The Effects of EPA and DHA on the UterineInflammatory Response in Mares during
In Vitro Culture of Endometrial Tissue
Item Type Electronic Dissertation; text
Authors Penrod, Leah Vee
Publisher The University of Arizona.
Rights Copyright © is held by the author. Digital access to this materialis made possible by the University Libraries, University of Arizona.Further transmission, reproduction or presentation (such aspublic display or performance) of protected items is prohibitedexcept with permission of the author.
Download date 17/05/2018 14:16:38
Link to Item http://hdl.handle.net/10150/145149
1
THE EFFECTS OF EPA AND DHA ON THE UTERINE INFLAMMATORY
RESPONSE IN MARES DURING IN VITRO CULTURE OF ENDOMETRIAL TISSUE
by
Leah Vee Penrod
A Dissertation Submitted to the Faculty of the
DEPARTMENT OF ANIMAL SCIENCES
In Partial Fulfillment of the Requirements
For the Degree of
DOCTOR OF PHILOSOPHY
In the Graduate College
THE UNIVERSITY OF ARIZONA
2011
2
THE UNIVERSITY OF ARIZONA
GRADUATE COLLEGE
As member of the Final Committee, we certify that we have read the dissertation
prepared by Leah Vee Penrod____________________________________________
entitled The effects of EPA and DHA on the uterine inflammatory response in mares
during in vitro culture of endometrial tissue__________________________________
and recommend that it be accepted as fulfilling the dissertation requirement for
Degree of Doctor of Philosophy___________________________________________
_____Dr. Mark J Arns_____________________Date: 4/15/2011
Mark J. Arns
_____Dr. Sean W Limesand________________Date: 4/15/2011
Sean W. Limesand
_____Dr. Ron E Allen_____________________Date: 4/15/2011
Ron E. Allen
_____Dr. Michelle L Rhoads___ _________ Date: 4/15/2011
Michelle L. Rhoads
_____Dr. Peder S Cuneo___________________Date: 4/15/2011
Peder S. Cuneo
Final approval and acceptance of this dissertation is contingent upon the candidate’s
submission of the final copies of the dissertation to the Graduate College.
I hereby certify that I have read this dissertation prepared under my direction and
recommend that it be accepted as fulfilling the dissertation requirement.
____Dr. Mark J Arns_______________________Date: 4/29/2011
Dissertation Director: Mark J Arns
3
STATEMENT BY AUTHOR
This dissertation has been submitted in partial fulfillment of requirements for an
advanced degree at The University of Arizona and is deposited in the University Library
to be made available to borrowers under rules of the Library.
Brief quotations from this dissertation are allowable without special permission, provided
that accurate acknowledgement of source is made. Requests for permission for extended
quotation from or reproduction of this manuscript in whole or in part may be granted by
the head of the major department or the Dean of the Graduate College when in his or her
judgment the proposed use of the material is in the interests of scholarships. In all other
instances, however, permission must be obtained from the author.
SIGNED: Leah Vee Penrod
4
ACKNOWLEDGEMENTS
First, I would like to thank my mentor and advisor, Dr, Mark Arns for his support
and guidance through both my Master’s and Doctorate. You have contributed to the
person I am today through your guidance and exceptional example. You set the bar high
for me and expected more from me than I have of myself. I appreciate your confidence in
me to complete this endeavor, without you it would not have been possible. Thank you
for sharing your wealth of knowledge with me. I am grateful for everything you have
done for me.
Secondly, I would like to thank Dr. Sean Limesand for his help and guidance with
making my research ideas and goals possible. Thank you for sharing your expertise and
knowledge as well as the major contribution you have made to my graduate career. You
also set the standards high for me and guided me to success. I am grateful for you
guidance, support, and encouragement throughout my Doctorate.
Thirdly, I would like to extend a thank you to my committee Dr. Ron Allen, Dr.
Michelle Rhoads, and Dr. Peder Cuneo. Each of you contributed a great depth of
knowledge and expertise to my research and graduate experience. Thank you for your
guidance and contribution to my studies and graduate career.
Fourth, to my friends, fellow graduate students, and undergraduate students. I am
grateful for your help and support through this project. I could not have survived graduate
school without you.
Fifth, I would like to thank my mother, Lori, father, Greg, and sister, Ashley, as
well as my boyfriend, Zane. I would like to express my sincere gratitude for your support,
guidance, and encouragement. You always believed in me and provided me with the
opportunities to achieve my goals and dreams. Without your love and support, none of
this would have been possible. I am grateful to have such a wonderful family.
Lastly, I would like to thank Cooper and Bandit for always listening and
providing my with my stress-relieving walk every night.
5
TABLE OF CONTENTS
LIST OF FIGURES………………………………………………………………….........8
LIST OF TABLES……………………………………………………………………….10
ABSTRACT……………………………………………………………………………...11
CHAPTER 1: LITERATURE REVIEW………………………………………………...13
Introduction……...……………………………………………………………………13
The Inflammatory Response………….………………………………………………15
Endometritis and early embryonic loss…………………………………………..15
Spermatozoa and seminal plasma effects………………………………………..18
Mares susceptible and resistant to endometritis………………………………….18
Summary…………………………………………………………………………19
Prostaglandins………………………………………………………………………...21
Prostaglandin production by cell type……………………………………………26
Steroid hormones and prostaglandins……………………………….……………27
Prostaglandin and enzyme expression…………………………………………...28
Interleukin effects on enzyme expression………………………………………..31
Oxytocin effects on enzyme expression…………………………………………31
Oxytocin…..…………………………………………………………………………..33
Oxytocin stimulated prostaglandin release………………………………………34
Oxytocin receptor antagonist…………………………………………………….38
Lipopolysaccharide……….…………………………………………………………..40
Toll-like receptors………………………………………………………………..40
LPS and prostaglandin secretion…………………………………………………41
Dietary Influences on the Inflammatory Response…………………...………………43
Polyunsaturated fatty acids………………………………………………………43
Fatty acid uptake…………………………………………………………………44
Omega-3 fatty acids and equine………………………………………………….45
Omega-3 fatty acids and female reproduction…………………………………...47
Omega-3 fatty acids and prostaglandins…………………………………………49
Omega-3 fatty acids and prostaglandin synthesis………………………………..51
Modulation of prostaglandin synthesis…………………………………………..53
Summary….…………………………………………………………………………...54
CHAPTER 2: ESTABLISHMENT AND CHARACTERIZATION OF EQUINE
ENDOMETRIAL CELL CULTURES AND OXYTOCIN STIMULATED
PRODUCTION OF PGF2α………………………………………………………………55
Abstract…...…………………………………………………………………………..55
Introduction……...……………………………………………………………………57
Materials and Methods………….…………………………………………………….59
Materials…………………………………………………………………………59
Animals…………………………………………………………………………..59
6
TABLE OF CONTENTS- continued
Experiment I……………………………………………………………………...59
Endometrial cell proliferation……………………………………………………61
Immunofluorescent staining……………………………………………………...62
Experiment II…………………………………………………………………….63
Statistical analysis………………………………………………………………..64
Results…..…………………………………………………………………………….65
Endometrial cell proliferation and characterization……………………………...65
Experiment I……………………………………………………………………...65
Experiment II…………………………………………………………………….65
Discussion…..………………………………………………………………………...66
CHAPTER 3: OXYTOCIN STIMULATED RELEASE OF PGF2α AND INHIBITION
OF PGF2α RELEASE BY A CYCLOOXYGENASE INHIBITOR, INDOMETHACIN,
AND AN OXYTOCIN RECEPTOR ANTAGONIST, ATOSIBAN, FROM EQUINE
ENDOMETRIAL CULTURES………………………………………………………….79
Abstract…...…………………………………………………………………………..79
Introduction……...……………………………………………………………………81
Materials and Methods………………………………………………………………..84
Materials…………………………………………………………………………84
Animals…………………………………………………………………………..84
Oxytocin dose response………………………………………………………….84
Uterine endometrial explant culture response to oxytocin………………………85
Uterine endometrial explant cultures in the presence of inhibitors……………...86
Enzyme immunoassay…………………………………………………………...87
Statistical analysis………………………………………………………………..87
Results…..…………………………………………………………………………….88
Oxytocin dose response………………………………………………………….88
Oxytocin stimulated PGF2α production over time……………………………….88
Inhibition of PGF2α release in endometrial explants…………………………….88
Discussion…..………………………………………………………………………...89
CHAPTER 4: EFFECTS OF OXYTOCIN, LPS, AND POLYUNSATURATED FATTY
ACIDS ON PROSTAGLANDIN SECRETION AND GENE EXPRESSION IN EQUINE
ENDOMETRIAL EXPLANT CULTURES……………………………………………..94
Abstract……...………………………………………………………………………..94
Introduction……...……………………………………………………………………96
Materials and Methods………………………………………………………………..97
Materials…………………………………………………………………………97
Animals…………………………………………………………………………..97
Fatty acid preparation……………………………………………………………97
Experiment I: fatty acid uptake…………………………………………………..98
Experiment II: effect of PUFAs on PG release and gene expression……………99
7
TABLE OF CONTENTS- continued
RNA extraction and quantitative real-time PCR (qPCR)………………………..99
Statistical analysis………………………………………………………………100
Results…..………………………………...…………………………………………101
Experiment I…………………………………………………………………….101
Experiment II…………………………………………………………………...101
qPCR…………………………………………………………………………....101
Discussion…...………………………………………………………………………103
REFERENCES…………………………………………………………………………112
8
LIST OF FIGURES
FIGURE 1.1 Prostaglandin Biosynthesis………………………………………………...23
FIGURE 1.2 Synthesis of 1-, 2-, and 3-series prostaglandins from dietary polyunsaturated
fatty acids through desaturation and chain elongation. (Wathes et al., 2007)…………...44
FIGURE 1.3 Three step method for absorption and transportation of long-chain fatty
acids across the cell membrane (Hamilton et al., 2002)…………………………………45
FIGURE 2.1 Equine endometrial tissue sections stained with a) DAPI (blue stained cells)
at 10x b) tissue section with both DAPI and Cytokeratin (green stained cells) at 10x
magnification and c) tissue section stained with both DAPI and Cytokeratin at 20x
magnification…………………………………………………………………………….71
FIGURE 2.2 Equine endometrial cell cultures following 6 days incubation that have been
stained with a) DAPI (blue stained cells) b) epithelial cell staining with primary
antiserum Cytokeratin (green stained cells) and c) cells that are both stained with DAPI
and Cytokeratin…………………………………………………………………………..72
FIGURE 2.3 Equine endometrial cell cultures following 24 h incubation with BrdU
(brown stained cells) and epithelial cell staining with primary antiserum Cytokeratin
(pink stained cells) at a) 4 days, b) 5 days, and c) 7 days in culture. Cells that are both
stained with BrdU and Cytokeratin are replicated epithelial cells.....................................73
FIGURE 2.4 Prostaglandin F2α (PGF2α) concentrations (mean + s.e.m) at 6 and 24 hours
in the absence (0nM,-Oxy ) or presence (250nM, +Oxy ) of oxytocin for equine
endometrial cell cultures……………………………..…………………………………..74
FIGURE 2.5 Prostaglandin F2α metabolite (PGFM) concentrations (mean + s.e.m) at 6
and 24 hours in the absence (0nM,-Oxy ) or presence (250nM, +Oxy ) of oxytocin
for equine endometrial cell cultures……………………………………………………...75
FIGURE 2.6 Prostaglandin F2α (PGF2α) concentrations at 6 hours for equine endometrial
cell cultures grown with or without a basement membrane matrix and without (“0%”) or
with (“10%”) additional horse serum added to the culture media. Endometrial cell
cultures were in the absence (0nM, “No”) or presence (250nM, “Yes”) of oxytocin…...76
FIGURE 2.7 Prostaglandin F2α (PGF2α) concentrations at 24 hours for equine
endometrial cell cultures grown with or without a basement membrane matrix and
without (“0%”) or with (“10%”) additional horse serum added to the culture media.
Endometrial cell cultures were in the absence (0nM, “No”) or presence (250nM, “Yes”)
of oxytocin……………………………………………………………………………….77
9
LIST OF FIGURES- continued
FIGURE 3.1 Prostaglandin F2α concentrations (PGF2α) (+ s.e.m) in equine endometrial
explant cultures after 24 h in the absence or presence of increasing concentrations of
oxytocin……………………………………………………………………………….….91
FIGURE 3.2 Prostaglandin F2α concentrations (+ s.e.m) in equine endometrial explant
cultures during 24 h of culture in the absence (-Oxy) or presence (+Oxy) of oxytocin…92
FIGURE 3.3 Prostaglandin F2α concentrations (+ s.e.m) in equine endometrial explant
cultures in response to oxytocin after 6 h of culture with increasing concentrations of
Indomethacin or Atosiban………………………………………………………………..93
FIGURE 4.1 Proportion of a) AA, b) EPA, and c) DHA content within equine
endometrial explants when cultured with 100 µM AA, 100 µM EPA, 100 µM DHA, or
50 µM EPA + 50 µM DHA for 24 h. Endometrial explants incorporated EPA and DHA
and tended to incorporate AA. …………………………………………………………109
FIGURE 4.2 Effects of a) stimulant and b) fatty acid treatment on PGF2α secretion in
equine endometrial explants cultured for 6 h in the presence of no stimulus (control),
LPS, or oxytocin. Due to non-homogeneity among the variances, data was transformed
using logarithmic 10 for statistical analysis; data presented is non-transformed means ±
s.e.m.…………………………………………………………………………………....110
FIGURE 4.2 Effects of a) stimulant and b) fatty acid treatment on PGE2 secretion in
equine endometrial explants cultured for 6 h in the presence of no stimulus (control),
LPS, or oxytocin. Due to non-homogeneity among the variances, data was transformed
using logarithmic 10 for statistical analysis; data presented is non-transformed means ±
s.e.m…………………………………………………………………………………….111
10
LIST OF TABLES
TABLE 2.1 Epithelial and total cell number within each culture condition system…….78
TABLE 4.1 Equine oligonucleotide primers used in this study………………………..107
TABLE 4.2 Gene expression in equine endometrial explants cultured with PUFAs for 24
h and stimulated with oxytocin or LPS for 6 h. Quantitative PCR was performed (n =7
except Cox-1, where n=4)…………………………..…………………………………..108
11
ABSTRACT
Uterine inflammation is one of the causes of a poor uterine environment. This can
result in early embryonic loss in the mare due to an inhibition of or an increased secretion
of prostaglandin F2α (PGF2α). Oxytocin binds to endometrial cell receptors to activate
prostaglandin synthesis. Increased secretion or accumulation of PGF2α within the uterus
due to uterine inflammation can cause luteolysis and result in early embryonic loss.
Supplementation with polyunsaturated fatty acids (PUFAs) has been shown to influence
prostaglandin production in many species, although the effects on the mare remain
unknown. Equine endometrial biopsies were collected and used to establish endometrial
epithelial cell and explant cultures to determine the release of PGF2α and PGFM in
response to oxytocin stimulation. Endometrial explant cultures were used to determine
the inhibitory effects of Atosiban, an oxytocin receptor antagonist, and Indomethacin, a
cyclooxygenase-2 inhibitor, on PGF2α secretion. Endometrial explant cultures were
challenged with oxytocin (250 nM) and PGF2α concentrations were measured over time.
The effects of PUFAs on equine endometrial prostaglandin production were determined
using endometrial biopsies harvested on day two of behavioral estrus. Equine endometrial
cells were established and shown to replicate in culture and on a basement membrane
matrix. Equine endometrial explants stimulated with oxytocin had increased secretion of
PGF2α and PGE2 and the secretion of PGF2α was inhibited through an oxytocin receptor
antagonist and Cox inhibition. Endometrial explants stimulated with lipopolysaccharide
had increased secretion of PGF2α and PGE2, however oxytocin stimulated to a greater
extent than LPS. Supplementation with PUFAs, specifically DHA, decreased the
12
secretion of PGF2α and PGE2, however AA and EPA failed to influence this response.
Expression of mRNA was not influenced by fatty acid supplementation, however was
altered by stimulus. Therefore DHA influences the inflammatory response in vitro
through mechanisms other than enzyme expression. Decreased PGF2α production
associated with PUFA supplementation in vitro, creates a likely approach for decreasing
early embryonic loss associated with post breeding inflammation commonly seen in the
equine industry.
13
CHAPTER 1
LITERATURE REVIEW
Introduction
Uterine infection, inflammation, and early embryonic loss are major
factors contributing to low pregnancy rates in the equine industry. Early embryonic loss
is also a major problem in the cattle industry. Every year 4.71 million calves are lost to
poor reproductive efficiency in the United States (Roesler, 2007). In aged mares, early
embryonic loss occurring before day 14 post ovulation can be as high as 70% (Ball et al.,
1986). Dietary supplementation with omega-3 fatty acids has been found to lower the
incidence of early embryonic loss in cattle. The effects of omega-3 fatty acid
supplementation on uterine function in the mare have not yet been determined. Potential
benefits of omega-3 fatty acid supplementation, especially for older mares or mares with
poor reproductive tract physiology, include increased pregnancy rates, decreased early
embryonic losses, and increased pre-ovulatory follicular size. If benefits are found from
omega-3 fatty acid supplementation, the equine breeding industry would profit from
increased reproductive efficiency and decreased economic losses associated with early
embryonic demise. Proven fertility benefits with dietary supplementation of
polyunsaturated fatty acids (PUFAs) have been found in the cow, ewe, rat, and human.
