer le volume des MCT dans le but de faciliter l’excision des tumeurs peut être considérée sans préoccupation significative pour des changements dans les caractéristiques histologiques des populations habituelles de MCT de grade bas à intermédiaire.
(Traduit par Dr Serge Messier)
Can Vet J 2021;62:45–50
Introduction
M ast cell tumors (MCT) are the most common malignant cutaneous tumor in dogs, and are typically diagnosed
based on fine-needle aspiration and cytologic evaluation (1). Prognostic indicators include: histologic grade, clinical stage, tumor location, proliferation indices [e.g., mitotic count, agrophilic nucleolar organizer regions (AgNOR) scoring, Ki67 and/or proliferating cell nuclear antigen (PCNA) labeling
index], presence of systemic signs, as well as c-Kit receptor localization and mutation status (2–9).
Surgical excision is the mainstay of treatment for localized canine MCT, with risk for local tumor recurrence depending on the completeness of surgical excision and tumor grade (9–11). For low- and intermediate-grade tumors (Patnaik grading system) with complete excision, the chance of recurrence has been reported as low as 5% to 11% (9,12), whereas high-grade
Seattle Veterinary Specialists Blue Pearl, Kirkland, Washington 98034, USA (Linde); Veterinary Referral Center of Central Oregon, 1820 NW Monterey Pines Drive, Bend, Oregon 97703, USA (Stockdale); University of Pennsylvania School of Veterinary Medicine, Philadelphia, Pennsylvania 19104, USA (Mison); Veterinary Cancer & Surgery Specialists, Portland, Oregon 97222 USA (Perry).Address all correspondence to Dr. Ken Linde; e-mail: [email protected])Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
FOR PERSONAL USE ONLY
46 CVJ / VOL 62 / JANUARY 2021
AR
TIC
LE
tumors (Patnaik, Kiupel grading systems) have a 35.9% chance of recurrence with complete excision (11). Recurrence rates fol-lowing incomplete excision or excision with margins of , 2 mm were 6% to 30% for low- and intermediate-grade MCTs, com-pared to 85% to 90% for high-grade MCTs with incomplete margins (9,13,14). For high-grade tumors, larger tumors, and those in locations in which wide margins are not attainable, neoadjuvant treatment with corticosteroids is often applied in an effort to reduce peritumoral edema and potentially down-stage local disease with the goal to facilitate complete excision (15). Corticosteroids have been demonstrated to inhibit MCT prolif-eration in vitro, perhaps have a direct anticancer effect due to the presence of glucocorticoid receptors on the tumor cell itself (16), and/or lessening of peritumoral edema and inflammation (17). Of concern is whether the use of preoperative corticosteroids may alter the histological grade or other microscopic features of the tumor. A change in such could lead to incorrect prog-nostication and potentially inappropriate treatment decisions following surgery, resulting in either under- or over-treatment in the adjuvant setting.
The aim of this study was to answer the question whether neoadjuvant prednisone therapy affects tumor grade, in the case of cutaneous MCT, or other histological prognostic features of both cutaneous and subcutaneous MCT. The null hypothesis was that treatment with prednisone for 7 to 14 d before exci-sional biopsy would not have a statistically significant effect on MCT grade, cellular atypia, or mitotic count.
Materials and methodsPatient selectionClient-owned dogs of any age, breed, or gender with a newly diagnosed, treatment naïve MCT of greater than 1 cm diameter were eligible for enrollment. Any dog which had a recurrent MCT, or which had received a corticosteroid, non-steroidal anti-inflammatory drug (NSAID) or chemotherapeutic agent within the past 7 d was excluded. Tumor volume was determined before manipulation by measuring and calculating the volume of an ellipsoid [4/3π (0.5 length 3 0.5 width 3 0.5 depth)]. Informed consent was obtained from all dog owners before enrollment in the study, and all surgical procedures were performed at Seattle Veterinary Specialists-Blue Pearl.
Incisional biopsyPrior to randomization, patients underwent incisional biopsy obtained on day 0. The incisional biopsy was performed using a standard pretreatment protocol with diphenhydramine (Diphenhydramine HCL; Armas Pharmaceuticals, Manalapan, New Jersey, USA), 2 mg/kg body weight (BW), IM, once, famotidine (Famotidine Injection; West-Ward Pharmaceuticals, Eatontown, New Jersey, USA), 1 mg/kg BW, IV, once, opi-oid [(oxymorphone, Opana; Endo Pharmaceuticals, Malvern, Pennsylvania, USA), hydromorphone (Hydromorphone HCl; Acorn, Lake Forest, Illinois, USA), or methadone (Methadone HCl; Mylan Institutional, Rockford, Illinois, USA), 0.1 to 0.2 mg/kg BW, IM, once], IV catheter placement, diazepam (Diazepam Injection; Hospira, Lake Forest, Illinois, USA), 0.1 to 0.2 mg/kg BW, IV, at induction, and propofol (Propoflo;
Zoetis, Kalamazoo, Michigan, USA) titrated to effect. An inci-sional biopsy was taken from the center of the lesion using a 4- to 6-mm punch. The biopsy defect was then sutured using monofilament nylon suture. The tumor sections stained with standard hematoxylin and eosin (H&E) stain were reviewed by a single, blinded pathologist, and tumor grade (Patnaik and Kiupel) and the mitotic counts (derived from counting mitotic figures in 10 consecutive high power fields) were determined.
TreatmentThe dogs were randomly assigned to a treatment or placebo group (A). Following the incisional biopsy, dogs were given a cellulose placebo (B) or prednisone (Prednisone; Jubilant Cadista Pharmaceuticals, Salisbury, Maryland, USA), 1 mg/kg BW, PO, q24h, as well as famotidine, 1 mg/kg BW, PO, q24h, and diphenhydramine, 2 mg/kg BW, PO, q12h, for 7 to 14 d before the definitive excisional biopsy. Tramadol (Tramadol HCl; Amneal Pharmaceuticals, Brookhaven, New York), 2 to 4 mg/kg BW, q8h to 12h, was also prescribed as needed for pain control for 5 d after the incisional biopsy. Prednisone was dispensed in 5 mg capsules only and each placebo capsule was treated as an equivalent to 5 mg of prednisone for dosing uniformity. Dosing was based on a 1 mg/kg BW, PO, q24h oral prednisone equivalent. Treatment was continued for 7 to 14 d until the excisional biopsy.
Excisional biopsyPrior to manipulation, the post-treatment tumor volume was measured and recorded. The excisional biopsy was per-formed using a standard pretreatment with diphenhydramine (Armas Pharmaceuticals), 2 mg/kg BW, IM, once; famotidine (West-Ward Pharmaceuticals), 1 mg/kg BW, IV, once; opioid [hydromorphone (Acorn), methadone (Mylan Institutional)], 0.1 to 0.2 mg/kg BW, IM, once, IV catheter placement, diaz-epam (Hospira), 0.1 to 0.2 mg/kg BW, IV at induction, and propofol (Zoetis) titrated to effect to facilitate intubation. The dogs were maintained on isofluorane gas anesthetic in oxy-gen. Tumors were then excised using a proportional-margins approach (18) with margins measured in cm and marked using a sterile ink pen in surgery. Tumors larger than 3 cm in diameter were excised with 3 cm margins. The tissue margins were inked at the time of surgery in each orientation before placement in formalin. Closure was routine and performed according to surgeon preference. Prednisone was discontinued at the time of excisional biopsy and all dogs were re-examined 2 wk after surgery by the principal investigators.
BlindingPrincipal investigators, surgeons, and the pathologist were blinded to treatment status until completion of the study. One surgery technician was aware of the treatment status and dis-pensed the medication.
HistopathologyAll slides were evaluated by a single Board-certified anatomic pathologist (AB). Tumor grade was reported for cutaneous MCT based on the Patnaik (3-tiered) system (19) and the
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 47
AR
TIC
LE
Kiupel (2-tiered) grading system (20). Mitotic count and cel-lular atypia were also reported. Atypia was reported as mild, mild to moderate, and moderate. Atypia and mitotic count were reported for subcutaneous MCT since traditional grading does not apply to subcutaneous MCT. Excisional biopsy margins were reported for all tumors, with complete (histological) margins considered to be $ 1 mm.
Statistical analysesA sample size power calculation performed a priori and based on a paired t-test and alpha = 0.05 (P , 0.05), beta = 0.20 (Power = 80%), a difference to detect = 25%, and a stan-dard deviation of the differences = 1.5, yielded an estimate of 15 dogs per group. Wilcoxon rank-sum test was used to assess differences between the treatment groups using the variables of age, weight, treatment duration, pre-treatment tumor volume, post-treatment tumor volume, pre-treatment mitotic count, and post-treatment mitotic count.
Wilcoxon signed-rank test was used to assess differences between tumor volumes and tumor mitotic count pre- and post-treatment within a treatment group. Chi-square test and Fischer’s exact test were used to assess differences between the treatment groups with respect to gender, castration status, pre-treatment tumor grade, post-treatment tumor grade, pre-treatment tumor atypia, post-treatment tumor atypia, tumor site (subcutaneous versus cutaneous), and margins. McNemar’s test was used to assess change of tumor grade, mitotic count, and atypia within a group pre- and post-treatment. Wilcoxon rank-sum test was used to assess the change of tumor grade, mitotic count, and atypia between the groups. Atypia was scored as 1 (mild), 2 (mild to moderate), and 3 (moderate) for statistical analysis.
ResultsTwenty-eight client-owned dogs, 18 females and 10 males, were enrolled in the study. The breeds included boxer, Boston ter-rier, pug, border collie, Labrador retriever, poodle, dachshund, Italian greyhound, and miniature schnauzer. The treatment group consisted of 16 dogs (11 females, 5 males) with a median age of 9.9 y (range: 5.5 to 23.5 y), and a median weight of 11 kg (range: 4.8 to 41.4 kg). The placebo group consisted of 12 dogs (7 females, 5 males) with a median age of 9.5 y (range: 7 to 13.5 y) and a median weight of 19.5 kg (range: 7.4 to 51.9 kg). The placebo group dogs weighed significantly more (P , 0.05) than the treatment group dogs. There were 18 MCT (13 cutaneous, 5 subcutaneous) in the treatment group and 13 MCT (9 cutaneous, 4 subcutaneous) in the placebo group (Table 1). Pre-treatment tumor grade, tumor volume, and atypia were not significantly different between the groups. There was a significant difference in the pre-treatment mitotic count between the treatment groups (P = 0.04). The median mitotic count of the treatment group was 0 (range: 0 to 3), while the median mitotic count for the placebo group was 1 (range: 0 to 4). Of the 13 cutaneous MCT incisional biopsies in the treatment group, there were 11 Grade II tumors, and 1 Grade I tumor when graded by the Patnaik system; one incisional biopsy did not yield an MCT. When graded by the Kiupel system all 13 cutaneous tumors were low grade. In the placebo group, the 9 cutaneous tumor incisional biopsies yielded 8 Grade II tumors and 1 Grade I tumor when graded by the Patnaik system, and all were low grade according to the Kiupel system.
The duration of treatment ranged from 7 to 14 d. The median treatment duration for the treatment group was 8 d (range: 7 to 12 d), and was not significantly different from the
Table 1. Fisher’s exact test P-values for prednisone treatment and placebo groups.
Post-treatment atypia 1, 2, 3 5, 5, 5 4, 6, 3 0.66a Margins were complete if they were $ 1 mm.b Tumor grade was Patnaik (I, II, III) and Kiupel (low, high).c Atypia was categorized as 1 (mild), 2 (mild to moderate), 3 (moderate).
FOR PERSONAL USE ONLY
48 CVJ / VOL 62 / JANUARY 2021
AR
TIC
LE
median treatment duration of the control group, which was 7 d (range: 7 to 14 d) (P = 0.2).
Excisional biopsy tumor grade, atypia and mitotic count did not change significantly from incisional biopsy indices with either prednisone or placebo, and there remained no difference between groups. In the treatment group, 2/13 tumors changed grade from II to I, when graded by the Patnaik system, whereas 0/13 tumors changed grade based on the Kiupel system. In the placebo group 0/9 tumors changed grade with Patnaik grading; however, 2/9 tumors changed from low to high grade with the Kiupel grading. There was no significant difference in change of tumor grade between the groups (P = 0.11). In the treatment group mitotic count changed in 11/17 tumors, with the mitotic count decreasing in 6 tumors and increasing in 5 tumors. In the placebo group, mitotic count changed in 9/13 tumors with the mitotic count decreasing in 5 tumors, and increasing in 4 tumors, and remaining unchanged in 4 tumors. There was no significant difference between the groups with respect to mitotic count changes (P = 0.9). In the treatment group, cellular atypia changed in 5/17 tumors (atypia score decreasing in 3 tumors and increasing in 2 tumors), and in the placebo group cellular atypia changed in 4/13 tumors (atypia score decreasing in 2 tumors and increasing in 2 tumors). There was no significant difference between the groups with respect to cellular atypia changes (P = 0.9).
Tumor volume was significantly (P = 0.01) decreased with prednisone treatment (Tables 2, 3). The median tumor volumes in the treatment group before and after treatment were 6.2 cm3 (range: 0.5 to 65.5 cm3) and 2.3 cm3 (range: 0.5 to 54.6 cm3), respectively, representing a median 3.9 cm3 or 63% decrease in tumor volume: 8 tumors stable disease, 8 tumors partial
response, and 2 tumors progressive disease. Tumor volume in the control group was not significantly different between pre-treatment and post-treatment, with a pretreatment median of 4.4 cm3 (range: 0.3 to 78.6 cm3) and post-treatment median of 5.2 cm3 (range: 0.4 to 54.6 cm3). Four tumors showed pro-gressive disease, 6 tumors partial response, and 3 tumors stable disease.
In the treatment group there were 14/18 tumors excised with complete margins and 4/18 excised with incomplete margins, compared to the control group in which 11/13 tumors were excised with complete margins and 2/13 tumors were excised with incomplete margins. The percentage of tumors with incom-plete margins was not significantly different between the groups.
Complications following excisional biopsy occurred in 2 dogs. One dog in the treatment group developed a seroma which resolved with drainage and 1 dog in the control group had incisional dehiscence which healed by second intention with open wound management.
DiscussionNeoadjuvant treatment of MCT with a glucocorticoid is often applied to reduce peri-tumoral edema and potentially down-stage local disease, in order to facilitate complete tumor excision. The administration of a glucocorticoid has been dem-onstrated to result in a reduction in grossly measured MCT volume (15,21,22). Stancliff et al (15) reported a reduction in tumor volume of 25% or more, with a median 81% reduction in 87% of prospectively treated grade II MCTs. Responses, however, were not durable and typically lasted only weeks (15). Matsuda et al (16) showed that glucocorticoids suppress MCT proliferation both in vitro and in vivo, and that MCT sensitivity
Table 2. Wilcoxon rank-sum test P-values for non-categorical variables for prednisone and placebo groups.
Prednisone Placebo Wilcoxon rank-sum testVariable Median Q1 Q3 Median Q1 Q3 P-value
Data were summarized by means of the Median, Q1, and Q3 (50th, 25th, and 75th percentiles, respectively). The Wilcoxon signed-rank test P-value is reported.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 49
AR
TIC
LE
to glucocorticoids was significantly correlated with glucocorti-coid receptor expression. This response is dependent on the level of tumor cell differentiation, with poorly differentiated, higher grade tumors responding less effectively (17).
The response of MCT to corticosteroids has been shown to be both dose dependent (17) and time dependent (21). However, Stancliff et al (15) showed that doses between 1 mg/kg BW and 2.2 mg/kg BW appear to achieve significant reductions in tumor volume, with no significant difference in response between 1 and 2.2 mg/kg BW per day dosing. For this study, a dose of 1 mg/kg BW per day was chosen because it has been demonstrated to reduce mast cell tumor volume without produc-ing as many undesirable side effects which are often present at higher doses. The treatment duration of 7 to 14 d was chosen because the investigators felt it would give adequate time for tumor response without delaying standard of care treatment for client-owned animals. Previous reports have shown a 70% response with a median treatment duration of 9 d (15). Teng et al (21) showed that median time to maximum tumor regres-sion was 14 d, with 81.5% of patients reaching maximum regression by 21 d. The method of incisional biopsy using a biopsy punch was chosen as it has been demonstrated to be an accurate method of sampling MCT (100% Patnaik, 95% Kiupel) compared with excisional biopsy (23). However, there were 2 incisional biopsies in our study that did not yield MCT. This may have occurred due to localized inflammation or error in biopsy technique.
Measurement outcomes in this study included tumor grade when appropriate and mitotic count because these are the com-monly reported prognostic factors for MCT biopsy in clinical practice (24). Tumor grade and mitotic count are important independent prognostic factors (4,5), and in this study neo-adjuvant treatment with prednisone did not affect tumor grade, or mitotic count. This finding may reflect a lack of sensitivity of the histopathological analysis performed on MCT biopsy samples, or it is possible that other histological features could be affected by neoadjuvant prednisone therapy. Veterinary studies have shown that neoadjuvant prednisone has the ability to alter the expression of certain mast cell growth factors, including c-Kit (21). Aberrant c-Kit expression has been associated with poorer clinical outcome, and previous studies have shown that 15% to 40% of all canine MCTs are affected by c-Kit mutations leading to aberrant expression (25). The combination of Ki67 and proliferating cell nuclear antigen scores has been shown to be prognostic for local recurrence, and dogs with such recurrence had significantly decreased survival times (9). Furthermore, prednisolone affects Kit pattern staining and Kit pattern stain-ing correlates with response to prednisolone (21). It was beyond the scope of the current study to evaluate immunohistochemical features, such as Ki-67, and c-Kit (6,8,13,26,27); however, it may be important to consider the effects of prednisone on these prognostic markers with future studies. In our study, there was no difference between the treatment and placebo groups with respect to incomplete margins. This suggests that using reduced tumor size to determine excisional margins after prednisone treatment does not statistically increase the risk of incomplete excision.
There are several limitations in this study. The largest poten-tial confounding factor of this study was that both cutaneous and subcutaneous MCT were included. The traditional Patnaik and Kiupel grading schemes were not developed for subcutane-ous tumors; however, in the absence of an alternative grading system many pathologists still grade subcutaneous tumors based on the traditional systems, and many oncologists still extrapolate these grading schemes to include subcutaneous MCT when making treatment decisions in clinical practice. Although the application of traditional grading schemes has not been clearly shown to be of prognostic utility, there is an impression that mitotic count, when applied to subcutaneous MCT, does pro-vide prognostic information similar to cutaneous MCT (7). We chose to include subcutaneous MCT in this study because they are common, and differentiating subcutaneous MCT from cutaneous MCT based strictly on gross features can be difficult.
The second limitation is the lack of high-grade tumors in this study. Most tumors (93%) were Grade II (Patnaik) or low grade (Kiupel), and higher-grade tumors may respond differently to prednisone (28). As high-grade tumors are statistically less common (3% to 21%) (24), we felt this distribution reflected a common distribution from the population. Based on our data we cannot conclude with certainty that prednisone would not alter histological features in high-grade MCT.
We attempted to minimize the confounding effect of tumor grading subjectivity (29) by having a single pathologist perform all the histopathology. As previously described, the use of c-Kit, AgNOR, and Ki-67 may improve our ability to predict biologi-cal behavior and may be the focus of a future study.
The use of other pharmaceuticals (famotidine, diphenhydr-amine, opioids) in conjunction with the prednisone potentially could have impacted tumor grade, although there are no pub-lished data to support this possibility. Since both treatment groups received identical adjunctive treatments, any changes in tumor grade should have been equivalent between the 2 groups. A final limitation of this study was the small sample size, which could lead to a type II error with regard to the effect of prednisone treatment. Twenty-eight patients were included in the study, with 2 of the incisional biopsies returned as non-diagnostic. The criteria for power calculation used for this study were based on a paired t-test and alpha = 0.05 (P , 0.05), beta = 0.20 (Power = 80%), a difference to detect = 25%, and a standard deviation of the differences = 1.5, yielding an estimate of 15 dogs per group.
This study tested the hypothesis in a randomized, double-blinded fashion, whether neoadjuvant prednisone therapy statistically affects tumor grade, atypia, or mitotic count. We accept the null hypothesis, that treatment with prednisone for 7 to 14 d before excisional biopsy does not have a statistically significant effect on MCT grade, atypia, or mitotic count in low to intermediate grade MCT. Furthermore, we recognize that neoadjuvant prednisone administration can result in a signifi-cant decrease in tumor volume without a significant increase in postoperative incisional complications or incomplete margins. In conclusion, the use of neoadjuvant prednisone to decrease MCT volume in order to facilitate tumor excision can be considered without significant concern for change of tumor histologic
FOR PERSONAL USE ONLY
50 CVJ / VOL 62 / JANUARY 2021
AR
TIC
LE
features, and thus prognostication in low to intermediate grade MCT. Ideally, future studies will include additional prognostic markers (c-Kit, Ki67, AgNOR, and PCNA), and longer-term follow-up for tumor recurrence and high-grade MCT.
