The Cold-Induced Two-Component System CBO0366/CBO0365Regulates Metabolic Pathways with Novel Roles in Group IClostridium botulinum ATCC 3502 Cold Tolerance
Elias Dahlsten,a Zhen Zhang,a Panu Somervuo,a Nigel P. Minton,b Miia Lindström,a Hannu Korkealaa
‹Department of Food Hygiene and Environmental Health, Faculty of Veterinary Medicine, University of Helsinki, Helsinki, Finlanda; Clostridia Research Group, Centre forBiomolecular Sciences, School of Molecular Medical Sciences, University of Nottingham, Nottingham, United Kingdomb
The two-component system CBO0366/CBO0365 was recently demonstrated to have a role in cold tolerance of group I Clostrid-ium botulinum ATCC 3502. The mechanisms under its control, ultimately resulting in increased sensitivity to low temperature,are unknown. A transcriptomic analysis with DNA microarrays was performed to identify the differences in global gene expres-sion patterns of the wild-type ATCC 3502 and a derivative mutant with insertionally inactivated cbo0365 at 37 and 15°C. Alto-gether, 150 or 141 chromosomal coding sequences (CDSs) were found to be differently expressed in the cbo0365 mutant at 37 or15°C, respectively, and thus considered to be under the direct or indirect transcriptional control of the response regulatorCBO0365. Of the differentially expressed CDSs, expression of 141 CDSs was similarly affected at both temperatures investigated,suggesting that the putative CBO0365 regulon was practically not affected by temperature. The regulon involved genes related toacetone-butanol-ethanol (ABE) fermentation, motility, arsenic resistance, and phosphate uptake and transport. Deterioratedgrowth at 17°C was observed for mutants with disrupted ABE fermentation pathway components (crt, bcd, bdh, and ctfA), arse-nic detoxifying machinery components (arsC and arsR), or phosphate uptake mechanism components (phoT), suggesting rolesfor these mechanisms in cold tolerance of group I C. botulinum. Electrophoretic mobility shift assays showed recombinantCBO0365 to bind to the promoter regions of crt, arsR, and phoT, as well as to the promoter region of its own operon, suggestingdirect DNA-binding transcriptional activation or repression as a means for CBO0365 in regulating these operons. The resultsprovide insight to the mechanisms group I C. botulinum utilizes in coping with cold.
Understanding the mechanisms by which food-borne patho-genic microorganisms cope with stress conditions they en-
counter in foods is of key importance in designing modern foodsafety measures. The ability of the anaerobic Gram-positive spore-forming Clostridium botulinum to survive, grow, and subse-quently produce the extremely potent botulinum neurotoxin infoods (1) raises substantial concern over food safety (2, 3). Expo-sure of bacteria to sublethal stress can result in increased robust-ness and (cross-)protection toward harsher treatments, thus cre-ating challenges in classical hurdle design in food processing (4).Identification of key mechanisms behind response and adaptationto the environmental hurdles C. botulinum encounters in the foodchain could potentially allow development of targeted controlmeasures.
Bacteria utilize two-component systems (TCSs) to sense en-vironmental stimuli and activate adaptive mechanisms neededfor survival and subsequent growth (5). The typical assembly ofa TCS consists of a membrane-bound sensor histidine kinase,which senses a defined signal and undergoes a conformationalchange, phosphorylating its cognate response regulator protein(reviewed in reference 6). The activated response regulatorsubsequently induces transcription of genes required for sur-vival in the situation at hand or represses genes that are unnec-essary or even detrimental.
The role of TCSs in response and adaptation to low temperatureshas been demonstrated in several prokaryotes. Most notably, theDesK/DesR TCS of Bacillus subtilis has been shown to respond to atemperature downshift and subsequently activate the transcription ofan O2-dependent membrane lipid desaturase-encoding des, resultingin increased membrane fluidity (7, 8). In addition, cold-related TCSs
have been identified in Listeria monocytogenes (9), Haemophilus in-fluenzae (10), the archaeon Methanolobus psychrophilus R15 (11), andYersinia pseudotuberculosis (12).
As for C. botulinum, the reports regarding machineries relatedto sensing and adapting to low temperature are scarce. The coldshock protein CspB was shown to be important in cold toleranceof C. botulinum ATCC 3502 (13) and, recently, the TCS CBO2306/CBO2307 was shown to have an important role in cold adaptationin this organism (14). In addition, we have shown the TCSCBO0366/CBO0365 of C. botulinum ATCC 3502 to be inducedupon temperature downshift (15); furthermore, insertional inac-tivation of either of the TCS genes resulted in a cold-sensitivephenotype (15). However, the mechanisms through which thisTCS exerts cold tolerance in C. botulinum are unknown.
To further characterize the role of CBO0366/CBO0365 in coldshock response and cold tolerance of C. botulinum ATCC 3502,transcriptomic analysis of the differences in global gene expres-sion between wild-type and cbo0365 mutant cultures at optimaland low temperatures was performed to identify genes putativelyunder transcriptional control of the CBO0365 response regulator.In addition, several differentially expressed genes, together withgenes encoding components of related metabolic pathways, were
Received 23 September 2013 Accepted 21 October 2013
mutated. The growth of these mutants at low temperatures wasinvestigated to gain insight into the possible role of the mutatedpathways under cold stress. Electrophoretic mobility shift assays(EMSAs) were carried out with recombinant CBO0365 protein toconfirm direct regulation of several operons by the CBO0365 reg-ulator.
MATERIALS AND METHODSConstruction of mutant strains. C. botulinum ATCC 3502 (group I, typeA) was used as a parent strain in the present study. An insertional knock-out mutant for cbo0365 was constructed using the ClosTron technology(16) by Lindström et al. (15). Insertional inactivation of genes cbo0751,cbo0753, cbo1407, cbo2525, cbo2847, cbo3199, and cbo3202 was similarlyaccomplished with the ClosTron technology, with de novo synthesizedintron targeting regions (DNA2.0, Inc., Menlo Park, CA) cloned into theClosTron pMTL007C-E2 vector (17, 18). The intron insertion sites andorientations for the mutant strains are presented in Table 1, and the prim-ers used for confirmation of the insertion site and orientation are de-scribed in Table 2. Single intron insertion was confirmed by Southernblotting with a probe targeted to the erm resistance marker within theinserted DNA fragment as described previously (20). A single intron in-sertion was similarly demonstrated for the previously constructedcbo0365 mutant.
Culture conditions. For RNA isolation for DNA microarray, quanti-tative real-time PCR and non-quantitative reverse transcription-PCR ex-periments, the bacterial cultures were anaerobically grown at 37°C inTPGY medium until the optical density at 600 nm (OD600) reached 1.0,and the cultures were subjected to rapid temperature downshift to 15°C.Samples for total RNA isolation were withdrawn from the cultures imme-diately before the temperature downshift, and after 1 h anaerobic incuba-tion at 15°C. The experiment was performed as three independent biolog-ical replicates.
Growth experiments to compare the growth of the ATCC 3502 wild-type and mutant strains were performed in an automatic turbidity reader(Bioscreen C Microbiology Reader; Growth Curves, Helsinki, Finland)placed in an anaerobic workstation with an internal atmosphere of 85%N2, 10% CO2, and 5% H2 (MK III; Don Whitley Scientific, Ltd., Shipley,United Kingdom) as described previously (21). Strains were grown inthree to five biological replicates in TPGY broth at 37°C for 24 h or at 17°Cfor 7 days or in TPGY broth supplemented with 0.1 mM sodium arseniteat 37°C for 2 days and at 20°C for 10 days. The OD600 of the cultures wasautomatically monitored at regular intervals. Growth curves were con-structed by plotting the OD600 of each culture against time.
RNA extraction. Samples from three replicate C. botulinum ATCC3502 wild-type or cbo0365 mutant cultures were collected at the timepoints described above for total RNA isolation. The samples were col-lected into sterile plastic tubes containing ice-cold ethanol-phenol (9:1)
TABLE 1 Strains and plasmids used in this study
Strain or plasmid Relevant properties Source or reference
Bacterial strainsC. botulinum
ATCC 3502 Wild-type parental strain ATCCa
ATCC 3502 cbo0365::intron 48|49S Insertional disruption of cbo0365 at base 48 in sense orientation, erm 15ATCC 3502 cbo0751::intron 254|255AS Insertional disruption of cbo0751 at base 254 in antisense orientation, erm This studyATCC 3502 cbo0753::intron 196|197AS Insertional disruption of cbo0753 at base 196 in antisense orientation, erm This studyATCC 3502 cbo1407::intron 428|429AS Insertional disruption of cbo1407 at base 428 in antisense orientation, erm This studyATCC 3502 cbo2525::intron 122|123AS Insertional disruption of cbo2525 at base 122 in antisense orientation, erm This studyATCC 3502 cbo2847::intron 509|510AS Insertional disruption of cbo2847 at base 509 in antisense orientation, erm This studyATCC 3502 cbo3199::intron 467|468AS Insertional disruption of cbo3199 at base 467 in antisense orientation, erm This studyATCC 3502 cbo3202::intron 167|168AS Insertional disruption of cbo3202 at base 167 in antisense orientation, erm This study
E. coliCA434 Conjugation donor University of NottinghamRosetta 2(DE3)/pLysS Recombinant expression host, pRARE2 encoding seven rare tRNAs, catP Novagen, Darmstadt,
Germany
PlasmidspMTL007C-E2 ClosTron plasmid, catP, L1.LtrB intron with ermB RAM, constitutive
intron expression under fdx promoterUniversity of Nottingham
(19)pMTL007C-E2::cbo0751-254|255AS pMTL007C-E2 with L1.LtrB retargeted to base 254 of cbo0751 in
antisense orientationThis study
pMTL007C-E2::cbo0753-196|197AS pMTL007C-E2 with L1.LtrB retargeted to base 196 of cbo0753 inantisense orientation
This study
pMTL007C-E2::cbo1407-428|429AS pMTL007C-E2 with L1.LtrB retargeted to base 428 of cbo1407 inantisense orientation
This study
pMTL007C-E2::cbo2525-122|123AS pMTL007C-E2 with L1.LtrB retargeted to base 122 of cbo2525 inantisense orientation
This study
pMTL007C-E2::cbo2847-509|510AS pMTL007C-E2 with L1.LtrB retargeted to base 509 of cbo2847 inantisense orientation
This study
pMTL007C-E2::cbo3199-467|468AS pMTL007C-E2 with L1.LtrB retargeted to base 467 of cbo3199 inantisense orientation
This study
pMTL007C-E2::cbo3202-167|168AS pMTL007C-E2 with L1.LtrB retargeted to base 167 of cbo3202 inantisense orientation
This study
pET-28b(�) Recombinant protein expression vector, kanR NovagenpET-28b(�)-cbo0365-HIS pET-28b(�) harboring cbo0365 with N-terminal His6 tag This study
stop solution (Sigma-Aldrich, St. Louis, MO) in a ratio of sample to stopsolution of 5 to 1, mixed thoroughly, and incubated on ice for 30 min.Cells were harvested by centrifugation (4°C, 8,000 � g) for 5 min. The cellpellets were immediately frozen to �70°C until RNA extraction.