Dietary supplementation with omega-3 fatty acids in the mare and influences on
reproductive function and inflammation has not been described in the literature.
However, a potential role for omega-3 fatty acids in female reproductive function has
been documented in a number of mammalian species. This review will describe the
14
uterine inflammatory response and the potential to utilize dietary supplementation of
omega-3 fatty acids to enhance reproductive function in the mare.
15
The Inflammatory Response
Endometritis and early embryonic loss
Persistent endometritis causes decreased conception rates in the brood mare and is
considered one of the top three clinical problems facing the equine industry (Troedsson,
1999). Endometritis that persists following mating affects 15% of mares and reduces
fertility (Rigby et al., 2001). In the normal mare, physical barriers protect the
reproductive tract from external contamination. If these barriers become compromised,
the mare is susceptible to uterine infection. Breeding, regardless of whether it is natural
service or by artificial insemination, also causes an inflammatory response, which can
lead to uterine infections in some mares.
In the mare, early embryonic loss is the failure to retain pregnancy between
fertilization and day 40 of gestation (Vanderwall, 2008). In a review by Vanderwall
(2008), early embryonic loss incidence in the equine industry ranged from 2.6% to
30.0%, with the highest early embryonic loss of 20.0% to 30.0% occurring in mares
eighteen years of age or older. Early embryonic loss between fertilization and day 14 is
much higher for aged mares (60% to 70%) as compared to young mares (<10%) (Ball et
al., 1986 and 1989). Costs associated with additional breeding of the mare and decreases
in foaling rates due to early embryonic loss create an economic loss for the equine
industry; therefore if dietary supplementation with PUFAs proves beneficial in the mare,
the equine industry could profit greatly from these affects.
Inflammation associated with persistent endometritis typically causes an increase
in PGF2α secretion and frequently results in premature luteolysis and early embryonic
16
loss (Neely et al., 1979). Early embryonic loss can result from an increase in
prostaglandin F2α secretion during early pregnancy (Mattos et al., 2003). When
inflammation persists after fertilization, bacteria, fluid, and inflammatory products can
create a hostile environment, which is unsuitable for survival of the conceptus (Smith et
al., 1971). Foreign material, bacteria, spermatozoa, and seminal components trigger an
inflammatory response in the uterus of the mare. Lehrer and colleagues (1988)
discovered that inflamed areas are first invaded by the inflammatory cells,
polymorphonuclear neutrophils (PMNs). An influx of PMNs into the uterine lumen is the
first indication of an inflammatory response and occurs within 30 minutes following
breeding or insemination (Troedsson et al., 2001; Katila, 1995). Rapid migration of
PMNs into the uterine lumen is thought to be mediated by chemoattractive properties of
uterine fluid, in which PMN-chemotactic mediators are quickly released from the uterus
in response to foreign material (Pycock and Allen, 1988). Phagocytosis and opsonization
of foreign material also occurs through complement proteins. Complement protein 3 (C3)
is the most abundant of all complement proteins found in the body (Sompayrac, 2008)
and the presence of C3 and complement cleavage factors have been shown in the equine
reproductive tract (Watson et al., 1987; Troedsson et al., 1993). The complement cascade
serves as part of the innate immune response to defend against foreign material and
bacteria by increasing vascular permeability, chemotaxis, lysing of bacteria through the
membrane attack complex, and opsonization of bacteria (Troedsson, 1999; Sompayrac,
2008). Activation of the complement cascade by equine spermatozoa is thought to induce
PMN chemotaxis (Troedsson, 1995). The protein C3 is cleaved in the body into reactive
17
protein fragments, one of which is C3b (Sompayrac, 2008), where along with
immunoglobulins (IgG and IgA), serve as opsonins for PMNs (Troedsson et al., 1993).
Arachidonic acid metabolites, leukotriene B4 (LTB4), prostaglandin E2 (PGE2), and
PGF2α, are important inflammatory mediators in the mare and are believed to serve as
chemoattractants for PMNs (Troedsson, 1999; Watson et al., 1988; Pycock and Allen,
1988). Leukotriene B4 is produced from leukocytes and stimulates the activation and
adhesion of leukocytes to the endothelium, which along with PGE2 enhances plasma
leakage (Watson et al., 1988). Cytokines released from lymphocytes and macrophages
during inflammation trigger various cascades of inflammatory mediators. Interleukin 1
(IL-1) stimulates the production of prostaglandins by increasing synthesis of
cyclooxygenase 2 (Cox-2) and inducing expression of terminal enzymes, such as
prostaglandin synthases E and F (PGES, PGFS). Interleukin 1 decreases 15-hydroxy-
prostaglandin dehydrogenase (PGDH), which is responsible for the conversion of PGF2α
into its metabolite. Phagocytosis of the foreign material in the uterus will also cause the
release of PGF2α. This release causes myometrium contractions, which aid in the
expulsion of dead spermatozoa and contaminating material from the uterus.
In the healthy mare, post-breeding inflammation is cleared within twenty-four
hours (Katila, 1995). Prostaglandin levels and inflammatory products decrease once the
inflammation is cleared. Although in older and susceptible mares the inflammation
persists due to fluid accumulation that cannot effectively be dispelled, which can
decrease conception in these mares. Early embryonic loss in the equine can be
contributed to a number of factors, including poor uterine environment. Uterine infection
18
and inflammation are likely the primary causes of creating a poor uterine environment
(Adams et al., 1987; Dimock and Edwards, 1928; Saltiel et al., 1986).
Spermatozoa and seminal plasma effects
Seminal plasma has been shown to suppress chemotaxis and migration of PMNs
in vitro, as well as have an immunosuppressive effect on various parts of the immune
system in different species (Troedsson, 1995; Fahmi et al., 1985). Seminal plasma is
therefore believed to modulate uterine inflammation, allowing spermatozoa to travel
through the uterus to the oviducts. Troedsson and colleagues (2002) demonstrated the
inflammatory reaction was of shorter duration when seminal plasma was included in the
inseminate, likely due to an altered inflammatory response, however the mechanism is
not clear. Typically there is an enhanced uterine inflammatory response in mares bred
with frozen/thawed semen, possibly due to removal of seminal plasma (Troedsson, 1995).
Seminal plasma also may provide protection to the spermatozoa against phagocytosis and
inflammatory factors. When spermatozoa are introduced into an inflammatory
environment, they bind to PMNs and form large clusters, decreasing motion and
mobility. Troedsson and researchers (2002) have shown support for the protective role of
seminal plasma in vitro and in vivo, by decreasing the binding between spermatozoa and
inflammatory cells.
Mares susceptible and resistant to endometritis
Mares with delayed uterine clearance following breeding can incur persistent
endometritis that can result in reduced fertility. During pregnancy, repeated and
prolonged stretching of the uterus occurs and can result in reproductive structural changes
19
that could increase the intensity and duration of an inflammatory response within the
uterine lumen. It has also been suggested that mares susceptible to uterine infections have
depressed immune responses, impaired or deficient PMNs, and/or opsonin (complement
cleavage factor and immunoglobulins) dysfunction (Watson et al., 1987; Troedsson et al.,
1993). Watson and colleagues (1987) demonstrated inhibited migration of blood
neutrophils and decreased phagocytic capabilities of uterine neutrophils from susceptible
mares as compared to resistant mares. Uterine secretions from susceptible mares also
showed a decrease in the ability of neutrophils to promote bactericidal activity, not
related to a deficiency in complement activity. Troedsson and colleagues (1993) found
susceptible mares showed a constant decline in IgG and C3 concentrations at 36 hours
compared to resistant mares, which demonstrated an increase in opsonin concentrations.
Concentrations were similar during the first 24 hours following infection, therefore an
immunoglobulin deficiency is not likely the cause of persistent uterine infections in
susceptible mares. Rigby et al. (2001) found an intrinsic contractile defect of the
myometrium in mares with delayed uterine clearance, suggesting it might contribute to
reduced uterine contractility and lead to a uterine infection in susceptible mares.
Summary
The inflammatory response in healthy mares consists of an influx of PMNs,
opsonization and phagocytosis of foreign material, and the clearance of fluid and
contaminating material within an appropriate time period. This inflammatory response
can be influenced by the removal or addition of seminal plasma to the inseminate. Mares
prone to infection or persistent endometritis are at increased risk of early embryonic loss,
20
possibly due to compromised external genitalia, impaired or deficient PMNs and
immunoglobulins, opsonin dysfunction, and/or a myometrial defect. Regardless of cause,
prolonged uterine inflammation can increase secretion of PGF2α and create an unsuitable
environment for the embryo, decreasing fertility in the susceptible mare.
21
Prostaglandins
Prostaglandin secretion and synthesis involves an intracellular cascade of actions.
The arachidonate cascade has three major pathways, including cyclooxygenase,
lipoxygenase (iron containing enzyme that catalyses the dioxygenation of PUFAs in
lipids), and epoxygenase (an enzyme that produces signaling enzymes involved in cell
proliferation) (Smith et al., 1991). The cyclooxygenase pathway includes the formation of
prostaglandins, leukotrienes, and thromboxanes from arachidonic acid in three phases.
The first phase is the mobilization of arachidonic acid: Arachidonic acid is cleaved from
the sn-2 position of the membrane phospholipids through the activation of phospholipase
C (PLC) or A2 (PLA2) (Smith et al., 1991). Arachidonic acid is converted into
prostaglandin G2 (PGG2) via prostaglandin endoperoxide H synthase-1 or -2 (also known
as Cyclooxygenase and PTGS). Prostaglandin G2 is further converted into prostaglandin
H2 (PGH2) by cyclooxygenase-1 or-2 (Cox-1 and Cox-2). The rate limiting step in the
production of prostaglandins occurs during the conversion of arachidonic acid into PGH2.
Cyclooxygenases-1 and -2 are considered to be the rate limiting enzymes in production of
endometrial prostaglandins (Arosh et al., 2002), as they convert arachidonic acid into
PGH2. Cyclooxygenase-1 is expressed in various cell types and it appears that acute
stimuli do not regulate the expression or release of Cox-1 (Burns et al., 1997); whereas
Cox-2 is inducible, expressed in fewer tissue types, and is acutely regulated.
Cyclooxygenase-2 can be regulated by acute stimuli, including hormones and growth
factors, during the synthesis of prostaglandins (Burns et al., 1997) and is likely
responsible for the main production of prostaglandins during an inflammatory response
22
because of its inducible capabilities (Crofford, 1997). It also appears Cox-2 is the
predominant form expressed in ovine and bovine endometrium throughout the estrous
cycle (Burns et al., 1997; Arosh et al., 2002). The conversion of PGH2 into PGF2α occurs
through a reduction via PGFS, and PGE2, PGI2, and PGD2 through isomerization via
PGES, PGIS, and PGDS, respectively (Smith, 1992). There are three isozymes of PGES,
two microsomal (PGES-1 and PGES-2) and one cytosolic (PGES-3). Prostaglandins F2α
and E2 are both produced in the endometrium and myometrium of uteri of various
animals. Prostaglandin F2α plays a vital role in luteolysis and is secreted from the
endometrium in pulses in response to endogenous oxytocin. Luteolysis or pregnancy
recognition occurs on days 15-17 of the bovine estrous cycle (Arosh et al., 2002) and on
day 14 of the equine estrous cycle. In the bovine, PGF2α secretion is inhibited by
interferon τ and prevents luteolysis during early pregnancy. PGE2 is believed to also be
involved in maternal recognition in ruminants by acting as a temporary luteotrophic
signal or having antiluteolytic actions (Pratt et al., 1977; Asselin et al., 1997).
23
Figure 1.1 Prostaglandin Biosynthesis.
The hormone-like chemicals, prostaglandins, are produced on demand and there is
no storage of them within the body; therefore the half life of prostaglandins is very short.
Prostaglandin F2α is quickly degraded in vivo to a more stable, biologically inactive
metabolite 13, 14-dihydro-15-keto PGF2α (PGFM) by 15-hydroxy-prostaglandin
dehydrogenase (PGDH). This enzyme is found in high levels in lung, liver, and placenta
tissues (Farina et al., 2004). Due to the short half-life of prostaglandins, they send signals
Cell membrane phospholipids
Phospholipase A2
Arachidonic Acid
Cyclooxygenase-1 (Cox-1)
Cyclooxygenase-2 (Cox-2)
PGG2
Cyclooxygenase-1 (Cox-1)
Cyclooxygenase-2 (Cox-2)
PGH2
PG synthases
PGF2α PGE2 PGD2 PGI2 PGE2 9-ketoreductase
PGD2 11-ketoreductase
24
in a paracrine (locally within the reproductive tract) or an autocrine (acting within the
same cell in the endometrium) fashion.
Prostaglandins control and influence many processes throughout the body,
including regulation of blood pressure and clotting, sleep, labor, and inflammatory
processes (Mitchell et al., 1992). In reproduction, prostaglandins have three main
functions, including causing ovulation, luteal maintenance and regression. When PGF2α
is given by subcutaneous, intramuscular, or intrauterine routes, it has been shown to
cause luteolysis in the mare (Allen and Rowson, 1973). Endogenous prostaglandin
release can be stimulated by the hormone oxytocin. Oxytocin is released from the
posterior pituitary gland and travels to the uterus where it binds to a G coupled protein
receptor to stimulate PGF2α release (Gimpl and Fahrenholz, 2001). Oxytocin is released
in pulses, causing the uterus to respond with pulsatile PGF2α release. Prostaglandin F2α,
in return, stimulates the release of oxytocin from luteal cells on the corpus luteum in
ruminants (McCracken et al., 1999). Prostaglandin receptors have been found on the
plasma membrane of granulosa derived luteal cells in many species (McCracken et al.,
1999). In contrast in non-ruminants, PGF2α secretion from the uterine endometrium is
stimulated by oxytocin, but it is believed there is no additional PGF2α release from luteal
cells’ release of oxytocin. Oxytocin and PGF2α create a positive feedback loop that is
believed to be necessary for luteolysis (Silvia et al., 1991). This feedback mechanism
stimulates greater secretion of PGF2α from the uterus that may be required for regression
of the corpus luteum. High concentrations and prolonged exposure to oxytocin and
PGF2α can create desensitization of uterine and luteal tissues to further stimulation for
25
approximately 6-8 hours (Silvia et al., 1991). Therefore, this refractoriness of the tissue to
oxytocin and PGF2α is believed to help establish the pulsatile release of PGF2α needed
for luteolysis.
Endocrine regulation of uterine PGF2α production and secretion has not been
determined in the mare, although it has been shown PGF2α release from the endometrium
results in luteolysis (Irvine, 1995). In 1985, Betteridge and colleagues demonstrated the
administration of oxytocin to mares in late diestrus caused an increase in peripheral 13,
14-dihydro-15-keto PGF2α (PGFM) plasma concentrations, suggesting oxytocin’s role in
luteolysis. Exogenous administration of oxytocin has been shown to stimulate PGF2α
release from the endometrium and cause luteolysis (Goff et al., 1987). Moreover, the
secretion of uterine endometrial PGF2α in response to oxytocin administration has been
shown to be dependent on stage of estrous (Sharp et al., 1997). Similarly, oxytocin
stimulated equine endometrial explants demonstrated variable response during culture
with maximal release on day 14 post ovulation (King and Evans, 1987). Furthermore,
porcine endometrial cell cultures showed variable prostaglandin release with lowest
production on days 6-8 (Blitek and Ziecik, 2004). In contrast, PGF2α production from
equine endometrial epithelial and stromal cell cultures was not affected by day of cycle
(Watson et al., 1992). However, most research demonstrates low secretion of PGF2α
during estrus, with increasing concentrations during diestrus and maximal secretion
around luteolysis (Vernon et al., 1981; King and Evans, 1987). Therefore, oxytocin
stimulated PGF2α production should be possible from equine endometrial cultures
throughout the estrous cycle.
26
Prostaglandin production by cell type
Prostaglandin production in response to oxytocin stimulation has been previously
evaluated in equine endometrial explant and cell cultures (King and Evans, 1987; Nash et
al., 2008; Watson et al., 1992). Concentrations of PGF2α were higher in oxytocin
stimulated endometrial glandular epithelial cell cultures as compared to non-stimulated
epithelial cells (Watson et al., 1992). Equine endometrial glandular epithelial cells
secreted higher concentrations of PGF2α during culture as compared to endometrial
stromal cells following 24 hours (Watson et al., 1992), demonstrating PGF2α secretion is
mainly from endometrial epithelial cells. Similarly, porcine endometrial epithelial cell
cultures produced higher levels of PGF2α as compared to endometrial stromal cells
(Blitek and Ziecik, 2004).