AcknowledgmentsWe thank Audrey Baldessari for her contributions to histo-pathology, Joe Hauptman for assistance with statistical anal-ysis, Kent Vince and Jessica Leeman for contributions to the incisional and excisional biopsies, and Seattle Veterinary Specialists-Blue Pearl for providing funding for the study. CVJ
References 1. Withrow SJ, Vail DM, Page R. Withrow and MacEwen’s Small Animal
Clinical Oncology. St. Louis, Missouri: Saunders, 2012. 2. Krick EL, Billings AP, Shofer FS, Watanabe S, Sorenmo KU. Cytological
lymph node evaluation in dogs with mast cell tumours: Association with grade and survival. Vet Comp Oncol 2009;7:130–138.
3. Thamm DH, Turek MM, Vail DM. Outcomes and prognostic factors following adjuvant prednisone/vinblastine chemotherapy for high-risk canine mast cell tumour: 61 cases. J Vet Med Sci 2006;68:581–587.
4. Elston L, Sueiro FA, Cavalcanti J, Metze K. The importance of the mitotic index as a prognostic factor for canine cutaneous mast cell tumors: A validation study. Vet Pathol 2009;46:362–364.
5. Romansik EM, Reilly CM, Kass PH, Moore PF, London CA. Mitotic index is predictive for survival for canine cutaneous mast cell tumors. Vet Pathol 2007;44:335–341.
6. Scase TJ, Edwards D, Miller J, et al. Canine mast cell tumors: Correlation of apoptosis and proliferation markers with prognosis. J Vet Intern Med 2006;20:151–158.
7. Thompson JJ, Pearl DL, Yager JA, Best SJ, Coomber BL, Foster RA. Canine subcutaneous mast cell tumors: Characterization and prognostic indices. Vet Pathol 2011;48:156–168.
8. Thompson JJ, Yager JA, Best SJ, Coomber BL, Foster RA. Canine sub-cutaneous mast cell tumors: Cellular proliferation and KIT expression as prognostic indices. Vet Pathol 2011;48:169–181.
9. Seguin B, Besancon MF, McCallan JL, et al. Recurrence rate, clinical outcome, and cellular proliferation indices as prognostic indicators after incomplete surgical excision of cutaneous grade II mast cell tumors: 28 dogs (1994–2002). J Vet Intern Med 2006;20:933–940.
10. Giantin M, Granato A, Baratto C, et al. Global gene expression analysis of canine cutaneous mast cell tumor: Could molecular profil-ing be useful for subtype classification and prognostication? PLoS One 2014;9:e95481.
11. Donnelly L, Mullin C, Balko J, et al. Evaluation of histological grade and histologically tumour-free margins as predictors of local recurrence in completely excised canine mast cell tumours. Vet Comp Oncol 2015; 13:70–76.
12. Weisse C, Shofer FS, Sorenmo K. Recurrence rates and sites for grade II canine cutaneous mast cell tumors following complete surgical excision. J Am Anim Hosp Assoc 2002;38:71–73.
13. Abadie JJ, Amardeilh MA, Delverdier ME. Immunohistochemical detec-tion of proliferating cell nuclear antigen and Ki-67 in mast cell tumors from dogs. J Am Vet Med Assoc 1999;215:1629–1634.
14. Brocks B, Neyens IJ, Teske E, Kirpensteijn J. Hypotonic water as adjuvant therapy for incompletely resected canine mast cell tumors: A randomized, double-blind, placebo-controlled study. Vet Surg 2008; 37:472–478.
15. Stanclift RM, Gilson SD. Evaluation of neoadjuvant prednisone administration and surgical excision in treatment of cutaneous mast cell tumors in dogs. J Am Vet Med Assoc 2008;232:53–62.
16. Matsuda A, Tanaka A, Amagai Y, et al. Glucocorticoid sensitivity depends on expression levels of glucocorticoid receptors in canine neoplastic mast cells. Vet Immunol Immunopathol 2011;144:321–328.
17. Takahashi T, Kadosawa T, Nagase M, et al. Inhibitory effects of glu-cocorticoids on proliferation of canine mast cell tumor. J Vet Med Sci 1997;59:995–1001.
18. Pratschke KM, Atherton MJ, Sillito JA, Lamm CG. Evaluation of a modified proportional margins approach for surgical resection of mast cell tumors in dogs: 40 cases (2008–2012). J Am Vet Med Assoc 2013;243:1436–1441.
19. Patnaik AK, Ehler WJ, MacEwen EG. Canine cutaneous mast cell tumor: Morphologic grading and survival time in 83 dogs. Vet Pathol 1984;21:469–474.
20. Kiupel M, Webster JD, Bailey KL, et al. Proposal for a 2-tier histologic grading system for canine cutaneous mast cell tumors to more accurately predict biological behavior. Vet Pathol 2011;48:147–155.
21. Teng SP, Hsu WL, Chiu CY, Wong ML, Chang SC. Overexpression of P-glycoprotein, STAT3, phosphor-STAT3 and KIT in spontaneous canine cutaneous mast cell tumours before and after prednisolone treat-ment. Vet J 2012;193:551–556.
22. McCaw DL, Miller MA, Ogilive GK, et al. Response of canine mast cell tumors to treatment with oral prednisone. J Vet Intern Med 1994;8:406–408.
23. Shaw T, Kudnig ST, Firestone SM. Diagnostic accuracy of pre-treatment biopsy for grading cutaneous mast cell tumours in dogs. Vet Comp Oncol 2018;16:214–219.
24. Sledge D, Webster J, Kiupel M. Canine cutaneous mast cell tumors: A combined clinical and pathologic approach to diagnosis, prognosis, and treatment selection. Vet J 2016;215:43–54.
25. Welle MM, Bley CR, Howard J, Rüfenacht S. Canine mast cell tumours: A review of the pathogenesis, clinical features, pathology and treatment. Vet Dermatol 2008;19:321–339.
26. Simoes JP, Schoning P, Butine M. Prognosis of canine mast cell tumors: A comparison of three methods. Vet Pathol 1994;31:637–647.
27. Bostock DE, Crocker J, Harris K, Smith P. Nucleolar organizer regions as indicators of post-surgical prognosis in canine spontaneous mast cell tumors. Br J Cancer 1989;59:915–918.
28. dos Santos Horta R, Eunice Lavalle G, Narducci Monteiro L, et al. Evaluation of histological, immunohistochemical, clinical and genetic prognostic factors associated with the response of canine mast cell tumours to glucocorticotherapy. J Comp Pathol 2018;165:72–81.
29. Northup NC, Harmon BG, Gieger TL, et al. Variation among patholo-gists in histologic grading of canine cutaneous mast cell tumors. J Vet Diagn Invest 2005;17:245–248.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 51
Article
Validation of a point-of-care polymerase chain reaction assay for detection of Streptococcus equi subspecies equi in rostral nasal swabs from horses with suspected strangles
Andrew T. Willis, Samantha Barnum, Nicola Pusterla
Abstract — This study aimed to validate a point-of-care polymerase chain reaction (PCR) assay for detection of Streptococcus equi subsp. equi (S. equi) in rostral nasal swabs from horses with suspected acute strangles and to compare the results against the molecular gold standard of quantitative polymerase chain reaction (qPCR). Two hundred thirty-two individual swabs of rostral nasal passages were characterized by qPCR as S. equi positive, S. equi subsp. zooepidemicus (S. zooepidemicus) positive, or S. equi and S. zooepidemicus negative. The specificity and sensitivity of the point-of-care PCR assay were 89% and 84%, respectively. The limits of detection of the qPCR assay and the point-of-care PCR analyzer were 3 and 277 eqbE target genes of S. equi, respectively. Overall agreement and short turnaround time make the point-of-care PCR assay a potential molecular diagnostic platform that will enhance the capability of equine veterinarians to timely support a diagnosis of strangles and institute proper biosecurity protocols.
Résumé — Validation d’une épreuve d’amplification en chaîne par la polymérase au point de service pour la détection de Streptococcus equi sous-espèce equi dans des écouvillons nasaux rostraux de chevaux suspectés d’avoir la gourme. La présente étude visait à valider une épreuve d’amplification en chaîne par la polymérase (PCR) au point de service pour la détection de Streptococcus equi ssp. equi (S. equi) à partir d’écouvillons nasaux rostraux de chevaux suspectés être atteints de gourme aiguë et de comparer les résultats à ceux de l’épreuve étalon de la réaction d’amplification en chaîne par la polymérase quantitative (qPCR). Deux cent trente-deux écouvillons individuels des voies nasales rostrales furent caractérisés par qPCR comme étant S. equi positif, S. equi ssp. zooepidemicus (S. zooepidemicus) positif ou S. equi et S. zooepidemicus négatifs. La spécificité et la sensibilité de l’épreuve PCR au point de service étaient de 89 % et 84 %, respectivement. Les limites de détection de l’épreuve par qPCR et de l’analyseur PCR au point de service étaient de 3 et 277 copies du gène cible eqbE de S. equi, respectivement. L’accord général et le court temps de réponse font du PCR au point de service une plate-forme de diagnostic moléculaire potentielle qui augmentera les capacités des vétérinaires équins à appuyer adéquatement un diagnostic de gourme et d’instituer les protocoles de biosécurité appropriés.
(Traduit par Dr Serge Messier)
Can Vet J 2021;62:51–54
Introduction
S trangles is a bacterial infection of the upper respiratory tract of equids, caused by Streptococcus equi subsp. equi
(S. equi) (1). Clinical disease involves bacterial colonization of the patient’s tonsils and pharynx resulting in upper respiratory catarrh and abscessation of the mandibular and retropharyn-
geal lymph nodes. The incubation period of strangles is up to 2 wk and signs will be evident within 1 to 2 d of the onset of fever. It is essential to isolate any horse with signs of strangles to prevent population outbreaks. Current diagnostic testing requires confirmation of the presence of S. equi detected by conventional bacterial culture and/or polymerase chain reaction
William R. Pritchard Veterinary Medical Teaching Hospital, School of Veterinary Medicine, University of California, 1 Garrod Drive, Davis, California, USA (Willis); Department of Medicine and Epidemiology, School of Veterinary Medicine, University of California, One Shields Avenue, Davis, California, USA (Barnum, Pusterla).Address all correspondence to Dr. Nicola Pusterla; e-mail: [email protected] of the authors of this paper has a financial or personal relationship with other people or organizations that could inappropriately influence or bias the content of the paper.Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
FOR PERSONAL USE ONLY
52 CVJ / VOL 62 / JANUARY 2021
AR
TIC
LE
(PCR) (2). The latter analytical platform is considered to be the gold standard for detection of the streptococcal organism (2,3). The current workflow for PCR detection requires access to a laboratory for testing, often with turnaround times between 24 and 72 h from sample collection. Although same-day reporting of a molecular result is possible with current diagnostic advance-ments, timely diagnosis of strangles, isolation of index cases, and institution of proper biosecurity protocols are critical to prevent rapid spread of disease in at-risk populations. Recent advances in diagnostic technology have allowed for patient-side PCR tests, such as influenza virus and respiratory syncytial virus testing in humans, to be developed with turnaround times within 1 h of sample collection (4).
Advantages of a point-of-care PCR platform for the equine practitioner would be to initiate timely treatment and biosecu-rity protocols, to offer immediate and weekend testing when central laboratories are closed, to test for S. equi at multiple time points during clinical disease, to initiate timely outbreak testing protocols in at-risk populations, and to screen high-risk horses entering S. equi-free herds or facilities. The objective of this study was to validate a point-of-care PCR assay for the detection of S. equi in rostral nasal swabs from horses with strangles and to compare the results against the molecular gold standard of quantitative PCR (qPCR). The authors hypothesized that the point-of-care PCR assay would generate comparable results in terms of sensitivity, specificity, and overall agreement compared with the gold standard of qPCR for the detection of S. equi in rostral nasal swabs from horses with suspected acute strangles.
Materials and methodsStudy samplesA total of 232 individual swabs collected from the rostral nasal passages from horses were tested for S. equi in parallel with the gold standard qPCR system (7900 HTA; Applied Biosystems, Foster City, California, USA) and the point-of-care PCR ana-lyzer (Fluxergy, Irvine, California, USA). Testing was performed in the investigators’ laboratory and not patient-side. Rostral nasal secretions were collected from horses with acute respira-tory signs compatible with strangles using rayon-tipped swabs. The swabs were immersed in 1 mL of phosphate-buffered saline solution (PBS).
Sample testingThe gold standard methodology included nucleic acid purifica-tion followed by qPCR analysis, while the POC PCR methodol-ogy combined sample preparation (including DNA extraction) and amplification into a microfluidic test card. Nucleic acid was extracted from 200 mL of the clinical samples in PBS using an automated nucleic acid extraction protocol (QIAcube HT; Qiagen, Valencia, California, USA) and analyzed for the pres-ence of S. equi and S. zooepidemicus using gold standard qPCR. In brief, purified nucleic acids were assayed for the presence of selected streptococcal-specific genes (eqbE gene of S. equi and ITS gene of S. zooepidemicus) according to previously published protocols (5). The samples were amplified in a combined ther-mocycler/fluorometer (7900 HTA; Applied Biosystems) with the standard thermal cycling protocol: 2 min at 50°C, 10 min at 95°C, and 40 cycles of 15 s at 95°C and 60 s at 60°C. The qPCR reactions were composed of a commercially available mastermix (Universal TaqMan Mastermix with AmpErase UNG; Applied Biosystems), containing 10 mM Tris (pH 8.3), 50 mM KCl, 5 mM MgCl2, 300 mM each of dATP, dCTP and dGTP, 600 mM dUTP, 0.625 U of AmpliTaq Gold per reaction, 0.25 U AmpErase UNG per reaction, 400 nM of each primer (eqbE forward primer: CTATTGTTGTCGCTATGGGTGG, eqbE reverse primer: GAATGGAAATCCAATCTTTCGG; ITS forward primer: GAGAGCGCCTGCTTTGCA, ITS reverse primer: GGTAAACCGAACCGTCTGTTAGTATC) and 80 nM of the respective TaqMan probe (eqbE probe: FAM-CAGAAGCATCTATTTGGTC-MGB; ITS probe: TAMRA-CAGGAGGTCAGCGGTTCGATCCC) and 1 mL of DNA sample for a total volume of 12 mL. An aliquot of the samples in PBS was available for testing using the point-of-care PCR analyzer (Fluxergy). For each test, 36 mL of nasal secre-tions in PBS were mixed with 84 mL of rehydration buffer and pipetted into a microfluidic test card targeting the eqbE gene of S. equi (forward primer: ATGTAGCTATGGCAAATGTGGC, reverse primer: AACACCCTTAGGAACACCTG). The test card was inserted into the device and the S. equi PCR test was initi-ated. Fluxergy’s proprietary microfluidic system handles sample preparation (including DNA extraction) by employing a sample type specific buffer system. Specifically, the inhibition-resistant buffer along with a mixture of surfactants and dispersants allows
Table 1. Characterization of 232 rostral nasal swabs based on qPCR results used for the validation of a point-of-care PCR testing platform specific for S. equi subspecies equi.
S. equi qPCR Copies Sample cycle threshold of eqbE Number of group value gene/mL Minimum Maximum Median Interpretation samples
1 None — — — — Negative S. equi and S. zooepidemicus 42
2 None — — — — Negative S. equi and positive S. zooepidemicus 40
3 , 32 . 828 897 32 083 8087 Strong positive (abundant amount of 42 S. equi DNA present)
4 32 to 35 92 to 828 128 828 346 Moderate positive (moderate amount 49 of S. equi DNA present)
5 . 35 , 92 5 91 15 Weak positive (small amount of S. equi 59 DNA present)
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 53
AR
TIC
LE
for rapid sample dispersion and lysis of raw sample matrix. The cycling conditions of the point-of-care PCR device were 94°C for 5 min followed by 45 cycles of 10 s at 94°C and 25 s at 56°C. The total time for each test was 50 min.
Each clinical sample was assigned to one of 5 groups based on the gold standard qPCR results (Table 1). Streptococcus equi qPCR-positive samples were further divided into 3 arbitrarily chosen groups based on absolute quantitation of the target gene and cycle threshold value. Absolute quantitation of the target gene (eqbE) of S. equi was performed using a standard curve as previously reported (5). The cycle threshold is defined as the number of heat cycles required for the fluorescent signal to cross a threshold that confirms presence of the specific target gene. The upper cycle threshold cut-off value for both readers was set at a cycle threshold value of 40. The outcome for the point-of-care PCR testing platform was either negative (absence of the target gene and presence of the housekeeping gene eGAPDH), positive (presence of the target gene and housekeeping gene eGAPDH) or indeterminate. The latter result was reported when the point-of-care PCR analyzer was unable to detect the housekeeping gene eGAPDH. Unfortunately, indeterminate results could not be repeated due to the inability to resample and retest the clinically affected horses.
Limit of detection (LOD) of the qPCR device and the point-of-care PCR assay was tested using 10-fold dilutions of a plasmid containing the eqbE target sequence. Analytical sensi-tivity for the 2 PCR platforms was assessed in order to explain potential discrepant test results. While both PCR platforms used the same specimens (swabs in PBS), the sample input to generate the respective results was different. The PCR POC platform used 36 mL of specimen while the qPCR used 1 mL of purified DNA from 200 mL of specimen. Differences in volume and dilution were considered when determining the LOD for each of the 2 platforms.
Once the validation had been completed, the results for both testing platforms were available to determine sensitivity, specific-ity, and overall agreement.
Data analysisDescriptive statistics were used to determine sensitivity, speci-ficity, and overall agreement for both testing platforms. For analytical purposes, all indeterminate results were classified as negative results.
ResultsThe overall agreement between the 2 PCR platforms was 85.8% (Table 2). For strongly positive and moderately positive bacterial loads (cycle threshold values , 32 and cycle threshold values 32 to 35, respectively), the point-of-care PCR assay showed 100% agreement with the qPCR analyzer and for weak bacterial loads (cycle threshold values , 35), the point-of-care PCR assay showed 71% agreement with the qPCR device. The rate of indeterminate samples was 17/232 (7.4%). Among the inde-terminate results 9/17 were negative by the qPCR device and 8/17 were positive by the qPCR device. Indeterminate samples were not retested due to the unavailability of horses for further sampling. When indeterminate samples were included in the calculations, the specificity and sensitivity of the point-of-care PCR assay was 89% and 84%, respectively. The limits of detec-tion of the qPCR assay and the point-of-care PCR analyzer were 3 and 277 eqbE target genes of S. equi, respectively.
DiscussionThe point-of-care PCR assay showed strong agreement with the qPCR assay and detected S. equi in most study samples in less than 1 h. The strong agreement and short turnaround time make the point-of-care PCR device a potential molecular diag-nostic platform allowing detection of S. equi. The availability of an accurate point-of-care device for the detection of S. equi will enhance the diagnostic capability of equine veterinarians to timely support a diagnosis of strangles and institute proper bios-ecurity protocols. Furthermore, the point-of-care PCR device was able to differentiate between S. zooepidemicus and S. equi, which is relevant for the equine practitioner, as false positive results can have undesirable consequences. False negative results are equally concerning, especially when they directly impact biosecurity decisions. Seventeen samples yielded indeterminate results, meaning that the nasal secretions did not pass quality control for reasons such as not enough nucleic acids present in the biological sample or presence of organic inhibitors. Unfortunately, horses with indeterminate results were unavail-able for resampling and retesting. Considering that almost half of the indeterminate results tested PCR-positive for S. equi using the gold standard qPCR system, such horses should always be treated as a potential risk and isolated whilst awaiting the results of a follow-up test.
This study also confirmed that rostral nasal swabs from acute cases were a suitable sample for the point-of-care PCR assay. Validation of other biological samples, such as lymph node aspirates, nasopharyngeal washes, nasopharyngeal swabs, and guttural pouch washes using the point-of-care PCR assay is needed since deeper respiratory tract samples have been shown to be more sensitive in the detection of S. equi compared to rostral nasal secretions (2). While the point-of-care PCR assay offers much convenience for testing, the limit of detection must be considered when testing clinical samples. The point-of-care PCR assay has a 100-fold lower limit of detection compared to the qPCR platform. The point-of-care PCR instrument uses 36 times the volume of material compared to the qPCR (36 mL versus 1 mL). The difference in volume was taken into account
Table 2. Overall agreement for 232 rostral nasal swabs between the gold standard of qPCR and the point-of-care PCR testing platform for the detection of S. equi subspecies equi.
Point-of-care qPCR platform
PCR platform Positive S. equi Negative S. equi Total
Positive S. equi 126 0 126Negative S. equi 16 73 89Indeterminatea 8 9 17Total 150 82 232a The point-of-care PCR assay reports indeterminate results when the housekeeping
gene (eGAPDH) is not detected in a biological sample and reflects a sample that does not pass quality control.
when the limit of detection was calculated, meaning that for the point-of-care PCR instrument, the limit of detection is 277 eqbE target genes in 36 mL of template, while for the qPCR it is 3 eqbE target genes in 1 mL of purified nucleic acid. The reduced limit of detection of the point-of-care PCR assay likely relates to a faster nucleic acid extraction protocol and a shorter nucleic acid purification step. The 16 samples that gave a false negative S. equi result by the point-of-care PCR assay were all below its analytical sensitivity. Unfortunately, the horses from which samples were submitted were unavailable for retesting. It is the authors’ recommendations that if a horse is presented with clinical signs consistent with strangles, the first step is to isolate the index case and to institute proper biosecurity protocols in order to reduce potential pathogen spread. Furthermore, if rostral nasal swabs test negative by the point-of-care PCR assay, the patient should either be retested 12 to 24 h later when a greater number of S. equi are present in nasal secretions, a deeper biological sample (e.g., nasopharyngeal swab or guttural pouch wash) should be collected for diagnostic testing or the sample should be shipped to a diagnostic laboratory and tested using the gold standard qPCR.