The cell pellets were thawed on ice for 5 min and used for RNA extrac-tion with the RNeasy minikit or RNeasy Midi kit (Qiagen GmbH, Hilden,Germany) according to the manufacturer’s instructions. The cells werelysed with a solution containing 25 mg lysozyme (Sigma-Aldrich, St.
Louis, MO)/ml and 250 IU of mutanolysin (Sigma-Aldrich)/ml in Tris-EDTA buffer (pH 8.0; Fluka BioChemica, Buchs, Switzerland) underagitation at 37°C for 30 min. To ensure efficient removal of all genomicDNA, an additional DNase treatment was carried out using the DNA-freekit (Ambion, Austin, TX) according to the manufacturer’s instructions.
The RNA yield and purity (A260/A280) were checked using the Nano-Drop ND-1000 spectrophotometer (Thermo Fisher Scientific, Inc., Wal-tham, MA). The A260/A280 ratio was �2.0 for all samples. Integrity of RNA
TABLE 2 Oligonucleotide primers used in this study
Primer Use Modification (sequence [5=–3=])a
cbo0366 RT Gene-specific reverse transcription CTTTTGATATTCCGCCCAAAcbo0363-cbo0364 F RT-PCR AGTATGGTTTAATGTAGCGGTAGTAAGcbo0363-cbo0364 R RT-PCR GCTTAGTGGCACAATATTTTCTTTcbo0364 F RT-PCR TTTTCTGTTCCTTATATGGTTTGGcbo0364 R RT-PCR TTTTCTGCTGACATTTCTTAATCAcbo0365-cbo0366 F RT-PCR AAACAGTTTGGGGAGTTGGAcbo0365-cbo0366 R RT-PCR TTTTTATCCATGCTCCAATGTCTcbo0365 F RT-PCR TGATGCCTAAGATGGATGGTcbo0365 R RT-PCR TCTTCATTTTCATTTCCATTTGAcbo0366-cbo0366 F RT-PCR AAAATTAATTATGGCAGAGGATGAAcbo0366-cbo0367 R RT-PCR AAATCTGCAGCACCTTTTACAcbo0751 qPCR F RT-qPCR TCTGCGGGGACAGAAACTAAACcbo0751 qPCR R RT-qPCR CCCCAATCCTCTGTATGTTTTGCcbo0753 qPCR F RT-qPCR TCCTGTGGAGAAAAGTGTGCTTGcbo0753 qPCR R RT-qPCR TATGATGGGACAGTGTCGGTTGcbo1407 qPCR F RT-qPCR ACTGGCTCAGAAATGGATGCcbo1407 qPCR R RT-qPCR AAATTTAGGGGCCATGGAAGcbo2226 qPCR F RT-qPCR TTAAGGCGGGGAGTAATGTGcbo2226 qPCR R RT-qPCR CGGAACAATTGAAACACCTGcbo2227 qPCR F RT-qPCR GGAGCTGTTGTTGGTTTGATTGGcbo2227 qPCR R RT-qPCR TGCAACGAATGCTCCTGCTATCcbo2847 qPCR F RT-qPCR GGCACTTGCAGCTGATTTAGcbo2847 qPCR R RT-qPCR TCCTCTCTCCAAAAGAGTCTCCcbo3199 qPCR F RT-qPCR GGAATACGGTGGAGCTGGTAcbo3199 qPCR R RT-qPCR TGGAGCGCAACATAAAGATGcbo3202 qPCR F RT-qPCR AGCCGACTATAGCAGCCGTAcbo3202 qPCR R RT-qPCR TCCTCCGAATCCTGGAGTTA16S rrn F RT-qPCR, EMSA probe preparation AGCGGTGAAATGCGTAGAGA16S rrn F 5= biotin EMSA probe preparation Biotin-AGCGGTGAAATGCGTAGAGA16S rrn R RT-qPCR, EMSA probe preparation GGCACAGGGGGAGTTGATACcbo0751M 254|255a R Intron insertion confirmation GGTCCTCTAATCCCCAATCCcbo0753M 196|197a R Intron insertion confirmation ATTTAATGAATAGTGACTCCATAATCCcbo1407M 428|429a R Intron insertion confirmation AAATTTAGGGGCCATGGAAGcbo2525M 122|123a R Intron insertion confirmation TCATCCTGACCACCAACATCcbo2847M 509|510a R Intron insertion confirmation TCCTCTCTCCAAAAGAGTCTCCcbo3199M 467|468a R Intron insertion confirmation ATCCTCTGTCTTGCCAATGCcbo3202M 167|168a R Intron insertion confirmation CGGCTTTTCCATGGTTTCTAEBS universal Intron insertion confirmation CGAAATTAGAAACTTGCGTTCAGTAAACcbo0365 F NheI CDS cloning for protein overexpression CCCGCTAGCATGTCAGCAGAAAAAATCCTTATTGcbo0365 R XhoI CDS cloning for protein overexpression CGCCTCGAGCTATTTTTCAACCTTATATCCAACTCCT7 promoter Sequencing pET28b(�)-cbo0365-HIS TAATACGACTCACTATAGGGT7 terminator Sequencing pET28b(�)-cbo0365-HIS GCTAGTTATTGCTCAGCGGPcbo0364 150bp F EMSA probe preparation AACAGGGCAAATATAAGGAAAGTGPcbo0364 150bp F 5= biotin EMSA probe preparation Biotin-AACAGGGCAAATATAAGGAAAGTGPcbo0364 150bp R EMSA probe preparation TCAATTTAACTTCCCCCATAACCPcbo0753 454bp F EMSA probe preparation TCTTCAGCAACTTTTCTTATTTTATCAPcbo0753 454bp F 5= biotin EMSA probe preparation Biotin-TCTTCAGCAACTTTTCTTATTTTATCAPcbo0753 454bp R EMSA probe preparation TCTGATAGTGCTTTAATAATTTTTGCPcbo0753 180bp F EMSA probe preparation AGTTAATATTTTCATGTTCACATTTPcbo0753 180bp F 5= biotin EMSA probe preparation Biotin-AGTTAATATTTTCATGTTCACATTTPcbo0753 180bp R EMSA probe preparation CAAGCTCATTAATCTCCCTCCTPcbo2525 223bp F EMSA probe preparation TTTTTGGTGCCTATAACAAAAGCPcbo2525 223bp F 5= biotin EMSA probe preparation Biotin-TTTTTGGTGCCTATAACAAAAGCPcbo2525 223bp R EMSA probe preparation TTCATTAATAAAAACCTCCGTTCAPcbo3202 250bp F EMSA probe preparation CAAAGTTTTATTTGATGGCAGTPcbo3202 250bp F 5= biotin EMSA probe preparation Biotin-CAAAGTTTTATTTGATGGCAGTPcbo3202 250bp R EMSA probe preparation TCCACTTAACCACCCCCTTAa Restriction enzyme sites in the primer sequences are underlined.
Dahlsten et al.
308 aem.asm.org Applied and Environmental Microbiology
was confirmed with miniaturized gel electrophoresis with the Agilent Bio-analyzer (Agilent Technologies, Inc., Santa Clara, CA). The RNA integritynumber was �9.2 for all RNA samples.
cDNA synthesis. For DNA microarray analysis, a total of 2 �g of eachRNA sample was reverse transcribed into cDNA and simultaneously la-beled with fluorescent dyes. In brief, each 30-�l labeling reaction mixturecontained 0.2 �g of random hexamers (Invitrogen)/�l, 0.01 M dithio-threitol (DTT; Invitrogen), 1.3 U of RNase inhibitor (Invitrogen)/�l, 0.5�M dATP, dTTP, and dGTP, 0.2 �M dCTP, 1.7 nmol of Cy-3 (two rep-licates of wild type, one replicate of cbo0365 mutant) or Cy-5 (two repli-cates of cbo0365 mutant, one replicate of wild type)-labeled dCTP (GEHealthcare, Pittsburgh, PA), 13 U of SuperScript III reverse transcriptase(Invitrogen)/�l, and appropriate buffer (1� First-Strand Buffer; Invitro-gen) and then incubated at 46°C for 3 h. RNA hydrolysis and reactioninactivation were performed by addition of 15 �l of 0.1 M NaOH and 0.5mM EDTA and incubation at 70°C for 15 min. The reactions were subse-quently neutralized by addition of 15 �l of 0.1 M HCl. The cDNA waspurified with QIAquick PCR purification kit (Qiagen), with final elutionvolume of 40 �l. The cDNA concentration of each sample was measuredwith NanoDrop.
For RT-qPCR, a total of 500 ng of each 15°C RNA sample was used forcDNA synthesis with the DyNAmo cDNA synthesis kit (Thermo FisherScientific) as instructed by the manufacturer. Each 20-�l reaction, whichcontained 15 ng of random hexamers/�l, 10 IU of Moloney murine leu-kemia virus RNase H� reverse transcriptase solution (Thermo Fisher Sci-entific), and appropriate buffer containing deoxynucleoside triphos-phates (dNTPs) and MgCl2 in a final concentration of 5 mM (1�; ThermoFisher Scientific), was incubated at 25°C for 10 min and at 37°C for 30min, inactivated at 85°C for 5 min, and finally chilled to 4°C. Two replicateRT reactions were made for each RNA sample.