Overall prostaglandin production varies by cell type and species, but differences
are also observed in PGF2α versus PGE2 secretion. Porcine myometrial explants secrete
higher concentrations of PGE2 as compared to PGF2α when stimulated with oxytocin
(Franczak et al., 2006). Prostaglandin release from endometrial epithelial cells appears to
be predominantly PGF2α, whereas stromal cells produce mainly PGE2. Furthermore,
porcine stromal cell cultures produced higher levels of PGE2 as compared to PGF2α
(Blitek and Ziecik, 2004). Bovine endometrial epithelial cells released higher
concentrations of PGF2α as compared to PGE2 following 6 hours of culture (Tithof et al.,
2007). These studies conclude prostaglandin production is dependent on cell type and day
of the estrous cycle, with highest concentrations of PGF2α release occurring around the
time of luteolysis.
27
Steroid hormones and prostaglandins
Estrogen and progesterone both appear to regulate the synthesis of prostaglandins
from the endometrium. Porcine endometrial glandular epithelial and stromal cells
experienced enhanced basal release of PGF2α when cultured with progesterone
(Carnahan et al., 2002). Estrogen has been shown to modestly stimulate production of
prostaglandins from uterine tissue in several species (McCracken, 2004). Progesterone
failed to influence prostaglandin production in equine endometrial explants; however in
vitro exposure to estrogen following prolonged progesterone exposure had a stimulatory
effect on PGF2α secretion (Vernon et al., 1981). In the ovine, McCracken (1980)
discovered estrogen and progesterone indirectly control PGF2α secretion by regulating
oxytocin receptors in the endometrium. Following the decline or removal of
progesterone, there is an increase in estrogen and oxytocin receptors. Similar regulatory
mechanisms have been found in the cow, sow, and mare (McCracken et al., 1999). The
lipophilic steroid hormone, progesterone, is believed to modify the fluidity of cell
membranes and influence receptor and ligand binding (Dunlap and Stormshak, 2004). In
ovine endometrial plasma membrane, progesterone was shown to have a suppressive
effect on the binding of oxytocin following in vivo and in vitro exposure (Dunlap and
Stormshak, 2004). Furthermore, progesterone decreased the stimulatory effect of
oxytocin on bovine myometrial cells without affecting the mRNA expression of Cox-2,
PGFS, or PGES (Slonina et al., 2009).
28
Prostaglandin and enzyme expression
Enzymes involved in the synthesis of prostaglandins include PLA2, Cox-1, Cox-2,
and PG synthases. Phospholipase C and protein kinase C are also involved in the
biosynthesis pathway if production is being stimulated by oxytocin. The mRNA and
protein expression of key enzymes involved in prostaglandin biosynthesis have been
evaluated throughout the estrous cycle in many species. Immunohistochemical analysis
of protein expression distribution in equine endometrium demonstrated co-localization of
Cox-2, PGES, and PGFS in the epithelial cells (Boerboom et al., 2004), indicating
epithelial cells are responsible for the majority of prostaglandin synthesis. Throughout the
estrous cycle, expression of Cox-1 mRNA was low in equine endometrial biopsies (Atli
et al., 2010). Likewise, bovine endometrial tissue lacked expression of Cox-1 mRNA and
protein during the estrous cycle (Arosh et al., 2002). In contrast, Cox-2 mRNA
expression was high on days 13-21 and low on days 1-12, similar to the expression
pattern of PGES (Arosh et al., 2002). Similarly, in sheep, Cox-2 mRNA expression was
found to be highest on days 12-14 and lower during early diestrus in endometrial cells
(Charpigny et al., 1999). Furthermore, Cox-2 mRNA expression in equine endometrium
increased around the time of luteolysis (Boerboom et al., 2004; Atli et al., 2010). This
data suggests that Cox-2 is the primary enzyme involved in the synthesis of
prostaglandins from the endometrium. Alternatively, monkey ovarian epithelium
produced mainly PGE2, and Cox-1 is likely responsible for this production versus Cox-2
(Cabrera et al., 2006), demonstrating differences in expression dependent upon species
and tissue type.
29
In bovine endometrial tissue, there was a correlation between mRNA expression
of Cox-2 and PGES (Arosh et al., 2002). Therefore, production of PGE2 from the bovine
endometrium is produced via the Cox-2 and PGES pathway during the estrous cycle.
Similarly, ovine endometrial cells released the greatest concentrations of PGE2 when
Cox-2 was highly expressed (Charpigny et al., 1999). In contrast, ovine endometrial cells
production of PGF2α is not correlated with changes in expression of Cox-2 around the
time of luteolysis (Charpigny et al., 1999). In the equine, PGFS and PGES mRNA
expression remained the same throughout diestrus, with no increase around the time of
luteolysis, and was unaffected by pregnancy status (Boerboom et al., 2004). In contrast,
Atli and colleagues (2010) observed increased PGFS and PGES mRNA expression in
both cyclic and pregnant mares during diestrus as compared to estrus. Expression of the
synthases was highest around the time of expected luteolysis, and decreased following
luteolysis in cycling mares (Atli et al., 2010).
Pregnancy status has been shown to affect release of PGF2α by decreasing
expression of Cox-2 in the endometrium of mares, affecting the overall release or
pulsatility of PGF2α. The increase in expression of Cox-2 mRNA observed in the cycling
mare does not occur in the pregnant mare (Boerboom et al., 2004). Similarly, Cox-2
mRNA expression was increased during early luteolysis and suppressed by pregnancy in
equine endometrial biopsies (Atli et al., 2010; Ealy et al., 2010). In contrast, increases in
Cox-2 mRNA expression occurred in both pregnant and cycling ewe endometrium
(Charpigny et al., 1999). In porcine myometrial explants, Cox-2 protein levels were
similar in cyclic and pregnant animals on days 14-16 (Franczak et al., 2006).
30
Furthermore, PGES was higher during pregnancy in the porcine as compared to time of
luteolysis, whereas PGFS had the highest expression around luteolysis (Franczak et al.,
2006). This data suggests a species difference in the expression of Cox-2 as it relates to
pregnancy status.
Cyclooxygenase-1 mRNA expression was unaffected by day of cycle or early
days in pregnancy in equine endometrium (Atli et al., 2010). Although on days 18 and 22
of pregnancy, mRNA expression of Cox-1 was up-regulated (Atli et al., 2010).
Furthermore a strong correlation was found between the expression of Cox-2 mRNA and
PGF2α release in the mare (Boerboom et al., 2004). This suggests that PGF2α release
must be blocked by some means during pregnancy, suggesting the conceptus prevents the
increase in mRNA expression of Cox-2. Atli et al. (2010) demonstrated equine
endometrial explants exposed to conceptus secretions decreased mRNA expression of
Cox-2. Similarly, the presence of a conceptus inhibited induction of Cox-2 on day 15 in
pregnant mares as compared to cyclic mares (Boerboom et al., 2004).
Hormonal regulation of enzymes involved in prostaglandin biosynthesis has been
evaluated in many species to determine the role of these enzymes in maternal recognition
of pregnancy. In porcine endometrial explants treated with estrogen, there was increased
expression of PGES mRNA and Cox-2 and PGES protein, which led to increased
secretion of PGE2 (Waclawik et al., 2009). Estrogen also decreased PGFS protein
expression, but did not affect expression of PGFS or PGF2α release from porcine
endometrial explants (Waclawik et al., 2009). In contrast, progesterone did not influence
the protein levels or mRNA expression of Cox-2, PGES, or PGFS in bovine myometrial
31
cells, even when stimulated with oxytocin (Slonina et al. 2009). Therefore, progesterone
inhibits the stimulatory effects of oxytocin on prostaglandin production and enzyme
expression.
Interleukin effects on enzyme expression
Interleukin-1 (IL-1) has been shown to stimulate the production of prostaglandins
from the endometrium and change expression of key enzymes involved in the
biosynthesis of prostaglandins. In bovine endometrial cells incubated with IL-1A,
expression of Cox-2 and PGES-1 mRNA and protein increased, whereas Cox-1, PGES2,
and PGFS mRNA and protein expression was not affected (Tanikawa et al., 2008).
Therefore, increased prostaglandin production due to IL-1 stimulation is likely due to
increased expression of Cox-2 and PGES-1 protein and mRNAs.
Oxytocin effects on enzyme expression
Intracellular mechanisms of oxytocin stimulation of PGF2α have been evaluated
in numerous species. Stimulation of equine endometrial explants with oxytocin increased
mRNA expression of Cox-2 following 6 and 24 hours of culture as compared to un-
stimulated explants (Ealy et al., 2010). In porcine myometrium, oxytocin increased
expression of Cox-2 protein, but did not alter the protein expression of PGES or PGFS
(Franczak et al., 2006). Burns and colleagues (1997) demonstrated oxytocin induces an
increase in the expression of Cox-2 mRNA in association with an increase in PGF2α
secretion in ovine endometrial tissue in vivo. Similarly, bovine endometrial epithelial
cells stimulated with oxytocin had increased mRNA expression of Cox-2 as compared to
un-stimulated cells; however expression of Cox-1 and PLA2 mRNA was not affected by
32
oxytocin stimulation (Asselin et al., 2008). Therefore, it is believed that oxytocin does
not regulate the gene expression of Cox-1 or PLA2, but does have regulatory affects on
Cox-2 mRNA expression. Oxytocin could also control or stimulate these enzymes at the
protein level. Moreover, oxytocin has been shown to increase the PLA2 protein
expression and activity in bovine endometrial epithelial cell cultures (Tithof et al., 2007).
33
Oxytocin
Oxytocin is a mammalian hormone produced by the hypothalamus and in luteal
cells in the ruminant. It has also been shown to be synthesized in other peripheral tissues,
such as the uterus, placenta, heart, testis, and amnion. Oxytocin has been shown to
remain at similar concentrations throughout the estrous cycle and the ovaries are not a
source of oxytocin in the mare (Stevenson et al., 1991). Oxytocin mRNA expression has
been reported in the endometrium of the mare, with maximal expression during late
diestrus and early estrus (Behrendt et al., 1997). Oxytocin gene expression has been
found to be high in the paraventricular and supraoptic nuclei of the hypothalamus (Gimpl
and Fahrenholz, 2001). It is then stored and released from the posterior pituitary gland.
Oxytocin is released in response to parturition, suckling, and certain stressors. In order
for oxytocin to stimulate prostaglandin synthesis, it must bind to its receptor. The
oxytocin receptor is a seven transmembrane class I G protein coupled receptor that is
coupled with a Gq protein to phospholipase C (PLC) (Gimpl and Fahrenholz, 2001). Once
oxytocin binds to its receptor, the G α and β proteins activate PLC. Phospholipase C
generates diacylglycerol (DAG) and inositol triphosphate from phosphatidylinositol,
which in turn stimulates Ca2+
release and protein kinase C (PKC) (Gimpl and Fahrenholz,
2001). The intracellular release of calcium leads to smooth muscle contractions through
activation of the myosin light-chain kinase (Gimpl and Fahrenholz, 2001) and the
activation of PKC triggers the release of AA and therefore begins prostaglandin
synthesis.
34
Oxytocin stimulated prostaglandin release
Phospholipase A2 is responsible for the cleavage of arachidonic acid from the cell
membrane lipid bilayer (Smith et al., 1991). The exact mechanism by which oxytocin
creates a stimulatory effect on the endometrium remains unclear. Phospholipase C and
DAG are believed to be mediators in the stimulatory effects of oxytocin. In ovine
endometrial tissue exposed to oxytocin, a small rise in PLC activity occurs before an
increase in PGF2α secretion (Silvia et al., 1994). Vasopressin, which is known to bind to
the oxytocin receptor, stimulates PGF2α and to a lesser extent PLC; suggesting that
maximal PGF2α can be secreted without maximal PLC activity and PLC activity does not
appear to control oxytocin stimulated PGF2α secretion (Silvia et al., 1994). This indicates
that another mechanism must be involved in the oxytocin stimulated release of
prostaglandins. Phospholipase C hydrolyses DAG from phosphatidylinositol 4, 5-
bisphosphate. Diacylglycerol then can activate PKC and act as a second messenger in the
stimulation of prostaglandin synthesis. Protein kinase C phosphorylates enzymes that are
involved in the cleavage of AA from the cell membrane (Silvia et al., 1994). Analogues
of DAG stimulated PGF2α in ovine endometrial tissue and may mediate oxytocin
stimulation (Silvia et al., 1994). Phospholipase A2 has been shown to simulate the release
of PGF2α in ovine endometrial explants and therefore is likely to mediate oxytocin
stimulated prostaglandin production (Lee and Silvia, 1994). There are two mechanisms
by which oxytocin is thought to stimulate prostaglandin synthesis through PLA2: 1) when
oxytocin binds to its GPCR, it activates PLA2 directly through a GTP-binding regulatory
protein or 2) increased activity of PLC and PKC lead to the activation of PLA2 (Fain et
35
al., 1988). The exact mechanism used by oxytocin to activate PLA2 and prostaglandin
synthesis in the endometrium has yet to be determined.
Oxytocin receptors were shown to have greater binding capacity in the
endometrium as compared to the myometrium in ovine uterine tissue and PGF2α was
enhanced by oxytocin stimulation only in the endometrium (Roberts et al., 1976);
suggesting oxytocin targets the endometrium for PGF2α production. In contrast, the
number of oxytocin binding sites in the mare was found to be greater in the myometrium
than the endometrium, although the affinity of the oxytocin receptors was higher in the
endometrium versus the myometrium (Stull and Evans, 1986). Oxytocin receptors within
the endometrium are up-regulated by an increase in estrogen and decrease in
progesterone during late diestrus (Spencer et al., 1995). Estrogens are believed to
influence the release of PGF2α from the uterus by possibly conditioning the prostaglandin
secretory mechanisms and stimulating the development of oxytocin receptors (Roberts et
al., 1976), indicating a role for steroids in oxytocin stimulated prostaglandin secretion.
Sharma and Fitzpatrick (1974) found that anestrous ewes failed to release PGF in
response to oxytocin stimulation, unless they were first primed with estradiol. Ewes
treated with estradiol on a long term basis had an inhibitory effect on oxytocin receptors
in the endometrium and long term treatment with progesterone enhanced this inhibition
(Vallet et al., 1990). Progesterone receptor expression is down-regulated through
endometrial exposure to circulating progesterone, causing an increase in expression of the
estrogen receptor and up-regulation of oxytocin receptors. In bovine endometrial
explants, treatment with estrogen did not affect concentrations of oxytocin receptors over
36
time, whereas treatment with progesterone decreased the oxytocin receptor
concentrations to less than 35% of the initial levels (Mann, 2001). Furthermore, secretion
of PGF2α from oxytocin stimulated bovine endometrial explants treated with
progesterone was similar to controls and explants treated with estrogen (Mann, 2001).
Therefore, it is possible production of PGF2α is not necessarily dependent on the
concentration of oxytocin receptors, but more on responsiveness of the tissue to oxytocin.
In contrast, porcine endometrial luminal epithelial cells treated with progesterone and
stimulated with oxytocin had an enhanced secretion of PGF2α (Carnahan et al., 2002),
despite a lack of change in the activity of PLC.
The release of oxytocin creates a positive feedback loop, in which PGF2α
synthesis and release causes additional secretion of oxytocin from the CL (Flint and
Sheldrick, 1982) and hypothalamus (Silvia et al., 1991). A positive feedback loop exists
in the mare and involves endometrial PGF2α and endometrial and pituitary oxytocin
(Stout and Allen, 1999). In the ewe, Silvia and colleagues (1991) found oxytocin release
from the hypothalamic-pituitary axis contributed to the positive feedback loop during
luteolysis. Another more likely source of oxytocin production is the uterus, in which both
mRNA and protein expression for oxytocin has been shown in the endometrium of a
number of species (Lefebvre et al., 1992, Chibbar et al., 1993, Boulton et al., 1996).
Maximal staining for oxytocin (Watson et al., 1997) and maximal expression of oxytocin
mRNA (Behrendt et al., 1997) occurred in equine endometrium during late diestrus and
early estrus. Sharp and colleagues (1997) have shown oxytocin receptors to be present in
the equine endometrium during estrus and are approximately 25% of the maximal
37
concentrations found on day 14 post ovulation. Concentrations of oxytocin receptors
were similar in pregnant and nonpregnant mares up until day 14 post ovulation, but the
affinity of the receptor was reduced in pregnant mares (Sharp et al., 1997). Similarly,
Starbuck et al. (1998) showed an increase in oxytocin receptor concentrations in
nonpregnant mares from day 10 to day 14 post ovulation, and there was no change in
receptor concentrations in pregnant mares. Oxytocin binding sites in the mare were
shown to be greatest on days 14-17 post ovulation for both endometrial and myometrial
tissue, although the affinity for each tissue did not change throughout the estrous cycle
(Stull and Evans, 1986).
Plasma concentrations of PGFM in mares administered oxytocin differed
throughout the estrous cycle, with maximal release on day 14 post ovulation and
decreasing concentrations following luteolysis (Sharp et al., 1997; Starbuck et al., 1998).
Similarly, equine endometrial explants have shown variable secretion of PGF2α based on
day of estrous cycle, with maximal production around day 14 post ovulation (King and
Evans, 1987; Vernon et al., 1981). In contrast, release of PGF2α from equine endometrial
epithelial cells stimulated with oxytocin did not differ throughout day of cycle or
pregnancy status (Watson et al., 1992). It has been documented by others that PGF2α
secretion is generally lower during estrus as compared to late diestrus (King and Evans,
1987; Vernon et al., 1981), however, oxytocin stimulated PGF2α release is possible.