When considering the use of a novel point-of-care assay, the end-user must consider advantages and limitations of the technology. The performance of the point-of-care PCR was evaluated in a controlled laboratory setting, which potentially could facilitate workflow and reduce the risk of environmental contamination. The point-of-care PCR is easy to perform and suitable as a patient-side assay with low risk of contamination considering minimal sample handling following collection and closed-tube microfluidic card for analysis. While the format of the point-of-care PCR and the quick turnaround time are appealing factors, one also needs to consider that, at the pres-ent time, the point-of-care PCR can only analyze 1 sample at the time, is limited to the testing of a single pathogen, and is less sensitive than laboratory-based qPCR technologies. Furthermore, based on the limit of detection of the point-of-care PCR, testing should be restricted to horses with clinical
signs compatible with acute strangles and future studies are required to determine the efficacy of this technology to detect subclinical infections using more sensitive samples such as gut-tural pouch washes. While the S. equi point-of-care PCR assay is not cheaper ($50 US for test card and reagents) than a similar assay offered by a commercial diagnostic laboratory, the lack of shipping costs should make this assay cost-effective to the client. Sample preparation buffers, PCR reagents, and the test card consumables must be purchased individually. Veterinarians can gain access to the laboratory platform through the company’s pilot program and can build and validate their own PCR tests for use in their practice. The company’s device, reagents, and consumables are not currently USDA approved.
In conclusion, the point-of-care PCR assay yielded accept-able results in terms of sensitivity, specificity, and overall agree-ment when compared to a qPCR platform for the detection of S. equi in rostral nasal swabs of horses with signs compatible with strangles.
AcknowledgmentThe authors thank Fluxergy for providing access to PCR read-ers and providing the test cards to run the point-of-care PCR. CVJ
infections in horses: Guidelines for treatment, control, and prevention of strangles. J Vet Intern Med 2005;19:123–134.
2. Boyle AG, Timoney JF, Newton JR, Hines MT, Waller AS, Buchanan BR. Streptococcus equi infections in horses: Guidelines for treatment, control, and prevention of strangles — Revised consensus statement. J Vet Intern Med 2018;32:633–647.
3. Waller A. New perspectives for the diagnosis, control, treatment, and prevention of strangles. Vet Clin N Am Equine Pract 2014;30:591–607.
4. Basile K, Kok J, Dwyer DE. Point-of-care diagnostics for respiratory viral infections. Expert Rev Mol Diagn 2018;18:75–83.
5. Pusterla N, Leutenegger CM, Barnum SM, Byrne BA. Use of quantitative real-time PCR to determine viability of Streptococcus equi subspecies equi in respiratory secretions from horses with strangles. Equine Vet J 2018; 50:697–700.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 55
Brief Communication Communication brève
A comparison of 4 iron supplementation protocols to protect suckling piglets from anemia
Robert Friendship, Victoria Seip, Rocio Amezcua
Abstract — Pigs are routinely supplemented with iron during the suckling period to prevent anemia, but recent studies have shown that despite iron treatment many fast-growing pigs are iron deficient at weaning. The objective of this study was to determine if oral iron supplementation provided free-choice from a week of age until weaning could prevent iron deficiency. Results showed that the industry standard treatment of a single iron injection at 4 days of age did not always prevent iron deficiency at weaning, indicating the need to provide additional iron to fast-growing suckling pigs either orally or by a second injection. It appears that providing piglets daily access to iron-enriched peat moss or injecting a second 200-mg dose of iron intramuscularly are both effective in meeting the piglets iron requirements during the suckling period.
Résumé — Comparaison de quatre protocoles de supplémentation en fer afin de protéger les porcelets non-sevrés d’anémie. Les porcs sont supplémentés de routine avec du fer durant la période d’allaitement afin de prévenir l’anémie, mais des études récentes ont démontré que malgré le traitement avec du fer plusieurs porcs à croissance rapide sont déficients en fer au moment du sevrage. L’objectif de la présente étude était de déterminer si une supplémentation orale en fer fournie au choix à partir d’une semaine d’âge jusqu’au moment du sevrage pourrait prévenir une déficience en fer. Les résultats ont démontré que le traitement standard de l’industrie d’une seule injection de fer à 4 jours d’âge ne prévenait pas toujours une déficience en fer au moment du sevrage, indiquant ainsi la nécessité de fournir du fer supplémentaire aux porcs non-sevrés à croissance rapide soit oralement ou par une seconde injection. Il semblerait que fournir aux porcelets un accès quotidien à de la mousse de tourbe enrichie de fer ou injecter par voie intramusculaire une deuxième dose de 200 mg de fer sont tous deux efficaces pour subvenir aux besoins en fer des porcelets durant la période d’allaitement.
(Traduit par Dr Serge Messier)Can Vet J 2021;62:55–58
T here is strong evidence that the standard practice of inject-ing piglets intramuscularly with 100 or 200 mg of iron at
3 or 4 d of age doesn’t meet the needs of large, fast-growing piglets under modern farming conditions (1–3). Various stud-ies have found the prevalence of pigs with iron deficiency (Hb , 110 g/L) at weaning to be about 25%, with the biggest piglets being most likely to be affected (1–3). Iron deficiency may result in anemia and lead to poor growth performance dur-ing the early nursery stage (4,5). This can be resolved by using a second iron injection near the end of the suckling period (6) but
this requires additional handling of pigs and there is reluctance at the farm level to adopt this solution.
Another reason to examine the current approach to control-ling iron deficiency in suckling pigs is the growing interest among consumers for pork that is produced from pigs raised in a more natural way. There is renewed interest, therefore, in oral supplementation of iron as opposed to the standard intramuscu-lar injection. In addition, recent advances in our understanding of iron absorption and the impact of large parenteral doses of iron on induction of hepcidin expression and the regulation of iron in the body provides a further reason to investigate alterna-tive strategies for iron supplementation (7).
Several commercial oral iron products are available, includ-ing powders and pastes, which require restraining the piglet and manually placing the product in the pig’s mouth, as well as products that can be scattered in the creep feeder area for free-choice consumption (8,9). One example of this latter approach involves mixing powdered iron with peat moss and providing this iron-rich product in the creep area. Pigs root in the peat moss in a manner similar to what they would do if raised out-doors where they have access to soil.
Department of Population Medicine, University of Guelph, Guelph, Ontario N1G 2W1 (Friendship, Amezcua); Grand Valley Fortifiers, Cambridge, Ontario N1R 5W6 (Seip).Address all correspondence to Dr. Robert Friendship; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
FOR PERSONAL USE ONLY
56 CVJ / VOL 62 / JANUARY 2021
CO
MM
UN
ICA
TIO
N B
RÈ
VE
The primary objective of this study was to compare different iron supplementation strategies to determine if, at weaning, there is a difference in hematological parameters indicative of iron status among the different approaches. Specifically, a goal of the study was to determine whether oral iron supplementa-tion could replace injectable iron protocols without risking an increased prevalence of anemia.
The study was approved by the Animal Care Committee at the University of Guelph and was conducted at the Arkell Swine Research Station, University of Guelph.
A total of 12 litters were included in the trial with all pigs individually identified with an ear tag. Treatment was allocated at the litter level and litters were chosen randomly before treatment was assigned. Pigs in 3 litters were assigned to Group 1 or 2 and pigs in the remaining 9 litters were assigned to Group 3 or 4 and pigs were assigned treatment using systematic random sampling. Group 1 pigs were injected with 200 mg (1 mL) of gleptoferron (Gleptosil; Ceva Animal Health, Cambridge, Ontario) at 4 d of age. Group 2 pigs were injected with 200 mg of gleptoferron at 4 d of age and again with 200 mg of gleptoferron at 14 d of age. Group 3 pigs were injected with 200 mg of gleptoferron at 4 d of age and from wk 1 of age until weaning they were provided with free-choice access to peat moss (Sweet Peat; Grand Valley Fortifiers, Cambridge, Ontario) containing chelated iron [8500 mg/kg body weight (BW) of added iron]. Group 4 pigs were given 1 dose (2 mL/pig) of an oral paste containing 40 mg of ferrous fumarate (MS Ferro Paste; MS Schippers Canada, Lacombe, Alberta) at 4 d of age and from 1 wk of age until weaning were provided with iron-fortified free-choice peat moss.
The trial was conducted in 1 farrowing room containing 12 farrowing crates. Cross fostering was carried out before pigs were assigned to treatments. Two pigs in Group 1 and 1 pig in Group 4 were fostered pigs. The average number of pigs per litter for Groups 1 and 2 was 11.3. The average number of pigs per litter for Groups 3 and 4 was 12.6. Creep feed was not provided for any of the litters. The amount of peat moss given daily per litter was recorded based on the number of 250-g cups that were used.
Pigs were weighed at Day 4 and at weaning to determine average daily gain (ADG). At weaning, blood samples (3 mL)
were collected via the infra-orbital sinus into tubes contain-ing ethylenediamine tetra-acetic acid (EDTA) and submit-ted to the Animal Health Laboratory (AHL), University of Guelph, for complete blood (cell) count (CBC) using the ADVIA 2120/2120i hematology system (Siemens Healthcare Diagnostics, Deerfield, Illinois, USA). The blood analysis included determination of red blood cell (RBC) count, hemo-globin (Hb), hematocrit (Hct), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean cell hemoglobin concentration (MCHC), and red blood cell distri-bution width proportion (RDW).
Data were entered into Microsoft Excel for PC 2007 (Microsoft, Redmond, Washington, USA), imported into Stata (Stata/SE 14.2 for Mac; StataCorp, College Station, Texas, USA), and validated. Descriptive statistics such as means, medi-ans, standard deviations (SD), and proportions were calculated for each treatment group. Continuous variables were assessed for normality using the Shapiro-Wilk test and normality diagnostic plots. Univariable analysis was conducted on each outcome of interest (hematological parameters and growth performance) for each treatment group. One-way analysis of variance (ANOVA) was used when outcome was normally distributed and the Kruskall-Wallis test when outcome was not normally distributed. Multiple comparison tests were used to determine the significant differences among treatment groups or weight of pigs. Medians (6 SD) were reported when outcome was not normally distrib-uted. A mixed-effects multi-level linear regression method with litter (clustering) as random effects was used to determine the association of Hb with treatment.
A Chi-square test was used to determine the association of Hb status based on the 3 categories: anemic (Hb , 90 g/L), iron deficient (Hb 90 to 110 g/L), and normal (Hb . 110 g/L) with treatment and with the weaning weight categories of the pigs. Pigs were categorized as small (, 5.5 kg) (26 pigs), medium (5.5 to 7.5 kg) (67 pigs), and large (. 7.5 kg) (53 pigs) based on weaning weights. The piglet iron status was categorized based on cut-off values described by Bhattarai and Nielsen (1). The weight of peat moss consumed per litter during the nursing period was calculated.
A total of 148 pigs were included in this trial with 18, 16, 58, and 56 pigs in Groups 1, 2, 3, and 4, respectively. The
Table 1. The mean (6 standard deviation) values of hematological parameters of pigs at weaning among 4 iron supplementation treatment groups.
Group 1 Group 2 Group 3 Group 4 Treatments* (n = 18) (n = 16) (n = 56) (n = 58) P-value
* TreatmentsGroup 1 — Injected with 200 mg of gleptoferron at 4 d of age.Group 2 — Injected with 200 mg of gleptoferron at 4 and 14 d of age.Group 3 — Injected with 200 mg of gleptoferron at 4 d of age and provided with iron-enriched peat moss, free-choice from 1 wk of age until weaning.Group 4 — Given 2 mL of an oral paste containing 40 mg of ferrous fumarate at 4 d of age and provided with iron-enriched peat moss, free-choice from 1 wk of age until weaning.a,b Values with different superscripted letters in the same row are significantly different.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 57
BR
IEF
CO
MM
UN
ICA
TIO
N
average weight at Day 4 was 2.2 kg 6 0.4 kg. The average weaning weight was 6.9 kg 6 1.6 kg. One pig from Group 3 died. Age of pigs at weaning ranged from 16 to 21 d. Day 4 and weaning weights were normally distributed. There were no significant differences in any of the growth parameters among treatment groups. Hematological parameters and ADG were not normally distributed. For the mixed model, 2 extremely low Hb values (, 75 g/L) were dropped from analysis, in order to approach normality. The RDW mean proportions for large pigs at weaning was greater (18.9 6 3.4) than for small pigs (17.5 6 3.2) or for medium weight pigs (17.9 6 3.1) (P = 0.04), but there were no other significant differences in the hematological parameters among pigs in these weight categories. Specifically, there were no significant differences in Hb levels among small (125.9 g/L 6 17.4 g/L), medium (128.0 g/L 6 13.6 g/L), and large (127.1 g/L 6 13.7 g/L) pigs at weaning (P = 0.8). One sample in Group 4 was clotted and so hemato-logical results were not reported for this sample.
A total of 3 pigs were anemic, 12 pigs were iron-deficient, and 131 pigs had normal hemoglobin levels at weaning. Group 1 (the industry standard of an IM injection of 200 mg of iron at 4 d of age) had 1 (5.5%) anemic pig and 5 (27.8%) iron-deficient pigs at weaning. Group 2 pigs receiving a second iron injection all had normal Hb levels. Group 3 pigs receiving an iron injection at 4 d of age and peat moss from 7 d of age until weaning had normal Hb levels except for 1 (1.8%) iron-deficient pig. Two (3.6%) pigs in Group 4 (oral paste and then peat moss) were anemic and 6 (10.7%) pigs were iron-deficient at weaning. The weaning weights of anemic pigs (7.1 kg 6 1.9 kg), iron-deficient pigs (6.9 kg 6 1.9 kg) and normal pigs (6.9 kg 6 1.5 kg) were similar (P = 0.9).
The descriptive statistics of hematological parameters among treatment groups are included in Table 1. The concentrations of Hb and the Hct, MCV, MCH, MCHC were significantly higher for pigs in Groups 2 and 3 compared to Groups 1 and 4 (P , 0.05). For pigs in Groups 2 and 3, RDW was significantly lower compared to Groups 1 and 4 (P , 0.05).
The weaning Hb levels in Groups 2 and Group 3 were signifi-cantly higher (127 and 133 g/L) than in Group 1 and Group 4 (P , 0.01) when controlling for litter. No significant differences were found between Group 1 and Group 4 (P = 0.6). A total of 45.6% of the model variation was explained at the litter level.
On average, litters provided with peat moss (n = 9) each consumed 7.2 kg of the iron-enriched product over an average of 14.5 d. On an individual basis, each pig consumed on average 568 g of peat moss during the trial.
The industry standard iron supplementation of 200 mg of iron injected intramuscularly during the first week of life was not sufficient to meet the nutritional iron needs of at least some of the suckling pigs in this study and this was in agreement with previous studies (1–3). In this study there were 18 pigs in Group 1 receiving this standard treatment, and at weaning 1 pig was classified based on Hb levels as anemic and 5 others were consid-ered iron-deficient. This proportion of iron-deficient or anemic pigs is almost identical to that in a study involving 20 Ontario farms that reported over 30% of pigs were either iron-deficient or anemic at the time of weaning (3). As with other studies (7,8)
that have used a second injection of 200 mg of iron at 14 d of age to ensure sufficient iron stores during the suckling period, the pigs in Group 2 had normal hemoglobin levels at weaning, indicating that this approach appears to be an effective method of preventing iron deficiency in pigs entering the nursery. Furthermore, the mean Hb levels and other hematological parameters associated with iron status were statistically higher for Group 2 pigs compared to Group 1. However, the second injection of iron at 14 d of age requires a significant labor com-mitment (8) and compliance among producers may be low.
In contrast to restraining and injecting each individual pig, iron supplementation via peat moss that is offered free-choice in weeks 2 and 3 of the suckling period appears to also be an effective means to meet the piglet’s iron requirement and may be more appealing from a labor standpoint. The mean values for hemoglobin and other hematological values indicative of iron status were similar between Groups 2 and 3. In Group 4, pigs were not injected but instead provided with an oral iron in the form of a paste. It has been reported in some studies that absorption of iron from a single oral dose during the early suckling period is not sufficient to meet the piglets’ require-ments (9,10) and even with free access to peat moss fortified with iron for the second and the third week of suckling, there was evidence that some of the pigs treated with the oral paste were iron-deficient at weaning. The amount of iron in a single dose (40 mg) is relatively low compared to the injectable treat-ment (200 mg) but iron fumarate is readily absorbed from the gut and not dependent on administration before gut closure Although the timing of the oral iron administration is somewhat controversial, the authors of a recent review of iron adminis-tration recommended 3 d of age rather than the first 12 h of life (10). Despite the administration of the lower dosage in the oral paste, pigs in Group 4 at weaning were comparable to those in Group 1 with respect to hematological parameters. There has been concern that the very large dose of parenteral iron typically given to pigs in the first few days of life may stimulate a negative feedback through the induction of hepcidin (11). In this trial, it appeared that pigs injected with 200 mg of gleptoferron at 4 d of age were able to utilize oral iron from the peat moss product adequately, but further studies are warranted to examine if the second injection of iron (Group 2) is associated with a decrease in iron absorption after weaning.
It is expected that larger pigs require more iron because of a greater blood volume and increased hemoglobin require-ments (2). However, similar to Bhattari and Nielsen (1), this study found no difference in mean Hb concentrations among small, medium, and large pigs at weaning, although large pigs had a significantly higher RDW. It must be considered that this size comparison involves pigs within different iron treat-ment groups. Hemoglobin concentrations are the most widely used parameter to assess iron status in piglets, but Hb alone may not be sensitive enough to detect an early change in iron status. Evaluating Hb concentrations alone may under-estimate the iron requirements of piglets (1). Additional hematological indices might serve as better early indicators of iron deficiency rather than traditionally used Hb values. For example, RDW measures variation in size of red blood cells and is considered
FOR PERSONAL USE ONLY
58 CVJ / VOL 62 / JANUARY 2021
CO
MM
UN
ICA
TIO
N B
RÈ
VE
one of the most reliable parameters indicating iron deficiency. The RDW increases during iron deficiency and it is therefore noteworthy that the large piglets herein had a higher RDW than the small and medium sized piglets, suggesting the large pigs may be beginning to develop iron deficiency.
This study suggests that a single iron treatment at 4 d of age is not sufficient to meet the needs of all piglets and additional iron is required. It appears that providing piglets daily access to iron-enriched peat moss or injecting a second 200 mg dose of iron intramuscularly are both effective in meeting the piglets’ iron requirements during the suckling period. The decision for most producers is likely related to individual preference.
AcknowledgmentsThis study was supported by Grand Valley Fortifiers Ltd and the Ontario Agri-Food Innovation Alliance. CVJ
References 1. Bhattarai S, Nielsen JP. Early indicators of iron deficiency in large piglets
at weaning. J Swine Health Prod 2015;23:10–17. 2. Svoboda M, Vaňhara J, Berlinská J. Parenteral iron administration in
suckling piglets — A review. Acta Vet Brno 2017;86:249–261.
3. Perri AM, Friendship RM, Harding JCS, O’Sullivan TL. An investi-gation of iron deficiency and anemia in piglets and the effect of iron status at weaning on post-weaning performance. J Swine Health Prod 2016;24:10–20.
4. Bruininx EMA, Swinkels JWG, Parmentier H, Jetten CWJ, Gentry JL, Schrama JW. Effects of an additional iron injection on growth and humoral immunity of weanling pigs. Livest Prod Sci 2000;67:31–39.
5. Schrama JW, Schouten JM, Swinkels JWGM, Gentry JL, de Vries Reilingh G, Parmentier HK. Effect of hemoglobin status on humoral immune response of weanling pigs differing in coping styles. J Anim Sci 1997;75:2588–2596.
6. Seip V, Friendship R, Amezcua R, Farzan A. The relationship between hemoglobin levels at weaning and growth performance and antibody response in nursery pigs. Can Vet J 2020;61:1170–1174.
7. Szudzik M, Starzynski RR, Jonczy A, Mazgaj R, Lenartowicz M, Lipiński P. Iron supplementation in suckling piglets: An ostensibly easy therapy of neonatal iron deficiency anemia. Pharmaceuticals 2018;11:128.
8. Maes D, Steyaert M, Vanderhaeghe C, et al. Comparison of oral versus parenteral iron supplementation on the health and productivity of piglets. Vet Rec 2011;168:188.
9. Svoboda M, Drabek J. Iron deficiency in suckling piglets: Parenteral and oral iron administration to piglets. Folia Vet 2005;49:165–174.