For reverse transcription-PCR (RT-PCR), a 20-�l reaction mixturecontaining 1 �g of C. botulinum ATCC 3502 RNA from a 37°C sample and2 �M primer cbo0366-RT was incubated at 65°C for 5 min for denatur-ation and on ice for 1 min for annealing. RT was performed in a reactionmixture containing 0.5 mM concentrations of each dNTP (Thermo FisherScientific), 5 mM DTT, 40 U of RNase inhibitor (RNaseOUT), First-Strand Buffer (50 mM Tris-HCl, 75 mM KCl, and 3 mM MgCl2), and 200U of SuperScript III reverse transcriptase (Invitrogen) or 2 �l of water forthe no-RT control. The reaction mixtures were incubated at 55°C for 60min. RNA hydrolysis, reaction inactivation, and neutralization were per-formed as described above for the cDNA synthesis procedure for microar-ray analysis.
Transcriptomic analysis with DNA microarrays. The in situ-synthe-sized DNA microarrays (8x15K; Agilent Technologies) were custom de-signed to cover 3,641 chromosomal (out of the total of 3,648) and all 19plasmid-borne open reading frames (ORFs) in the ATCC 3502 genome(22). Depending on the length of ORF, a total of 3 to 14 60-mer oligonu-cleotide probes were designed for each ORF.
For array hybridizations, biological replicate samples of the wild typeand mutant were labeled with either Cy5 or Cy3 as described above. Atotal of 300 ng of Cy3-labeled cDNA and 300 ng of Cy5-labeled cDNA(wild type versus mutant from the same condition) were mixed into a finalvolume of 18 �l, and 0.1 mg of salmon sperm DNA (Invitrogen)/ml wasadded. The DNA was denatured at 95°C for 2 min, chilled on ice, andfinally mixed with a blocking agent (Hi-RPM GE hybridization kit; Agi-lent Technologies) and hybridization buffer (Hi-RPM GE hybridizationkit) as instructed by the manufacturer. A volume of 50 �l of the mix waspipetted onto the DNA microarrays. The arrays were hybridized at 65°Covernight and washed as instructed (Gene Expression wash buffer kit;Agilent Technologies).
The slides were scanned (Axon GenePix Autoloader 4200 AL; West-burg, Leusden, Netherlands) at 532 and 635 nm using a 5-�m resolution.Image processing was performed with GenePix Pro 6.0 software (AxonInstruments), and data analysis was performed with the R limma package(23). The foreground and local background intensities of each spot were
characterized by the mean and median pixel values of the spot, respec-tively. Local background was subtracted from the foreground signal usingthe “normexp” method, with an offset value of 50 (24). For comparisonbetween different arrays, the signal intensities measured in the Cy5 andCy3 channels were converted into a logarithmic (log2) scale and normal-ized using the loess method (25). Statistical analysis was performed to finddifferentially expressed genes between the wild type and the cbo0365 mu-tant. The analysis was done separately for each probe to control for vari-ation within a coding sequence. A moderated t test with empirical Bayesvariance shrinkage (“eBayes” function) was applied to each probe on thearray, and the resulting P values were converted into false discovery rate(FDR) values by a Benjamini-Hochberg adjustment (“topTable” func-tion) (26). For each ORF, the probe with a median unmodified P value forthe expression difference was chosen to represent the ORF. Of the repre-sentative ORFs, those with a FDR of �0.05 were subsequently consideredto have a significant difference in expression. Furthermore, of these sig-nificantly differently expressed ORFs, ones with a log2 fold change of��2.0 or �2.0 in either or both of the sampling points were consideredto be included in the CBO0365 regulon.
RT-qPCR. To validate the expression values obtained from the mi-croarray experiments, quantitative real-time reverse transcription-PCR(RT-qPCR) was performed for selected genes, representing genes mark-edly less, more, or not differently expressed in the cbo0365 mutant in themicroarray experiment. The DyNAmo Flash SYBR green qPCR kit(Thermo Fisher Scientific) was used according to the manufacturer’s in-structions to set up the RT-qPCRs. Each reaction consisted of 1�DyNAmo Flash SYBR green Master Mix (Thermo Fisher Scientific), 0.5�M forward and reverse primers (Table 2), and 4 �l of cDNA in a totalvolume of 20 �l. The reactions were performed in the Rotor-GeneRG3000 thermal cycler (Qiagen) with initial heating at 95°C for 15 min toactivate the DNA polymerase, followed by either 40 cycles of denaturationat 95°C for 10 s and then annealing and extension at 60°C for 20 s (primerscbo0365, cbo0366, cbo0753, cbo2227, cbo2525, cbo3199, cbo3202, and 16Srrn) or 40 cycles of denaturation at 95°C for 10 s, annealing at 55°C for 15s, and extension at 72°C for 15 s (primers cbo0751, cbo1407, cbo2226, andcbo2847). Data acquisition was performed during the extension step. Theamplification reaction efficiencies and the appropriate sample dilutionfactor for each primer pair were defined with dilution series of pooledcDNA. Rotor-Gene 6 software (Qiagen) was used to set the thresholdfluorescence levels for each primer pair and to calculate the reaction effi-ciencies. The reaction efficiencies of the primers varied between 0.91 and1.05. A sample dilution factor of 1:20 was used with primer pairs forcbo0365, cbo0366, cbo3199, and cbo3202, of 1:103 for cbo0751, cbo0753,cbo1407, cbo2226, cbo2227, cbo2525, and cbo2847, and of 1:105 for 16S rrn.The 1:105-diluted no-RT controls were analyzed with the 16S rrn primersand reaction conditions described above, and no-template controls wereincluded in each run. A melting-curve analysis was included in each run toconfirm primer specificity.
The relative quantification of target gene expression in the cbo0365mutant, normalized to reference gene (16S rrn) and calibrated to thesamples taken from the wild-type strain, were determined by calculatingthe expression ratios of target genes with the Pfaffl method (27), whichincorporates the reaction efficiency of each primer pair into the ratiocalculations. The quantification cycle (Cq) values measured for 16S rrnremained stable throughout the experiment, supporting its use as a reli-able normalization control. 16S rrn is the only previously reported refer-ence gene for C. botulinum (28, 29), and no other suitable reference geneshave been reported.
RT-PCR. To identify the transcript structure of the cbo0365 locus,RT-PCR was performed on cDNA synthesized from wild-type ATCC3502 RNA. Each reaction consisted of 1 �l of C. botulinum ATCC 3502first-strand cDNA template, a 200 �M dNTP mixture (Thermo FisherScientific), 0.5 �M concentrations of each forward and reverse primer(primers targeted to the intergenic region between cbo0363 and cbo0364[cbo0363-cbo0364f � cbo0363-cbo0364r], cbo0364 alone [cbo0364f �
cbo0364r], and cbo0365 alone [cbo0365M-f � cbo0365-r1] or to the inter-genic region between cbo0365 and cbo0366 [cbo0365-cbo0366-f �cbo0365-cbo0366-r]; Table 2), and 2 U of DyNAzyme II DNA polymerase(Thermo Fisher Scientific) in a 1� reaction buffer (Thermo Fisher Scien-tific). The PCR run consisted of 30 cycles of denaturation at 94°C for 30 s,annealing at 55°C for 30 s, and extension at 72°C for 1 min 20 s. The PCRproducts were visualized under UV light by ethidium bromide stainingafter agarose gel electrophoresis.
EMSAs. To overexpress and purify the CBO0365 protein, a 699-bpDNA fragment containing the coding sequence (CDS) of cbo0365 wasPCR amplified using the Phusion DNA polymerase (Thermo Fisher Sci-entific) with the primers cbo0365 F NheI and cbo0365 R XhoI (Table 2),incorporating an NheI site at the 5= end and an XhoI site at the 3= end ofthe CDS. The fragment was purified with the GeneJET PCR purificationkit, digested with NheI and XhoI (New England BioLabs), and cloned intothe pET-28b(�) expression vector (Novagen, Darmstadt, Germany) in-corporating an N-terminal His6 tag into the CDS. The plasmid was prop-agated in Escherichia coli TOP10 electrocompetent cells (Invitrogen) in LBbroth containing 30 �g of kanamycin/ml. Plasmids were isolated fromcultures with a GeneJET plasmid miniprep kit (Thermo Fisher Scientific)and verified by sequencing. Recombinant CBO0365 protein was ex-pressed in a culture of E. coli Rosetta 2(DE3)/pLysS (Novagen) grown at37°C in 100 ml of Luria-Bertani (LB) broth containing 30 �g of kanamy-cin/ml and 34 �g of chloramphenicol/ml. The cultures were grown to anOD600 of 0.8, the protein expression was induced with 1 mM IPTG (iso-propyl-�-D-thiogalactopyranoside), and the bacteria were further cul-tured for an additional 5 h. Cells were harvested by centrifugation at10,000 � g for 15 min at 4°C and frozen overnight at �20°C. The cellswere resuspended in 10 ml of binding buffer (0.5 M NaCl, 20 mM Tris-HCl, 16 mM imidazole [Sigma-Aldrich]; pH 7.9) and sonicated. Cell de-bris was separated from the soluble fraction by centrifugation (10,000 � gfor 15 min at 4°C), and the supernatant was passed through a 0.45-�m-pore-size syringe-end filter. The filtrate was applied to 1 ml of His-BindNi2�-NTA resin (Novagen) and incubated at 4°C for 1 h under gentleagitation. The suspension was applied to a gravity flow chromatographycolumn (Novagen), washed with 10 ml of binding buffer and 10 ml ofwash buffer (0.5 M NaCl, 20 mM Tris-HCl, 60 mM imidazole [Sigma-Aldrich]; pH 7.9), and eluted in three 1-ml fractions with elution buffer(0.5 M NaCl, 20 mM Tris-HCl, 1 M imidazole; pH 7.9). The purity of theeluted fractions was assessed with SDS-PAGE with Coomassie blue stain-ing, and the protein concentrations were approximated with a Bradfordassay using bovine serum albumin (BSA) as a standard. The eluted proteinfractions were pooled into a final concentration of 1 mg/ml. The pooledprotein was dialyzed into storage buffer (50 mM HEPES [pH 7.5; Sigma-Aldrich], 100 mM NaCl, 25 mM MgCl, 1 mM EDTA, 10% glycerol) withNovagen D-tube dialyzers (molecular mass cutoff, 6 to 8 kDa) and storedat 4°C for a maximum of 2 weeks.