Currently exogenous administration with oxytocin is used in the mare to aid in
uterine clearance (Cadario et al., 1999). Oxytocin stimulates uterine contractions by
binding to its receptors within the myometrium; this stimulates the activation of PLC
38
which in turn hydrolyses DAG and inositol 1,4,5-triphosphate (IP3) (Mitchell et al.,
1992). Inositol 1,4,5-triphosphate stimulates the release of intracellcular calcium release
and activates the myosin light chain kinase, which cause muscle contractions (Mitchell et
al., 1992). Oxytocin also stimulates the release of PGF2α by binding its receptors on the
endometrium. Prostaglandin F2α causes further myometrial contractions and therefore
aids in stimulating the clearance of foreign material and fluid from the uterus in mares
with delayed uterine clearance or persistent endometritis (Cadario et al., 1999). Gutjahr et
al. (2000) has demonstrated mares treated with oxytocin have a greater uterine response
two days prior to ovulation as compared to 2 days post ovulation. If oxytocin is given
prior to ovulation a lower dose is just as effective as the higher dose typically given post
ovulation (Gutjahr et al., 2000). The greater effect seen prior to ovulation could be due to
oxytocin receptor concentrations and an influence on the receptor population by estradiol
prior to ovulation and progesterone suppressing the oxytocin receptor post ovulation.
Oxytocin receptor antagonist
Antagonists for oxytocin and vasopressin were first described by Melin and
colleagues in 1981 using rat and human myometrial tissue. Atosiban, an oxytocin
receptor antagonist, prevents the binding of oxytocin to its receptor through competitive
inhibition and therefore blocks second messenger formation (Phaneuf et al., 1994).
Atosiban is an oligopeptide containing nine amino acids with a ring structure (Buscher et
al., 2001). It has great affinity for both the oxytocin and vasopressin receptors without
initiating any downstream activity from the receptor. Atosiban and similar oxytocin
antagonists have been primarily used to aid in the prevention of preterm labor and
39
myometrium contractions. Atosiban inhibited oxytocin stimulated myometrial cell
activation in cultured human myometrium by preventing the increase in intracellular
calcium (Phaneuf et al., 1994). Atosiban had no effect on oxytocin sensitivity during long
term exposure and prevented oxytocin desensitization during long term culture with
oxytocin (Phaneuf et al., 1994). Similarly, oxytocin induced contractions were inhibited
in a dose dependent manner when pregnant human myometrial strips were cultured with
Atosiban (Buscher et al., 2001).
40
Lipopolysaccharide
The bacterial endotoxin, lipopolysaccharide (LPS), is a glycolipid and a major
component of Gram-negative bacteria cell walls. It has a stimulatory effect on
inflammatory mediators, including prostaglandins, tumor necrosis factor (TNF),
interleukin-1 (IL-1), and increases synthesis and release of these cytokines from
macrophages, neutrophils, and lymphocytes (Taylor and Terranova, 1996; Raetz and
Whitfield, 2002). Lipid A, an endotoxin, is a phospholipid, hydrophobic anchor of LPS
that is on the outer membranes of bacteria, such as Escherichia coli (E. coli) (Raetz and
Whitfield, 2002). Pattern-recognition receptors (PRRs) are germline receptors that
recognize pathogens through conserved molecular patterns shared by groups of
microorganisms (Akira et al., 2001). Foreign pathogens, such as E. coli, are first
recognized by Toll-like receptors (TLRs) by binding the ligand LPS, and are expressed
on antigen presenting cells within the body (Akira et al., 2001). Toll-like receptors are
similar to PRRs and function in the same manner in mammals (Akira et al., 2001). These
receptors are a large family of molecules that are involved in the innate immune response
and initial recognition of pathogens (Muzio and Mantovani, 2000). Toll-like receptors are
type I transmembrane protein receptors and are related to interleukin-1 receptors.
Lipopolysaccharide has been found to signal cytokine synthesis through Toll-like
receptor-4 (TLR4) (Chow et al., 1992).
Toll-like receptors
Evaluation of human endometrium revealed the expression of TLR1-6 and 9
mRNAs in whole endometrium and endometrial epithelium (Young et al., 2004).
41
Additionally, TLR-4 mRNA transcripts were also detected in bovine endometrial
epithelial and stromal cells (Herath et al., 2006). Equine endometrial biopsies have also
been shown to express TLR-4 mRNA before and after insemination (Nash et al., 2010).
Furthermore, TLRs-2, -3, -4, and -9 mRNA expression was found in the cervix, uterus,
and placenta of nonpregnant and pregnant mice (Gonzalez et al., 2007). The mRNA
expression of the TLRs was up-regulated in pregnant uterine and cervical mice tissues,
although there was a down-regulation of TLR-4 in placental tissue (Gonzalez et al.,
2007). Therefore, TLR are present in the female reproductive tract and can serve as an
innate pathogen detection mechanism. The placenta is likely to have less exposure to a
pathogen as compared to the cervical and uterine tissue, which would likely serve as a
first response.
LPS and prostaglandin secretion
Bovine endometrial explants and stromal and epithelial cells cultured with LPS
secreted increasing concentrations of PGE2 and PGF2α in a dose dependent manner
(Herath et al., 2006). Additionally, LPS stimulated bovine endometrial epithelial and
stromal cells demonstrated an up-regulation in the expression of Cox-2 mRNA (Herath et
al., 2006). Likewise, stimulation of human non-pigmented ciliary epithelial cells with
LPS increased secretion of PGE2 and expression of Cox-2 proteins (Yadav et al., 2010).
In ovine uterine arteries, stimulation with LPS increases production of PGI2 and
expression of Cox-2 protein, but had no affect on expression of Cox-1 (Vagnoni and
Magness, 1998). Treatment with LPS in bovine endometrial explants stimulated release
of PGF2α, but had no effect on oxytocin receptor mRNA expression (Leung et al., 2001).
42
Lipopolysaccharide stimulated PGE2 release from rat hypothalamic explants following 60
minutes of culture, but had no affect on PGF2α secretion (Pozzoli et al., 1994). Similarly,
PGE2, not PGF2α release was stimulated by LPS from rat cortical astrocyte cultures
following 24 hours of culture (Pozzoli et al., 1994). In contrast, human placental explants
stimulated with LPS for 60 minutes had increased concentrations of PGF2α and PGE2 as
compared to controls (Gu et al., 1994). Increasing concentrations of LPS did not increase
secretion of prostaglandins in a dose response manner; PGF2α and PGE2 concentrations
were similar for human placental explants treated with 0.1-100 µg/mg of LPS (Gu et al.
1994).
Pre-treatment with progesterone or estradiol decreased the secretion of
prostaglandins in response to LPS stimulation in bovine endometrial epithelial and
stromal cells (Herath et al., 2006). Similarly, rat ovarian granulosa cells treated with LPS
had inhibited LH-stimulated estradiol secretion (Taylor and Terranova, 1996). In
contrast, estrogen appeared to play a role in the response of ovine uterine arteries to LPS,
in that only when uterine arteries were treated with estradiol did they respond to LPS
with an increase in PGI2 (Vagnoni and Magness, 1998). Likewise, ovariectomized ewes
showed no expression of Cox-2, suggesting a need for pre-exposure to progesterone
and/or estradiol (Vagnoni and Magness, 1998).
43
Dietary Influence on the Inflammatory Response
Polyunsaturated fatty acids
Polyunsaturated fatty acids (PUFAs) have one or more double bonds within the
molecule and can be classified as omega-3, omega-6 or omega-9 fatty acids, depending
on where the first double bond is located. Animals cannot synthesize omega-3 or omega-
6 fatty acids because they lack the appropriate desaturase enzymes, and thus these fatty
acids are dietary essential fatty acids (Wathes et al., 2007). Omega-6 fatty acids are found
mainly in vegetable oils, such as corn, sunflower, and safflower and are mostly derived
from linolenic acid. Omega-3 fatty acids are mainly found in green vegetables, grasses,
plants, fish, and marine sources and mostly derived from alpha-linolenic acid. Alpha-
linolenic is converted in the body into eicosapentanceoic acid (EPA) and
docosahexaneoic acid (DHA) through fatty acid desaturases 1 and 2 and elongase. EPA
can be converted into 3-series prostaglandins (Wathes et al., 2007), in contrast to AA
which is converted into 2-series prostaglandins. Linoleic acid is converted similarly in the
body into the omega 6 fatty acid dihomo-gamma-linolenic acid (DGLA) and arachidonic
acid, which can then be converted into 1 and 2 series prostaglandins.
44
Figure 1.2 Synthesis of 1-, 2-, and 3-series prostaglandins from dietary
polyunsaturated fatty acids through desaturation and chain elongation. (Wathes et al.,
2007)
Fatty acid uptake
The molecular mechanisms by which long-chain fatty acids are transported
through the cell membrane remains unclear. There are two mechanisms in debate by
which fatty acids are likely to be transported across the membrane: passive diffusion
(Hamilton et al., 2002) or a protein carrier mediated transport (Stremmel et al., 1992;
Campbell et al., 1997). Human placental choriocarcinoma cells cultured with oleic,
linolenic, arachidonic, and docosahexaneoic acids for 30 minutes, demonstrated uptake of
all the fatty acids (Campbell et al., 1997). Furthermore, inhibition of the plasma
membrane fatty acid binding protein (FABP) decreased the uptake of all fatty acids,
demonstrating the potential involvement of FABP with the uptake of long-chain fatty
acids (Campbell et al., 1997). Additionally, cultured hepatocytes showed a decrease in
45
uptake of oleate when a FABP inhibitor was added and further demonstrates the
translocation of fatty acids across the membrane involves binding to a membrane protein
(Stremmel et al., 1992). In contrast, Hamilton et al. (2002) demonstrated rat adipocytes
absorb and transport long-chain fatty acids through a three step method (Figure 1.3) that
does not involve a transport or binding protein, but works via diffusion by a flip-flop
mechanism; however it is possible a membrane protein might be involved at the cell
surface to attract albumin and facilitate absorption. Glatz and colleagues (1997) recognize
the uptake and translocation of long-chain fatty acids is a multiple step process and likely
involves both passive diffusion and the use of a membrane fatty acid binding protein.
Figure 1.3 Three step method for absorption and transportation of long-chain fatty acids
across the cell membrane (Hamilton et al., 2002).
Omega-3 fatty acids and equine
Many animal diets, including the equine, have been supplemented with fats and
oils for several years to provide nutritional and health benefits. Vegetable oils rich in
omega 6 fatty acids are the most common source of supplementation in equine diets. The
average forage diet contains between 1.5-3.5 % crude fat, where as the fat in a diet
46
containing both forage and a concentrate ranges from 4.5-7.0 % (Valentine, 2001). A
high-fat diet can contain 12% or more of fat in the concentrate portion of the diet. Fats
play an important role in equine nutrition and health and are required for a number of
functions, including absorption of fat-soluble vitamins and serve as a source of
concentrated energy and essential fatty acids (linolenic acid, linolenic acid, and
arachidonic acid). Recently, fish oil has been used as a dietary supplement to increase
omega 3 fatty acids in the diet and provide many health benefits for the equine.
Supplementation with fat to lactating mares appeared to influence the fatty acid
composition of their foals and milk (Spearman et al., 2005). Dietary supplementation
with fish oil has been shown to decrease heart rate in exercising horses (O’Connor et al.,
2004), suggesting a role for omega 3 fatty acids in exercise metabolism. Hall and
colleagues (2004) found dietary supplementation with polyunsaturated fatty acids altered
the inflammatory response of normal horses by increasing production of pro-
inflammatory cytokine TNF-α and increasing phagocytic activity of BALF cells.
Similarly, the omega 3 fatty acids EPA and DHA are currently thought to decrease
inflammation in horses with osteoarthritis by decreasing both the concentration of plasma
PGE2, and the number of inflammatory cells in synovial fluid (Manhart et al., 2005). In
contrast, lymphocyte proliferation and PGE2 production was not affected in horses
supplemented with omega-3 fatty acids (Vineyard et al., 2010). Similarly, equine fed an
encapsulated fish oil supplement did not alter antibody production or neutrophil function,
although plasma fatty acid composition of cell membranes was changed, demonstrating
uptake of the fatty acids (Vineyard et al., 2005).Woodward et al. (2005) found an
47
increase in trot stride length and plasma EPA and DHA in horses fed a supplement
containing stabilized long chain polyunsaturated fatty acids. The increased stride length
could be due to the increase in omega-3 fatty acids in plasma, alleviating inflammatory
problems found in horses with osteoarthritis.
Omega-3 fatty acids and female reproduction
Supplementation with polyunsaturated fatty acids has been shown to effect
multiple functions in the body, including inflammation, brain function, arthritis,
reproduction, and cell function. Possible incorporation of fatty acids into various foods to
increase the ratio of omega-3 to omega-6 has been evaluated due to the numerous
benefits. Hens supplemented with fish oil had increased yolk fat omega-3 fatty acid
concentrations; demonstrating dietary supplementation will affect the fatty acid profile
(Alvarez et al., 2004). Similarly, omega-3 fatty acid supplementation using fish meal
altered the plasma and endometrial cell membrane composition in non-lactating beef
cows (Burns et al., 2003). These results indicate that supplementation with omega-3 fatty
acids does alter the fatty acid profile and uptake of fatty acids can occur within the
endometrium.
Dietary supplementation with omega-3 and omega-6 fatty acids decreased plasma
progesterone and increased the number of medium-sized follicles in lactating dairy cows,
but had no affect on oxytocin stimulated plasma PGFM concentrations (Robinson et al.,
2002). This study suggests a role of polyunsaturated fatty acid in steroidogenesis.
Possible mechanisms of PUFAs mediating steroidogenesis include altering prostaglandin
synthesis by decreasing luteotrophic PGE2 secretion or possible delayed ovulation
48
leading to delayed luteal development (Robinson et al., 2002). Beef heifers with low
progesterone levels supplemented with fish meal had decreased concentrations of PGF2α
in response to oxytocin, suggesting a possible method to improve fertility (Wamsley et
al., 2005). In contrast, progesterone and estradiol concentrations were not influenced in
beef heifers supplemented with fish oil, although the heifers did have increased corpora
lutea diameter on day 7 post ovulation (Childs et al., 2008). Antiluteolytic effects of EPA
and DHA has been suggested by Petit et al. (2002), who reported that cows fed a diet
high in omega-3 fatty acids had larger corpora lutea than cows fed linseed oil or no fatty
acid supplement. In addition to the antiluteolytic effect of EPA and DHA, Bilby et al.
(2006) found that cows fed an omega-3 fatty acid enriched diet had larger pre-ovulatory
follicles as compared to non-supplemented cows; suggesting a potential role of EPA
and/or DHA in folliculogenesis. In rats supplemented with AA, EPA or DHA, there were
no affects on ovulation, suggesting the effects of fatty acid supplementation may be pre-
ovulatory (Broughton et al., 2009).
Early embryonic losses in the bovine can partly be attributed to deficient
concentrations of interferon produced by the embryo and subsequent luteolysis (Wathes
et al., 2007). In the mare, early embryonic loss can be caused by a lack of maternal
inhibition of PGF2α or increased secretion of PGF2α due to uterine inflammation.
Decreases in early embryonic loss may be mediated by dietary supplementation with
EPA and DHA (Mattos et al., 2000) as Petit et al. (2002) showed that cows receiving a
diet supplemented with polyunsaturated fatty acids had lower incidence of early
49
embryonic losses compared to cows not receiving the polyunsaturated fatty acid
supplement.
Omega-3 fatty acids and prostaglandins
Dietary supplementation with polyunsaturated fatty acids alters the membrane
phospholipid composition of cells throughout the body. Altered phospholipid bilayers
within the cell may lead to competitive inhibition of the enzymes, Cox-1 and Cox-2, by
changing the availability of substrates. In the presence of increased quantities of EPA and
DHA, AA metabolism can decrease (Wathes et al., 2007). Supplementation with omega-
3 fatty acids could lead to displacement of arachidonic acid (AA) with EPA or DHA
which could decrease production of series-2 prostaglandins and shift to series-3
prostaglandin production. In men, it has been shown dietary supplementation with
omega-3 fatty acids enhances the synthesis of 3-series prostaglandins (Hornstra et al.,
1991). Likewise, in rats supplemented with DHA, PGE3 and PGF3α concentrations
increased, but PGE2 and PGF2α concentrations remained unaffected by the diet
(Broughton et al., 2009).