10. Svoboda M, Píšková K. Oral iron administration in suckling piglets — A review. Acta Vet Brno 2018;87:77–83.
11. Starzyński R, Laarakkers C, Tjalsma H, et al. Iron supplementation in suckling piglets: How to correct iron deficiency anemia without affect-ing plasma hepcidin levels. PLoS One 2013;8:e64022.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 59
Brief Communication Communication brève
Artificial insemination of gilts with bovine viral diarrhea virus-contaminated semen
Gabriel Y. Storino, Marina L. Mechler-Dreibi, Eduarda B. Xavier, Artur S. Fioroto, Maria E. F. Oliveira, Edviges M. Pituco, Luis G. de Oliveira
Abstract — Bovine viral diarrhea virus (BVDV) is a pestivirus that infects swine and other species and has genetic and antigenic similarity to classical swine fever virus. The objective of this study was to mimic the infection of swine by contaminated semen and evaluate the effects on their reproductive tracts and litters. Six gilts were artificially inseminated with semen containing BVDV-2 ncp (LVB 16557/15) and 2 were inseminated with BVDV-free semen. Blood samples from all gilts were collected for polymerase chain reaction and virus neutralization tests. No viremia or neutralizing antibodies were detected, and all the litters were born healthy.
Résumé — Insémination artificielle de cochettes avec du sperme contaminé par le virus de la diarrhée virale bovine. Le virus de la diarrhée virale bovine (BVDV) est un pestivirus qui infecte les porcs et d’autres espèces et qui présente des similitudes génétiques et antigéniques avec le virus de la peste porcine classique. L’objectif de ce travail était de reproduire expérimentalement l’infection des femelles porcines par insémination avec du sperme contaminé, d’évaluer les effets sur l’appareil reproducteur de la truie et sur sa portée. Six cochettes primipares ont été inséminées artificiellement avec du sperme contenant du BVDV-2 ncp (LVB 16557/15) et deux femelles ont été inséminées avec du sperme sans BVDV. Des échantillons de sang de toutes les femelles ont été prélevés pour des tests de réaction d’amplification en chaîne par la polymérase et de neutralisation virale. Aucune virémie ni aucun anticorps neutralisant n’ont été détectés et toutes les portées sont nées saines.
(Traduit par les auteurs)
Can Vet J 2021;62:59–61
B ovine viral diarrhea virus (BVDV) has 2 genotypes, BVDV-1 and BVDV-2, and is a member of the genus Pestivirus, as
are classical swine fever and border disease viruses. These viruses were reclassified as Pestivirus A, B, C, and D, respectively, and the newly described atypical pestiviruses were reclassified as Pestivirus E to K (1). Because they belong to the same genus, these viruses may present antigenic and genetic similarity (2). Some of these viruses share the ability to infect swine and other domestic species (3). It has been reported that BVDV infections in pigs can trigger reproductive changes, such as the birth of low viabil-
ity piglets, occurrence of mummified fetuses, and abortion (4), besides the birth of piglets with persistent congenital infection (5). However, several recent studies have shown that despite antigenic similarity to other pestiviruses, experimental BVDV infection in pregnant swine is unremarkable, with the birth of healthy lit-ters (6,7), and that experimentally inoculated boars did not shed the virus into the reproductive tract (8).
Considering that there is disagreement in the data found in the literature, the objective of this study was to mimic BVDV transmission by semen in gilts, and to evaluate whether this virus represents a risk to swine.
All the procedures performed in this study were approved by the Animal Ethics Committee of the School of Agricultural and Veterinarian Sciences/Unesp, under protocol number 19242/16. Eight gilts of commercial lineage were selected (Landrace 3 Large white); they were 180 d old and negative for BVDV-1 and BVDV-2 by serological evaluation. The pigs were divided into 2 groups: control (n = 2) and challenged (n = 6), which were kept in separate environments, at a distance of 1.5 km and managed by teams of different professionals, aiming to eliminate the possibility of agent transmission between groups.
In order to mimic virus transmission via semen, pigs from the challenged group received 2 doses of experimentally con-taminated semen using the conventional cervical insemination technique. To this end, a total of 3 mL of BVDV-2 ncp inoculum
School of Agricultural and Veterinarian Sciences — São Paulo State University (FCAV/Unesp). Via de Acesso Prof. Paulo Donato Castellane s/n, Jaboticabal, SP 14884-900, Brazil (Storino, Mechler-Dreibi, Xavier, Fioroto, Oliveira, de Oliveira); Biological Institute of São Paulo, Av. Conselheiro Rodrigues Alves, 1252 — Vila Mariana, São Paulo, SP, 04014-002, Brazil (Pituco).Address all correspondence to Dr. Luis G. de Oliveira; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
FOR PERSONAL USE ONLY
60 CVJ / VOL 62 / JANUARY 2021
CO
MM
UN
ICA
TIO
N B
RÈ
VE
(LVB 16557/15) at 280°C was thawed to 37°C using a water bath, added directly from the cryovials to the plastic bags con-taining extended semen, and homogenized gently. The inoculum was mixed with a prepared dose of semen about 5 min before insemination of 6 gilts. The 2 gilts from the control group were inseminated with BVDV-negative semen from BVDV-1 and BVDV-2 negative animals, whose semen and blood samples were negative by reverse transcriptase-polymerase chain reac-tion (RT-PCR). The doses used to inseminate all the gilts had 100 mL of extended semen with 3 3 109 sperm/dose, produced from fresh boar semen and then stored at 17°C for up to 24 h. The gilts were examined twice a day for estrus detection during exposure to a boar. The first dose of serum was administered at the first time that the gilt showed complete immobility in the presence of a boar, and was followed by a second dose, 12 h later.
The inoculum used for the experiment was produced by iso-lating the virus from a clinical case of BVDV disease in cattle by the Biological Institute of São Paulo. The infective doses of non-cytopathic BVDV-2 ncp strain LVB 16557/15 were obtained from the 6th passage of cultured Madin-Darby bovine kidney epithelial cells (MDBK; ECACC-Sigma-Aldrich, Salisbury, UK) with a virus titer of 105.5 TCID50/mL. The volume of inoculum added was calculated in order to obtain doses of semen with a titer of approximately 103 TCID50/mL, similar to the viral concentration reported in the semen of boars from a BVDV congenitally infected litter (9).
After insemination, blood samples were taken from the pigs every 4 d for 60 d post-inoculation. Blood was collected by puncture of the jugular vein with sterile syringes and 18-G, 1.2 mm 3 40 mm needles. The blood samples were separated into tubes containing ethylenediaminetetraacetic acid (EDTA) for whole blood and into tubes containing clot activator for serum samples. Serum was obtained by centrifugation of the clotted blood at 9000 3 g for 15 min, and each sample was aliquoted in duplicate in 2.0 mL tubes and stored at 220°C until tested. Throughout the post-insemination period, the pigs were evaluated daily for abortion and return to estrus. On the 40th day after insemination, all 8 pigs underwent abdominal ultrasound examination for confirmation of pregnancy.
Serum samples collected from pigs in both groups were submitted to virus neutralization tests (10) for the detection of neutralizing antibodies against BVDV-2. The serum samples and control positive and negative sera were heat-inactivated at 56°C for 30 min. All serum samples were subjected to serial 2-fold dilutions from 1:10 to 1:5120 and were tested in duplicate in microtiter plates. An equal volume of a cytopathic BVDV-2 (VS 253 strain) containing 100 TCID50 was added to each well and the plates were incubated for 1 h at 37°C in 5% CO2. Madin-Darby bovine kidney epithelial cells (ECACC-Sigma-Aldrich), previously tested negative for BVDV-1 and BVDV-2, were added to each plate, and the plates were incubated at 37°C for 96 h in 5% CO2. The wells were examined and the virus neutralization titer was the highest dilution in which total neu-tralization of 100 TCID50 occurred, as evidenced by the absence of a cytopathic effect on the layer of MDBK cells.
Whole blood samples were evaluated for the presence of BVDV-2 by RT-PCR in an attempt to detect viremia. All
samples were subjected to RNA extraction using Trizol, and transcribed from RNA to cDNA by reverse transcriptase reaction (Applied Biosystems, Foster City, California, USA) according to manufacturer’s guidelines. The following were added to the PCR mix: buffer 13 (50 mM KCl, 200 mM Tris-HCl, pH 8.4), 2 mM MgCl2, 0.2 mM dNTPs, 1.0 U Taq DNA polymerase, 5 pmol of primers 103 (59-TAG CCA TGC CCT TAG TAG GAC-39), and 392 (59-ACT CCA TGT GCC ATG TAC AGC-39), that amplify the 290 base pair untranslated region (11), 3 mL of cDNA and sterile water to complete 20 mL. The thermal cycler was programmed at 95°C for 2.5 min, and 35 cycles at 94°C for 30 s, 58°C for 30 s, 72°C for 40 s and a final cycle at 72°C for 10 min. All samples were reamplified under the same conditions described and visualized on 1% agarose gel.
Statistical analysis was performed using the R Project software (R Core Team, Vienna, Austria). The non-parametric Mann-Whitney U-test was used to analyze the differences between groups regarding the number of piglets born alive and stillbirths, since the distribution of the values did not meet the assump-tions of normality and homoscedasticity, as measured by the Shapiro-Wilk test (P , 0.05) and Bartlett test (P , 0.05). In the Mann-Whitney U-test, P , 0.05 was used for significant differences between the medians.
All 8 pigs had pregnancy confirmed by ultrasound image and none returned to estrus or aborted. No clinical signs indicative of viremia were observed. No antibody titers against BVDV-2 were detected in any of the inseminated pigs during the entire evaluation period. No viral RNA was detected in the blood of any of the pigs. With respect to the birth, there were no differences in the median numbers of piglets born alive from the challenged (14 6 0.87) and control (10 6 1.25) groups, and no difference in median numbers of stillbirths from chal-lenged (0.50 6 0.41) and control (1 6 0) groups (median 6 standard error of median), P , 0.05. There was no mummifica-tion of any fetuses. Moreover, the animals showed no clinical signs that could be related to BVDV-2 infection.
Under the conditions of the present study, contamination of pig semen with BVDV-2 did not lead to signs of infection in gilts challenged with BVDV-2 by the reproductive pathway, neither triggering reproductive losses nor producing neutral-izing antibodies.
There was no evidence of clinical signs in BVDV-2-infected animals, which is consistent with previous studies showing that experimental BVDV-2 infection in pigs has no clinical mani-festation of the disease (6,7,12–14).
Despite efforts to conduct blood sampling at short 4-day intervals, viremia was not detected. It is possible, however, that BVDV infection promotes transient viremia at short intervals with no established pattern (6). If there was mild and transient in BVDV-2-infected animals in the present study, the probability that the circulating virus in the blood would reach different organs was low.
It is believed that, as BVDV is a ruminant pestivirus poorly adapted to swine, it is not capable of causing severe infection in pigs, leading to the inference that this virus represents low or no risk to swine. Insemination of gilts with BVDV-2 contaminated
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 61
BR
IEF
CO
MM
UN
ICA
TIO
N
semen did not trigger clinical signs or reproductive losses, and the challenge did not promote viremia or neutralizing antibody production. Thus, insemination with semen contaminated with the non-cytopathic bovine viral diarrhea virus type 2 showed that there was no risk to pregnant gilts or their litters.
AcknowledgmentsWe thank São Paulo State Research Foundation (FAPESP) for granting research funds (2016/02982-3) and the GYS Masters scholarship (2017/00950-0), to Coordenação de Aperfeiçoamento de Pessoal de Nível Superior — Brasil (CAPES) — Financing Code 001. CVJ
References 1. Smith DB, Meyers G, Bukh J, et al. Proposed revision to the tax-
onomy of the genus Pestivirus, family Flaviviridae. J Gen Virol 2017; 98:2106–2112.
2. Terpstra C, Wensvoort G. Natural infections of pigs with bovine viral diarrhoea virus associated with signs resembling swine fever. Res Vet Sci 1988;45:137–142.
3. Ridpath JF. Flaviviridae. In: Flores EF, ed. Virologia Veterinária. 2nd ed. Santa Maria, Rio Grande do Sul: Editora UFSM, 2012:565–589.
4. Tao J, Liao J, Wang Y, Zhang X, Wang J, Zhu G. Bovine viral diarrhea virus (BVDV) infections in pigs. Vet Microbiol 2013;165:185–189.
5. Terpstra C, Wensvoort G. Bovine virus diarrhea virus infections in swine. Tijdschr Diergeneeskd 1991;116:943–948.
6. Mechler ML, Gomes F dos S, Nascimento KA, et al. Congenital tremor in piglets: Is bovine viral diarrhea virus an etiological cause? Vet Microbiol 2018;220:107–112.
7. Pereira DA, Brigolin PJ, Almeida HMS, et al. Experimental inoculation of gilts with bovine viral diarrhea virus 2 (BVDV-2) does not induce transplacental infection. Vet Microbiol 2018;225:25–30.
8. Storino GY, Xavier EB, Mechler-Dreibi ML, et al. No effects of non-cytopathic bovine viral diarrhea virus type 2 on the reproductive tract of experimentally inoculated boars. Vet Microbiol 2020;240:108512.
9. Terpstra C, Wensvoort G. A congenital persistent infection of bovine virus diarrhoea virus in PIGS: Clinical, virological and immunological observations. Vet Q 1997;19:97–101.
10. OIE — World Organization For Animal Health. Bovine Viral Diarrhea In: Manual of 414 Diagnostic Tests and Vaccines of Terrestrial Animals [homepage on the Internet]. c2015. Available from: https://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/3.04.07_BVD.pdf Last accessed October 14, 2020.
11. Weinstock D, Bhudevi B, Castro AE. Single-tube single-enzyme reverse transcriptase PCR assay for detection of bovine viral diarrhea virus in pooled bovine serum. J Clin Microbiol 2001;39:343–346.
12. Gomes FS, Mechler-Dreibi ML, Gatto IRH, et al. Congenital persistent infection with bovine viral diarrhea virus not observed in piglets. Can Vet J 2018;60:1220–1222.
13. Santos ACR, Nascimento KA, Mechler ML, et al. Experimental infec-tion and evaluation of airborne transmission and nose-to-nose contact of bovine viral diarrhea virus among weaned piglets. Aust J Basic Appl Sci 2017;11:12–19.
14. Nascimento KA, Mechler ML, Gatto IRH, et al. Evidence of bovine viral diarrhea virus transmission by back pond water in experimentally infected piglets. Pesqui Vet Bras 2018;38:1896–1901.
FOR PERSONAL USE ONLY
62 CVJ / VOL 62 / JANUARY 2021
Brief Communication Communication brève
Long-chain LPS-based enzyme-linked immunosorbent assay to detect swine herds infected by Actinobacillus pleuropneumoniae serotype 17
Marcelo Gottschalk, Sonia Lacouture, Tim Blackwell, Janine Bossé
Abstract — Actinobacillus pleuropneumoniae serotype 17, one of the two most recent serotypes described, has been isolated from diseased pigs in North America. Yet, no serological test for surveillance has been developed so far. An enzyme-linked immunosorbent assay (ELISA) using the long-chain lipopolysaccharide antigen (LC-LPS) of this serotype is described. As predicted by previous genetic data on the O-antigen locus, cross reactions were observed between this serotype and serotypes 3, 6, 8, and 15. Although animals infected by serotype 17 would be detected using the current serotype 3 LC-LPS ELISA, better results may be obtained when plates are coated with the antigen purified from the homologous serotype.
Résumé — Développement d’un test sérologique ELISA en utilisant l’antigène de la chaine O du LPS afin de détecter les troupeaux infectés par Actinobacillus pleuropneumoniae sérotype 17. Le récemment décrit Actinobacillus pleuropneumoniae sérotype 17 a été isolé chez des porcs malades en Amérique du Nord. Pourtant, aucun test sérologique n’a été mis au point à ce jour. Nous avons développé un test ELISA utilisant l’antigène lipopolysaccharidique à longue chaîne (LC-LPS) de ce sérotype. Tel que prévu par l’analyse du locus de l’antigène O du LPS, des réactions croisées ont été observées entre ce sérotype et les sérotypes 3, 6, 8 et 15. Bien que les animaux infectés par le sérotype 17 pourraient être détectés en utilisant le sérotype 3 LC-LPS ELISA, plus de sensibilité pourrait être obtenue en utilisant l’antigène purifié à partir du sérotype homologue.
(Traduit par les auteurs)
Can Vet J 2021;62:62–65
P orcine pleuropneumonia is an infectious respiratory disease of swine caused by Actinobacillus pleuropneumoniae. The
disease occurs throughout the world and results in significant economic losses due to mortality, growth retardation, veterinary costs, and slaughter condemnations (1).
In the peracute form, it is common to find dead animals without any premonitory signs and with a characteristic foamy blood-tinged nasal discharge. In the acute form, many pigs are usually ill and have fever, are depressed and reluctant to rise, eat, and/or drink. They may show dyspnea, cough, epistaxis, and sometimes mouth breathing (1). In the chronic form, there is little or no fever, and a spontaneous or intermittent cough of
varying intensity develops. Feed consumption may be reduced, and affected animals can demonstrate intolerance to exercise. Although the infection is well-controlled in North America, A. pleuropneumoniae-related problems remain a major concern in Latin American, Australasian, and many European countries. The infection may also be present in the absence of clinical signs and lesions at slaughter (1). In these sub-clinically infected herds, bacteria are confined to tonsillar crypts. This occurs commonly in conventional herds which may be simultaneously infected with not only low virulence strains, but also potentially virulent ones. In the latter cases, outbreaks may suddenly appear in the presence of concomitant diseases or as a consequence of management changes (2).
Until recently, 16 serotypes of A. pleuropneumoniae (based on the antigenicity of the capsular polysaccharide) and 2 biotypes, based on the requirement (biotype I) or not (biotype II) of nico-tinamide adenine dinucleotide (NAD) had been described (1). Serotypes 5 and 7 (biotype I) are the most commonly recovered serotypes from clinical cases in Canada (3). However, 2 addi-tional serotypes have recently been described: serotypes 17 and 18 (4). Serotype 17 comprises biotype I strains in Europe and biotype II (NAD-independent) strains in Canada and the United States (4). Serotype 18 strains have been recovered to date only in Europe and are all biotype I (4).
Early identification of sub-clinically infected herds is a key factor in the overall control of the disease as carrier animals
Faculté de médecine Faculté de médecine vétérinaire, Université de Montréal, 3200 Sicotte, Saint-Hyacinthe, Québec, Canada J2S 2M2 (Gottschalk, Lacouture); Lead Veterinarian, Disease Prevention-Swine, Ontario Ministry of Agriculture, Food, and Rural Affairs (Blackwell); Section of Pediatric Infectious Disease, Department of Infectious Disease, Imperial College London, St. Mary’s Campus, London, United Kingdom (Bossé).Address all correspondence to Dr. Marcelo Gottschalk; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 63
BR
IEF
CO
MM
UN
ICA
TIO
N
are the main source of contamination of naïve herds. Serology based on enzyme-linked immunosorbent assay (ELISA) is the most cost-effective diagnostic approach to identify such herds. There are 2 types of ELISA: i) those that are serotype/serogroup-specific based on the long O-chain lipopolysaccharide (LC-LPS) antigen; and ii) those that detect all A. pleuropneumoniae sero-types (without discrimination) based on the ApxIV toxin (2). Since most commercial herds in North America are subclini-cally infected by serotypes of low to intermediate virulence, the ApxIV test is of little value, because most such herds will test positive (2). Traditionally, the LC-LPS ELISA has successfully been used in Canada and USA to serologically monitor the presence of subclinical infection caused by A. pleuropneumoniae serotypes 1 to 15 (2). Some serotypes share common antigens at the LC-LPS level and cross-react in the ELISA, so they are considered as serogroups (Table 1). Previous genetic data indi-cated that the O-antigen locus of serotype 17 shares 97% to 100% identity with the loci of serotypes 3, 6, 8, 15 (4), sug-gesting possible cross-reactivity in LC-LPS ELISA although no serological data are available. Therefore, we produced LC-LPS antigens of strains 14-022 and 16287-1, representative of North American (Canada) and European (Denmark) sero-type 17 strains, respectively, and tested these for possible cross-reactions with sera from animals exposed to other serotypes of A. pleuropneumoniae.
The Canadian strain 14-022 of serotype 17, biotype II, iso-lated from a case of swine pleuropneumonia in Ontario and the European reference strain 16287-1, biotype I, recovered from a diseased pig in Denmark (4), were used to produce LC-LPS according to the methodology (phenol extraction) previously
described (5). Sera from convalescent animals (2 per serotype) experimentally infected with serotypes 1 to 15 were already available at our laboratory. Sera from animals infected with serotype 16 were not available, since this serotype has been reported in Hungary only (1). Sera of pigs originating from an A. pleuropneumoniae-free herd (confirmed by ApxIV-ELISA serology) were used as negative controls. Two 6-week-old ani-mals (pigs 427 and 428), coming from an A. pleuropneumoniae-free herd, were experimentally infected with the Canadian serotype 17 strain 14-022. Animals were infected intranasally 4 times at weeks 1, 3, 5, and 7 after arrival with increasing bacterial concentrations of 1 3 108, 1 3 109, 1 3 1010, and 5 3 1011 colony-forming units per animal, respectively. Pigs were bled before administering each infective dose and at the end of the trial, 11 wk after arrival. No clinical signs were observed, and the animals remained healthy during the entire trial period. All experiments involving pigs were conducted in accordance with the guidelines and policies of the Canadian Council on Animal Care and the principles set forth in the Guide for the Care and Use of Laboratory Animals by the Animal Welfare Committee of the University of Montreal. The ELISA was performed according to the optimized protocol already reported (6) and routinely carried out at the Diagnostic Service of the Faculty of Veterinary Medicine of the University of Montreal. LC-LPS antigens of other serotypes were also those routinely used in the laboratory of the Diagnostic Service. Each serum sample was tested at least 4 times.