The ability of recombinant CBO0365 protein to bind in vitro to puta-tive promoter sequences of the operons of interest was investigated withnonradioactive EMSAs. To produce 5=-biotin-labeled DNA probes for theEMSA, DNA fragments containing the putative promoter sequences ofcbo0364, cbo2525, and cbo3202 and a fragment within the coding sequenceof 16S rrn were PCR amplified with Phusion DNA polymerase (ThermoFisher Scientific) using the 5=-biotin-labeled forward primers and unla-beled reverse primers described in Table 2. In addition, two fragments ofthe noncoding region upstream of cbo0753 were similarly constructed: a454-bp fragment containing the entire noncoding region betweencbo0752 and cbo0753 and a fragment containing the 180-bp region directlyupstream of cbo0753. Cold probes were similarly produced using onlyunlabeled primers. The PCRs for labeled probes were electrophoresed innondenaturing polyacrylamide gels for 90 to 120 min and visualized withethidium bromide staining. Fragments of the desired size were excisedfrom the gels with a sterile scalpel blade. The gel slices were destained innuclease-free water twice for 20 min each time and then crushed, andDNA was eluted overnight at 37°C into 3 volumes of gel extraction buffer
(300 mM sodium acetate, 1 mM EDTA). The eluted DNA buffer solutionwas sterile filtered, DNA was ethanol precipitated and dissolved in nu-clease-free water. Unlabeled probes were purified with the GeneJET PCRpurification kit (Thermo Fisher Scientific). The concentration and purityof the probes was determined with the NanoDrop ND-1000 spectropho-tometer (Thermo Fisher Scientific).
Prior to the DNA-protein binding reactions, 0 to 4 �M His6-taggedCBO0365 protein was phosphorylated in binding buffer containing 20mM HEPES (pH 7.9; Sigma-Aldrich), 60 mM KCl, 5 mM MgCl2, 1 mMEDTA, 1 mM DTT, 0.3 mg of BSA/ml, 5% glycerol, and 50 mM lithiumpotassium acetyl phosphate (Sigma-Aldrich) for 1 h at 25°C. To test thebinding capacity of recombinant CBO0365 to the promoter fragmentsproduced above, 20 fmol of 5=-biotin-labeled DNA probe was added tothe reactions, and binding was allowed to proceed for 30 min at 25°C. Thereactions were loaded into precast 5% native polyacrylamide gels (Bio-Rad, Inc., Hercules, CA) and run at 115 V for 90 to 160 min in prechilled0.5� Tris-borate-EDTA (TBE) buffer at 4°C. The DNA fragments weretransferred to a positively charged nylon membrane (Roche Applied Sci-ence, Indianapolis, IN) with a Bio-Rad Trans-Blot electrotransfer appa-ratus (Bio-Rad) at 100 V for 30 min in 0.5� TBE buffer at 4°C. Themembrane detection was performed with Pierce chemiluminescent nu-cleic acid detection module (Thermo Fisher Scientific) according to themanufacturer’s instructions and imaged by exposure to chemilumines-cent film (Amersham HyperFilm ECL; GE Healthcare). Control reactionswithout acetyl phosphate were similarly performed, and additional reac-tions to determine the specificity of each DNA-protein interaction wereperformed with a 200-fold molar excess of unlabeled DNA probe added toreactions with 4 �M protein.
Microarray accession number. The microarray data have been depos-ited in the NCBI Gene Expression Omnibus (GEO) under accession num-ber GSE26587.
RESULTSIdentification of genes in the putative CBO0365 regulon. Toidentify the CDSs under putative regulation of the CBO0365 re-sponse regulator, we compared the transcriptomes of the wild-type ATCC 3502 and cbo0365 mutant strains during growth at37°C and 1 h after a temperature downshift to 15°C using DNAmicroarrays based on the ATCC 3502 genome. Genes expressedsignificantly less or more (median log2 ratios of ��2.0 or �2.0,an FDR of �0.05) in the cbo0365 mutant than in the wild-typestrain were considered to be directly or indirectly positively ornegatively, respectively, regulated by CBO0365.
At 37°C, a total of 150 chromosomal CDSs showed signifi-cantly different expression between the cbo0365 mutant and thewild-type strain. One hour after temperature downshift to 15°C,the number of differentially expressed chromosomal CDSs was141. All chromosomal CDSs markedly (log2 ratio of ��2.0 or�2.0) less or more expressed in the cbo0365 mutant than in thewild type at only one temperature were similarly less or moreexpressed at the other (FDR � 0.05), albeit with a log2 expressiondifference falling outside the defined cutoff values. Hence, theputative CBO0365 regulon was practically not affected by temper-ature (Table 3).
The chromosomal CDSs less expressed in the cbo0365 mutantthan in the wild type both at 37 and 15°C were arranged in six lociand included cbo0043 encoding a putative RNA polymerase sigmafactor, cbo0344 encoding a metallopeptidase, cbo3197-cbo3199and cbo3200-cbo3202 related to acetone-butanol-ethanol (ABE)fermentation, 16 CDSs related to prophage 1 (the entire prophageis cbo1679 to cbo1755 [22]), and 49 CDSs related to prophage 2(the entire prophage is cbo2313 to cbo2394 [22]) (Table 3).
The chromosomal CDSs significantly more highly expressed in
Dahlsten et al.
310 aem.asm.org Applied and Environmental Microbiology
TABLE 3 Genes of C. botulinum ATCC 3502 with significant differences in expression between cbo0365 insertional mutant and wild-type strains inearly logarithmic growth at 37°C and 1 h after a temperature downshift to 15°Ca
Functional classificationb CDSPredicted protein product(s)/genomiccontext
Log2 fold changec
37°C 15°C
Chemotaxis and mobility cbo0719 Methyl-accepting chemotaxis protein 2.5 2.3cbo2226-cbo2227 Flagellar motor protein 3.3 to 3.7 3.2 to 3.4
Detoxification cbo0753-cbo0757 Arsenical resistance 2.3 to 3.0 2.4 to 3.0Drug/analog sensitivity cbo0072 Putative Na�-driven multidrug efflux pump 2.2 2.1Transport and binding cbo2521-cbo2525 Phosphate binding and transport 3.4 to 5.5 3.6 to 4.7Adaptation cbo0550 Carbon starvation protein A 2.1 1.8Carbohydrate metabolism cbo0880-cbo0883 Glucoside uptake 2.2 to 3.7 2.5 to 3.6
Sporulation cbo0069 Spore maturation protein A 2.6 2.5Degradation of proteins cbo0344 Probable metallopeptidase –1.2 –2.0Biosynthesis of cofactors cbo0422-cbo0425 Biosynthesis of pantothenate 3.0 to 4.4 3.1 to 4.1Electron transport cbo3197-cbo3199 ABE fermentation –2.9 to �3.3 –3.2 to �3.8
cbo3200-cbo3202 ABE fermentation –3.0 to �3.7 –3.2 to �4.0Fatty acid biosynthesis cbo0502 3-Oxoacyl-[acyl-carrier protein] reductase 2.1 2.5Cell envelope cbo0715 Membrane protein 2.4 2.3
cbo2101 Putative UDP-glucose epimerase 1.6 2.5cbo2309 Membrane protein 2.0 1.7cbo2804 Putative exported protein 2.1 1.9cbo2929 Putative exported protein 1.8 2.0cbo2937 Membrane protein –2.7 –2.3cbo2972 Membrane protein 2.7 2.4cbo3016 N-Acetylmuramoyl-L-alanine amidase 2.3 1.7cbo3222 Putative secreted protein 1.8 2.6cbo3352 Membrane protein 2.4 2.0
cbo3019-cbo3040, cbo3042-cbo3044 Putative genomic island 2.1 to 3.4 1.7 to 3.4Hypothetical proteins cbo0043A Conserved hypothetical protein –4.1 –5.2
cbo0257 Putative isochorismatase 2.1 2.3cbo0427 Hypothetical protein 3.2 3.5cbo0641-cbo0642 Conserved hypothetical protein 1.6 to 2.3 2.3 to 2.8cbo0716 Conserved hypothetical protein 1.9 2.1cbo1247 Hypothetical protein 2.3 2.0cbo2310 Conserved hypothetical protein 2.7 3.4cbo2528 Conserved hypothetical protein 1.7 2.2cbo2693 Hypothetical protein 2.2 1.8cbo2936 Conserved hypothetical protein –3.3 –3.1cbo3211 Conserved hypothetical protein 3.1 2.3
Not classified cbo2183 Putative phenazine biosynthesis-like protein 2.3 2.0cbo2850-cbo2852 Dehydrogenases 5.1 to 5.6 4.2 to 5.3cbo3210 Putative phosphoesterase 2.9 2.7cbo3571 Nitroreductase (pseudogene) 2.0 2.1
a Genes of C. botulinum ATCC 3502 with significant (FDR � 0.05) difference in expression (�2.0 or ��2.0 log2 fold) between cbo0365 insertional mutant and wild-type strain inearly logarithmic growth at 37°C and 1 h after temperature downshift to 15°C. FDR, false discovery rate.b According to Riley (55).c cbo0365 mutant versus ATCC 3502 wild type.
the cbo0365 mutant than in the wild type at 37 and 15°C werearranged in 32 loci and included those with predicted functions insporulation (cbo0069), multidrug resistance (cbo0072), pantothe-nate biosynthesis (cbo0422 to cbo0425), fatty acid biosynthesis(cbo0502), arsenic resistance (cbo0753 to cbo0756), glucoside up-take (cbo0880 to cbo0883), flagellar rotation (cbo2226 andcbo2227), phosphate binding and transport (cbo2521 to cbo2525),dehydrogenation (cbo2850 to cbo2852), and a putative genomicisland (cbo3016 to cbo3044) (Table 3).