Beef heifers supplemented with fish oil and stimulated with oxytocin had higher
concentrations of plasma PGFM as compared to controls (Childs et al., 2008). Likewise,
dairy cows fed omega-3 fatty acids in the form of fish oil also had higher concentrations
of plasma PGFM following an oxytocin challenge (Petit et al. 2002). In contrast, Mattos
and co-workers (2002) found that lactating cows fed a fish meal diet and challenged with
estradiol and oxytocin to stimulate PGF2α release had lower PGF2α concentrations as
compared to cows fed a non-fatty acid supplemented diet. Moreover, in vitro cell cultures
50
of bovine endometrial cells incubated with DHA and EPA had inhibited PGF2α release
(Mattos et al., 2003). Similarly, bovine endometrial cells cultured for 24 hours with EPA
decreased concentrations of PGF2α by 75% as compared to controls (Caldari-Torres et
al., 2006). Furthermore, the inhibition of PGF2α secretion was decreased when the ratio
of omega-6 to omega-3 fatty acids increased (Caldari-Torres et al., 2006). Mattos and co-
workers (2004) also found that lactating dairy cows fed a fatty acid supplemented diet
during the periparturient period showed a decrease in the secretion of PGF2α. This is
similar to earlier work reported by Arntzen et al. (1998) who showed PGF2α and PGE2
synthesis was inhibited in decidual cell cultures supplemented with n-3 polyunsaturated
fatty acids. A similar study found rats fed diets rich in DHA had lower levels of placental
PGF2α compared to rats fed a linolenic supplemented diet (Perez et al., 2006). Perez et al.
(2006) also showed significantly lower concentrations of arachidonic acid in the uterus
and placenta of rats fed a DHA rich diet. Concentrations of PGF2α and PGE2 from
peritoneal fluid were decreased in rabbits supplemented with fish oil following surgically
induced endometritis (Covens et al., 1988). Moreover, ovine amnion cells cultured with
DHA showed inhibition of PGE2 secretion, whereas treatment with AA increased release
(Kirkup et al., 2010).
Treatment of ovine uterine epithelial cells with omega-6 fatty acids decreased
oxytocin stimulated release of PGF2α and reduced the cells’ responsiveness to oxytocin
(Cheng et al., 2005). Similarly, dietary supplementation of cows with omega-6 fatty acids
decreased PGF2α and PGE2 secretion from endometrial explant cultures as compared to
the omega-3 fatty acid supplemented group and cows receiving no dietary supplement
51
(Cheng et al., 2001). Also, omega-6 fatty acid supplementation inhibited the ability of
endometrial explants to respond to oxytocin (Cheng et al., 2001). Although, omega-3
fatty acid supplemented cows had increased concentrations of PGF1α (Cheng et al.,
2001), suggesting a change in prostaglandin production from the active 2-series to a less
bioactive 1-series.
Supplementation with polyunsaturated fatty acids influences the secretion of
prostaglandins in vivo and in vitro in many species. The effects of fatty acid
supplementation seem to be dependent on the source of the fatty acid, the ratio of omega-
6 fatty acids to omega-3 fatty acids, duration of supplementation, and the series of
prostaglandin being evaluated.
Omega-3 fatty acids and prostaglandin synthesis
Eicosapentaenoic acid has been shown to inhibit the activity of Cox-1 (Wathes et
al., 2007), although the conversion of EPA into 3-series prostaglandins via Cox-1 is poor.
Mattos and colleagues (2003) found PGF2α to be suppressed in vitro in bovine cell
cultures supplemented with polyunsaturated fatty acids, possibly due to reductions in
PGHS-2 and PLA2 enzyme activity and PGHS-2 mRNA concentrations and protein
expression. The inhibition of fatty acid supplementation on PGF2α is believed to be
through a different mechanism than that of bovine interferon tau (Mattos et al., 2003). In
contrast, EPA did not influence the detectable mRNA of Cox-2 in cultured bovine
endometrial cells (Caldari-Torres et al., 2006). Similarly, lactating dairy cows
supplemented with fish meal had increased uterine omega-3 fatty acid concentrations, but
there was no affect on endometrial Cox-2 protein or PGF2α production in response to an
52
oxytocin challenge (Moussavi et al., 2007). Furthermore, human decidual cells cultured
with DHA and stimulated with interleukin-1 had decreased PGF2α and PGE2 production
and mPGES-1 and -2 mRNA expression, but there was no affect on Cox-1 or Cox-2
mRNA expression following 12 hours of incubation (Roman et al., 2006). Culture with
EPA had no affect on prostaglandin production or enzyme expression in human decidual
cell cultures (Roman et al., 2006). Eicosapentaenoic acid fed to rats increased ovarian
PGF2α and PGE2 release, although had no affect on Cox-1 or Cox-2 protein expression
(Broughton et al., 2009). In contrast, dietary omega-3 fatty acids fed to lactating dairy
cows had no affect on concentrations of prostaglandins from uterine flushing, although
staining intensity of the Cox-2 protein was decreased (Bilby et al., 2006). Dietary
supplementation of beef heifers with high omega-3 fatty acid diets increased PGES and
decreased PLA2 mRNA expression within the uterus, but had no affect on the oxytocin
receptor, PLC, Cox-1, Cox-2 or PGFS mRNA expression (Coyne et al., 2008).
Dissimilar to the bovine, EPA inhibited Cox-1 and Cox-2 activity as well as decreased
PGD2 secretion from cultured human mast cells in response to IgE-anit-IgE challenge
(Obata et al., 1999). Bovine aortic endothelial cells cultured with DHA or EPA for 24
hours showed reduced PGI2 production as well as decreased Cox-1 protein expression
and mRNA levels (Achard et al., 1997). Similarly, Holstein cows fed flaxseed had
reduced Cox-2 mRNA expression in the endometrium (Palin et al., 2005). Furthermore,
Massaro et al. (2006) showed DHA decreased Cox-2 protein expression, but not Cox-1,
in human vascular endothelial cells. The decrease in protein expression could be due to
53
longer incubation with DHA; Massaro et al. (2006) incubated cells for 48 hours whereas
many other cultures where incubated for only 24 hours.
Modulation of prostaglandin synthesis
Enzyme expression related to prostaglandin synthesis varies with tissue type and
concentration, source and duration of fatty acid supplementation. Although DHA and
EPA decreases prostaglandin production, it has been shown altering of enzyme
expression is not the only mechanism inhibiting prostaglandin secretion; therefore other
mechanisms must be involved in the DHA mediated inhibition of PGF2α release. Possible
mechanisms for this inhibition include 1) shifting production from 2-series prostaglandins
to 1 or 3-series prostaglandins, through competition of EPA and DHA with AA for lipid
metabolism and incorporation in the phospholipid membrane (Mattos et al., 2003; Calder,
2009) or 2) DHA is possibly affecting the lipid composition of the membrane influencing
signaling pathways within the cell (Chapkin et al., 2009). Docosahexaneoic acid has been
shown to alter cell membrane properties, including fluidity, protein function, rapid
diffusion and flip/flop translocation of fatty acids and order of fatty acid chains (Stillwell
and Wassall, 2003). The transmembrane domain and activation of the oxytocin receptor
could be influenced by DHA if the cell membrane is being altered. Omega-3 fatty acids
have also been shown to inhibit inflammation through nuclear receptors and lipid rafts
(Chapkin et al., 2009), such as the Toll-like receptor and recognition of LPS.
54
Summary
Uterine inflammation and persistent endometritis are major factors contributing to
early embryonic loss and decreased fertility within the equine industry. Accumulation of
inflammatory fluid or infection, especially in older mares, can increase secretion of
PGF2α and leads to regression of the corpus luteum and loss of the embryo. Oxytocin has
been shown to stimulate the release of PGF2α in vivo and in vitro in many species. This
release is dependent on day of the cycle and species. Oxytocin stimulated release of
PGF2α involves key enzymes in the synthesis pathway. There is a potential for
supplementation with omega-3 fatty acids to influence the expression of these enzymes.
The literature reviewed collectively demonstrates the positive influence dietary
supplementation with omega-3 fatty acids can have on female reproduction and the
inflammatory process. Omega-3 fatty acids have an impact and can regulate uterine
inflammation and early embryonic loss. Supplementation with polyunsaturated fatty
acids, specifically DHA, can influence the inflammatory response in vitro and in vivo
through mechanisms involving enzyme expression, but also other mechanisms must be
involved in the inhibition of prostaglandin secretion. The effects of omega-3 fatty acid
supplementation in the mare is unknown and warrants further investigation because of the
positive impact it could potentially have on equine reproduction and fertility.
55
CHAPTER 2
ESTABLISHMENT AND CHARACTERIZATION OF EQUINE
ENDOMETRIAL CELL CULTURES AND OXYTOCIN STIMULATED
PRODUCTION OF PGF2α
Abstract
Exogenous administration of oxytocin in the mare can be used to promote
uterine clearance and improve fertility. Oxytocin stimulated release of PGF2α and its
metabolite (PGFM) from equine endometrial cell culture has not been determined during
estrus. Equine endometrial biopsies were used to establish endometrial epithelial cell
cultures and determine the release of PGF2α and PGFM in response to oxytocin
stimulation. The effects of a basement membrane matrix and the addition of horse serum
to the media on the growth and response of endometrial epithelial were also evaluated.
Proliferation and characterization of epithelial cells was performed using BrdU and
immunoflorescent staining. Endometrial cell cultures were challenged with 250 nM of
oxytocin and PGF2α and PGFM secretion was measured. Equine endometrial cell
cultures showed replication within 24 hours of culture and cells were epithelial in origin.
Oxytocin did not stimulate the release of PGF2α and PGFM following 6 or 24 hours of
culture of endometrial epithelial cells. The addition of a basement membrane matrix
increased (P < 0.05) PGF2α concentrations at 6 and 24 hours in both challenged and non-
challenged cell cultures. The addition of horse serum did not influence PGF2α secretion
from endometrial epithelial cell cultures. In conclusion, equine endometrial cells were
established and shown to replicate in a non-matrix supported culture and on a basement
56
membrane matrix. Although endometrial epithelial cells were shown to replicate and
were viable in vitro, functional competency was undetectable as measured by a failure to
elicit a PGF2α release upon oxytocin stimulation. More work is necessary to define a
deficient cell culture system that is capable of secreting PGF2α when stimulated with
oxytocin.
57
Introduction
In ruminants, oxytocin is secreted by the corpus luteum and stimulates release of
PGF2α from the endometrium, which causes luteolysis at the end of estrous cycle.
Oxytocin receptors within the endometrium are up-regulated by an increase in estrogen
and a decrease in progesterone during late diestrus (Spencer et al., 1995). Progesterone
receptor expression is down-regulated through endometrial exposure to circulating
progesterone, causing an increase in expression of the estrogen receptor and up-
regulation of oxytocin receptors. The release of oxytocin creates a positive feedback loop,
in which PGF2α synthesis and release cause additional secretion of oxytocin from the CL
(Flint and Sheldrick, 1982) and hypothalamus (Silvia et al., 1991). Unlike the ruminant,
oxytocin is not secreted by the CL in the equine (Stevenson et al., 1991). In the ewe,
Silvia and colleagues (1991) found oxytocin release from the hypothalamic-pituitary axis
contributed to the positive feedback loop during luteolysis. Another, more likely, source
of oxytocin production is the uterus, in which both mRNA and protein for oxytocin have
been isolated from the endometrium of several species (Lefebvre et al., 1992; Chibbar et
al., 1993; Boulton et al., 1996). Maximal binding for oxytocin (Watson et al., 1997) and
maximal expression of oxytocin mRNA (Behrendt et al., 1997) occurred in mare
endometrium during late diestrus and early estrus.
The endocrine regulation of endometrial PGF2α production and release has not
been determined in the mare, although the release of PGF2α from the uterine
endometrium does result in luteolysis (Irvine, 1995). In 1985, Betteridge and colleagues
demonstrated that the exogenous administration of oxytocin to mares in late diestrus
58
caused an increase in peripheral 13, 14-dihydro-15-keto PGF2α (PGFM) plasma
concentrations, suggesting the role of oxytocin for luteolysis. Exogenous administration
of oxytocin has been shown to stimulate PGF2α release from the endometrium and cause
luteolysis (Goff et al., 1987).
Currently, oxytocin administration has been used to promote uterine clearance
and improve fertility in mares prone to infection and persistent endometritis (Cadario et
al., 1999). Prostaglandin F2α release due to oxytocin administration has been shown to be
dependent on stage of the estrous cycle, with maximal secretion on day 14 around the
time of luteolysis (Sharp et al., 1997). Equine endometrial explants showed variable
response to oxytocin during culture with maximum release on day 14 (King and Evans,
1987), which coincides with time of luteolysis. Similarly, concentrations of oxytocin
receptors in equine endometrium have also been shown to be dependent on the day of the
estrous cycle (Sharp et al., 1997). During estrus, oxytocin receptors were present in the
endometrium of mares, although concentrations were approximately 25% of maximal
concentrations found on day 14 post ovulation (Sharp et al., 1997). Oxytocin stimulated
release of PGF2α and its metabolite (PGFM) from equine endometrial cell culture has not
been determined during estrus. The purpose of this study was to establish equine
endometrial cell cultures and determine if oxytocin would stimulate the release of PGF2α
and PGFM.
59
Materials and Methods
Materials
Six well culture plates, Hank’s Balanced Salt Solution (HBSS), bovine serum
albumin (BSA), Hams F-12, and Eagle minimum essential medium (MEM) were
purchased from Fisher Scientific (Pittsburgh, PA). The antibiotic antimycotic and insulin-
transferrin-selenium X supplement was from Invitrogen (Carlsbad, CA). The fetal bovine
serum (FBS) was from HyClone (Logan, UT). The Liberase Blendzyme III was from
Roche Diagnostics (Indianapolis, IN). Oxytocin was purchased from MWI Veterinary
Supply (Boise, ID). The BD Matrigel basement membrane matrix was purchased from
BD Biosciences (Bedford, MA).
Animals
A total of five mature (mean 10.6 years ± 5) mares of light horse breeding were
utilized and housed at The University of Arizona Equine Center. Mares were teased with
a stallion daily for detection of behavioral estrus. Follicular development and uterine
edema were monitored by transrectal palpation and ultrasonography every day from the
first detection of behavioral estrus through ovulation. All animal procedures were
reviewed and approved by the Institutional Animal Care and Use Committee at The
University of Arizona.
Experiment I
One endometrial biopsy was taken from each of eight mares on the second day of
behavioral estrus. The biopsies were recovered non-surgically using a cattle biopsy
instrument (3 mm × 450 mm, semiflexible forceps with a Palmer Jacobs jaw, Richard
60
Wolf Medical Instruments Corporation, Vernon Hills, IL) immediately right and left of
the uterine bifurcation. Uterine tissue was removed aseptically from the biopsy punch and
placed into 10 ml of HBSS supplemented with 2X concentration of antibiotic-antimycotic
solution. Biopsies were transported to the laboratory on ice within 30 minutes of harvest.
Uterine tissue was rinsed one time with fresh HBSS. The endometrial biopsy was finely
minced using sterile scalpel blades and individual cells dispersed with Liberase
Blendzyme III in HBSS and trypsin-EDTA solution (0.25% trypsin in HBSS). Fibroblast
cell contamination was reduced by dual plating the dispersed cells. The dispersed cells
were plated for 2-4 hours to allow for fibroblast attachment; after washing, endometrial
cells were plated on 35 mm wells of six well plates. Cells were grown in culture media
(40% Hams F-12, 40% MEM, 10 ml/L of antibiotic antimycotic, 200 U/L of Insulin-
Transferrin-Selenium X supplement, and 20% fetal bovine serum) until confluence (6.6+
1.5 d) at 37ºC in a humidified incubator containing 95% air and 5% CO2. Once cells
reached a confluent monolayer, the endometrial cells were rinsed two times with a 1%
bovine serum albumin (BSA) culture media (1% BSA in Hams F-12 and MEM), and 3
ml of fresh 1% BSA culture media (1% BSA in Hams F-12 and MEM, 10 ml/L of
antibiotic antimycotic, and 200 U/L of Insulin-Transferrin-Selenium X supplement) was
added to each well. Half of the wells were challenged with 250 nM of oxytocin and the
other half remained unchallenged and served as controls (3 replicates per treatment).
Conditioned media was collected and stored at -80ºC until PGF2α and PGFM
concentrations were measured to determine production at 6 and 24 hours post oxytocin
challenge. Commercial EIA kits (Cayman Chemical Co., Ann Arbor, MI) were used to
61
measure the concentration of PGF2α and PGFM in culture medium according to
manufacturer instructions. After all media was removed, five of the eight plates’ cells
were fixed with 100% methanol at 4ºC for 10 minutes and then rinsed with PBS two
times. Cells were removed from wells and stored at -80ºC for protein analysis. Protein
analysis was performed using the Pierce Microplate BCA Protein Assay Kit (Thermo
Scientific, Rockford, IL). Three of the plates were used for characterization of the cells
following the cell proliferation and staining procedures below.
Endometrial Cell Proliferation
After the media was collected for the oxytocin challenge, culture media
containing 10 µmol/L bromodeoxyuridine (BrdU) was added and cells were cultured for
another 24 h. Cells were then washed four times with PBS for 1 minute each and then
fixed in 100% methanol and hydrogen peroxide with a concentration of 0.5% v/v (1
µL/mL) at 4ºC for 10 minutes. The cells were washed with PBS for 5 minutes and
incubated in 2 M HCl for 60 minutes at room temperature. Cells were then washed with
PBS three times for 3 minutes and non-specific binding sites were blocked with 10%
horse serum in PBS (Vector Laboratories; Vectastain Elite ABC Kit) for 20 minutes.