Results showed that, using a homologous LC-LPS antigen extracted from the 14-022 strain, optical densities measured at 414 nm (OD414) obtained by standardized ELISA slowly but regularly increased with each infectious dose for pig 427, reaching intermediate OD414 values (between 0.30 and 0.70) at euthanasia. In the case of pig 428, values reached a plateau after the second dose and remained intermediate until euthanasia (Table 2). However, earlier and markedly higher values (OD414 . 1.0) were obtained for sera collected after 1 or 2 doses for pigs 427 and 428, respectively, when the LC-LPS from the European strain 16287-1 was used (Table 2).
When the final serum samples for both pigs 427 and 428 were tested by ELISA with LC-LPS antigens of serotypes 1 through 15, clear positive reactions were obtained with antigens of serotypes 3, 6, 8, and 15, and no reactivity was observed with antigens of the other serotypes (Table 3). When sera from animals experimentally infected with other serotypes of A. pleuropneumoniae were tested with the serotype 17 antigens, however, a weak reaction (close to OD414 = 0.30, considered as the cut-off level) was observed with animals infected with serotype 8 when using the LC-LPS antigen from strain 14-022 (Table 3). However, when the LC-LPS antigen purified from the European strain 16287-1 was used, clear and strong positive reactions were observed with sera from animals infected with serotypes 3, 6, 8, or 15 (Table 3). Sera from animals infected with all other serotypes remained negative when tested with the antigens purified from both strains (Table 3).
Overall, these ELISA results confirm the predicted cross-reactivity due to common LC-LPS antigens of serotypes 3, 6, 8, 15, and 17. The reason for poorer reactivity in ELISA of the
Table 1. Serotypes of Actinobacillus pleuropneumoniae described to date and reported cross-reactions observed using the LC-LPS ELISA.
Biotype (if present in Presence in Serotype North America) Cross-reactions North America
1 I 9, 11 Yes 2a I Nil Yes 3 I 6, 8, 15 Yes 4b - 7 Unknown 5 I Nil Yes 6 I 3, 8, 15 Yes 7a I 4 Yes 8 I 3, 6, 15 Yes 9a - 1, 11 No10b I 13 Unknown11a - 1, 9 No12 I Nil Yes13c I 10 Yes14 - Nil Nod
15 I 3, 6, 8 Yes16 - Unknown No17e II 3, 6, 8, 15 Yes18 - Unknown Noa Biotype II strains present in Europe (1).b A few isolates of serotypes 4 and 10 were reported more than 20 y ago from carrier
animals but identified using antibody-based techniques (7,8) and never confirmed by polymerase chain reaction (PCR).
c Strains from Europe are biotype II and antigenically different from those in North America (1).
d Wild boars in Western Canada are serologically positive for this serotype (9).e This study.
FOR PERSONAL USE ONLY
64 CVJ / VOL 62 / JANUARY 2021
CO
MM
UN
ICA
TIO
N B
RÈ
VE
serovar 17 LC-LPS antigen from the Canadian strain 14-022 compared to that from European strain 16287-1, both with homologous sera, as well as sera from animals infected with serotypes 3, 6, 8, or 15, is unclear. However, similar results have been observed for other serotypes; indeed, a local Canadian strain of serotype 5, instead of the reference strain, is routinely used to produce the LC-LPS antigen (5,6).
Finally, sera from animals originating from 2 herds affected by A. pleuropneumoniae serotype 17 were tested. A total of 15 serum samples from finishing animals of the Ontario farm where the serotype 17 strain 14-022 had originally been isolated were col-lected. In addition, 23 serum samples from sows in a continuous flow system in the USA where grower animals suffered mortal-ity due to A. pleuropneumoniae serotype 17 were also received. All sera were then tested with the serotype 3 LC-LPS antigen (routinely used to detect antibodies against serotypes 3, 6, 8, and 15) and the serotype 17 LC-LPS antigen of strain 16287-1. Two and seven serum samples had optical densities of OD414 . 0. 30 with antigens of serotype 3 and 17, respectively, in the Canadian herd. Similarly, 2 and 7 serum samples from the US herd reacted with serotypes 3 and 17 antigens, respectively. These results suggest that the use of the specific serotype 17 antigen of strain 16287-1 (rather than that of serotype 3) might lead to a higher sensitivity. Although never isolated, the presence of other cross-reacting serotypes (serotypes 3, 6, 8, and/or 15) in these farms is unknown.
In conclusion, these results suggest that the use of an LC-LPS antigen purified from the European reference strain 16287-1 of serotype 17 in an ELISA may be useful to detect herds infected
by this serotype. It is also possible that the ELISA that cur-rently uses the LC-LPS antigen from serotype 3 also detects, to a lower extent, positive animals in such infected herds. A complete validation of the LC-LPS ELISA using the serotype 17 strain 16287-1 antigen should be performed. However, access to sera from herds confirmed to be infected by this serotype, but also free of A. pleuropneumoniae serotypes 3, 6, 8, and 15, is difficult, since many of the latter are subclinically present in many commercial herds.
AcknowledgmentsWe thank Katerine Aubé and Line Vachon for invaluable technical help. This work was funded by the Natural Sciences and Engineering Research Council of Canada, grant 04435, the Diagnostic Service, Faculty of Veterinary Medicine of the University of Montreal funding to MG and the Biotechnology and Biological Sciences Research Council (grant BB/S002103/1) to JB. CVJ
References1. Gottschalk M, Broes A. Actinobacillosis. In: Zimmerman J, Karriker L,
Ramirez A, Schwartz K, Stevenson G, eds. Diseases of Swine. 11th ed. Ames, Iowa: Wiley-Blackwell. 2019:749–765.
2. Gottschalk M. The challenge of detecting herds sub-clinically infected with Actinobacillus pleuropneumoniae. Vet J 2015;206:30–38.
3. Gottschalk M, Lacouture S. Canada: Distribution of Streptococcus suis (from 2012 to 2014) and Actinobacillus pleuropneumoniae (from 2011 to 2014) serotypes isolated from diseased pigs. Can Vet J 2015; 56:1093–1094.
4. Bossé JT, Li Y, Sárközi R, et al. Proposal of serovars 17 and 18 of Actinobacillus pleuropneumoniae based on serological and genotypic analysis. Vet Microbiol 2018;217:1–6.
Table 2. ELISA results for sera from animals experimentally infected with the Canadian A. pleuropneumoniae strain 14-022 tested using LC-LPS antigens purified from serotype 17 homologous (14-022) or European (16287-1) strain.
Results are shown as mean OD414 (6 standard deviation). A cut-off of 0.3 was used.Results of serotype 1 is presented as an example. Similar results were obtained with antigens of different serotypes and sera of animals infected with A. pleuropneumoniae serotypes 2, 4, 5, 7, 9, 11, 12, and 14. Values in bold are positive.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 65
BR
IEF
CO
MM
UN
ICA
TIO
N
5. Gottschalk M, De Lasalle F, Radacovici S, Dubreuil JD. Evaluation of long chain lipopolysaccharides (LC-LPS) of Actinobacillus pleuropneu-moniae serotype 5 for the serodiagnosis of swine pleuropneumonia. Vet Microbiol 1994;38:315–327.
6. Trottier YL, Wright PF, Larivière S. Optimization and standardization of an enzyme-linked immunosorbent assay protocol for serodiagno-sis of Actinobacillus pleuropneumoniae serotype 5. J Clin Microbiol 1992;30:46–53.
7. Lebrun A, Lacouture S, Côté D, Mittal KR, M Gottschalk M. Identification of Actinobacillus pleuropneumoniae strains of serotypes
7 and 4 using monoclonal antibodies: Demonstration of common LPS O-chain epitopes with Actinobacillus lignieresii. Vet Microbiol 1999;65:271–282.
8. Sidibé M, Messier S, Larivière S, Gottschalk M, Mittal KR. Detection of Actinobacillus pleuropneumoniae in the porcine upper respiratory tract as a complement to serological tests. Can J Vet Res 1993;57:204–208.
9. McGregor GF, Gottschalk M, Godson DL, Wilkins W, Bollinger TK. Disease risks associated with free-ranging wild boar in Saskatchewan. Can Vet J 2015;56:839–844.
1. C) Inflammatory arthritis of Chinese shar-peis can affect any age and is associated with episodic fever and swelling of the hocks.
C) L’arthrite inflammatoire chez le shar-pei chinois peut affecter les chiens de tous âges et être associée à de la fièvre épiso-dique et à de l’enflure des jarrets.
2. E) The presence of proteinuria does not cause chronic kidney disease to worsen.
E) La présence de protéinurie ne cause pas une détérioration de la maladie rénale chronique.
3. A) Horner syndrome results from cranial sympathetic denerva-tion, and is characterized by various symptoms in the head and cervical region, including blepharoptosis, enophthalmos, prolapse of the third eyelid, miosis, increased secretion of lacrimal or nasal glands, increased cutaneous temperature, local sweating and laryngeal hemiplegia.
A) Le syndrome de Horner résulte de la dénervation sympa-thique des nerfs crâniens et est caractérisé par des symp-tômes variés touchant la tête et la région cervicale, incluant la blépharoptose, l’énophtalmie, le prolapsus de la troisième paupière, le myosis, l’augmentation de la sécrétion des glandes lacrymales et nasales, l’augmentation de la tempé-rature cutanée, la sudation locale et l’hémiplégie laryngée.
4. C) The vaginal examination suggests uterine torsion at the level of the vagina. This is the most common presentation and easiest to diagnose; the more difficult are those twisted at the level of the posterior uterus. Diagnosis of torsions and direction can be made by rectal examination of the uterine arteries, which are bilateral in the normal uterus, but appear unilateral in cases of uterine torsion, with one pulled across the dorsal and contralateral side of the cervix. The most common uterine torsion is anticlockwise (as viewed from behind the cow), which would pull the right uterine artery
over the top to the left side over the dorsal aspect. Surgery is not required to diagnose this; the ultrasound is not useful for diagnosis, and casting and rolling before a diagnosis is made may exacerbate the problem if the cow is rolled in the incorrect direction.
C) L’examen vaginal suggère une torsion utérine au niveau du vagin. C’est la présentation la plus commune et la plus facile à diagnostiquer; les torsions les plus difficiles à diagnosti-quer sont les torsions de la partie postérieure de l’utérus. Le diagnostic de la torsion et de la direction de celle-ci peut être fait par l’examen transrectal des artères utérines, qui sont situées bilatéralement quand l’utérus est en position normale mais apparaissent unilatérales en cas de torsion utérine étant donné que l’une est tirée du côté dorsal et controlatéral du col utérin. La torsion est le plus souvent dans le sens antihoraire (lorsqu’on regarde l’animal par der-rière), ce qui tire l’artère utérine droite vers le côté gauche par dessus la face dorsale de l’utérus. La chirurgie n’est pas nécessaire pour établir le diagnostic, l’échographie n’est pas utile pour le diagnostic, et coucher et rouler la vache avant d’avoir confirmé le diagnostic peut exacerber le problème si la vache est roulée dans la mauvaise direction.
5. E) In young pigs, Bordetella bronchiseptica induces rhinitis with sneezing. Lacrimal duct blockage leads to epiphora, and paroxysmal sneezing can cause epistaxis. Colonization by Pasteurella multocida and toxin production then results in snout deformity.
E) Chez les jeunes porcelets, Bordetella bronchiseptica cause une rhinite avec des éternuements. Le blocage du conduit lacrymal conduit à de l’épiphora, et les éternuements paroxystiques peuvent provoquer de l’épistaxis. La coloni-sation par Pasteurella multocida et la production de toxines entraînent ensuite la déformation du groin.
Answers to Quiz Corner Les réponses du test éclair
quiz corner is generously sponsored by le test éclair est généreusement commandité par
NEW THE ONLY VETERINARY LICENSED TETRACOSACTIDE.
INDICATED FOR THE EVALUATION OF ADRENOCORTICAL FUNCTION IN DOGS.
COST-EFFECTIVE, 1 ML SINGLE-USE VIALS.
FOR PERSONAL USE ONLY
66 CVJ / VOL 62 / JANUARY 2021
Special Report Rapport spécial
Poultry veterinarians in health and production
Adam Lichtensteiger
W hat are the roles played by poultry veterinarians and why do we need them? As a North Vancouver native,
this is a question I find myself answering all too often to my family and friends. As I am not from a farming background, when I say “poultry veterinarian” they immediately picture me performing turkey brain surgery or doing CPR on a pheasant, and while I am sure there is a vet somewhere out there who has attempted these procedures, this of course is not my role as a poultry veterinarian. I am a first-year poultry veterinarian who graduated from the Western College of Veterinary Medicine in 2020. The following is an outline of the role that I and others play in the poultry industry as avian pathologists, poultry vets, and chicken masters.
OverviewPoultry is the fastest growing food animal commodity in the world, with chicken meat estimated to be the most consumed meat in the world in 2019, due in part to changes in the pig supply attributable to African Swine Fever (1). In 2018, Canadian poultry farmers produced a record 1.465 billion kg of poultry (2). While everyone understands that this meat does not simply appear in the grocery store fridges and freezers, practi-cally, this is what most people experience, and this is about as far as the relationship extends between most people and poultry production. In reality, poultry production is a complicated relationship between primary breeder companies, hatcheries, producers, feed mills, and processing plants, all intertwined with biology, industry, public health, welfare, and politics. The fun part, and the challenging part of being a poultry veterinarian is that we are trained to have our hands in it all.
Working with producersProducers are the backbone of our supply management system in Canada. These are the farmers, the professionals who produce
the meat and the eggs that we eat. Now, usually at this point when I explain to family and friends that I work with poultry farmers, the next thought is that I live on, or in, a chicken farm. While this is not the case, poultry vets do work very closely with producers, but usually in a consulting fashion. We help with diagnostics when there are disease outbreaks on the farm, and more importantly, with preventative medicine to help stop diseases such as coccidiosis and necrotic enteritis before they happen. On the veterinary side this is accomplished by working with producers to implement good husbandry and biosecurity practices and to develop vaccination and medication programs, as well as performing routine disease surveillance on the farm. This is done with the help of trained management field techni-cians and nutritionists who work with producers to provide the best feed and environment for chicks to keep them healthy. Veterinarians work with poultry nutritionists and feed mills to design economical nutrition programs that maximize perfor-mance and poultry welfare. The ability to work with experts in a variety of fields is a great benefit of working in the poultry industry, a benefit that many veterinarians are not afforded. Professional input on disease prevention is especially important since the Chicken Farmers of Canada have voluntarily discontin-ued the prophylactic use of category I and category II antibiotics and are currently working on the removal of category III antibi-otics, while the Turkey Farmers of Canada have eliminated the prophylactic use of category I, II, and III antibiotics. Disease prevention is important for the welfare of the birds, economics of production, and efficiency of growth (feed conversion) which reduces overall land and energy use.
Working in the hatcheryMany poultry veterinarians work directly with a hatchery or consult for one or several. The successful incubation and hatch-ing of baby chicks is an extremely important aspect of raising healthy flocks. Veterinarians assist hatchery teams with routine analysis of unhatched eggs, vaccination programs, biosecurity, sanitation, hatchability issues, or egg/chick quality issues. Our work in the field monitoring flocks is also valuable for hatchery operators as issues in the field can sometimes be informative for potential problems in the hatchery or with supply flocks. Veterinarians as well as industry service technicians act as intermediaries, facilitating communication on diagnostics and outbreaks between hatcheries and farmers. Awareness of the importance of hatcheries is continuing to grow and innovations are constantly in development and becoming available to these facilities. Thanks to research and development by scientists and engineers we are seeing improvements in areas such as in ovo
Dr. Lichtensteiger, a native of British Columbia, is a 2020 graduate from the Western College of Veterinary Medicine, University of Saskatchewan. He has a record of volunteering overseas in Bali and Thailand and is presently a poultry veterinarian in Alberta. He has written this article on behalf of the Canadian Association of Poultry Veterinarians.Address all correspondence to Dr. Adam Lichtensteiger; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 67
SP
EC
IAL
RE
PO
RT
chick sexing, embryo vaccination, use of more sophisticated single stage incubators, automated handling systems, provision of feed and water in hatchers, and increased sophistication in trucks for shipping chicks to farms. All these changes have implications for chick health and welfare which will continue to benefit from veterinary support.
Working at the plantIt is inevitable that birds need to be slaughtered and processed before making it to the grocery store or dinner plate. An effi-ciently functioning processing plant is essential for bird welfare and to produce safe food for consumers. From a welfare per-spective, a veterinarian’s goal during a processing plant visit is to ensure that equipment is running correctly to make certain birds are stunned before slaughter, are as comfortable as possible in loading bays prior to stunning, and that slaughter is rapid and accurate every time. While processing plant operators and managers already have these aspects dialed in, vets can play a supportive role by working with crews to prevent oversights. Vets also play a role in the plant by investigating cases in which birds are found dead on arrival or are condemned at slaughter. Our goal in these cases is to determine the cause of the issue and prevent a repeat of this issue in the future. Finally, we also play a role in performing diagnostics within the plant itself pertaining to food quality.
Public healthAn area closely intertwined with plant work, the importance of which cannot be overstated, is human health. Food safety is something that is taken very seriously in production animal medicine. Canada’s On-Farm Food Safety Assurance Program (OFSAP), for example, has been developed with input from veterinarians, farmers, provincial boards national biosecurity guidelines, and other specialists (3). These guides provide rec-ommendations on personnel training, farm access, feed/water provision, cleaning and disinfection, and other management practices. Our role as veterinarians is to help producers meet program guidelines and ensure birds are healthy on the farm and when they arrive at the plant. This is accomplished partly through routine diagnostics and treatment, but also through mandated surveillance programs such as the Canadian Integrated Program for Antimicrobial Resistance Surveillance (CIPARS) and the Canadian Notifiable Avian Influenza Surveillance System (CanNAISS). In addition, we play a role in prevent-ing product contamination by ensuring that proper feed and medication withdrawal times are followed. Routine diagnostics that take place in the lab include testing for Salmonella and Campylobacter and product shelf life.
EmergenciesOccasionally, chicken emergencies do happen. In the case of a flipped truck or collapsed barn, veterinarians need to be available to ensure that the birds are depopulated in the most humane and timely manner possible. In an avian influenza or Newcastle disease outbreak, our role is to minimize the spread of these diseases which can have devastating impacts on the industry, and in rare cases, risks to human health.
ResearchAs with every aspect of veterinary medicine, there is consider-able research that is undertaken by veterinarians in the field of poultry. Developments in genetics, vaccines, nutraceuticals, diagnostics, and welfare are constantly evolving. The world is working to reduce our dependence on antibiotic use due to the fear of continued selection for multi-drug resistant pathogens that are affecting human medicine. The hunt is on for alterna-tive types of medicine for our animals, stimulating a great deal of research in the field to find innovative new approaches.
Research and development of poultry genetics is a huge industry: Cobb, Aviagen, and Hybrid, being some of the larger primary breeding names in the game. While in the past a large part of genetic research was focused on increased carcass yield, now geneticists are focused on including a far more diverse array of characteristics into their birds such as bone strength, feed efficiency, fertility, livability, and disease resistance which could help limit the need for treatment.
Poultry veterinarians are directly involved with many aspects of vaccine development. We are the only industry that currently vaccinates embryos. This is done using robotic in ovo vaccina-tion technology in the hatchery at a mass scale on billions of chicks every year. In addition, autogenous vaccine programs are becoming more well-established, which allow us to produce tailor-made vaccines targeted at pathogens specific to certain farms or geographic regions. Veterinarians and lab technicians are directly involved in this process through strain identification, isolation, and selection.
Nutraceuticals are another antibiotic alternative that are being heavily researched. Essential oils, yeasts, probiotics, and other products are showing promise in field studies that veterinar-ians may play a role in facilitating. This is only a small subset of research that is performed by veterinarians. Other avenues include diagnostics, disease epidemiology, welfare, and much more.
EducationWhether it is through workshops, articles, conferences, or through direct communication on the farm or in the lab, poultry vets, like many other vets, spend a great deal of time teaching. A common practice is holding workshops for producers to teach approved on-farm euthanasia techniques, basic post-mortem techniques, as well as new innovations and management prac-tices. Teaching others and learning from producers, technicians, nutritionists, academics, and other vets is one of my favorite aspects of the job, which I guess is only natural when one spends 25 years of their life in the education system. One of the nice things about this industry is that there is no shortage of good mentors.
The futureThe poultry industry will continue to change and evolve. Advancements in automation and machinery, improved disease diagnostics and treatments, new disease strains, changes to bird genetics, and changing welfare standards will continue to change the industry in unforeseen ways that will pose new challenges
FOR PERSONAL USE ONLY
68 CVJ / VOL 62 / JANUARY 2021
RA
PP
OR
T S
PÉ
CIA
L
for veterinarians and other professionals in the industry. For example, there is currently a lot of pressure from retailers, restaurants, and grass roots organizations to improve living standards for egg-laying birds. This has resulted in the devel-opment of new Codes of Practice for the Care and Handling of Pullets and Laying Hens and the Code of Practice for the Care and Handling of Hatching Eggs, Breeders, Chickens, and Turkeys (4,5). These were made with input from multiple stakeholders, including veterinarians. Changes such as these require millions of dollars invested by farmers. Barns need to be re-invented, which requires new training and adjustments to management practices. The new codes of practice will lead to the abolition of traditional cages in place of enriched cages, free-run, and free-range systems. These changes will undoubtedly lead to an increased frequency of disease challenge within our flocks, which combined with the gradual move away from the use of prophylactic antibiotics will result in increased demand for veterinary oversight in the future.