Validation of the DNA microarray results. To validate theDNA microarray expression data, we performed a relative geneexpression analysis using RT-qPCR of the ABE fermentationpathway genes cbo1407, cbo2847, cbo3199, and cbo3202, the arsen-ical resistance operon genes cbo0751 and cbo0753, putative flagel-lar protein-encoding cbo2226 and cbo2227, and the phosphateABC transporter substrate binding protein-encoding cbo2525, inthe ATCC 3502 wild type and cbo0365 mutant 1 h after tempera-ture downshift to 15°C. An R2 correlation value of 0.98 was ob-served between the log2 expression ratios of the microarray andRT-qPCR experiments (Fig. 1), although the microarray experi-
ment appeared to slightly underestimate the largest expressiondifferences. The higher expression differences suggested by theRT-qPCR experiments than by the DNA microarray analysis areprobably attributed to the different normalization proceduresused in the two approaches. In addition, the validation resultssupported the use of the cutoff log2 ratios of ��2.0 and �2.0 inthe microarray experiment, since the most prominent discrepan-cies in the expression ratios between DNA microarray and RT-qPCR experiments were observed in genes with expressionchanges under these cutoff values (cbo0751, cbo1407, and cbo2847[Fig. 1]).
Inactivation of putative CBO0365 regulon genes results incold-sensitive phenotypes. To test whether the metabolic path-ways with components under putative transcriptional control ofCBO0365 have roles in cold tolerance of C. botulinum ATCC3502, insertional inactivation of several genes related to these met-abolic events was performed. We inactivated the ABE fermenta-tion pathway-related cbo1407 (bdh), cbo2847 (ctfA), cbo3199(bcd), and cbo3202 (crt) encoding NADH-dependent butanol de-hydrogenase, butyrate-acetoacetate coenzyme A (CoA)-trans-ferase subunit A, butyryl-CoA dehydrogenase, and 3-hydroxybu-tyryl-CoA dehydratase, respectively, the arsenic resistance-relatedcbo0751 (arsC) and cbo0753 (arsR), and cbo2525 (phoT) encodinga phosphate ABC transporter substrate-binding protein andtested the growth of these mutants at low temperature. Inactiva-tion of cbo3202 resulted in complete inability to grow at 17°C (Fig.2A). A slight decrease in the growth rate of the cbo3199 mutant at17°C was also observed (Fig. 2A). The cbo1407 and cbo2847 mu-tants both had a markedly lower growth rate at 17°C than thewild-type strain (Fig. 2B). The putative ABE fermentation path-way components of C. botulinum ATCC 3502 and the effect ofinactivation of related genes on cold tolerance are summarized inFig. 3.
Markedly impaired growth was observed for the cbo0751 mu-tant at 17°C, and inactivation of cbo0753 completely abolishedgrowth at this temperature (Fig. 2C), suggesting an important rolefor these arsenic resistance protein-encoding genes in cold toler-ance of C. botulinum ATCC 3502. Similarly, inactivation ofcbo2525 resulted in a phenotype almost completely unable to growat 17°C (Fig. 2D). No differences in growth at optimal conditions(37°C) were observed between the wild-type strain and any of themutant strains investigated here (data not shown).
cbo0365 locus. The structure of the cbo0365 locus suggests thatcbo0365, encoding a putative response regulator, and cbo0366, en-coding a putative sensor histidine kinase, are cotranscribed to-gether with cbo0364. The 3= end of the cbo0364 coding sequenceoverlaps with 58 bases of the 5= end of the coding sequence ofcbo0365, and the 3= end of the cbo0365 coding sequence overlapswith 11 bases of the 5= end of the coding sequence of cbo0366.Transcription of the three genes into the same mRNA, indepen-dent of cbo0363, was confirmed by RT-PCR analysis of RNA ex-tracted from the ATCC 3502 wild-type cells. Extracted RNA wasreverse transcribed with a gene-specific primer targeted to the 3=end of cbo0366. PCR was performed using primer pairs (Table 2)targeted to the intergenic region between cbo0363 and cbo0364,the CDS of cbo0364, the CDS of cbo0365, or to the intergenicregion between cbo0365 and cbo0366 (Fig. 4). No products wereobtained with primers targeted to the intergenic region betweencbo0366 and cbo0367 from cDNA synthesized with random hex-amers, confirming that cbo0367 was not included in the same tran-
FIG 1 Confirmation of DNA microarray results with quantitative reversetranscription-PCR (RT-qPCR). Correlation of log2 fold changes in expressionof cbo0751, cbo0753, cbo1407, cbo2226, cbo2227, cbo2525, cbo2847, cbo3199,and cbo3202 between C. botulinum ATCC 3502 cbo0365 mutant and the wild-type strain 1 h after a temperature downshift from 37 to 15°C observed in theDNA microarray (x axis) and RT-qPCR (y axis) experiments.
Dahlsten et al.
312 aem.asm.org Applied and Environmental Microbiology
script (data not shown). In addition, no-RT controls failed to yieldamplification products, indicating that there was no DNA con-tamination in the RNA samples (Fig. 4).
A BLAST search against sequenced C. botulinum genomesother than ATCC 3502 suggested cbo0366/cbo0365 to be highlyconserved among group I C. botulinum but also to share 43 to 44%(cbo0366) to 66% (cbo0365) amino acid similarity with a TCSpresent in three group II C. botulinum strains. The CDS of cbo0364encodes a protein predicted to harbor six transmembrane helicesand a type 2 phosphatidic acid phosphatase (PAP2) superfamilydomain (NCBI Conserved domain database [http://www.ncbi.nlm.nih.gov/cdd]). However, although a protein with 41 to 43%amino acid identity could be identified in B. cereus, the function ofCBO0364 is unknown. A possible function as an auxiliary phos-phatase fine-tuning the CBO0366/CBO0365 phosphorelay canbe speculated for CBO0364, based on the predicted functionaldomain and its transcriptional association with cbo0365 andcbo0366.
Recombinant CBO0365 protein binds to putative promoterregions of cbo0364, cbo3202 (crt), cbo0753 (arsR), and cbo2525(phoT). To confirm direct CBO0365-mediated regulation ofgenes and/or operons with markedly affected expression in thecbo0365 mutant, we purified recombinant His6-tagged CBO0365protein and tested its ability to bind to the putative promoter
regions of these operons. In vitro phosphorylated CBO0365 wasshown to bind to a 150-bp fragment derived from the noncodingDNA region directly upstream of cbo0364, thus suggestingCBO0365 to directly control the transcription of its own operon(Fig. 5A), a phenomenon commonly observed with TCSs (30).Furthermore, binding to the promoter regions of cbo3202 (Fig.5B), to cbo2525 (Fig. 5C), and to the full-length noncoding regionbetween cbo0752 and cbo0753 (Fig. 5D) was observed. No bindingwas observed to a 180-bp fragment derived from sequence directlyupstream of cbo0753 (Fig. 5E), suggesting that the binding site forCBO0365 resides in the 274-bp noncoding region directly down-stream of cbo0752. In vitro phosphorylation of CBO0365 for 60min by acetyl phosphate was essential for any DNA-binding activ-ity, and no binding was observed in reactions with nonphosphor-ylated protein. Specificity of the protein-DNA interactions be-tween CBO0365 and the promoter fragments were confirmed byprevention of signal shifts in the presence of a 200-fold molarexcess of unlabeled competitor probe. Furthermore, no binding toa control DNA fragment derived from the coding sequence of 16Srrn was observed (Fig. 5F). These data, along with the markedlyhigher or lower expression of cbo0753, cbo2525, and cbo3202 in thecbo0365 mutant than in the wild-type strain, suggest direct regu-lation of related operons by CBO0365 and the ability for the
FIG 2 Mutants of several genes under putative regulation of CBO0365 and within related metabolic pathways show impaired growth at low temperature. (A toD) Average growth of C. botulinum ATCC 3502 wild type (WT) and mutants with insertionally inactivated cbo3199 (bcd) and cbo3202 (crt) encoding two centralenzymes of the ABE fermentation pathway (A), cbo1407 (bdh) and cbo2847 (ctfA) encoding components of the ABE pathway (B), arsenical resistance operoncomponents cbo0751 (arsC) and cbo0753 (arsR) (C), and cbo2525 (phoT) encoding a phosphate ABC transporter (D) at 17°C. Error bars denote the minimumand maximum values of five biological replicates.
CBO0365 protein to function either as an activator or repressor oftranscription.
Mutants of cbo0365, cbo0751 (arsC), and cbo0753 (arsR)show impaired resistance to sodium arsenite. Since disruption ofthe regulation of the arsenical resistance operon cbo0753-cbo0756
(arsRDAB) in the cold-sensitive cbo0365 mutant was observed, thegrowth characteristics of the cbo0365, cbo0751 (arsC), and cbo0753(arsR) mutants in the presence of 0.1 mM sodium arsenite at 37and 20°C were investigated to gain further information of thefunctionality of this pathway and its possible relation to cold tol-
FIG 3 Putative ABE fermentation pathway of C. botulinum ATCC 3502 and effect of inactivation of related components on cold tolerance. The genes putativelyencoding the pathway components are inferred from homology to C. acetobutylicum ATCC 824. No homologues for C. acetobutylicum acetoacetate decarbox-ylase adc were discovered in the ATCC 3502 genome, suggesting inability of C. botulinum ATCC 3502 to produce acetone. Acidogenic reactions are presentedwith dashed, and solventogenic reactions with solid arrows. Bold arrows represent the central reactions of the pathway. The existence of reactions presented withred arrows is uncertain in C. botulinum ATCC 3502 due to missing acetone production pathway genes. Insertional inactivation of genes crt, bcd, ctfA, and bdh(blue background) resulted in deteriorated growth at 17°C.
FIG 4 RT-PCR was performed to show the transcriptional arrangement of the cbo0365 locus. PCR primer pairs were targeted to cbo0363-cbo0364 (A), cbo0364alone (B), cbo0365 alone (C), and cbo0365-cbo0366 (D). Templates included cDNA from ATCC 3502 wild-type culture RNA synthesized with a primer targetedto the 3= end of cbo0366 (lanes 1), no-RT control of RNA from ATCC 3502 wild-type culture (lanes 2), positive control; genomic DNA of ATCC 3502 wild type(lanes 3), and water (lanes 4). M, DNA molecular weight marker VIII (Roche Applied Science).