Primary antiserum, mouse anti-BrdU, was diluted 1:1,000 in blocking buffer, applied to
the cells, and incubated overnight at 4ºC. Cells were washed three times in PBS for 5
minutes and incubated with diluted biotinylated secondary antiserum (Vector
Laboratories; Vectastain Elite ABC Kit) for 30 minutes. Following three 5 minute washes
with PBS, the cells were incubated with Vectastain Elite ABC Reagent (Vector
Laboratories) for 30 minutes at room temperature. Cells were washed two times with
62
PBS for 5 minutes. 3, 3’-diaminobenzidine (DAB) substrate (Vector Laboratories) was
applied and monitored until desirable stain developed. To distinguish epithelial cells, dual
staining was performed with a second round of staining using the mouse anti-human
cytokeratin clone AE1/AE3 (1:1,000; Dako, Carpinteria, CA). Prior to addition of the
primary antibody, cells were incubated in PBS and hydrogen peroxide at a concentration
of 0.5% v/v (1 µL/mL) to abolish all endogenous peroxidase activity and the staining
procedures were performed again. In the second round of staining, VIP substrate (Vector
Laboratories) was used to detect immunocomplexes and monitored until desired stain
developed.
Immunofluorescent Staining
Dual immunofluorescent staining was performed to characterize cell types within
the uterine biopsies and endometrial cell cultures. Epithelial cells were demarcated with
mouse anti-human cytokeratin clone AE1/AE3 (1:200; Dako, Carpinteria, CA) and
fibroblast cells were identified with mouse anti-vimentin (1:10,000; Sigma-Alrich,
St.Louis, MO). Cells were rinsed in PBS with 0.2% Trition X for 15 minutes. Following
washing three times in PBS for 5 minutes, non-specific binding sites were blocked by
incubating cells in 0.5% NEN blocking buffer (0.1 M Tris-HCl, 0.15 M NaCl; Perkin-
Elmer) for 60 minutes. Primary antiserum was diluted in 1% bovine serum albumin
(BSA), applied to the cells, and incubated at room temperature for 2 hours. Cells were
washed three times for 10 minutes in PBS. Secondary antiserum (against the appropriate
species immunoglobulin conjugated with Cy2 or Cy3) was diluted 1:500 in 1% BSA and
63
incubated for 60 minutes. The cells were then washed three times in PBS and visually
photographed on a Lieca 4000B microscope with fluorescent imaging capabilities.
Experiment II
To evaluate different culture conditions, four endometrial biopsies were taken
from each of two mares on the second day of behavioral estrus as described previously.
Different culture conditions evaluated included the use of a basement membrane matrix
coating on the bottom of each well and increasing the amount of serum added to the
culture media. Each of the four biopsies were finely minced and dispersed following the
methods described above and plated equally into four wells on six well plates (35 mm
wells). Wells on two of the four plates were coated with BD Matrigel Basement
Membrane Matrix according to the manufacturer instructions. The other two plates were
left uncoated to serve as a control. Cells were grown in culture media (40% Hams F-12,
40% MEM, 10 ml/L of antibiotic antimycotic, 200 U/L of Insulin-Transferrin-Selenium
X supplement, and 20% fetal bovine serum) until confluence (6 ± 1.3 days) at 37ºC in a
humidified incubator containing 95% air and 5% CO2. Once cells reached a confluent
monolayer, the endometrial cells were rinsed two times with a 1% BSA culture media
(1% BSA in Hams F-12 and MEM). One basement membrane matrix coated plate and
one uncoated plate received 3 mL of fresh 1% BSA culture media (1% BSA in Hams F-
12 and MEM, 10 ml/L of antibiotic antimycotic, and 200 U/L of Insulin-Transferrin-
Selenium X supplement). The other two plates received 3 mL of media containing 10%
horse serum (40% Hams F-12, 40% MEM, 10 % horse serum, 10 ml/L of antibiotic
antimycotic, and 200 U/L of Insulin-Transferrin-Selenium X supplement). Two wells on
64
each plate were challenged with 250 nM oxytocin and the other two wells served as
controls and were not challenged. Conditioned media was collected and stored at -80ºC
until PGF2α concentrations were measured. Commercial EIA kits (Cayman Chemical
Co., Ann Arbor, MI) were used according to manufacturer instructions.
Statistical Analysis
Significant differences among data were determined by least squares analysis of
variance using the mixed procedure of the Statistical Analysis System (SAS Institute,
Cary, NC, v9.2, 2008). Oxytocin treatment, time, culture conditions, and their
interactions were considered independent variables. Mare was considered random for all
experiments. Prostaglandin F2α production data was transformed for statistical analysis
using the logarithmic 10 due to the non-homogeneity among the variances. A
significance level of P < 0.05 was used for all statistical tests. Results are presented as
non-transformed means ± s.e.m.
65
Results
Endometrial Cell Proliferation and Characterization
Equine endometrial tissue sections contained epithelial cells (Figure 2.1). Equine
endometrial cell cultures were primarily epithelial in origin with few fibroblast cells
present (Figure 2.2) and showed replication at 4, 5, and 7 days of culture (Figure 2.3)
Experiment I
Mean concentrations of PGF2α and PGFM were similar in challenged and control
endometrial cell cultures at 6 and 24 hours (Figures 2.4 and 2.5). Concentrations of
PGF2α were higher (P < 0.05) in equine endometrial cells following 24 hours of culture
as compared to 6 hours of culture (Figure 2.4).
Experiment II
Prostaglandin F2α concentrations did not differ between challenged and control
endometrial cells cultured for 6 or 24 hours, regardless of basement membrane matrix or
addition of horse serum (Figures 2.6 and 2.7). The addition of a basement membrane
matrix increased (P < 0.05) PGF2α concentrations in endometrial epithelial cell cultures
at 6 and 24 hours as compared to cell cultures without a basement membrane matrix. The
addition of horse serum did not affect PGF2α concentrations, regardless of stimulation or
a basement membrane matrix. The use of a basement membrane matrix increased (P <
0.05) the total cell number within the cell cultures, regardless of stimulus, however the
number of epithelial cells did not change with culture condition (Table 2.1).
66
Discussion
Previously, there has been the isolation and culture of endometrial cells reported
in many species. Watson and colleagues (1992) isolated and cultured confluent
monolayers of glandular epithelial and stromal cells from mare endometrium on plastic.
Similarly, we were able to isolate and culture endometrial epithelial cells on plastic and
plastic coated with an extracellular matrix. To the best of our knowledge, this is the first
report of the establishment of equine endometrial cells on a basement membrane matrix.
Epithelial and stromal cell cultures demonstrated different morphology and when
stimulated with oxytocin, glandular epithelial cells produced higher concentrations of
PGF2α as compared to stromal cells at 24 hours (Watson et al., 1992). Watson et al.
(1992) also demonstrated PGF2α concentrations increased with time of incubation, which
is in agreement with our findings. Concentrations of PGF2α produced by glandular
stromal and epithelial cultured cells were not affected by day of cycle or pregnancy status
(Watson et al., 1992). In contrast, Vernon et al., (1981) showed endometrial cultures
from cycling mares produced increasing amounts of PGF2α when harvested from day 4 to
day 16 and declined in tissue harvested on day 20. Prostaglandin F2α concentrations were
significantly higher following two hours of incubation, demonstrating the capacity of the
endometrium to synthesize PGF2α in vitro (Vernon et al., 1981).
In the current study, equine endometrial epithelial cell cultures challenged with
oxytocin failed to release PGF2α. The lack of response to oxytocin reported herein could
be due to a deficiency of oxytocin receptors, although Sharp et al. (1997) demonstrated
oxytocin receptors were present in the endometrium during all stages of the estrous cycle.
67
However, the receptor concentrations during estrus are approximately 25% of the
maximal concentration found on day 14 post ovulation (Sharp et al., 1997), therefore,
endometrial biopsies taken on day 2 of behavioral estrus should have oxytocin receptors
present, although concentrations of oxytocin receptors was not evaluated during this
study. Another possibility is that during preparation of the endometrial biopsy for culture,
digestion of the endometrial tissue could have caused a disruption of the cell’s surface
and interfered with the oxytocin receptor. However, equine endometrium digested
similarly still was able to respond to oxytocin stimulation in culture, demonstrating the
presence and function of the oxytocin receptor (Watson et al., 1992). There could also be
a disruption of enzymes or signals within the prostaglandin biosynthesis pathway, leading
to gaps in the oxytocin receptor mediated signaling pathway. An evaluation of the
oxytocin receptor, concentrations, and function would be important to ensure the
prostaglandin biosynthesis pathway is intact and functional in these culture systems.
Other possible reasons for a failure to detect a response from the endometrial cell
cultures include lack of sufficient animal numbers and potentially insufficient cell
number within the cultures. There were only five mares used for the oxytocin stimulated
PGF2α release experiment; possibly if animal numbers were increased, a difference in
PGF2α concentrations could be detected. In another study performed by our lab,
endometrial explant cultures from ten mares had greater concentrations of PGF2α when
stimulated with oxytocin as compared to controls (Penrod et al, unpublished, Chapter 3 of
Dissertation). Even though endometrial cell cultures were grown to approximately 90%
confluence, low epithelial cell numbers could be a probable cause for low PGF2α
68
concentrations. Other endometrial cell cultures are plated by cell number and consist of
105 or 10
6 cells (Mattos et al., 2003; Watson et al., 1992), possibly increasing the
detectable concentrations of PGF2α in the culture system. Total cell numbers within our
culture system were around 104 cells, much lower than other endometrial epithelial
cultures.
Endometrial epithelial cells lose their shape and tight lateral junctions when
cultured for several days on glass or plastic surfaces, causing a loss in cell function and
polarity (Classen-Linke et al., 1997). Classen-Linke and colleagues (1997) have shown in
order to keep the cell’s polarity and differentiated functions, the epithelial cells must have
contact with the extracellular matrix and access to substrates. Uterine epithelial cell
characteristics depend largely upon their culture environment (Glasser et al., 1988).
Glasser and colleagues (1988) demonstrated uterine epithelial cells cultured on a matrix-
coated surface resembled characteristics and functions displayed in vivo. The technique
of using an extracellular matrix for endometrial cell culture has been used in various
animal models (Glasser et al., 1988; Jacobs et al., 1990; Mahfoudi et al., 1991) to
improve cell function. Glandular epithelial cells from guinea pig endometrium cultured
on Matrigel-coated dishes exhibited ultrastructural features similar to those of
endometrial epithelial cells in vivo and contained progesterone receptors (Mahfoudi et al.,
1991). Based on these findings, the extracellular matrix was utilized to aid in cell growth
and function. Equine endometrial cells cultured on an extracellular matrix produced
higher concentrations of PGF2α than endometrial cells cultured on plastic, although the
response was similar between non-challenged and oxytocin challenged endometrial cells
69
grown on a matrix. These findings would indicate the extracellular matrix allowed for
additional growth, attachment, and replication of cultured equine endometrial cells, but
did not change the cells responsiveness to oxytocin. The number of endometrial epithelial
cells was similar between cultures with a matrix and cultures without a matrix, however
there was an increase in total cell number. Perhaps the addition of a membrane matrix
leads to better functioning cells, but also increases the attachment and growth of non-
epithelial cells.
The appearance of endometrial epithelial cells in this study grown on a plastic
surface looked flattened and clumped together, lacking the 3D structure seen in vivo. In
contrast, the endometrial epithelial cells plated on a basement membrane matrix coated
surface demonstrated a round, 3D appearance. The cells looked as though they were
growing up off the matrix coated plate, as opposed to flattened on the plate. The cells
appeared to have structure, forming an environment similar to that seen in vivo. Epithelial
cells in both culture conditions were larger and rounder than fibroblast cells seen towards
the end of the culture period.
In conclusion, equine endometrial cells were established and shown to replicate in
culture and on a basement membrane matrix. Although endometrial epithelial cells were
shown to replicate and were viable in vitro, functional competency was not demonstrated
as measured by a failure to elicit a PGF2α release upon oxytocin stimulation. More work
is necessary to define a cell culture system that is capable of secreting PGF2α when
stimulated with oxytocin. Future work is needed to determine the cause of the low PGF2α
response from equine endometrial cell cultures in order to produce a viable and
70
functional system that can be used as a model to further evaluate the uterine
inflammatory process.
71
Figure 2.1 Equine endometrial tissue sections stained with a) DAPI (blue stained cells) at
10x b) tissue section with both DAPI and Cytokeratin (green stained cells) at 10x
magnification and c) tissue section stained with both DAPI and Cytokeratin at 20x
magnification.
a) b)
c)
72
Figure 2.2 Equine endometrial cell cultures following 6 days incubation stained with a)
DAPI (blue stained cells) b) epithelial cell staining with primary antiserum Cytokeratin
(green stained cells) and c) cells that are both stained with DAPI and Cytokeratin.
c)
b) a)
73
Figure 2.3 Equine endometrial cell cultures following 24 h incubation with BrdU (brown
stained cells) and epithelial cell staining with primary antiserum Cytokeratin (pink
stained cells) at a) 4 days, b) 5 days, and c) 7 days in culture. Cells that are both stained
with BrdU and Cytokeratin are replicated epithelial cells.
a)
c)
b)
74
Figure 2.4 Prostaglandin F2α (PGF2α) concentrations (mean + s.e.m) at 6 and 24 hours in
the absence (0nM,-Oxy ) or presence (250nM, +Oxy ) of oxytocin for equine
endometrial cell cultures. a,b
Means with different superscripts differ (P < 0.05).
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
5
5.5
6
Oxy - Oxy + Oxy - Oxy +
6h 24h
PG
F2α
Co
nce
ntr
atio
n (
pg/µ
g o
f p
rote
in)
a a
b
b
75
Figure 2.5 Prostaglandin F2α metabolite (PGFM) concentrations (mean + s.e.m) at 6 and
24 hours in the absence (0nM,-Oxy ) or presence (250nM, +Oxy ) of oxytocin for
equine endometrial cell cultures.
0
5
10
15
20
25
30
35
40
- Oxy + Oxy - Oxy + Oxy
6 h 24 h
PG
FM
Co
nce
ntr
atio
n
(pg/
10
,00
0 e
pit
hel
ial
cell
s)
76
Figure 2.6 Prostaglandin F2α (PGF2α) concentrations at 6 hours for equine endometrial
cell cultures grown with or without a basement membrane matrix and without (“0%”) or
with (“10%”) additional horse serum added to the culture media. Endometrial cell
cultures were in the absence (0nM, “No”) or presence (250nM, “Yes”) of oxytocin. a,b
Means with different superscripts differ (P < 0.05).
0
0.5
1
1.5
2
2.5
3
3.5
4
No Yes
PG
F2α
Co
nce
ntr
atio
n
(µg/n
um
ber
of
epit
hel
ial
cell
s)
Oxytocin
Matrix 0%
Matrix 10%
No Matrix 0%
No matrix 10%
b b
b
b
a
a
a
a
77
Figure 2.7 Prostaglandin F2α (PGF2α) concentrations at 24 hours for equine endometrial
cell cultures grown with or without a basement membrane matrix and without (“0%”) or
with (“10%”) additional horse serum added to the culture media. Endometrial cell
cultures were in the absence (0nM, “No”) or presence (250nM, “Yes”) of oxytocin. a,b
Means with different superscripts differ (P < 0.05).
0
2
4
6
8
10
12
14
No Yes
PG
F2α
Co
nce
ntr
atio
n
(µg/n
um
ber
of
epit
hel
ial
cell
s)
Oxytocin
Matrix 0%
Matrix 10%
No Matrix 0%
No matrix 10%
a
a
b b b b
a
a
78
Table 2.1 Epithelial and total cell number within each culture condition system.
a,b Means with different subscripts differ ( P < 0.05).
*0% HS- No additional horse serum added to media and without matrix, 0% + M- No
additional horse serum added to media and with a matrix, 10% HS- Additional horse
serum added to media and without a matrix, 10% HS + M- Additional horse serum added
to media and with a matrix
Culture
Condition*
Oxytocin Epithelial
Cells
Total Cells % Epithelial
Cells
0% HS (-) 8177.5 9684a
84%
0% HS (+) 8324.5 9554.5a 85%
0% HS + M (-) 8063 12177.5b
71%
0% HS + M (+) 8091.5 11101.5b
76%
10% HS (-) 8380 12005a
70%
10% HS (+) 9415.5 11361a
83%
10% HS + M (-) 9355 14475b
68%
10% HS + M (+) 8590 14130b
65%
79
CHAPTER 3
OXYTOCIN STIMULATED RELEASE OF PGF2α AND INHIBITION OF PGF2α
RELEASE BY A CYCLOOXYGENASE INHIBITOR, INDOMETHACIN, AND
AN OXYTOCIN RECEPTOR ANTAGONIST, ATOSIBAN, FROM EQUINE
ENDOMETRIAL CULTURES
Abstract
Uterine inflammation is one of the causes of a poor uterine environment. This can
result in early embryonic loss in the mare due to an inhibition of maternal recognition or
an increased secretion of prostaglandin F2α (PGF2α). Oxytocin binds to endometrial cell
receptors to activate prostaglandin synthesis. Atosiban, an oxytocin receptor antagonist,
and Indomethacin, a cyclcooxygenase inhibitor, both decrease PGF2α production. Equine
endometrial explants were harvested on day two of behavioral estrus to determine effects
of Atosiban and Indomethacin on PGF2α secretion. Endometrial explant cultures were
challenged with oxytocin (250 nM) and PGF2α concentrations over time were measured.