What I love about this job so farWhile my career is only in its infancy, I am really enjoying where I am so far. I am meeting great people, with ambition and pas-sion, who take pride in what they do. I am reaping the benefit of good mentorship from individuals with specialized experience, skills, and knowledge to help me grow professionally. I enjoy
the ability to get outside, work with animals in the field, and travel, without having to always be outside and travelling. The work is interesting in that I get to perform research, teach, work directly with farmers, problem solve, help people and animals, perform diagnostics, learn about business, and be paid for what I know, not just what I do. Working full time in addition to fulfilling my master’s degree requirements keeps me very busy, but I do feel that I have entered a career in which work/life bal-ance is valued. Overall, I am excited about my future prospects in this career, and I hope that through this article I have been able to shed some light into a small part of what we do as avian pathologists, poultry vets, and chicken masters.
References1. Poultry Poised to be the World’s Most Consumed Meat. WattPoultry.
Available from: https://www.wattagnet.com/articles/37539-poultry-poised- to-be-worlds-most-consumed-meat Last accessed November 23, 2020.
2. Poultry and egg statistics, May 2019 and annual 2018. Statistics Canada. Available from: https://www150.statcan.gc.ca/n1/daily-quotidien/ 190527/dq190527a-eng.htm Last accessed November 23, 2020.
3. OFFSAP manual 2014. Chicken Farmers of Canada. Available from: https://www.chickenfarmers.ca/wp-content/uploads/2014/07/OFFSAP-Manual-2014.pdf Last accessed November 23, 2020.
4. Codes of Practice Pullets and Laying Hens. NFACC. Available from: https://www.nfacc.ca/codes-of-practice/pullets-and-laying-hens Last accessed November 23, 2020.
5. Poultry Code of Practice. NFACC. Available from: https://www.nfacc.ca/ poultry-code-of-practice Last accessed. November 23, 2020.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 69
Student Paper Communication étudiante
Peritoneal-pericardial diaphragmatic hernia in a 6-year-old male intact pug dog
Bryan T. Welch
Abstract — A 6-year-old intact male pug dog was referred to the Atlantic Veterinary College veterinary teaching hospital for a surgical consultation after survey radiographs taken by the referring veterinarian led to a tentative diagnosis of a peritoneal-pericardial diaphragmatic hernia. Computed tomography of the thorax and abdomen prior to surgery further characterized the lesion and aided in surgical planning. Surgical correction of the defect was achieved via primary herniorrhaphy. The patient was discharged and was reported to be doing well 7 months after surgery.
Résumé — Hernie péritonéale-péricardique diaphragmatique chez un carlin mâle non-castré âgé de 6 ans. Un carlin mâle non-castré âgé de 6 ans fut référé à l’hôpital d’enseignement vétérinaire de l’Atlantic Veterinary College pour une consultation chirurgicale à la suite des radiographies prises par le vétérinaire référant qui ont mené à un diagnostic préliminaire d’hernie péritonéale-péricardique diaphragmatique. La tomodensitométrie du thorax et de l’abdomen avant la chirurgie a permis de mieux caractériser la lésion et a aidé dans la planification de la chirurgie. La correction chirurgicale du défaut fut réalisée par hernioraphie primaire. Le patient obtint son congé et allait bien 7 mois après la chirurgie.
(Traduit par Dr Serge Messier)Can Vet J 2021;62:69–72
O n July 22, 2019 a 6-year-old intact male pug dog was presented to the referring veterinarian (rDVM) because
of a month-long history of intermittently increased respiratory effort. The reported dyspnea had increased over the previous 3 d. There were no overt respiratory signs observed by the rDVM at the time of the examination. Complete blood (cell) count (CBC), serum biochemistry profile, and serum total thyroxine profile (TT4) were determined. Mild hypocholesterolemia [3.2 mmol/L; reference range (RR): 3.4 to 8.9 mmol/L] and mild thrombocytosis (599 3 109/L; RR: 143 to 448 3 109/L) were considered to be clinically insignificant. No other abnor-malities were detected. Survey radiographs revealed an enlarged cardiac silhouette with a gas-filled viscus within the thorax and continuity between the cardiac silhouette and the diaphragm. The dog was referred to the Atlantic Veterinary College vet-erinary teaching hospital (AVC VTH) for further evaluation.
The dog was presented to the AVC VTH on July 23, 2019. Upon presentation the dog was panting and appeared bright, alert, and responsive. The dog was in good body condition
(body condition score = 5/9; weight = 7.8 kg). The dog’s mucous membranes were pink and moist with a capillary refill time of , 2 s. Thoracic auscultation revealed diminished heart sounds and intermittent borborygmi on the right hemithorax. Vital signs on presentation were unremarkable. The dog’s abdomen was unusually tucked at the waist and upon abdominal palpation there appeared to be a lack of abdominal viscera.
The radiographs were reviewed by a Board-certified radi-ologist, who confirmed an enlarged cardiac silhouette and gas-filled viscus overlying the cardiac silhouette. There was also a soft tissue opacity in the caudal thorax that appeared to be continuous between the cardiac silhouette and the diaphragm (Figures 1, 2). Based on the radiographs, the radiologist was unable to definitively diagnose a peritoneal-pericardial diaphrag-matic hernia (PPDH) and recommended computed tomography (CT) for further characterization. Blood was collected for blood glucose, lactate, blood urea nitrogen (BUN) test strip, packed cell volume (PCV), and total solids (TS). Blood lactate was elevated (3.2 mmol/L; RR: , 2.5 mmol/L). This mild eleva-tion in lactate normalized following maintenance intravenous fluid therapy with Lactated Ringers Solution (I.V. Sol. Lactated Ringers 1000 mL; Baxter Canada, Mississauga, Ontario) at 2.2 mL/kg body weight (BW) per hour.
On July 24, 2019 the dog was anesthetized for CT (Toshiba Aquilion 16; Toshiba Animal Medical Systems, Markham, Ontario). Despite thoracic radiographs and CT (Figure 2), the extent of the diaphragmatic defect could not be determined, and surgical exploration was recommended. The dog was maintained
Atlantic Veterinary College, 550 University Avenue, Charlottetown, Prince Edward Island C1A 4P3.Address all correspondence to Bryan Welch; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
FOR PERSONAL USE ONLY
70 CVJ / VOL 62 / JANUARY 2021
CO
MM
UN
ICA
TIO
N É
TU
DIA
NT
E
on inhalant anesthesia and transferred to the surgery department for exploratory laparotomy.
A routine ventral midline incision was made from xiphoid to pubis. Upon entering the peritoneal cavity, a large amount of abdominal viscera was noted to be protruding through a 5-cm defect in the most ventral aspect of the diaphragm. The stomach, spleen, left medial and lateral liver lobes, gall blad-der, a portion of small intestine and omentum were manually reduced through the defect into the peritoneal cavity. A 1- to 2-cm adhesion was noted between the omentum and the right caudodorsal aspect of the pericardium. Upon removal of the viscera, the myocardium was visualized, permitting a definitive diagnosis of PPDH.
Surgical repair of the defect was accomplished via primary herniorrhaphy. The edges of the defect were debrided using a #15 scalpel blade. A continuous pattern of 3-0 Prolene (Prolene; 3-0 FS-2 Cut; Ethicon, Johnson & Johnson, Somerville, New Jersey, USA) was used to close the defect. Closure at the ventral-most aspect was augmented with a cruciate pattern using 3-0 PDS (Suture PDS; 3-0 SH, Ethicon). Following herniorrha-phy, a transdiaphragmatic thoracocentesis was performed using an 18-gauge intravenous style catheter and a 12-mL syringe. A 20-mL volume of air was removed from the pleural space.
Following herniorrhaphy, an abdominal exploration was per-formed. The left medial, left lateral, and the papillary processes of the caudate liver lobes were atrophied and were an estimated 40% of their normal size. The right medial, right lateral, and caudate liver lobes were hypertrophied. There was a small area of ectopic splenic tissue noted in the omentum. No other irregularities were noted. Closure was routine. The linea alba was closed with a combination of a simple continuous pattern of 2-0 PDS (Suture PDS; 2-0 CT-2, Ethicon) and cruciate pattern of 2-0 PDS (Suture PDS; 2-0 CT-2, Ethicon). The subcutaneous layer was closed in a simple continuous pattern of 3-0 Monocryl (Suture Monocryl Plus; 3-0 SH, Ethicon). The skin was closed
with an intradermal pattern of 3-0 Monocryl (Suture Monocryl Plus; 3-0 FS-2 Violet, Ethicon).
Post-operative radiographs revealed a minor pneumothorax. The patient was monitored for post-operative complications for about 36 h; none were noted and the patient was discharged on day 4 of hospitalization. The patient was returned several hours later due to a respiratory episode identical to those that had prompted the initial visit to the rDVM. After re-examining the patient and consulting with the clients, it was determined that the dog had been reverse-sneezing and was not experiencing a respiratory crisis related to either recurrence of the hernia or postoperative complications.
DiscussionThere are 2 main categories of diaphragmatic hernias: traumatic and congenital (1). Traumatic diaphragmatic hernias occur when forces upon the diaphragm exceed the diaphragmatic holding strength resulting in a defect. Congenital diaphrag-matic hernias (due to developmental failure) can be further broken down into peritoneal-pericardial diaphragmatic her-nias (PPDH) and pleuro-peritoneal diaphragmatic hernias (PDH) (1). Peritoneal-pericardial diaphragmatic hernias result in an open communication between the peritoneal and peri-cardial spaces; a result of dysembryogenesis (2) and are thought to be due to a failure of proper septum transversum develop-ment (1–5). Abdominal viscera are able to translocate through the communication between the peritoneum and pericardium. The most common organs to translocate are the liver, stomach, spleen, gall bladder, and small intestine (2,6).
Many patients are presented with clinical signs and physical examination findings related to their PPDH. Clinical signs are often proportional to the size of the defect, related to the translocation of viscera. Diaphragmatic defects can lead to entrapment of viscera within the pericardium, which may lead to respiratory, cardiac, and/or gastrointestinal signs as well as
Figure 1. a — Pre-operative right lateral thoracic radiograph illustrating PPDH. A — Enlarged cardiac silhouette; B — Gas-filled viscus overlaying cardiac silhouette. b — Pre-operative ventrodorsal thoracic radiograph illustrating PPDH. A — Enlarged cardiac silhouette; B — Gas-filled viscus overlaying cardiac silhouette; C — Continuity between cardiac silhouette and diaphragm.
a b
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 71
ST
UD
EN
T P
AP
ER
visceral adhesions to the pericardium, diaphragm, or even the myocardium itself (2,3). Clinical signs can include anorexia, respiratory distress, weight loss, exercise intolerance, discomfort when eating, or the patient may be completely asymptom-atic (4,6). The most common physical examination findings associated with PPDH are muffled heart sounds, decreased lung sounds, borborygmi on thoracic auscultation and cardiac arrhythmia (2). It is important to note that in many cases vis-cera are not entrapped and therefore able to freely slide in and out of the pericardium, which can lead to intermittent clinical/physical signs.
Diagnosis of PPDH is typically achieved with thoracic radio-graphs (6). Radiographic findings consistent with a diagnosis of PPDH include enlarged cardiac silhouette, gas-filled viscus within the pericardium/overlying the cardiac silhouette, and loss of distinction between the cardiac silhouette and the dia-phragm (3,6). Additional imaging modalities include abdominal ultrasonography, echocardiography, and CT (3).
Confirmation of a radiographic diagnosis can be achieved with echocardiography but was not pursued in this case (6). Laboratory testing can also provide supportive evidence. In dogs, the most common biochemical abnormality seen is an elevated serum alanine aminotransferase (ALT), but this was not noted in this dog (3,6). Although ALT has been reported to be elevated in a considerable percentage of canine PPDH cases, ALT eleva-tion is a nonspecific finding. While this dog did not display an elevated ALT, it did have a mild hyperlactemia. Serum lactate is widely used as an indicator of systemic perfusion and com-
monly used as a prognostic indicator in a multitude of disease states. There is limited literature investigating the correlation between serum lactate in PPDH and prognosis, but there have been retrospective studies analyzing preoperative serum lactate as a prognostic indicator in cases of traumatic diaphragmatic hernias. In cases of traumatic diaphragmatic hernias, elevated serum lactate at presentation has not been demonstrated to be associated with increased mortality (7).
Nearly 50% of all PPDH cases are diagnosed inciden-tally (3,6). Incidental cases are generally in older dogs (average: 7 y old) and can be successfully managed medically (2,3,6). Medical management consists of “benign neglect” — with own-ers monitoring these animals at home for signs of respiratory distress. Patients with more severe clinical signs attributable to PPDH are more often brought to surgery for repair, but between the surgical and non-surgical cases there is no significant differ-ence in outcome — suggesting that for asymptomatic patients, surgery may be unwarranted (2,6).
This case was initially believed to be an atypical presentation; most cases presenting with clinical signs related to their PPDH are younger (median age: 1 y) based on a retrospective study of 128 dogs (2). Once it was determined that the dog’s respiratory episodes were attributable to reverse sneezing, it became clear that this was a more typical presentation — an older dog with PPDH diagnosed as an incidental finding. Reverse sneezing is thought to be related to upper respiratory problems, especially nasal and pharyngeal disorders (6,8). To the author’s knowledge, there has not been any literature relating reverse sneezing to PPDH.
Upon referral of this case, there was strong suspicion that the respiratory episodes the dog was experiencing were related to the PPDH. The initial thought was that the dog’s intermittent clinical signs could be due to abdominal viscera sliding in and out of the pericardium. With the history of respiratory distress combined with the profound amount of translocated abdominal viscera, surgery was determined to be the treatment of choice. If reverse sneezing had been determined to be the “respiratory distress” episodes prior to surgery, medical management may have been pursued.
Surgical repair of PPDH is aimed at reduction of herniated viscera, closure of the diaphragmatic defect, and restoration of division between pleural (pericardial) and peritoneal cavities. There are multiple methods of repair including primary herni-orrhaphy, mesh implant, diaphragmatic flap, pericardial flap, and rectus abdominis rotational flap (2). The most common repair method is primary herniorrhaphy with either absorbable or non-absorbable suture in various patterns including simple continuous, simple interrupted, horizontal mattress and ford interlocking (2,9). This dog’s defect did not have excessive ten-sion that would have prohibited a primary herniorrhaphy repair. Had there been tension preventing the edges of the defect from meeting, an augmented repair method such as a muscular flap or mesh implant would have been required. The combination of cruciate and simple continuous patterns was used due to the conformation of the defect. The defect resembled a “T” shape with one long section adjoining a shorter, perpendicular portion (at the ventral aspect). The simple continuous pattern was used
Figure 2. Cross-section thoracic CT illustrating PPDH. A — Heart; B — Spleen; C — Small intestine; D — Stomach all in close association within the thoracic cavity and apparently contained within a common cavity (pericardium).
FOR PERSONAL USE ONLY
72 CVJ / VOL 62 / JANUARY 2021
CO
MM
UN
ICA
TIO
N É
TU
DIA
NT
E
on the longest aspect of the defect, while the cruciate pattern was used for the short edge of the “T.”
Surgical repair, although highly effective, is not without risk. The intra-operative complication rate can exceed 20% (including adhesions in 15% of patients), while post-operative complications can exceed 47% based on the largest retrospective study available (2). Post-operative mortality is an important con-sideration as well, which can exceed 8% in dogs (2). Operative complications include adhesions, arrhythmias, pericardial hemorrhage, hypothermia, hypotension, requirement of aug-mented repair method, pneumothorax, cardiac tamponade, and death (2,4,5). Post-operative complications include hemorrhage, pneumothorax, pneumopericardium, compartment syndrome, systemic inflammatory response syndrome, re-expansion pulmo-nary edema, herniorrhaphy failure, and gastrointestinal motility disorders (2,4,5,10). Despite the high prevalence of potential complications, the survival rate to discharge is high (97%) from the largest retrospective study to date (2). No postoperative com-plications were noted in this patient. The most recent follow-up with the client was 7 mo following discharge from the hospital. The owners reported that the dog was doing well at home.
This case is consistent with the high success rate of primary herniorrhaphy, and also highlights the importance of obtaining thorough histories from clients. Retrospectively, it is unlikely that this dog was experiencing respiratory distress from his PPDH and based on the available literature would have likely gone on to live a normal, healthy life without surgical interven-tion. This case also demonstrated that these patients can have a significant amount of herniated viscera, including extensive portions of the gastrointestinal system displaced without expe-riencing any gastrointestinal related clinical signs.
AcknowledgmentsI am grateful to Dr. Adam Ogilvie for his oversight and surgi-cal expertise in this case, as well as his contributions in editing this report, and to Dr. Meagan Walker for her help, especially in post-operative management. I also thank all the support staff and fellow students from the AVC VTH for their assistance with this patient. Finally, I thank the dog’s owners for permitting me to present this case. CVJ
References 1. Levine SH. Diaphragmatic hernia. Vet Clin North Am Small Anim
Pract 1987;17:411–430. 2. Morgan K, Singh A, Giuffrida MA, et al. Outcome after surgical and
conservative treatments of canine peritoneopericardial diaphragmatic her-nia: A multi-institutional study of 128 dogs. Vet Surg 2019;49:138–145.
3. Burns CG, Bergh MS, Mcloughlin MA. Surgical and nonsurgical treat-ment of peritoneopericardial diaphragmatic hernia in dogs and cats: 58 cases (1999–2008). J Am Vet Med Assoc 2013;242:643–650.
4. Nikiphorou X, Chioti R, Patsikas MN, Papazoglou LG. Peritoneoperi-cardial diaphragmatic hernia in the dog and cat. J Hellenic Vet Med Soc 2018;67:189–194.
5. Owen LJ. Peritoneal pericardial herniorrhaphy. In: Griffon D, Hamaide A, eds. Complications in Small Animal Surgery. Hoboken, New Jersey: Wiley, 2017:383–387.
6. Ettinger SJ, Feldman EC, Côté E. Textbook of Veterinary Internal Medicine: Diseases of the Dog and Cat. 8th ed. St. Louis, Missouri: Elsevier, 2017:1306–1307,
7. Legallet C, Mankin KT, Selmic LE. Prognostic indicators for periop-erative survival after diaphragmatic herniorrhaphy in cats and dogs: 96 cases (2001–2013). BMC Vet Res 2016;13:16.
8. Billen F, Day MJ, Clercx C. Diagnosis of pharyngeal disorders in dogs: A retrospective study of 67 cases. J Small Anim Pract 2006;47:122–129.
A 10-year-old spayed female miniature schnauzer was exam-ined at the ophthalmology service at the Western College
of Veterinary Medicine for evaluation of a pigmented mass of the left eye. The menace responses, palpebral, oculocephalic, and direct and consensual pupillary light reflexes were present bilaterally. Schirmer tear test (Schirmer Tear Test Strips; Alcon Canada, Mississauga, Ontario) values were 15 and 30 mm/min in the right and left eyes, respectively. The intraocular pressures were estimated with a rebound tonometer (Tonvet; Tiolat, Helsinki, Finland) and were 15 and 12 mmHg in the right and left eyes, respectively. Fluorescein staining (Fluorets; Bausch & Lomb Canada, Markham, Ontario) was negative bilaterally. On direct examination a large, raised, smooth, pigmented, non-discrete mass was present involving the dorsal limbus and extending into the adjacent cornea and sclera. Following application of 0.5% tropicamide (Mydriacyl; Alcon Canada, Mississauga, Ontario), biomicroscopic examination (SL-14; Kowa, Tokyo Japan) and indirect ophthalmoscopic (Heine Omega 20;, Heine Instruments Canada, Kitchener, Ontario) examinations were completed bilaterally. Biomicroscopic exami-nation revealed melanocytes within the aqueous humor and pig-ment spots on the anterior lens capsule of the left eye. Indirect ophthalmoscopy revealed no further abnormalities bilaterally. A photograph of the left eye at presentation is provided for your assessment (Figure 1).
What is the clinical diagnosis, differential diagnoses, therapeutic plan,
and prognosis?DiscussionThe clinical diagnosis was a melanocytic tumor of the globe. Differential diagnoses of a pigmented mass near the limbal region include: limbal melanocytoma, conjunctival melanoma or melanocytoma, extraocular extension of a uveal melanocy-toma, dermoid, ocular melanosis, staphyloma, papilloma, and pigmented squamous cell carcinoma (1). An ocular ultrasound examination was completed which showed a large mass involv-
ing the adjacent ciliary body. The clinical manifestations were therefore most consistent with extraocular extension of a uveal melanocytoma.
Uveal melanocytomas are the most common primary intra-ocular tumor in dogs (2,3). They are benign, slow growing masses originating from the iris, ciliary body, or choroid. Although they do not typically metastasize, they are expans-ile and cause compression and distortion of intraocular tis-sues (2–5). Expansion into the iridocorneal angle commonly leads to obstruction of aqueous humor outflow and secondary glaucoma (4,5). Tumors may grow outwardly through the tra-becular meshwork and appear as a nodular mass posterior to the limbus. These can be mistaken clinically as a limbal melanocy-toma (5). Differentiation between uveal and limbal tumors is based on gonioscopy and ultrasonography evaluating for uveal involvement (1,5).