Dahlsten et al.
314 aem.asm.org Applied and Environmental Microbiology
erance. At 37°C, inactivation of cbo0751 encoding the arsenatereductase ArsC, a central detoxifying enzyme, expectedly resultedin a phenotype with sensitivity to sodium arsenite markedly in-creased from that of the wild-type strain (Fig. 6A). Inactivation ofcbo0365 also resulted in significantly deteriorated growth in the pres-ence of 0.1 mM sodium arsenite (Fig. 6A) despite higher expression ofthe arsenical resistance operon arsRDAB in the mutant. Moreover,inactivation of cbo0753 (arsR), the putative arsenical resistanceoperon repressor, almost completely abolished growth in the pres-ence of 0.1 mM sodium arsenite (Fig. 6A). At 20°C, addition of 0.1mM sodium arsenite to the growth medium resulted in complete lackof growth for the cbo0365 mutant (Fig. 6B), whereas the wild-typestrain was still able to grow under these conditions (Fig. 6B).
DISCUSSION
The two-component signal transduction system CBO0366/CBO0365 plays an important role in the cold shock tolerance and
growth of group I C. botulinum strain ATCC 3502 at low temper-ature (15). In the present study, we sought to gain insight into themechanisms regulated by the CBO0365 response regulator,through which the cold-sensitive phenotypes of the CBO0366/CBO0365 TCS mutants (15) could be mediated. Since the growthof the cbo0365 mutant at low temperatures was extremely poor(15), the effects of cbo0365 mutation on the transcriptome wereinvestigated in optimal growth conditions and after a temperaturedownshift. By comparison of the RT-qPCR-confirmed transcrip-tomic profiles of the cbo0365 mutant and the ATCC 3502 wild type at37 and 15°C, several genes and operons with markedly affected ex-pression in the mutant were discovered. These genes and operonswere considered to be directly or indirectly, positively or negatively,regulated by CBO0365. Mutational analysis of the identified genesand components of related metabolic pathways suggested novel rolesfor acetone-butanol-ethanol (ABE) fermentation, resistance to arse-nic, and phosphate uptake-related genes in cold tolerance of C. botu-
FIG 5 Phosphorylated CBO0365 binds in vitro to promoter regions of cbo0364, cbo3202 (crt), cbo0753 (arsR), and cbo2525 (phoT). (A to D) EMSA resultsobtained with 0 to 4 �M phosphorylated CBO0365 protein showing binding to double-stranded biotin-labeled DNA probes of putative promoter regions ofcbo0364 (A), cbo3202 (B), cbo0753 (C), and cbo2525 (D). (E and F) No binding was observed to a short fragment directly upstream of cbo0753 (E) or to anegative-control fragment from the coding region of 16S rrn (F). No DNA-binding activity was observed for nonphosphorylated CBO0365 (A to E). Specificitywas confirmed with addition of 200-fold molar excess of nonlabeled competitor probe.
linum ATCC 3502. The presence of direct regulatory links was con-firmed by showing recombinant CBO0365 to bind in vitro to severalputative target gene promoters.
The genome of C. botulinum ATCC 3502 harbors genes highlysimilar to the components of the ABE fermentation machinery inthe solventogenic Clostridium acetobutylicum ATCC 824, suggest-ing a solvent-producing capability for group I C. botulinum, withthe exception for acetone production (22). Among the CDSs sig-nificantly less expressed in the cbo0365 mutant than in the wild-type strain were six genes involved in the formation of butyryl-CoA from acetyl-CoA, thus encoding the central enzymes of theABE fermentation pathway (31). The locus structure in ATCC3502 suggests these genes to be arranged in two operons, the firstone including cbo3202 (crt) encoding 3-hydroxybutyryl-CoA de-hydratase, cbo3201 (hbd) encoding 3-hydroxybutyryl-CoA dehy-drogenase, and cbo3200 (thl) encoding acetyl-CoA acetyltrans-ferase. The second putative operon includes cbo3199 (bcd)encoding short-chain specific acyl-CoA dehydrogenase andcbo3198 and cbo3197 encoding electron transfer flavoprotein al-pha- and beta subunits (etfAB). An EMSA analysis showed recom-binant CBO0365 to bind to the putative promoter of cbo3202,suggesting direct regulation of the cbo3202-cbo3200 operon by theCBO0366/CBO0365 TCS. The disruption of regulation of the ABEfermentation pathway as an explanation for the cold sensitivity ofthe CBO0366/CBO0365 TCS mutants was further supported bythe inability of the cbo3202 mutant to grow at 17°C. Moreover,disruption of cbo3199, putatively encoding an enzyme catalyzingthe reaction following the one catalyzed by the product of cbo3202,resulted in a moderate effect on cold tolerance of C. botulinumATCC 3502.
A common way for bacteria to counter cold-induced decreasein membrane fluidity is to increase membrane fatty acid unsatu-ration (32, 33). Unsaturated fatty acid (UFA) synthesis has beenthoroughly characterized in Escherichia coli (32, 34); however, themechanisms for UFA synthesis and particularly the enzymes cat-alyzing the isomerization reaction responsible for diverting theunsaturated carbon bond into the growing acyl chain remain un-identified in clostridia (35). Group II C. botulinum has beenshown to increase the unsaturated fatty acid content of its lipidmembrane at low temperature (36), but the mechanisms for such
adjustments are unclear. The cbo3202-encoded enzyme belongs tothe crotonase superfamily, which harbors enzymes with diversefunctions related to acyl-acyl carrier protein and acyl-CoA modifica-tions—the central steps in lipid biosynthesis (37). Thus, a possibleexplanation for the markedly cold-sensitive phenotype exhibited bythe cbo3202 mutant is that the putatively cbo3202-encoded 3-hy-droxybutyryl-CoA dehydratase possesses an alternative function infatty acid synthesis.
Another means for decreasing the membrane lipid meltingpoint is to increase the proportion of branched-chain fatty acids(BCFA), especially the anteiso-BCFA (32, 33). The synthesis ofBCFA is described to be initiated with branched-chain acyl-CoAprimers, such as 2-methylbutyryl-CoA, produced from thebranched-chain -keto acids by the branched-chain -keto aciddehydrogenase Bkd in several Gram-positive bacteria (38). Theutilization of branched-chain -keto acids and the presence ofBCFA in C. botulinum and in the closely related Clostridium sporo-genes have been previously reported, although some controversyon the results exists (39–42). No homologues for genes encodingthe Bkd enzymes can be detected in the genomes of either of theseclostridial species, suggesting alternate, as-yet-uncharacterizedmechanisms for BCFA primer production in clostridia. Hypothet-ically, conversion of the central ABE fermentation acyl-CoA inter-mediates into structurally closely related BCFA primers couldserve as means to initiate BCFA synthesis in clostridia. Thus, thecold-sensitive phenotype observed in the cbo3202 and cbo3199mutants could be attributed to the lack of putative BCFA synthesisprecursors. In conclusion, the central ABE fermentation interme-diates and the enzymes catalyzing their synthesis appear to have animportant role in cold tolerance of C. botulinum and should befurther investigated in attempts to elucidate the mechanisms offatty acid biosynthesis in clostridia.
To further characterize the role of the ABE fermentation path-way components in cold tolerance of C. botulinum ATCC 3502,mutants of cbo1407 and cbo2847 putatively encoding butanol de-hydrogenase and CoA-transferase A, respectively, were con-structed. The putatively cbo1407-encoded butanol dehydrogenasecatalyzes aldehyde-alcohol transformation, ultimately resulting insolvent (butanol and/or ethanol) production (31). Mutation ofcbo1407 resulted in slower growth at 17°C, suggesting the impor-
FIG 6 Mutants of cbo0365, cbo0751 (arsC), and cbo0753 (arsR) show impaired resistance to sodium arsenite. (A and B) Average growth of C. botulinum ATCC3502 wild type (WT) and mutants with insertionally inactivated cbo0365 or the arsenical resistance operon components cbo0751 (arsC) and cbo0753 (arsR) at37°C in the presence of 0.1 mM sodium arsenite (A) and of C. botulinum ATCC 3502 wild type (WT) and a mutant with insertionally inactivated cbo0365 at 20°Cin the presence of 0.1 mM sodium arsenite (B). Error bars denote the minimum and maximum values of three (A) or five (B) biological replicates.
Dahlsten et al.
316 aem.asm.org Applied and Environmental Microbiology
tance for solvent formation at low temperature. One of the importanttoxic effects of butanol accumulation in solventogenic clostridia is thedirect fluidization of the lipid membranes (43). Since the strictlyanaerobic C. botulinum lacks the lipid desaturase system increas-ing cold-induced O2-dependent membrane fluidity in B. subtilis(44, 45), other strategies to rapidly counter membrane solubiliza-tion at temperature downshift are possibly present. The impor-tance of intact solventogenic mechanisms at a low temperaturecould be attributed to the lipid-solubilizing effect of solvents andsubsequently to a reduced efficiency of rapid membrane adapta-tion in mutants with impaired solventogenesis.
The cbo2847 encoding CoA-transferase A is related to acid re-assimilation after a switch to solventogenesis in C. acetobutylicumand coupled to acetone production with acetoacetate decarboxyl-ase (46). However, since the acetoacetate decarboxylase-encodingadc is missing from the genome of ATCC 3502, the functionality ofthe CoA-transferase A remains to be confirmed in C. botulinum.Nevertheless, inactivation of cbo2847 resulted in a cold-sensitivephenotype similar to the cbo1407 mutant, suggesting a role for thisenzyme in tolerance to low temperature in C. botulinum ATCC3502.
To the authors’ knowledge, the ABE fermentation pathway ofC. botulinum has not been characterized, probably because theextreme toxicity of most laboratory strains and the unavailabilityof nontoxigenic surrogates restricts the usage of available researchequipment and facilities. Thus, the ultimate effects of mutations inthe ABE fermentation pathway on the metabolism of C. botulinumand the impact of altered solvent production in adaptation to lowtemperature remain to be characterized.