Explants were also cultured with increasing concentrations of Atosiban and Indomethacin
for 6 hours to determine the influence on PGF2α secretion. When endometrial explants
were challenged with oxytocin, PGF2α concentrations were higher (P < 0.0001) at each
time point over the 24 hours culture as compared to controls. Oxytocin failed (P < 0.001)
to elicit PGF2α release in explants cultured with either inhibitor. In conclusion equine
endometrial explants can be stimulated with oxytocin to increase secretion of PGF2α and
this secretion can be inhibited through an oxytocin receptor antagonist and Cox inhibitor,
80
suggesting that this response to oxytocin involves an oxytocin receptor mediated event
that activates the prostaglandin synthesis cascade through cyclooxygenase.
81
Introduction
Uterine infection, inflammation, and early embryonic loss are factors contributing to
low pregnancy rates in the equine industry. Infection and inflammation are likely the
primary causes of creating a poor uterine environment (Adams et al., 1987; Saltiel et al.,
1986; Dimcock and Edwards, 1928) and often result in early embryonic loss. The natural
inflammatory response induced by breeding can decrease conception rates in older mares
or mares susceptible to infection. In the healthy mare, post-breeding inflammation is
usually cleared within twenty-four hours (Katila, 1995). In older mares and mares
susceptible to delayed uterine clearance, the inflammation persists due to fluid
accumulation that cannot effectively be dispelled. Uterine prostaglandin F2α (PGF2α)
secretion is triggered by the influx of polymorphonuclear neutrophils (PMNs) into the
uterus (Troedsson, 1999). Prostaglandin F2α is responsible for myometrium contractions,
and subsequent expulsion of contaminating fluid and debris from the uterus.
Currently, exogenous oxytocin administration is used to improve uterine clearance in
mares prone to infection or persistent endometritis (Cadario et al., 1999). In vivo
oxytocin-stimulated PGF2α release is dependent on day of cycle in the mare (Sharp et al.,
1997). Circulating concentrations of PGFM were increased in cycling mares
administered oxytocin on days 10, 14, and 18 post ovulation, with the highest response
on day 14 (Starbuck et al., 1998). Similarly, cultured equine endometrial explants showed
variable response to oxytocin with maximum release from explants harvested on day 14
post ovulation (King and Evans, 1987). In contrast, equine endometrial glandular
epithelial and stromal cells’ response to oxytocin stimulation during culture was not
82
dependent on stage of cycle or pregnancy (Watson et al., 1992). However, endometrial
glandular epithelial cells produced more PGF2α than stromal cells after 24 hours of
culture (Watson et al., 1992). The differences found in PGF2α secretion from endometrial
tissue harvested throughout the estrous cycle could be due to the type of culture system
used. In the study by Watson and colleagues (1992), the cell cultures were divided into
epithelial and stromal, possibly suggesting a role for cell type in the secretion of PGF2α
based on day of the cycle. The length of culture could also influence the release of PGF2α
in cell versus explant cultures.
Oxytocin binds to endometrial cell membrane receptors coupled with G proteins to
activate prostaglandin synthesis (Gimpl and Fahrenholz, 2001). Atosiban, an oxytocin
receptor antagonist, blocks the binding of oxytocin to its receptor, preventing second
messenger formation (Phaneuf et al., 1994). Atosiban and similar oxytocin antagonists
have been primarily used in human uterine cell cultures to inhibit myometrial
contractions (Buscher et al., 2001) and clinically in women to aid in the prevention of
preterm myometrium contractions and preterm labor (Eogan and McKenna, 2004).
Cyclooxygenase-1 and 2 (Cox-1, 2) are responsible for converting arachidonic acid (AA)
into prostaglandin H2 (PGH2), which is further reduced into PGF2α by prostaglandin F
synthase or isomerized into PGE2 by prostaglandin E synthase (Smith, 1992).
Indomethacin, a non-steroidal anti-inflammatory, blocks Cox from converting AA into
PGH2 and therefore prevents the production of prostaglandins.
The purpose of this study was to 1) establish equine endometrial explant cultures, 2)
determine the effects of oxytocin stimulation over time, and 3) evaluate the effects of an
83
oxytocin receptor antagonist and a Cox inhibitor on prostaglandin production during
culture.
84
Materials and Methods
Materials
Six well culture plates, Hank’s Balanced Salt Solution (HBSS), bovine serum
albumin (BSA), Hams F-12, and Eagle minimum essential medium (MEM) were
purchased from Fisher Scientific (Pittsburgh, PA). The antibiotic antimycotic and insulin-
transferrin-selenium X supplement was from Invitrogen (Carlsbad, CA). The fetal bovine
serum (FBS) was from HyClone (Logan, UT). The oxytocin antagonist, Atosiban, was
from BioVender (Candler, NC) and Cox inhibitor, Indomethacin, from Sigma-Aldrich
(St. Louis, MO). Oxytocin was purchased from MWI Veterinary Supply (Boise, ID).
Animals
A total of ten mature cycling mares of light horse breeding and of various age
(12.6 years ± 5) were utilized and housed at The University of Arizona Equine Center.
Mares were teased with a stallion daily for detection of behavioral estrus. Follicular
development and uterine edema were monitored by transrectal palpation and
ultrasonography every day from the first detection of behavioral estrus through ovulation.
All animal procedures were reviewed and approved by the Institutional Animal Care and
Use Committee at The University of Arizona.
Oxytocin Dose Response
An oxytocin dose response was performed using equine endometrial explants.
One endometrial biopsy was taken from each of seven mares of light horse breeding on
day two of behavioral estrus. The biopsy was recovered non-surgically using a cattle
biopsy instrument (3 mm × 450 mm, semiflexible forceps with a Palmer Jacobs jaw,
85
Richard Wolf Medical Instruments Corporation, Vernon Hills, IL). Uterine tissue was
removed aseptically from the biopsy punch and placed into HBSS supplemented with 2X
antibiotic-antimycotic solution. The biopsy was transported to the laboratory on ice
within 30 minutes of harvest. Uterine tissue was rinsed with fresh HBSS. Uterine tissue
was minced into equal sections, divided into 6 wells (35 mm) and covered with 3 ml of
fresh media per well (40% Hams F-12, 40% MEM, 10 ml/L of antibiotic antimycotic,
200 U/L of Insulin-Transferrin-Selenium X supplement, and 20% fetal bovine serum).
Explants were acclimated for 90 minutes at 37ºC in a humidified incubator in the
presence of 95% air and 5% CO2, as we have previously shown endometrial explants
require an acclimatization period prior to culture (data unpublished, 2009). Following 90
minutes of incubation, explants were rinsed one time with fresh 1% BSA culture media
(1% BSA in Hams F-12 and MEM). Each well received 2 ml of fresh 1% BSA culture
media (1% BSA in Hams F-12 and MEM, 10 ml/L of antibiotic antimycotic, and 200 U/L
of Insulin-Transferrin-Selenium X supplement) and then challenged with increasing
doses of oxytocin (0, 31.25, 62.5, 125, 250, or 500 nM). Media was collected and stored
at -80ºC until PGF2α analysis.
Uterine Endometrial Explant Culture Response to Oxytocin
One endometrial biopsy was taken from each of ten mares on the second day of
behavioral estrus as previously described. The endometrial biopsy was minced into six
equal sections and divided into six wells (35 mm), then covered with 3 ml of fresh media
per well (40% Hams F-12, 40% MEM, 10 ml/L of antibiotic antimycotic, 200 U/L of
Insulin-Transferrin-Selenium X supplement, and 20% fetal bovine serum). Following 90
86
minutes of acclimation in a humidified incubator in the presence of 95% air and 5% CO2,
explants were then washed one time with fresh 1% BSA culture media (1% BSA in Hams
F-12 and MEM) and each well received 3 ml of fresh 1% BSA culture media (1% BSA in
Hams F-12 and MEM, 10 ml/L of antibiotic antimycotic, and 200 U/L of Insulin-
Transferrin-Selenium X supplement). Half the explants were challenged with 250 nM
oxytocin and the remaining half served as a control and did not receive oxytocin.
Following the oxytocin challenge, 500µL of media was collected at half an hour, 1, 2, 6,
and 24 hours. Conditioned media was collected and stored at -80ºC until PGF2α analysis.
Uterine Endometrial Explant Cultures in the presence of Inhibitors
Two endometrial biopsies were taken from each of five mares of light horse
breeding on the second day of estrus using methods described above. The biopsies were
minced into ten equal sections and plated into 10 single wells (35 mm) on 2-6 well plates
for incubation. Explants were allowed to acclimate for 90 minutes at 37ºC in a humidified
incubator, then washed one time with fresh 1% BSA culture media (1% BSA in Hams F-
12 and MEM). Two wells served as controls and received 3 ml of fresh 1% BSA culture
media (1% BSA in Hams F-12 and MEM, 10 ml/L of antibiotic antimycotic, and 200 U/L
of Insulin-Transferrin-Selenium X supplement) without the addition of an inhibitor.
Other pairs were divided and received one of the following treatments: 1% BSA media (3
ml) containing either 4 µg/ml of Indomethacin, 8 µg/ml of Indomethacin, 50 µg/ml of
Atosiban, or 100 µg/ml of Atosiban. Following 30 minutes of acclimation, one well from
each treatment was left un-stimulated (control) and one well was stimulated with 250 nM
of oxytocin. Following the oxytocin challenge, 300 µl of media was collected at half an
87
hour, 1, 2, 6, and 24 hours. Conditioned media was collected and stored at -80ºC until
PGF2α concentrations were determined.
Enzyme Immunoassay
Commercial EIA kits (Cayman Chemical Co., Ann Arbor, MI) were used to
measure the concentration of PGF2α in culture medium according to manufacturer
instructions.
Statistical Analysis
Significant differences among treatments were determined by least square
analysis of variance using the mixed procedure of Statistical Analysis System (SAS
Institute, Cary, NC, v9.2, 2008). Oxytocin, time, inhibitor and their interactions were
considered independent variables. Mare was considered random for all experiments.
Prostaglandin F2α production over time data was transformed for statistical analysis using
logarithmic 10 due to the non-homogeneity among the variances. A significance level of
P < 0.05 was used for all statistical tests. Results are presented as non-transformed means
± s.e.m.
88
Results
Oxytocin Dose Response
Oxytocin stimulated (P < 0.05) PGF2α release from endometrial explants in a dose
dependent fashion (Figure 3.1). Specifically, stimulation with 31.25 nM of oxytocin did
not increase concentrations of PGF2α when compared to the non-stimulated explants. The
PGF2α response plateaued at 125 nM, with oxytocin concentrations of 62.5, 125, 250,
500, 1000, and 1500 nM having the same influence on PGF2α release.
Oxytocin Stimulated PGF2α Production Over time
When endometrial explants were challenged with 250 nM of oxytocin,
concentrations of PGF2α were higher (P < 0.0001) at each time point over the 24 hours of
culture compared to non-stimulated explants (Figure 3.2). In both challenged and
unchallenged explants PGF2α concentrations did not increase through 2 hours of culture,
but increased (P < 0.001) at 6 and 24 hours, respectively.
Inhibition of PGF2α release in Endometrial Explants
Concentrations of PGF2α were higher (P < 0.02) following 6 hours of culture in
endometrial explants challenged with oxytocin as compared to non-stimulated explants
(Figure 3.3). Moreover, oxytocin failed (P < 0.001) to elicit PGF2α release in endometrial
explants cultured with an oxytocin receptor antagonist or a Cox inhibitor.
89
Discussion
The data reported herein demonstrates that equine endometrial explant cultures
release PGF2α in a dose dependent fashion when stimulated with increasing
concentrations of oxytocin and is similar to what has been previously reported in the
literature in the equine (Nash et al., 2008; King and Evans, 1987; Watson et al., 1992),
porcine (Blitek and Ziecik, 2004), and the bovine (Mann, 2001; Hearth et al., 2009).
Although not tested in this study, others have found in equine and porcine endometrial
cell cultures, epithelial cells secreted higher concentrations of PGF2α as compared to
stromal cells (Watson et al., 1992; Blitek and Ziecik, 2004).
This is the first study to show that the oxytocin stimulated PGF2α release in
equine explants is specific to an oxytocin receptor mediated event as demonstrated by the
inhibition of PGF2α release when stimulated with oxytocin in the presence of an oxytocin
antagonist. This inhibition is similar to that seen in an in vitro study using oxytocin
stimulated myometrial strips from pregnant women (Buscher et al., 2001). Similarly,
Phaneuf and colleagues (1994) found Atosiban to inhibit oxytocin induced myometrial
cell activation in cultured human myometrium.
The oxytocin stimulated release of PGF2α from equine endometrial explants reported
here also involves the enzyme Cox. The Cox inhibitor, Indomethacin, equally impeded
the secretion of PGF2α in oxytocin stimulated equine endometrial explants when
compared to the oxytocin receptor antagonist, Atosiban. The inhibition of PGF2α release
by Indomethacin is similar to what others have reported in equine and bovine endometrial
cultures (King and Evans, 1987; Asselin et al., 1997).
90
In conclusion, the data reported herein supports, as others earlier have reported, equine
endometrial explant cultures stimulated with oxytocin have increased secretion of PGF2α.
Moreover, this study establishes that PGF2α secretion can be inhibited through the
oxytocin receptor antagonist, Atosiban; as well as by the cyclooxygenase inhibitor,
Indomethacin. This response involves an oxytocin receptor mediated event that activates
the prostaglandin synthesis cascade. The described culture system offers an experimental
model that can now be used to determine the effects of other factors, such as diet, on the
production of PGF2α from the equine endometrium.
91
Figure 3.1 Prostaglandin F2α concentrations (PGF2α) (+ s.e.m) in equine endometrial
explant cultures after 24 h in the absence or presence of increasing concentrations of
oxytocin. a,b,c
Means with different superscripts differ (P < 0.05).
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
5
5.5
6
6.5
0 100 200 300 400 500 600 700 800 900 1000 1100 1200 1300 1400 1500
PG
F2α
Co
nce
ntr
atio
ns
(pg/µ
g o
f p
rote
in)
Oxytocin (nM)
a
a,b
b,c
b,c b,c
c
a,b,c
a,b,c
92
Figure 3.2 Prostaglandin F2α concentrations (+ s.e.m) in equine endometrial explant
cultures during 24 h of culture in the absence (- Oxy) or presence (+ Oxy) of oxytocin. x,y
Means within each time point differ (P < 0.0001). a,b,c
Means with different superscripts
differ within each treatment (P < 0.0001).
-1
0
1
2
3
4
5
6
7
8
9
10
11
12
13
0 2 4 6 8 10 12 14 16 18 20 22 24
PG
F C
once
ntr
atio
ns
(pg/µ
g o
f p
rote
in)
Time (hours)
(-) Oxy
(+) Oxy
b,x
c,x
a,xa,xa,
x
a,y a,y a,y
b,y
c,y
93
Figure 3.3 Prostaglandin F2α concentrations (+ s.e.m) in equine endometrial explant
cultures in response to oxytocin after 6 h of culture with increasing concentrations of
Indomethacin or Atosiban. a,b
Means with different superscripts differ (P < 0.02).
0
1
2
3
4
5
6
7
8
9
10
11
(-) Oxy (+) Oxy
PG
F2α
Co
nce
ntr
atio
n (
pg/µ
g o
f p
rote
in)
None
Indomethacin-4µg/ml
Indomethacin-8µg/ml
Atosiban-50µg/ml
Atosiban-100µg/ml
b
aa a
a aa
a
aa
94
CHAPTER 4
EFFECTS OF OXYTOCIN, LPS, AND POLYUNSATURATED FATTY ACIDS
ON PROSTAGLANDIN SECRETION AND GENE EXPRESSION IN EQUINE
ENDOMETRIAL EXPLANT CULTURES
Abstract
Dietary supplementation with polyunsaturated fatty acids (PUFAs) has been
shown to influence uterine prostaglandin production in many species, although the effect
of PUFAs on uterine inflammatory response in the mare remains unknown. To determine
the effects of PUFAs on equine endometrial prostaglandin production, endometrial
biopsies were harvested on day two of behavioral estrus. Fatty acid uptake of arachidonic
acid (AA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) by equine
endometrial explants was evaluated using gas liquid chromatography. Equine endometrial
explants were also treated with 100 µM of AA, EPA, or DHA and then challenged with
oxytocin (250nM) or lipopolysaccharide (LPS, 1 µg/ml). Prostaglandin F2α and E2
production was measured and the relative mRNA expression of key enzymes involved in
prostaglandin synthesis was determined using quantitative real-time PCR. Equine
endometrial explants incorporated EPA (P < 0.05) and DHA (P < 0.01) during culture for
24 hours with the addition of fatty acids. There was a tendency (P < 0.06) for explants to
incorporate AA. Prostaglandin F2α and E2 concentrations were higher (P < 0.0001) in
endometrial explants challenged with oxytocin or LPS as compared to controls despite
which fatty acid was added. Moreover, oxytocin stimulated explants to a greater (P <
0.007) extent than LPS. Only DHA inhibited (P < 0.0001) PGF2α and PGE2 secretion in
95
non-stimulated and stimulated (with oxytocin or LPS) explants. Endometrial explants
stimulated with oxytocin had increased expression of Cox-1 (P < 0.02), Cox-2 (P <
0.001), PGFS (P < 0.01), PGES (P < 0.01), and PLA2 ( P < 0.005) as compared to
controls and regardless of fatty acid treatment. Explants stimulated with LPS had
increased expression of Cox-2 (P < 0.004), PGFS (P < 0.03), PGES (P < 0.01), and PLA2
(P < 0.01) as compared to controls and regardless of fatty acid treatment. In conclusion,
supplementation with PUFAs, specifically DHA, can influence the inflammatory
response in vitro through mechanisms other than enzyme expression. Decreased PGF2α
production associated with PUFA supplementation in vitro, creates a likely approach for
decreasing early embryonic loss in vivo associated with post breeding inflammation
commonly seen in the equine industry.