Melanocytoma is the term used for behaviorally benign mela-nocytic tumors. These are usually formed by large, intensely pigmented round to polygonal (plump) melanocytes with a less conspicuous population of poorly pigmented, spindle-shaped germinal cells (2,3,5). In contrast, melanoma is the term used for potentially malignant tumors. Some studies suggest that mitotic index may be useful for predicting the potential for malignant behavior (3). Tumors with proven malignant behavior usually have a mitotic index of at least 4 and, most often, greater than 10 (2). More recently, however, tissue invasion and poor cellular differentiation in melanocytic ocular tumors have been suggested to be more reliable predictors of biological behavior than mitotic index (6). Extrascleral extension has not been shown to correlate with metastasis or local recurrence (5).
Lynne S. Sandmeyer, Stephanie Osinchuk, Marina Leis
Department of Small Animal Clinical Sciences, Western College of Veterinary Medicine, University of Saskatchewan, 52 Campus Drive, Saskatoon, Saskatchewan S7N 5B4.Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
Figure 1. Photograph of the left eye of a 10-year-old spayed female miniature schnauzer.
FOR PERSONAL USE ONLY
74 CVJ / VOL 62 / JANUARY 2021
OP
HTA
LM
OLO
GIE
DIA
GN
OS
TIQ
UE
Diode laser photocoagulation may be a successful non-invasive treatment for small discrete uveal melanocytomas (7). Sector iridectomy or iridocyclectomy may be considered to remove anterior uveal tumors that are less than 3 clock-hours in size (8). Those that are expansile, causing glaucoma, or with extraocular extension are treated by enucleation (8).
Due to the large size of the mass and extrascleral extension, eyelid function was impaired, and the dog was experiencing discomfort. Enucleation was therefore completed and the globe was submitted for histopathology. Light microscopic examina-tion revealed extensive invasion of the uvea, involving the cili-ary body and choroid, with extraocular extension through the ciliary cleft and iridocorneal angle. The mass extended below Descemet’s membrane well into the deep corneal stroma and out into the episcleral tissues. The neoplastic cells included a mixed population of predominantly intensely pigmented plump, melanocytes with laterally displaced nucleoli as well as lightly pigmented spindle cells with prominent nucleoli. Mitotic figures were uncommon. The histopathologic diagnosis confirmed the clinical diagnosis of a uveal melanocytoma with extraocular extension.
For melanocytic tumors, anatomic site and the species affected are important prognostic indicators (2,3). For example, melanocytic tumors of the feline uvea most commonly present as diffuse iris melanomas which have malignant potential (5,9). Canine and feline melanocytic tumors of the conjunctiva are also reported to have malignant potential (10,11). In contrast, melanocytic tumors of the canine uvea, limbus, and eyelid skin tend to be behaviorally benign and are associated with a reduced
rate of metastasis (2–5). The prognosis in this case was good due to species, location, and morphology of the tumor. Enucleation was curative with no local recurrence or metastasis noted.
References 1. Ledbetter EC, Gilger BC. Diseases and surgery of the canine cornea
2. Wilcock B, Dubielzig RR, Render JA. Histologic classification of ocular and otic tumors of domestic animals. Washington, DC: Armed Forces Institute of Pathology, 2002:14–28.
3. Wilcock BP, Peiffer RL, Jr. Morphology and behavior of primary ocular melanomas in 91 dogs. Vet Pathol 1986;23:418–424.
4. Bussanich NM, Dolman PJ, Rootman J, Dolman C. Canine uveal mela-nomas: Series and literature review. J Am Anim Hosp Assoc 1987;23: 415–422.
5. Grahn BH, Peiffer R, Wilcock B. Intraocular neoplasia. In: Grahn B, Peiffer R, Wilcock B, eds. Histologic Basis of Ocular Disease in Animals. Hoboken, New Jersey: John Wiley & Sons, 2019:409–441.
6. Wang AL, Kern T. Melanocytic ophthalmic neoplasms of the domestic veterinary species: A review. Top Companion Anim Med 2015;30: 148–157.
7. Cook CS, Wilke A. Treatment of presumed iris melanoma in dogs by diode laser photocoagulation: 23 cases. Vet Ophthalmol 1999;2: 217–225.
8. Hendrix DVH. Diseases and surgery of the canine anterior uvea. In: Gelatt KN, ed. Veterinary Ophthalmology. 5th ed. Ames, Iowa: Wiley-Blackwell, 2013:1146–1198.
9. Wiggans KT, Reilly CM, Kass PH, Maggs DJ. Histologic and immu-nohistochemical predictors of clinical behaviour of feline diffuse iris melanoma. Vet Ophthalmol 2016;19:44–55.
10. Schobert CS, Labelle P, Dubielzig RR. Feline conjunctival melanoma: Histopathological characteristics and clinical outcomes. Vet Ophthalmol 2010;13:43–46.
11. Collins BK, Collier LL, Miller MA, Linton LL. Biologic behavior and histologic characteristics of canine conjunctival melanoma. Prog Vet Comp Ophthalmol 1993;3:135–140.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 75
Commentary Commentaire
T here has been incessant clamor that there is a shortage of veterinarians in Canada. However, this has been mostly
anecdotal, based on conversations with veterinarians looking to hire veterinarians, or through perusal of classified sections of professional publications. Evidence to support such a case has been largely lacking until the recently completed 2020 CVMA Workforce Study (1). The shortage is claimed to be in every sec-tor of the veterinary profession and across Canada. I will leave Quebec out of this discussion, because of its unique situation.
Despite a lack of credible evidence to support the case for a shortage of veterinarians, there are many solutions being offered to address the issue. For example, a proposed panacea is to increase enrollment in veterinary colleges in Canada. After a long pause in the creation of a new veterinary college since the Ontario Veterinary College (OVC) was established (more than 150 years ago), Canada has opened 3 new colleges since the 1960s, with each opening roughly 20 years apart. This has expanded the annual number of graduating veterinarians by nearly 160, in addition to those from the OVC. Alberta’s fund-ing of 50 veterinary seats singlehandedly accounts for nearly 1/3 of non-OVC enrollment in Canada.
The other source of veterinarians in Canada has been through immigration, mostly by graduates of veterinary colleges not accredited by the Council on Education (COE) of the American Veterinary Medical Association. These veterinarians undergo a series of examinations to gain a Certificate of Qualification (CQ) from the National Examining Board (NEB) of the Canadian Veterinary Medical Association, to become qualified as veterinarians in Canada. According to NEB data, from 2007 to 2020, a total of 1150 CQ have been issued to graduates of non-COE accredited colleges (average: 88/year). This is more than the annual combined number of graduating veterinarians
from the Atlantic Veterinary College (AVC) and the University of Calgary Faculty of Veterinary Medicine (UCVM). Therefore, Canada has benefited substantially from well-crafted immigra-tion policies that attract educated professionals, in this case veterinarians, to Canada, to grow our economic enterprise and provide services for agriculture and companion animals.
In addition to immigrant veterinarians, a growing number of Canadians are pursuing veterinary medical training in Australia, New Zealand, the United Kingdom, or the US in colleges accredited by the COE. Whereas a total of 437 such veterinar-ians obtained CQ from the NEB from 2007 to 2016 (average: 43/year), there has been a major increase from 2017 to 2019 (average: 144 CQ/year). This has made a substantial contribu-tion to the supply of veterinarians in Canada.
Taken together, annual contributions of graduates of non-Canadian veterinary colleges to Canada’s veterinary supply averaged approximately 156/year from 2007 to 2019, equal to the combined annual output of AVC, the Western College of Veterinary Medicine (WCVM), and the UCVM. Although we will not know for some time, perhaps this robust supply of veterinarians is starting to mitigate the perceived shortage and will eventually balance out the demand and supply scenario.
However, if we take the argument at its face value that there is a shortage of veterinarians across all the sectors and the growing supply of veterinarians from non-Canadian veterinary colleges has not and will not mitigate the shortfall, what shall we do?
First, should another college be opened, considering many Canadians go to COE-accredited veterinary colleges in other countries? I believe there is a case to be made for that, especially in light of the success of the University of Calgary Faculty of Veterinary Medicine. The UCVM stands as an example of an innovative and courageous pedagogic model, now copied by many other colleges. It also stands out as a unique experiment in partnership with the Alberta Veterinary Medical Association and the broader veterinary community in Alberta, in the edu-cation of veterinary students. Second, addition of a college adds dozens of highly specialized basic and clinical veterinary specialists to the research and innovation sector who can work with other health professionals to solve “wicked” problems such as antimicrobial resistance, food safety, and environmental health. Yes, we do gain some efficiency by adding more students to existing programs, but that does not expand infrastructure which creates more capacity for research and disease surveillance. Lastly, co-location of veterinary medical programs with medi-cal schools, as done at Calgary, or with other programs such as
Is there really a shortage of veterinarians in Canada? If so, what are we going to do?
Baljit Singh
Dr. Singh was Dean of the Faculty of Veterinary Medicine, University of Calgary from 2016 to 2020. He has recently been appointed Vice-President, Research at the University of Saskatchewan, effective February 1, 2021.Faculty of Veterinary Medicine, University of Calgary, Calgary.Address all correspondence to Dr. Baljit Singh; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
FOR PERSONAL USE ONLY
76 CVJ / VOL 62 / JANUARY 2021
CO
MM
EN
TAIR
E
public policy or environmental sciences creates cutting-edge interdisciplinary programs.
Second, while the long-term idea of opening a new veterinary college is deliberated, provincial governments could add more seats to the existing veterinary colleges. Based on the demand for veterinarians across western Canada, British Columbia, Saskatchewan, and Manitoba could easily add 20 seats to the program at the Western College of Veterinary Medicine, and Alberta could fund an additional 10 seats at University of Calgary. Arguably, British Columbia should add 20 additional seats to the veterinary program in Saskatoon; despite having a population similar to that of Alberta, that funds 50 seats, it has traditionally funded only 20 seats per year. Therefore, the time has come for British Columbia to take its responsibility of funding veterinary medicine more seriously, considering owner-ship of a large number of animals, including thriving dairy and poultry industries.
Lastly, I have personally observed both passive and active reluctance of Canadian veterinary colleges to create any educa-tion programs for Canadian immigrants who are graduates of non-COE accredited veterinary programs; this needs to change if not for the reason of helping immigrant veterinarians then to address the issue of shortage of veterinarians. The time has come
for Canadian veterinary colleges to create a training program for Canadian immigrant veterinarians, especially in light of recent changes to the licensure pathways for veterinary medicine. This would rapidly expand the supply of veterinarians. For example, one could envision enrolling these candidates into the 4th year of a DVM program, after they have passed their two required theory examinations. If each veterinary school were to open 5 spots for such a program, the 4 colleges in English Canada could graduate a total of 20 additional veterinarians each year.
In summation, we need a combination of approaches to alle-viate the long-standing and growing shortage of veterinarians. To attain the long-term annual growth of 3.5% to 4% in the supply of veterinarians recommended in the CVMA Workforce Study (1), there is a need for close and active collaboration among provincial and federal governments, the professional veterinary organizations, and the veterinary colleges.
AcknowledgmentThe author thanks Dr. John Kastelic for editing this commentary.
Reference1. Canadian Veterinary Medical Association. 2020 CVMA Workforce Study.
Can Vet J 2020;61:821–828.
The participation of advertisers in the CVJ is an indication of their com-mitment to the advancement of veterinary medicine in Canada. We encourage our readers to give their products and services appropriate consideration. — Ed.
Le support des annonceurs démontre leur engagement pour l’avancement de la médecine vétérinaire au Canada. Nous vous encourageons à prendre connaissance de leurs services et produits. — NDLR
G uinea pigs (Cavia porcellus) are mammals belonging to the suborder Hystricomorph, 1 of the 2 main subor-
ders of rodents. This species is native to South America and was domesticated thousands of years ago as a source of meat. Currently guinea pigs are raised mainly as pets or laboratory animals. Dermatological conditions are the most commonly diagnosed pathologies in guinea pigs (1,2), with alopecia being the most prevalent clinical dermatological sign, followed by pruritus, scaling, and crusty lesions (3). Alopecia is defined as the absence of hair in an area where it is normally present. This clinical sign can be purely esthetic, or it may be a manifestation of a disease with important health consequences. As alopecia is of multifactorial etiology, it is important to obtain an accurate diagnosis in guinea pigs with this clinical sign. Treatment based on signs alone could lead to failure or only temporary improve-ment in the patient, causing frustration for both the owner and the treating veterinarian.
Clinical historyAs in other species, data collection is of utmost importance as part of an appropriate diagnostic approach. Most dermatoses in guinea pigs have a direct relationship with nutrition and management of the environment; therefore, problem-oriented veterinary records are of great importance for this species (4).
Important information to be collected (4–6):• Origin of the animal (adoption, pet shop, etc.)• Breed or type, sex, and age (juvenile, adult, geriatric, or
known date of birth)• Behavioral changes• Weight gain or weight loss• Environmental factors (area, humidity, and temperature)• Feeding and management (diet, bedding, cleaning, cage
disinfection)
Dr. Venturo is a private practice veterinarian in Lima, Peru who has special interest in veterinary dermatology and is a member of the CAVD.Address all correspondence to Dr. Renzo Venturo; e-mail: [email protected] Veterinary Dermatology column is a collaboration of The Canadian Veterinary Journal with the Canadian Academy of Veterinary Dermatology (CAVD). Established in 1986, the CAVD is a not-for-profit organization for veterinarians, veterinary technicians and technologists, and students with an interest in veterinary dermatology. Being under the umbrella of the World Association of Veterinary Dermatology, the mission of the CAVD is to advance the science and practice of veterinary dermatology in Canada by providing education and resources for veterinary teams, supporting research, and promoting excellence in care for animals affected with skin and ear disease.The CAVD invites everyone with a professional interest in dermatology to join (www.cavd.ca) and share our passion for dermatology, including continuing education in this dynamic field. Annual membership fees are: $50 for regular members and free for students.Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
Hair loss in guinea pigs
Renzo Venturo
the dermatology feature is generously sponsored by royal canin.
la rubrique sur la dermatologie est généreusement commanditée par royal canin.
FOR PERSONAL USE ONLY
78 CVJ / VOL 62 / JANUARY 2021
DE
RM
AT
OLO
GIE
VÉ
TÉ
RIN
AIR
E
• Other animals owned by the household (same or different species)
• Contagion to other animals or humans• Other clinical signs• Age at onset of alopecia• Manifestation of itching, before or after the onset of alopecia• Response to previous treatment
Clinical examinationGuinea pigs are docile, which makes their inspection easy. The initial approach consists of examining the animal from its cage to obtain information on the mental state, locomo-tion, and respiratory rate. Subsequently, it is necessary to weigh the animal, measure rectal temperature and heart rate, examine mucous membranes, and palpate peripheral lymph nodes (4,7). After the general physical examination has been completed, a careful examination of the coat should be done to look for excessive hair loss and to determine if ectoparasites are present. Alopecia may appear as focal lesions, multifocal lesions, and as large areas of total or partial hair loss. In addi-tion, dermatological lesions such as desquamation, erythema, scabs, excoriations and their distribution on the skin should be evaluated.
It should be remembered that guinea pigs have minimal or absent hair density between the nose and lips, around the lips, on the external pinna, and behind the ears (7).
Useful diagnostic testsMultiple tests can be performed when presented with a guinea pig with alopecia (Table 1). The use and order of these tests should be based on patient history, clinical examination, and established differential diagnoses.
Common causes of alopecia in guinea pigs (Table 2)
Vitamin C deficiencyGuinea pigs, like primates, do not synthesize vitamin C because they lack the enzyme L-gulonolactone oxidase, which is neces-sary for the biosynthesis of vitamin C from glucose (10). Guinea pigs deficient in vitamin C negatively regulate the expression of type IV collagen and elastin, resulting in defects in the integrity of the blood vessels, leading to bleeding or bruising of the skin. Vitamin C deficiency can also affect other organs and reduce immune function (10–12). Guinea pigs need vitamin C in their diet, with an absolute requirement of 10 mg/kg body weight (BW) per day, increasing to 30 mg/kg BW per day during pregnancy (5). Hypovitaminosis C should be considered as a potential underlying factor in bacterial, fungal, or parasitic skin diseases. Cutaneous clinical signs such as alopecia (Figure 1), rough hair, peeling of the ears, petechiae, ecchymosis, and bruis-ing may be present, as well as multiple nonspecific signs, such as weight loss, anorexia, reduced growth rate, stiff or crawling gait, lameness, bleeding gums, diarrhea, pain (manifested by teeth grinding or excessive vocalization), poor wound healing, or even death (5,7,10). The diagnosis is made based on the clinical history including systemic and dermatological signs, diagnostic tests and previous therapeutic results. Radiographs are useful in revealing alterations in the costochondral junctions and widening of the epiphyses of the long bones. Serum Vitamin C levels can be used to confirm the diagnosis (3,10,12). Treatment consists of correction of clinical signs, diet, and vitamin C supplementation of 50 mg/kg BW to 100 mg/kg BW daily parenterally until signs improve. The same dose is subsequently administered orally. Once the animal has returned to normal, dietary supplementation is continued (5,10,12).
Table 1. Diagnostic tests for diagnosis of alopecia in guinea pigs.
Diagnostic testsa Comments
Hair plucks and Identification of self-induced alopecia, trichograms observation of ectoparasites (lice, mites),
postpartum effluvium (telogen hairs), observation of dermatophyte spores
Tape strips Observation of ectoparasites (lice, mites)
Cytology Morphological identification of infectious microorganisms, observation of inflammatory cells, approach to neoplasms
Skin scrapes Identification of ectoparasites
Fungal culture Identification of dermatophytes; the toothbrush technique is useful
Bacterial cultures and Bacterial identification and antibiotic antibiogram sensitivity
Biopsy Dermatophytosis, neoplasms
Imaging (ultrasound, Detection of ovarian cysts, neoplasms, X-ray) hypovitaminosis Ca Useful tests in alopecia in guinea pigs (2,4,5,7–10). Note: Wood’s lamp is not a
useful diagnostic test in guinea pigs.
Table 2. Causes of alopecia in guinea pigs.
Causes of non-self-induced alopecia Causes of self-induced alopecia
Barbering (caused by other Acariasis (Chirodiscoides caviae, guinea pigs) Trixacarus caviae, Ornithonyssus
Dermatophytosis (ringworm)Dermatophytes are filamentous keratinophilic fungi, which generally affect the hair, nails, and keratinized layers of the skin. These fungi are a common cause of skin disease in guinea pigs (13). The incidence of this zoonosis has now increased in guinea pig owners (14). Dermatophyte species belonging to the Trichophyton mentagrophytes complex are mainly reported (7). Very young, old, or immunosuppressed animals are susceptible to infection; however, in healthy animals, spontaneous resolu-tion is common (13). Alopecia is the most frequent clinical sign of this pathology, followed by scabs and scaling, with a more prevalent distribution on the head and face (Figure 2). However, it can affect other areas of the body less frequently, including legs, and flanks of the abdomen. Moderate to severe itching may be present or absent. Without pruritus, the animal may not exhibit dermatological signs and may remain asymptom-atic (4,9,14). Since T. mentagrophytes complex dermatophytes
do not emit fluorescence under ultraviolet light, the diagnostic value of Wood’s lamp is limited in guinea pigs. Direct exami-nation of hairs, fungal cultures, and histopathology (including periodic acid Schiff, Grocott’s Methenamine Silver staining), however, are useful for the diagnostic approach to dermatophy-tosis in this species (2,5,7,13). As treatment, topical products containing chlorhexidine, miconazole, enilconazole or systemic pharmacotherapy such as terbinafine 20 mg/kg BW, PO, q24h, and itraconazole 5 mg/kg BW, PO, q24h are effective in guinea pigs affected with dermatophytosis (5,7).
AcariasisTrixacarus caviae is the most common mite found in guinea pigs, being reported mainly in males and juveniles (1,3). It is a sarcoptiform parasite that generates severe clinical signs and zoonotic potential (2,7). These mites burrow into the skin, cre-ating epidermal tunnels and eliciting a cell-mediated immune response that causes itching (8). Clinical signs are often severe itching (giving the appearance of seizures or spastic movements), generalized alopecia (Figure 3), hyperkeratosis, erythema, and
Figure 1. Hypovitaminosis C. Note the presence of alopecia and petechiae.
Figure 2. Dermatophytosis.
Figure 3. Trixacarus caviae infestation.
Figure 4. Skinny pigs. The skinny pig owes its origin to the crossing of hairy guinea pigs and hairless guinea pigs, the latter comes from a strain related to a genetic mutation identified in 1978 in Canada.
FOR PERSONAL USE ONLY
80 CVJ / VOL 62 / JANUARY 2021
DE
RM
AT
OLO
GIE
VÉ
TÉ
RIN
AIR
E
secondary pyoderma (2,3,8). Acariasis is primarily diagnosed in animals from pet stores (4). Diagnosis can be made by skin scraping or acetate tape impressions (3). Treatments include: ivermectin 0.4 mg/kg BW, SC, every 10 to 14 d for 4 treat-ments; selamectin 15 mg/kg BW, single topical dose; or aerosol products such as fipronil or permethrin (7,8).