The expression levels of cbo0753-cbo0756 encoding compo-nents of the putative arsenical resistance operon were found to besignificantly higher in the cbo0365 mutant strain than in the wild-type strain at both 37 and 15°C. Furthermore, recombinantCBO0365 was shown to bind to the promoter region of cbo0753(arsR), suggesting direct transcriptional control the of the arsoperon by CBO0365. In our previous studies, an association be-tween arsenic resistance and robustness toward low temperaturewas observed in C. botulinum (47, 48). The Nordic (group I) C.botulinum type B strains form two distinct clusters BI and BII (49,50), which differ in their genomic content and, in particular, intheir arsenical resistance operon structure (47). The lack of arsenicresistance-encoding genes in the cluster BI strains was consistentwith significantly decreased robustness to the presence of sodiumarsenite (47) or low temperature (48). In contrast, the cluster BIIstrains harboring a full complement of the arsenic resistance ma-chinery showed tolerance to sodium arsenite (47) and to the lowerend of the growth temperature range (48), with a 3.3°C lowerminimum growth temperature than that of the arsenic-sensitivecluster BI strains. These findings were supported by the impairedor completely abolished growth of the cbo0751 (arsC) and cbo0753(arsR) mutants, respectively, at 17°C compared to the wild-typestrain. These data suggest a novel important role for an intactarsenical resistance operon exerting cold tolerance of C. botuli-num. A possibility for interconnections between mechanisms forarsenic tolerance and oxidative stress response could be specu-lated as the factor causing the cold-sensitive phenotype of mutantsin which the metal-sensing arsenic resistance mechanisms are dis-turbed. Strict regulation of metal homeostasis is crucial in coun-tering oxidative stress, which has been demonstrated to arise sec-ond from cold stress (4).
ArsR is a trans-acting repressor that, together with ArsD,forms a balanced regulatory circuit that fine-tunes the tran-scription levels of the ars operon (51). Such a delicate regula-tion and ultimately arsenic resistance are prone to be imbal-anced by disruption of any of the related regulators. Indeed, theinactivation of arsC, encoding the central detoxifying enzymearsenate reductase, resulted in impaired tolerance to sodiumarsenite. Moreover, the cbo0365 and arsR mutants were botharsenic sensitive, the latter presenting almost completely abol-ished growth in the presence of 0.1 mM sodium arsenite,whereas the wild-type strain was expectedly able to grow underthese conditions (47). The growth defect was even more pro-nounced when the arsenic stress was combined with cold stress:at 20°C, the presence of sodium arsenite completely abolishedthe growth of the cbo0365 mutant, whereas the mild cold stressalone was previously observed to allow growth, albeit with asignificantly deteriorated rate (15). These data support a rolefor an intact arsenical resistance operon and its undisturbedregulation in robustness to low temperature in group I C. bot-ulinum.
Arsenate uptake into cells has been shown to be facilitated bythe pho operon-encoded phosphate transport system (52).Among the operons significantly more expressed in the cbo0365mutant than in the wild-type strain was cbo2521-cbo2525 (pho)putatively encoding a phosphate uptake system. To characterizethe potential role of this cellular process in cold tolerance, cbo2525(pstS) putatively encoding a phosphate uptake system protein wasinactivated. A role for this mechanism in cold tolerance of C.botulinum was demonstrated by the deteriorated growth of thecbo2525 mutant at 17°C. The similar expression differences ob-served for both pho and ars operons suggest a regulatory link be-tween the phosphate uptake and arsenic detoxifying mechanisms.This hypothesis is further supported by the EMSA result showingbinding of CBO0365 to putative promoters of both operons andthus direct control of expression by the CBO0366/CBO0365 TCS.How phosphate uptake and arsenic transport and detoxificationultimately are related to clostridial cold tolerance remains un-known.
Inactivation of the cold adaptation-related cbo0365 responseregulator markedly affected the global gene expression pattern ofC. botulinum ATCC 3502 both at 37 and at 15°C. Characterizationof these transcriptional differences suggests previously uncharac-terized roles for the ABE fermentation, arsenic resistance, andphosphate uptake mechanisms in cold tolerance of C. botulinumATCC 3502. Moreover, the results provide an explanation for thecold-sensitive phenotype exhibited by the cbo0366 and cbo0365mutants (15). Several of the identified mechanisms were shown tobe under the direct transcriptional control of the CBO0366/CBO0365 TCS. The genetic responses of C. botulinum to environ-mental stress are poorly understood and, apart from those withdemonstrated roles in cold tolerance (14, 15) or toxigenesis (20,53, 54), the roles of TCSs in this pathogen are largely unknown.Identification of the key mechanisms behind growth at low tem-perature provides novel approaches to control the food safety haz-ards this notorious pathogen causes in food processing.
ACKNOWLEDGMENTS
This research was performed in the Finnish Centre of Excellence in Mi-crobial Food Safety Research and was funded by the Academy of Finland(grants 118602 and 141140), the ABS Graduate School, the Finnish Min-
istry for Agriculture and Forestry, the European Community’s SeventhFramework Programme FP7/2007-2013 “CLOSTNET” (grant 237942),the Finnish Foundation of Veterinary Research, and the Walter EhrströmFoundation.
We thank Hanna Korpunen, Esa Penttinen, Kirsi Ristkari, and HeimoTasanen for technical assistance.
REFERENCES1. Peck MW. 1997. Clostridium botulinum and the safety of refrigerated
2. Lindström M, Kiviniemi K, Korkeala H. 2006. Hazard and control ofgroup II (non-proteolytic) Clostridium botulinum in modern food pro-cessing. Int. J. Food Microbiol. 108:92–104. http://dx.doi.org/10.1016/j.ijfoodmicro.2005.11.003.
3. Lindström M, Korkeala H. 2006. Laboratory diagnostics of botulism.Clin. Microbiol. Rev. 19:298 –314. http://dx.doi.org/10.1128/CMR.19.2.298-314.2006.
4. den Besten HM, Arvind A, Gaballo HM, Moezelaar R, Zwietering MH,Abee T. 2010. Short- and long-term biomarkers for bacterial robustness:a framework for quantifying correlations between cellular indicators andadaptive behavior. PLoS One 5:e13746. http://dx.doi.org/10.1371/journal.pone.0013746.
5. Krell T, Lacal J, Busch A, Silva-Jiménez H, Guazzaroni M, Ramos JL.2010. Bacterial sensor kinases: diversity in the recognition of environmen-tal signals. Annu. Rev. Microbiol. 64:539 –559. http://dx.doi.org/10.1146/annurev.micro.112408.134054.
6. Igo MM, Slauch JM, Silhavy TJ. 1990. Signal transduction in bacteria:kinases that control gene expression. New Biol. 2:5–9.
7. Aguilar PS, Hernandez-Arriaga AM, Cybulski LE, Erazo AC, de Men-doza D. 2001. Molecular basis of thermosensing: a two-component signaltransduction thermometer in Bacillus subtilis. EMBO J. 20:1681–1691.http://dx.doi.org/10.1093/emboj/20.7.1681.
8. Altabe SG, Aguilar P, Caballero GM, de Mendoza D. 2003. The Bacillussubtilis acyl lipid desaturase is a delta5 desaturase. J. Bacteriol. 185:3228 –3231. http://dx.doi.org/10.1128/JB.185.10.3228-3231.2003.
9. Chan YC, Hu Y, Chaturongakul S, Files KD, Bowen BM, Boor KJ,Wiedmann M. 2008. Contributions of two-component regulatory sys-tems, alternative sigma factors, and negative regulators to Listeria mono-cytogenes cold adaptation and cold growth. J. Food Prot. 71:420 – 425.
10. Steele KH, O’Connor LH, Burpo N, Kohler K, Johnston JW. 2012.Characterization of a ferrous iron-responsive two-component system innontypeable Haemophilus influenzae. J. Bacteriol. 194:6162– 6173. http://dx.doi.org/10.1128/JB.01465-12.
11. Chen Z, Yu H, Li L, Hu S, Dong X. 2012. The genome and transcriptomeof a newly described psychrophilic archaeon, Methanolobus psychrophilusR15, reveal its cold adaptive characteristics. Environ. Microbiol. Rep.4:633– 641.
12. Palonen E, Lindström M, Karttunen R, Somervuo P, Korkeala H. 2011.Expression of signal transduction system encoding genes of Yersinia pseu-dotuberculosis IP32953 at 28°C and 3°C. PLoS One 6:e25063. http://dx.doi.org/10.1371/journal.pone.0025063.
13. Söderholm H, Lindström M, Somervuo P, Heap J, Minton N, Lindén J,Korkeala H. 2011. cspB encodes a major cold shock protein in Clostridiumbotulinum ATCC 3502. Int. J. Food Microbiol. 146:23–30. http://dx.doi.org/10.1016/j.ijfoodmicro.2011.01.033.
14. Derman Y, Isokallio M, Lindström M, Korkeala H. 2013. The two-component system CBO2306/CBO2307 is important for cold adaptationof Clostridium botulinum ATCC 3502. Int. J. Food Microbiol. 167:87–91.http://dx.doi.org/10.1016/j.ijfoodmicro.2013.06.004.
15. Lindström M, Dahlsten E, Söderholm H, Selby K, Somervuo P, HeapJT, Minton NP, Korkeala H. 2012. Involvement of two-componentsystem CBO0366/CBO0365 in the cold shock response and growth ofgroup I (proteolytic) Clostridium botulinum ATCC 3502 at low tempera-tures. Appl. Environ. Microbiol. 78:5466 –5470. http://dx.doi.org/10.1128/AEM.00555-12.
16. Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP. 2007.The ClosTron: a universal gene knockout system for the genus Clostrid-ium. J. Microbiol. Methods 70:452– 464. http://dx.doi.org/10.1016/j.mimet.2007.05.021.
17. Heap JT, Cartman ST, Kuehne SA, Cooksley C, Minton NP. 2010.
18. Kuehne SA, Heap JT, Cooksley CM, Cartman ST, Minton NP. 2011.ClosTron-mediated engineering of Clostridium. Methods Mol. Biol. 765:389 – 407. http://dx.doi.org/10.1007/978-1-61779-197-0_23.
19. Heap JT, Kuehne SA, Ehsaan M, Cartman ST, Cooksley CM, Scott JC,Minton NP. 2010. The ClosTron: mutagenesis in Clostridium refined andstreamlined. J. Microbiol. Methods 80:49 –55. http://dx.doi.org/10.1016/j.mimet.2009.10.018.
20. Zhang Z, Korkeala H, Dahlsten E, Sahala E, Heap JT, Minton NP,Lindström M. 2013. Two-component signal transduction systemCBO0787/CBO0786 represses transcription from botulinum neurotoxinpromoters in Clostridium botulinum ATCC 3502. PLoS Pathog.9:e1003252. http://dx.doi.org/10.1371/journal.ppat.1003252.
21. Derman Y, Lindström M, Selby K, Korkeala H. 2011. Growth of groupII Clostridium botulinum strains at extreme temperatures. J. Food Prot.74:1797–1804. http://dx.doi.org/10.4315/0362-028X.JFP-11-187.
22. Sebaihia M, Peck MW, Minton NP, Thomson NR, Holden MT, Mitch-ell WJ, Carter AT, Bentley SD, Mason DR, Crossman L, Paul CJ, IvensA, Wells-Bennik MH, Davis IJ, Cerdeno-Tarraga AM, Churcher C,Quail MA, Chillingworth T, Feltwell T, Fraser A, Goodhead I, Hance Z,Jagels K, Larke N, Maddison M, Moule S, Mungall K, Norbertczak H,Rabbinowitsch E, Sanders M, Simmonds M, White B, Whithead S,Parkhill J. 2007. Genome sequence of a proteolytic (group I) Clostridiumbotulinum strain Hall A and comparative analysis of the clostridial genomes.Genome Res. 17:1082–1092. http://dx.doi.org/10.1101/gr.6282807.
23. Smyth G. 2005. Limma: linear models for microarray data, p 397– 420. InGentleman R, Carey V, Dudoit S, Irizarry R, Huber W (ed), Bioinformat-ics and computational biology solutions using R and Bioconductor.Springer, New York, NY.
24. Ritchie ME, Silver J, Oshlack A, Holmes M, Diyagama D, Holloway A,Smyth GK. 2007. A comparison of background correction methods fortwo-color microarrays. Bioinformatics 23:2700 –2707. http://dx.doi.org/10.1093/bioinformatics/btm412.
25. Smyth GK, Speed T. 2003. Normalization of cDNA microarray data.Methods 31:265–273. http://dx.doi.org/10.1016/S1046-2023(03)00155-5.
26. Smyth GK. 2004. Linear models and empirical Bayes methods for assess-ing differential expression in microarray experiments. Stat. Appl. Genet.Mol. Biol. 3:Article3. http://dx.doi.org/10.2202/1544-6115.1027.
27. Pfaffl MW. 2001. A new mathematical model for relative quantification inreal-time RT-PCR. Nucleic Acids Res. 29:e45. http://dx.doi.org/10.1093/nar/29.9.e45.
28. Chen Y, Korkeala H, Lindén J, Lindström M. 2008. Quantitative real-time reverse transcription-PCR analysis reveals stable and prolonged neu-rotoxin cluster gene activity in a Clostridium botulinum type E strain atrefrigeration temperature. Appl. Environ. Microbiol. 74:6132– 6137. http://dx.doi.org/10.1128/AEM.00469-08.
29. Lövenklev M, Holst E, Borch E, Rådstrom P. 2004. Relative neurotoxingene expression in Clostridium botulinum type B, determined using quan-titative reverse transcription-PCR. Appl. Environ. Microbiol. 70:2919 –2927. http://dx.doi.org/10.1128/AEM.70.5.2919-2927.2004.
30. Goulian M. 2010. Two-component signaling circuit structure and prop-erties. Curr. Opin. Microbiol. 13:184 –189. http://dx.doi.org/10.1016/j.mib.2010.01.009.
31. Jones DT, Woods DR. 1986. Acetone-butanol fermentation revisited.Microbiol. Rev. 50:484 –524.
32. Suutari M, Laakso S. 1994. Microbial fatty acids and thermal adaptation. Crit.Rev. Microbiol. 20:285–328. http://dx.doi.org/10.3109/10408419409113560.
33. Zhang YM, Rock CO. 2008. Membrane lipid homeostasis in bacteria.Nat. Rev. Microbiol. 6:222–233. http://dx.doi.org/10.1038/nrmicro1839.
34. Feng Y, Cronan JE. 2009. Escherichia coli unsaturated fatty acid synthesis:complex transcription of the fabA gene and in vivo identification of theessential reaction catalyzed by FabB. J. Biol. Chem. 284:29526 –29535.http://dx.doi.org/10.1074/jbc.M109.023440.
35. Zhu L, Cheng J, Luo B, Feng S, Lin J, Wang S, Cronan JE, Wang H.2009. Functions of the Clostridium acetobutylicum FabF and FabZ proteinsin unsaturated fatty acid biosynthesis. BMC Microbiol. 9:119 –2180-9-119. http://dx.doi.org/10.1186/1471-2180-9-119.
36. Evans RI, McClure PJ, Gould GW, Russell NJ. 1998. The effect of growthtemperature on the phospholipid and fatty acyl compositions of non-proteolytic Clostridium botulinum. Int. J. Food Microbiol. 40:159 –167.http://dx.doi.org/10.1016/S0168-1605(98)00029-4.
and structures of crotonase superfamily enzymes— how nature controlsenolate and oxyanion reactivity. Cell Mol. Life Sci. 65:2507–2527. http://dx.doi.org/10.1007/s00018-008-8082-6.
38. Kaneda T. 1991. Iso- and anteiso-fatty acids in bacteria: biosynthesis,function, and taxonomic significance. Microbiol. Rev. 55:288 –302.
39. Elsden SR, Hilton MG, Parsley KR, Self R. 1980. The lipid fatty acids ofproteolytic clostridia. J. Gen. Microbiol. 118:115–123.
40. Moss CW, Lewis VJ. 1967. Characterization of clostridia by gas chroma-tography. I. Differentiation of species by cellular fatty acids. Appl. Micro-biol. 15:390 –397.
41. Elsden SR, Hilton MG. 1978. Volatile acid production from threonine,valine, leucine, and isoleucine by clostridia. Arch. Microbiol. 117:165–172. http://dx.doi.org/10.1007/BF00402304.
42. Kimble CE, McCollough ML, Paterno VA, Anderson AW. 1969. Com-parison of the fatty acids of proteolytic type B and nonproteolytic types Eand F of Clostridium botulinum. Appl. Microbiol. 18:883– 888.
43. Vollherbst-Schneck K, Sands JA, Montenecourt BS. 1984. Effect ofbutanol on lipid composition and fluidity of Clostridium acetobutylicumATCC 824. Appl. Environ. Microbiol. 47:193–194.
44. Cybulski LE, Albanesi D, Mansilla MC, Altabe S, Aguilar PS, de Men-doza D. 2002. Mechanism of membrane fluidity optimization: isothermalcontrol of the Bacillus subtilis acyl-lipid desaturase. Mol. Microbiol. 45:1379 –1388. http://dx.doi.org/10.1046/j.1365-2958.2002.03103.x.
45. Aguilar PS, Cronan JE, Jr, de Mendoza D. 1998. A Bacillus subtilis geneinduced by cold shock encodes a membrane phospholipid desaturase. J.Bacteriol. 180:2194 –2200.
46. Lehmann D, Honicke D, Ehrenreich A, Schmidt M, Weuster-Botz D,Bahl H, Lütke-Eversloh T. 2012. Modifying the product pattern of Clos-tridium acetobutylicum: physiological effects of disrupting the acetate andacetone formation pathways. Appl. Microbiol. Biotechnol. 94:743–754.http://dx.doi.org/10.1007/s00253-011-3852-8.
47. Lindström M, Hinderink K, Somervuo P, Kiviniemi K, Nevas M, ChenY, Auvinen P, Carter AT, Mason DR, Peck MW, Korkeala H. 2009.
Comparative genomic hybridization analysis of two predominant Nordicgroup I (proteolytic) Clostridium botulinum type B clusters. Appl. Envi-ron. Microbiol. 75:2643–2651. http://dx.doi.org/10.1128/AEM.02557-08.
48. Hinderink K, Lindström M, Korkeala H. 2009. Group I Clostridiumbotulinum strains show significant variation in growth at low and hightemperatures. J. Food Prot. 72:375–383.
49. Nevas M, Lindström M, Hautamäki K, Puoskari S, Korkeala H. 2005.Prevalence and diversity of Clostridium botulinum types A, B, E, and F inhoney produced in the Nordic countries. Int. J. Food Microbiol. 105:145–151. http://dx.doi.org/10.1016/j.ijfoodmicro.2005.04.007.
50. Nevas M, Lindström M, Hielm S, Björkroth KJ, Peck MW, Korkeala H.2005. Diversity of proteolytic Clostridium botulinum strains, determinedby a pulsed-field gel electrophoresis approach. Appl. Environ. Microbiol.71:1311–1317. http://dx.doi.org/10.1128/AEM.71.3.1311-1317.2005.
51. Wu J, Rosen BP. 1993. The arsD gene encodes a second trans-actingregulatory protein of the plasmid-encoded arsenical resistance operon.Mol. Microbiol. 8:615– 623. http://dx.doi.org/10.1111/j.1365-2958.1993.tb01605.x.
52. Rosen BP, Liu Z. 2009. Transport pathways for arsenic and selenium: aminireview. Environ. Int. 35:512–515. http://dx.doi.org/10.1016/j.envint.2008.07.023.
53. Connan C, Brueggemann H, Mazuet C, Raffestin S, Cayet N, PopoffMR. 2012. Two-component systems are involved in the regulation ofbotulinum neurotoxin synthesis in Clostridium botulinum type Astrain Hall. PLoS One 7:e41848. http://dx.doi.org/10.1371/journal.pone.0041848.
54. Cooksley CM, Davis IJ, Winzer K, Chan WC, Peck MW, Minton NP. 2010.Regulation of neurotoxin production and sporulation by a putative agrBDsignaling system in proteolytic Clostridium botulinum. Appl. Environ. Micro-biol. 76:4448–4460. http://dx.doi.org/10.1128/AEM.03038-09.
55. Riley M. 1993. Functions of the gene products of Escherichia coli. Micro-biol. Rev. 57:862–952.