Chirodiscoides caviae is another species-specific mite very common in guinea pigs (7). Physical contact and the tendency to gather in the presence of any potential predator facilitates its transmission, with many cases of animals from pet stores being reported (15). The life cycle of C. caviae is approximately 14 d. As clinical signs, guinea pigs present erythema, rough hair coat, pruritus, alopecia, scaling, and ulcers, although some patients may remain asymptomatic for long periods of time (16). Chirodiscoides caviae is found mainly in the flank and trunk area, and the diagnostic techniques that have been used are: trichogram, acetate tape impression, brushing, and scrap-ing (2,15). Effective treatments include subcutaneous ivermectin at a dose of 0.2 to 0.4 mg/kg BW, q7 to 10d for 3 treatments; topical selamectin at a dose of 12 to 15 mg/kg BW, q2wk; and, single topical application of 0.05 mL of moxidectin 1% and imidacloprid 10% (15).
PediculosisGliricola porcelli, the most prevalent louse in guinea pigs, is grayish-yellow in color, and measures between 1 and 2 mm in length. These lice feed on skin debris, being found mainly on the neck, ears, and ventral abdomen. Its life cycle is about 14 to 21 d. Clinical signs of infestation are variable, with pruritus and rough fur being common symptoms. The animal may remain asymptomatic without significant pruritus. Diagnosis can be made by direct visualization of eggs or lice using acetate tape and/or flea combing (3,11,17). Treatment options include sub-cutaneous ivermectin 0.2 to 0.4 mg/kg BW, q10d for 3 treat-ments; or, single topical application of 0.05 mL of moxidectin 1% and imidacloprid 10% (5,15,17).
Ovarian cystsOvarian cysts are a common finding in middle-aged to older guinea pigs. In most cases, both ovaries are affected, although unilateral cases are also seen with the right ovary being more commonly affected (18). This disorder has a reported prevalence of 76% in female guinea pigs aged 1.5 to 5 y (12). The most common clinical sign, often observed by owners, is progressive hair loss in the flank region and abdomen, without itching or abnormal appearance of the skin. Hair loss is presumed to be the result of increased levels of estrogen produced by neoplas-tic ovarian cysts or steroidogenic follicular cysts. In addition, crusting of the skin around the nipples, changes in behavior (gathering in groups, aggression, sexual behaviors) may be
present along with non-specific systemic clinical signs of loss of appetite, lethargy, or vocalization when manipulated. Some ani-mals may be asymptomatic and cysts may be found incidentally at necropsy (5,6,12). Diagnosis is based on the clinical history, abdominal palpation, imaging techniques such as radiography and ultrasound. The cysts can be up to 10 cm in size and tender on palpation. In some cases, they are associated with concur-rent cystic endometrial hyperplasia, mucometra, endometritis, and fibroleiomyoma (5). Surgical treatment is by ovariohyster-ectomy and is the treatment of choice. Oophorectomy is not recommended because ovarian cysts are associated with multiple uterine diseases (6).
References 1. Minarikova A, Hauptman K, Jeklova E, Knotek Z, Jekl V. Diseases
in pet guinea pigs: A retrospective study in 1000 animals. Vet Rec 2015;177:200.
2. Palmeiro BS, Roberts H. Clinical approach to dermatologic disease in exotic animals. Vet Clin Exot Anim 2013;16:523–577.
3. White SD, Sanchez-Migallon D, Paul-Murphy J, Hawkins MG. Skin diseases in companion guinea pigs (Cavia porcellus): A retro-spective study of 293 cases seen at the Veterinary Medical Teaching Hospital, University of California at Davis (1990–2015). Vet Dermatol 2016;27:1–8.
4. Mitchell MA, Tully TN. Current Therapy in Exotic Pet Practice. 1st ed. St. Louis, Missouri: Elsevier, 2016:1–47.
5. Paterson S. Skin diseases and treatment of guinea pigs. In: Paterson S, eds. Skin Diseases of Exotic Pets. 1st ed. Oxford, UK: Blackwell Science, 2006:232–250.
6. Bean AD. Ovarian cysts in the guinea pig (Cavia porcellus). Vet Clin Exot Anim 2013;16:757–776.
7. Pignon C, Mayer J. Guinea pig. In: Quesenberry KE, Orcutt CJ, Mans C, Carpenter JW, eds. Ferrets, Rabbits, and Rodents Clinical Medicine and Surgery. 4th ed. St. Louis, Missouri: Elsevier, 2020:270–297.
8. Donnelly TM. Pruritus and alopecia in guinea pigs. Trixacarus caviae infestation. Lab Animal 2004;33:21–23.
9. Bartosch T, Frank A, Günther C, et al. Trichophyton benhamiae and T. mentagrophytes target guinea pigs in a mixed small animal stock. Vet Mycol 2019;23:37–42.
10. Meredith A. Hypovitaminosis C in the Guinea pig (Cavia Porcellus). Companion Animal 2006;11:81–82.
11. Ellis C, Mori M. Skin diseases of rodents and small exotic mammals. Vet Clin North Am Exot Anim Pract 2001;4:493–542.
12. Riggs SM. Guinea pigs. In: Mitchell MA, Tully TN, eds. Manual of Exotic Pet Practice. 1st ed. St. Louis, Missouri: Saunders Elsevier, 2009:456–473.
13. Donnelly TM, Rush EM, Lackner PA. Ringworm in small exotic pets. Semin Avian Exot Pet Med 2000;9:82–93.
14. Kraemer A, Hein J, Heusinger A, Mueller RS. Clinical signs, therapy and zoonotic risk of pet guinea pigs with dermatophytosis. Mycoses 2013;56:168–172.
15. D’Ovidio D, Santoro D. Prevalence of fur mites (Chirodiscoides caviae) in pet guinea pigs (Cavia porcellus) in southern Italy. Vet Dermatol 2014;25:135–137.
16. Schönfelder J, Henneveld K, Schönfelder A, Hein J, Müller R. Concurrent infestation of Demodex caviae and Chirodiscoides caviae in a guinea pig. A case report. Tierärzt Prax 2010;38:28–30.
17. Kim SH, Jun HK, Yoo MJ, Kim DH. Use of a formulation containing imidacloprid and moxidectin in the treatment of lice infestation in guinea pigs. Vet Dermatol 2008;19:187–188.
18. Pilny A. Ovarian cystic disease in guinea pigs. Vet Clin Exot Anim 2014;17:69–75.
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 81
Veterinary Practice Management Gestion d’une clinique vétérinaire
Adapting your practice to COVID-19
S’adapter durant la pandémie de COVID-19
Darren Osborne
O ver the last several months, the move to curbside medicine has helped to ensure the safety of our staff and clients;
however, social distancing measures have come at the expense of efficiency and human resources. Following are some ideas, tips, and advice on how to improve your practice management during the pandemic. 1. Fire clients. The top priority for veterinary hospitals is
keeping staff safe. This is clearly evident with the move to curbside medicine and vigilant use of personal protective equipment (PPE), but these policies only protect physical health and don’t address the mental health risk. Consider a client code of conduct to protect staff from aggressive or unreasonable clients. If a client raises their voice, uses profane or offensive language, they should be warned to cease the behavior. If it continues, the staff member should excuse themself, leave the area or hang up the phone, and report the problem to their supervisor. If the offending client does not immediately remedy their behavior, they should be informed that they are no longer welcome at the hospital. Firing those clients who are abusive to your team shows staff that you have their backs and goes a long way towards building loyalty.
A u cours des derniers mois, le passage aux consultations sans la présence physique des propriétaires d’animaux a contri-
bué à assurer la sécurité du personnel et des clients; cependant, les mesures de distanciation sociale se sont faites au détriment de l’efficacité et des ressources humaines. Voici quelques idées, astuces et conseils pour améliorer la gestion de votre pratique pendant la pandémie. 1. Congédiez des clients. La priorité absolue des établisse-
ments vétérinaires doit être d’assurer la sécurité de leur personnel. C’est évidemment ce que vous faites avec la prise en charge des animaux à l’extérieur de la clinique et l’uti-lisation vigilante d’équipement de protection individuelle, mais ces politiques ne protègent que la santé physique de vos employés et n’écartent pas les risques pour leur santé mentale. Envisagez de mettre en œuvre un code de conduite du client pour protéger votre personnel contre les clients agressifs ou déraisonnables. Si un client élève la voix ou utilise un langage grossier ou offensant, il devrait être averti de cesser ce comportement immédiatement. S’il continue, le membre du personnel devrait mettre poliment fin à la conversation, s’éloigner ou raccrocher le téléphone, et signaler le problème à son supérieur. Si le client ne change
Darren Osborne has been the Director of Economic Research for the Ontario Veterinary Medical Association for 20 years. He completed an MA (Economics) from York University and has worked as an economic analyst in veterinary medicine, dentistry, human medicine, and the transport industry.Address all correspondence to Darren Osborne, e-mail [email protected] article is provided as part of the CVMA Business Management Program, which is co-sponsored by IDEXX Laboratories, Petsecure Pet Health Insurance, Merck Animal Health, and Scotiabank.Address all correspondence to the CVMA Business Management Advisory Group; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.
Darren Osborne est directeur de la recherche économique pour l’OVMA (Ontario Veterinary Medical Association) depuis 20 ans. Il a obtenu une maîtrise en économie de l’Université York et a travaillé comme analyste économique en médecine vétérinaire, en médecine dentaire, en médecine humaine et dans l’industrie des transports.Envoyez toute correspondance à Darren Osborne ([email protected]).Le présent article est rédigé dans le cadre du Programme de gestion commerciale de l’ACMV, qui est cocommandité par IDEXX Laboratories, Petsecure assurance maladie pour animaux, Merck Santé animale et la Banque Scotia.Veuillez adresser toute correspondance au Groupe consultatif de la gestion commerciale de l’ACMV ([email protected]).L’usage du présent article se limite à un seul exemplaire pour étude personnelle. Les personnes intéressées à se procurer des réimpressions devraient communiquer avec le bureau de l’ACMV ([email protected]) pour obtenir des exemplaires additionnels ou la permission d’utiliser cet article ailleurs.
FOR PERSONAL USE ONLY
82 CVJ / VOL 62 / JANUARY 2021
GE
ST
ION
D’U
NE
CL
INIQ
UE
VÉ
TÉ
RIN
AIR
E
pas d’attitude, il devrait être informé qu’il n’est plus le bienvenu à la clinique. Le fait de renvoyer les clients qui malmènent votre équipe montre à vos employés que vous avez leur bien-être à cœur et contribue grandement à accroître leur loyauté.
2. Donnez à votre personnel accès à un service de soutien. Il peut être difficile pour vos employés de composer avec tous les stress auxquels ils sont soumis en dehors de leur travail. Tous ceux qui ont des enfants vivent avec des préoccupa-tions additionnelles comme les exigences de l’école et de la garderie, les tests de dépistage de la COVID-19, l’auto-isolement, ainsi que la sécurité d’emploi et les revenus et du ménage. Le programme d’aide aux employés ARIVE de l’ACMV offre du soutien pour relever tous les défis de la vie. Il est offert aux employés assurés en vertu du régime d’avantages sociaux des employés de l’ACMV dont la police comprend l’accès à ce programme.
3. Décompressez. Vivre avec la distanciation sociale est stres-sant. Avant que la pression soit trop forte, organisez une activité courte mais amusante qui donnera aux employés la possibilité de décompresser. Ainsi, ils pourront faire une pause et oublier leur travail et leurs soucis pendant quelques minutes. Quelque chose d’aussi simple qu’un dîner avec de la pizza ou la célébration d’un anniversaire en respectant la distanciation physique ne vous fera pas prendre trop de retard et peut aider à réduire le niveau de stress de toute l’équipe.
4. Élaborez un protocole de santé et de sécurité pour la prise en charge des animaux à l’extérieur pendant les mois d’hiver. Protégez les membres de votre personnel dans leur nouvel environnement hivernal en enlevant la neige et la glace de leur nouveau poste de travail à l’extérieur de l’établissement. Assurez-vous qu’ils aient des pelles à neige et du sel à leur disposition, ainsi qu’un protocole à suivre précisant qui est responsable de garder cet endroit dégagé.
5. Embauchez une autre réceptionniste. De nombreux propriétaires et gestionnaires de pratique se concentrent sur l’embauche de médecins vétérinaires et de techniciens en santé animale. Pensez à engager une autre réceptionniste afin de libérer du temps pour les techniciens et les médecins vétérinaires déjà en poste. Une réceptionniste supplémen-taire peut réduire le nombre d’appels à retourner en répon-dant au téléphone qui sonne constamment et diminuer le nombre d’absences en confirmant les rendez-vous prévus, en plus d’aider à faire la navette pour emmener les animaux et transporter les produits de l’établissement vétérinaire aux voitures des clients et vice versa.
6. Haussez vos prix. Le nombre de clients a augmenté, tout comme le coût de la prestation des soins vétérinaires. L’économie n’a pas (encore) changé pour de nombreux clients, et beaucoup de médecins vétérinaires ont signalé que les clients sont moins sensibles aux prix parce qu’ils ont plus d’économies étant donné qu’ils ne partent pas en vacances, ne vont pas au restaurant et travaillent à partir de la maison. La plupart des clients reconnaissent les efforts supplémentaires déployés par les médecins vétérinaires et leur personnel en matière de distanciation et de service
2. Give your staff access to counselling. Dealing with all the stresses people encounter outside of practice can be challenging at the best of times. Anyone with kids now has a whole new level of stressors with school and daycare requirements, COVID testing, self quarantine, and the household’s income and job security. The CVMA’s ARIVE Employee Assistance Program offers counselling to help with all of life’s challenges. The service is available to employees insured under the CVMA Employee Benefits Plan, with the employee assistance program benefit.
3. Let off some steam. Coping in a socially distanced world is stressful. Before pressure builds to a breaking point, engage staff in a short but fun activity that gives them a chance to relax. They can take a break from the rigors of work and forget the world is ending for a few minutes. Something as simple as a pizza lunch or a socially distanced birthday celebration will not put you too far behind and can help lower the stress meter.
4. Develop a health and safety protocol for curbside medi-cine during the winter months. Protect staff in their new winter environment by clearing snow and ice from their new curbside workstation. Have snow shovels and salt avail-able alongside a protocol on who is responsible for keeping the area clean.
5. Hire another receptionist. Many practice owners and managers are focusing on hiring veterinarians and certified technicians. Consider hiring another receptionist to free up existing technician and veterinary time. An additional receptionist can reduce the volume of call-backs required by answering the constantly ringing phone, prevent no-shows by confirming scheduled appointments, and help shuttle pets and products to and from client vehicles in the parking lot.
6. Raise your fees. The number of clients has gone up but so has the cost of delivering veterinary medicine. The economy has not changed (yet) for many clients and several veterinarians have reported clients are less price sensitive because they have additional savings from not going on vacation, not going to restaurants, and working from home. Most clients recognize the extra effort put in by veterinar-ians and staff with social distancing and curbside service and would not balk at a fee increase. One big advantage to increasing fees now is the timing; this insulates you from raising your fees during difficult economic times, which could be around the corner.
7. Rent a portable point-of-sale (POS) terminal. Bank fees have shot up in most hospitals. Banks, like many other ser-vice providers are raising fees to cover their increased costs, but there is one area in which you can directly impact this expense. Inputting payment over the phone is considered a “card not present” transaction and there is typically an additional fee. According to Marc Milewski from Blue Pay, “card not present” costs range from 0.2% to 1% which can result in a veterinary hospital paying thousands of dollars in extra fees. One simple solution is to rent a portable POS terminal for $35 a month and use the terminal for curbside transactions. In addition to saving thousands of dollars in
FOR PERSONAL USE ONLY
CVJ / VOL 62 / JANUARY 2021 83
VE
TE
RIN
AR
Y P
RA
CT
ICE
MA
NA
GE
ME
NT
fees, a portable POS will save receptionists the phone calls required to clients in their cars to get payment informa-tion. Most curbside transactions already require staff to come into some contact with clients, such as when they collect the pet, so there is little added risk in introducing a portable POS.
8. Implement technician appointments. Some veterinary hospitals are coping with the difficulty in hiring associate veterinarians by using veterinary technicians to conduct appointments. A whole day of technician appointments handling parasite testing and treatment, rechecks, and booster vaccinations can free up a lot of veterinarian time, to be redirected elsewhere.
9. Use MyVetStore for automatic food reordering. Admittedly, many hospitals are too busy to invest in a new service like automatic reorder, but MyVetStore is probably one of the best investments a veterinary hospital can make
to secure long-lasting, hassle-free dietary sales. Taking a few precious minutes to sign a client up for automatic reorder-ing on their pet’s diet can save more time down the road and improve safety by eliminating in-person transactions every month. Financially, it is a win because there is clear evidence that automatic reorder increases compliance on diet sales.
10. Telemedicine. As an adjunct service to conventional veteri-nary care, telemedicine can keep a schedule flowing during times of restricted access. According to a recent Ontario survey of pet owners, 75% had their issue resolved during a pet-absent telemedicine consult. Offering the option of telemedicine or in-person consultations may be part of the new reality with COVID but can also be a viable option during times of inclement weather or for clients who have had success with a telemedicine consult. ■
à l’extérieur de l’établissement, et ne s’opposeraient pas à une augmentation des frais. Un grand avantage d’une augmentation des tarifs faite dès maintenant serait son caractère opportun – ainsi, vous n’auriez pas à hausser vos prix durant une période économique plus difficile, qui pourrait être imminente.
7. Louez un terminal de point de vente (PDV) portable. Les frais bancaires ont grimpé en flèche pour la plupart des éta-blissements vétérinaires. Les institutions financières, comme de nombreux autres prestataires de services, augmentent les frais pour couvrir leurs charges opérationnelles plus élevées, mais il y a une portion de ces frais que vous pouvez faire diminuer. En effet, le paiement par téléphone est considéré comme une transaction à saisie manuelle « sans carte » et il y a généralement des frais supplémentaires. Selon Marc Milewski de Blue Pay, les frais pour ce type de transaction varient de 0,2 à 1 %, ce qui peut représenter des milliers de dollars de frais supplémentaires pour l’établissement vétérinaire. Une solution simple consiste à louer un ter-minal de point de vente portable pour 35 $ par mois et à utiliser ce terminal pour les transactions avec les clients qui restent à l’extérieur de la clinique. En plus de vous faire économiser, un terminal portable libérera les réceptionnistes qui n’auront plus à appeler les clients dans leur voiture pour obtenir le paiement. La plupart des transactions qui se font à l’extérieur de l’établissement exigent déjà qu’un membre du personnel entre en contact avec le client, par exemple lorsqu’il ramène l’animal; l’utilisation d’un termi-nal portable n’entraîne donc pas nécessairement de risque supplémentaire.
8. Offrez des rendez-vous avec les techniciens. Dans certains établissements vétérinaires, on compose avec la pénurie de médecins vétérinaires en offrant des rendez-vous avec les techniciens en santé animale. Une journée entière de
rendez-vous avec un technicien chargé du dépistage et du traitement des parasites, des réévaluations et des vaccina-tions de rappel peut libérer beaucoup de temps pour les médecins vétérinaires, que ces derniers peuvent alors utiliser à d’autres fins.
9. Utilisez le programme « Ma vitrine vétérinaire » pour le renouvellement automatique des commandes de nourri-ture. Même si vous estimez être trop occupé pour investir dans un nouveau service comme le réapprovisionnement automatique, le programme « Ma vitrine vétérinaire » est probablement l’un des meilleurs investissements qu’une pratique puisse faire pour garantir des ventes de nourriture récurrentes et sans tracas. Prendre quelques précieuses minutes pour inscrire un client au renouvellement automa-tique de sa commande de nourriture pour son animal peut vous faire sauver du temps à long terme tout en améliorant la sécurité pour votre personnel et votre client en éliminant les transactions en personne tous les mois. Le programme est aussi avantageux sur le plan financier, car il est évident que le réapprovisionnement automatique augmente l’obser-vance de vos recommandations concernant la diète de vos patients.
10. Adoptez la télémédecine. En tant que service complémen-taire aux soins vétérinaires conventionnels, la télémédecine peut maintenir un horaire fluide pendant les périodes d’accès restreint. Selon un récent sondage mené en Ontario auprès de propriétaires d’animaux, 75 % des répondants ont vu leur problème résolu lors d’une consultation de télémédecine. Offrir au client la possibilité de choisir entre une consultation en personne ou en télémédecine peut faire partie de la nouvelle réalité avec la COVID-19, mais peut également être une option viable pendant les périodes de mauvais temps ou pour les clients qui ont eu une expérience positive avec la télémédecine. ■
FOR PERSONAL USE ONLY
84 CVJ / VOL 62 / JANUARY 2021
Classifieds Petites annonces
Business Directory Annuaire des entreprisesAvoid the pitfalls of a corporate offer
Veterinary Practice Sales & Valuations
Considering a corporate sale?Partner with the industry leader to maximize
your transaction
Practice Valuations ∙ Practice Sales ∙ BuyerAgency ∙ Sale Facilitation519-383-4438 I simmonsinc.com
• Practice Management Agreements• Incorporations• Employment Matters• Discipline Proceedings and Malpractice Defence• Buying and Selling a Practice