96
Introduction
Early embryonic loss in the mare can be caused by a lack of maternal inhibition of
prostaglandin F2α (PGF2α) or increased secretion of PGF2α due to uterine inflammation.
Increased secretion or accumulation of PGF2α within the uterus causes luteolysis of the
corpus luteum and results in embryonic loss. Strategies to increase embryonic survival in
older mares or mares susceptible to uterine infection include decreasing or inhibiting
PGF2α secretion. Supplementation with polyunsaturated fatty acids (PUFAs),
eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), have been shown to
decrease PGF2α release in vivo (Mattos et al., 2000; Perez et al., 2006) and in vitro
(Arntzen et al., 1998; Mattos et al., 2003; Caldari-Torres et al., 2006) using human, rat,
and bovine models. Petit et al. (2002) showed that cows receiving a diet supplemented
with polyunsaturated fatty acids had a lower incidence of early embryonic loss.
Supplementation of mares with EPA and/or DHA could decrease PGF2α secretion within
the uterus and help prevent premature luteolysis and early embryonic loss as seen in
cattle (Mattos et al., 2000).
In this study, our objectives were to determine AA, EPA, and DHA uptake in
equine endometrial explants and to evaluate their influence on PGF2α and PGE2 secretion
and expression of enzymes involved in prostaglandin synthesis.
97
Materials and Methods
Materials
Six well culture plates, Hank’s Balanced Salt Solution (HBSS), bovine serum
albumin (BSA), Hams F-12, and Eagle minimum essential medium (MEM) were
purchased from Fisher Scientific (Pittsburgh, PA). The antibiotic antimycotic and insulin-
transferrin-selenium X supplement was from Invitrogen (Carlsbad, CA). The fetal bovine
serum (FBS) was from HyClone (Logan, UT). Escherichia coli lipopolysaccharide (LPS,
serotype 026:B6) was from Sigma-Alrich (St. Louis, MO). The fatty acids EPA (C20:5,
n-3), DHA (C22:6, n-3) and AA (C20:4, n-6) and PGE2 and PGF2α EIA kits were
purchased from Cayman Chemical Company (Ann Arbor, MI).
Animals
A total of ten mature cycling mares of light horse breeding and various age (12.6
years ± 5) were utilized and housed at The University of Arizona Equine Center. Mares
were teased with a stallion daily for detection of behavioral estrus. Follicular
development and uterine edema were monitored by transrectal palpation and
ultrasonography every day from the first detection of behavioral estrus through ovulation.
All animal procedures were reviewed and approved by the Institutional Animal Care and
Use Committee at The University of Arizona.
Fatty acid preparation
Stock solutions of polyunsaturated fatty acids were diluted in 1 ml of ethanol (50
mg/ml) and stored at -80ºC until further use. At preparation of culture media with fatty
acids, fatty acids were diluted with 1% bovine serum albumin (BSA) culture media (1%
98
BSA in Hams F-12 and MEM) to a concentration of 100 nM. These solutions were
incubated for 1 h in a water bath at 37ºC to allow for binding of the fatty acids within the
media and then further diluted with 1% BSA culture media to final concentration of 100
µM per well.
Experiment I: fatty acid uptake
Two endometrial biopsies were collected from each of four mares on the second
day of behavioral estrus. The biopsies were recovered non-surgically using a cattle
biopsy instrument (3 mm × 450 mm, semiflexible forceps with a Palmer Jacobs jaw,
Richard Wolf Medical Instruments Corporation, Vernon Hills, IL). Uterine tissue was
removed aseptically from the biopsy punch and placed into 10 ml of HBSS supplemented
with 2X concentration of Antibiotic-Antimycotic solution. Biopsies were transported to
the laboratory on ice within 30 minutes of harvest. Uterine tissue was rinsed with fresh
HBSS. Endometrial biopsies were minced into 10-12 mm2 sections and were divided into
five 35 mm wells on a six well plate. Explants were incubated in 3 ml of fresh media
(40% Hams F-12, 40% MEM, 10 ml/L of antibiotic antimycotic, 200 U/L of Insulin-
Transferrin-Selenium X supplement, and 20% fetal bovine serum) for 90 minutes at 37ºC
in a humidified incubator containing 95% air and 5% CO2. Explants were then rinsed
one time with fresh 1% BSA culture media (1% BSA in Hams F-12 and MEM) and each
well received 3 ml 1% BSA culture media (1% BSA in Hams F-12 and MEM, 10 ml/L of
antibiotic antimycotic, and 200 U/L of Insulin-Transferrin-Selenium X supplement)
containing one of the following treatments: control (1% BSA culture media in Hams F-12
and MEM with 1.8 µl ethanol), 100 µM AA, 100 µM EPA, 100 µM DHA, or 50 µM
99
EPA + 50 µM DHA. After 24 hours of culture, explants were collected in 1.5 ml tubes
and stored at -80ºC until analysis. Fatty acid content of the endometrial explants was
measured using gas liquid chromatography.
Experiment II: effect of PUFAs on PG release and gene expression
Four endometrial biopsies were taken from each of eight mares on the second day
of behavioral estrus using methods described above. Biopsies were minced and divided
into twenty-four sections and plated into individual wells on 6 well plates (4 wells per
plate). On each plate, each of the wells received one of the following treatments in 2.5 ml
of 1% BSA culture media: control (no treatment), 100 µM AA, 100 µM EPA, or 100 µM
DHA. After the addition of the treatments, explants were incubated for 24 hours to allow
fatty acid uptake. Following incubation, two plates served as control and did not receive
any stimulant, two plates were stimulated with oxytocin (250 nM), and two plates were
stimulated with LPS (1 µg/ml). Conditioned media was collected at 6 and 24 h and stored
at -80ºC until PGF2α and PGE2 analysis. Commercial EIA kits were used according to
manufacturer instructions to measure PGF2α and PGE2. Endometrial explant tissue was
collected and stored in 1.5 ml tubes at -80ºC until gene expression analysis. Three plates
(one plate from each stimulant) served for analysis of prostaglandin production and the
other three plates for gene expression analysis.
RNA extraction and quantitative real-time PCR (qPCR)
Total RNA from equine endometrial explants (n=7) was extracted using the
Qiagen RNeasy Protect Mini Kit (Qiagen, Valencia, CA). Primers were designed to
measure gene expression for five genes involved in the prostaglandin biosynthesis
100
pathway. Details of the primer sets used are listed in Table 4.1. The relative expression of
Cox-1 and 2, PGFS, PGES, and PLA2 mRNA transcripts were measured by quantitative
real-time PCR using QuantiTect SYBR Green RT-PCR Master Mix (Qiagen, Valencia,
CA) in an iQ5 Real-Time PCR Detection System (BioRad Laboratories, Hercules, CA).
After initial denaturation at 95ºC for 15 minutes, the PCR reactions were subjected to 40
cycles of 95ºC for 30 seconds, 60ºC for 30 seconds and 72ºC for 10 seconds. A melt
curve analysis was performed starting at 60ºC with an increase of 0.2ºC every 6 seconds
to 96ºC at the end of the amplification to confirm homogeneity among products.
Duplicate RNA samples were measured and threshold cycles were normalized to
a reference gene (ribosomal protein S15) using the comparative ∆ Ct method (CT gene of
interest – CT reference gene), and fold changes (∆∆ CT) were determined using the Pfaffl
(Pfaffl, 2001) and Livak Method (Livak and Schmittgen, 2001).
Statistical Analysis
Significant differences among treatments were determined by least squares
analysis of variance using the mixed procedure of the Statistical Analysis System (SAS
Institute, Cary, NC, v9.2, 2008). Fatty acid treatment, stimulant, time, and their
interactions were considered the independent variables. Mare was considered random for
all experiments. Data for prostaglandin F2α production in the presence of fatty acids and
stimulants was transformed for statistical analysis using logarithmic 10 due to the non-
homogeneity among the variances. A significance level of P < 0.05 was used for all
statistical tests. Results are presented as non-transformed means ± s.e.m.
101
Results
Experiment I
Endometrial explants incorporated EPA (P < 0.05) and DHA (P < 0.01) when
cultured with fatty acids for 24 hours. There was a tendency (P < 0.06) for explants to
incorporate AA (Figure 4.1).
Experiment II
The affect of stimulant and fatty acid treatment on PGF2α and PGE2 secretion are
presented separately as means due to a lack of stimulant by fatty acid treatment
interaction (Figures 4.2 and 4.3). Prostaglandin F2α and E2 concentrations were higher (P
< 0.0001) in endometrial explants challenged with oxytocin or LPS as compared to
controls despite the addition of fatty acid treatment (Figures 4.2a and 4.3a). Moreover,
oxytocin stimulated explants to a greater (P < 0.007) extent than LPS.
When explants were stimulated with oxytocin or LPS, only DHA inhibited (P <
0.0001) PGF2α and PGE2 secretion (Figures 4.2b and 4.3b). The addition of AA and EPA
failed to influence PGF2α or PGE2 secretion from equine endometrial explants.
qPCR
Endometrial explants stimulated with oxytocin had increased expression of Cox-1
(P < 0.02), Cox-2 (P < 0.001), PGFS (P < 0.01), PGES (P < 0.01), and PLA2 ( P < 0.005)
as compared to controls and regardless of fatty acid treatment (Table 4.2). Explants
stimulated with LPS had increased expression of Cox-2 (P < 0.004), PGFS (P < 0.03),
PGES (P < 0.01), and PLA2 (P < 0.01) as compared to controls and regardless of fatty
102
acid treatment. Fatty acid treatment with AA, EPA, or DHA failed to influence the
expression of any of the genes analyzed.
103
Discussion
Herein we report for the first time the response of equine endometrial explants
cultured with fatty acids and stimulated with LPS or oxytocin. As expected, oxytocin
stimulated PGF2α release from endometrial explants, as has been previously
demonstrated in vitro in equine endometrial tissue (King and Evans, 1987; Watson et al.,
1992). However, this is the first report of oxytocin stimulated release of PGE2 from
equine endometrial explants. Similar to PGE2 concentrations found in porcine epithelial
endometrial cells (Blitek and Ziecik, 2004), concentrations of PGE2 from stimulated
equine endometrial explants were less than half that of PGF2α concentrations. Although
we did not determine PGE2 origin, PGE2 has been shown to be mainly secreted from
endometrial stromal cells (Blitek and Ziecik, 2004). We have also demonstrated PGF2α
and PGE2 secretion increased in equine endometrial explants stimulated with LPS,
although to a lesser extent than with oxytocin stimulation. Similarly, equine (Nash et al.,
2008) and bovine (Herath et al., 2006) endometrial explants had increased concentrations
of PGF2α when stimulated with LPS. The secretion of PGE2 in response to LPS
stimulation has not previously been shown in equine endometrial explants; although rat
hypothalamic explants (Pozzoli et al., 1994), human ciliary epithelial cells (Yadav et al.,
2010), and equine synovial tissue (Briston et al., 2010) treated with LPS had increased
concentrations of PGE2 which is similar to the response we found in equine endometrial
explants.
Supplementation with DHA decreased secretion of PGF2α and PGE2 from equine
endometrial explants which is similar to results seen in bovine (Mattos et al., 2003;
104
Caldari-Torres et al., 2006) and ovine (Kirkup et al., 2010) endometrial epithelial cells,
human decidual cells (Arntzen et al., 1998; Roman et al., 2006), and rat uteri (Perez et al.,
2006). Similar to results we found in equine endometrial explants, EPA did not influence
prostaglandin secretion in decidual cell cultures (Roman et al., 2006) or bovine uterine or
endometrial tissue (Cheng et al., 2001; Meier et al., 2009). Although EPA did not
influence PGF2α or PGE2 release in our study, EPA decreased PGF2α and/or PGE2
secretion in bovine and decidual cell cultures (Arntzen et al., 1998; Mattos et al., 2003;
Caldari-Torres et al., 2006). In contrast, rats supplemented with DHA had higher
concentrations of PGF which the authors attribute to increasing PGF3α. Similar results of
polyunsaturated fatty acids increasing 1 and 3 series prostaglandins, which are less
biologically active, has been demonstrated in ovine uterine epithelial cells (Cheng et al.,
2005). It is likely supplementation with EPA and/or DHA increases production of 1 and 3
series prostaglandins while decreasing the biologically more active 2 series. Arachidonic
acid has been show to increase PGF2α and PGE2 release from equine endometrial
explants (King and Evans, 1987), bovine endometrial cells (Mattos et al., 2003), ovine
uterine epithelial cells (Cheng et al., 2005) , and human decidual cells (Arntzen et al.,
1998); whereas in our endometrial explants AA did not influence the release of PGF2α or
PGE2. The contrasting data between our study and the King and Evans (1987) study is
unexpected; however the lack of influence by AA in our study could be due to the lack of
detection because of high variation seen between mares.
Decreases in prostaglandin production in association with the supplementation of
polyunsaturated fatty acids could likely be caused by regulation of enzyme expression
105
within the prostaglandin synthesis pathway. However, supplementation with PUFAs did
not affect Cox-1, Cox-2, PGFS, or PLA2 mRNA expression in the bovine uterus (Coyne
et al., 2008) or protein levels in the bovine endometrial cells (Mattos et al., 2003).
Incubation with DHA or EPA did not affect mRNA expression of Cox-1, Cox-2, or
PGDH in decidual cell cultures (Roman et al,. 2006). Similarly, we showed no difference
in enzyme expression in explants cultured with EPA or DHA. In contrast, Coyne and
colleagues (2008) demonstrated bovine receiving a high polyunsaturated fatty acid diet
had increased expression of PGES mRNA and tended to have lower expression of PLA2
mRNA within endometrial tissue. Furthermore, Massaro et al. (2006) showed DHA
decreased Cox-2 protein expression in human vascular endothelial cells. The decrease in
protein expression could be due to variations in the length of incubation with DHA; 48
hours (Massaro et al., 2006) versus 24 hours (Mattos et al., 2003). However, we did
detect a difference in enzyme expression when explants were stimulated with oxytocin or
LPS as compared to controls, similar to what others have reported in vitro in the porcine
myometrium (Franczak et al., 2006) and equine endometrium (Ealy et al., 2010). The
increased enzyme expression would be expected, as oxytocin has been shown to
stimulate PGF2α release in various cell and explant cultures.
In our study, enzymes related to prostaglandin synthesis were not affected by 24
hour culture with EPA or DHA. However, two enzymes not evaluated in this study, but
are needed for oxytocin stimulated prostaglandin release are phospholipase C and protein
kinase C. Changes in expression of these two enzymes could influence the synthesis of
prostaglandins. Human vascular endothelial cells cultured with DHA then stimulated
106
with IL-1α, had decreased prostaglandin secretion likely due to inhibition of protein
kinase C activity (Massaro et al., 2006). Although, DHA decreased prostaglandin
production, it appears not to be modulated through enzyme expression within the
endometrium; therefore DHA could be inhibiting PGF2α secretion through other
mechanisms. Possible mechanisms for this inhibition include 1) shifting production from
2-series prostaglandins to 1 or 3-series prostaglandins, 2) through competition of EPA
and DHA with AA for lipid metabolism and incorporation in the phospholipid
membrane, or 3) DHA is possibly affecting the cell membrane and phospholipid bilayer
and influencing signaling pathways. The transmembrane domain and activation of the
oxytocin receptor could be influenced by DHA if the cell membrane is being altered. It
has been shown that DHA alters basic cell membrane properties including fluidity and
protein function (Stillwell and Wassall, 2003). Docosahexaenoic acid has a strong
aversion to cholesterol causing it to incorporate and packs poorly with other lipids
present in the membrane (Stillwell, 2006). This could create movement of lipid rafts and
other membrane domains, possibly altering the location of key signaling enzymes.
In conclusion, supplementation with polyunsaturated fatty acids, specifically
DHA, can influence the inflammatory response in vitro through mechanisms other than
enzyme expression. Decreased PGF2α production associated with omega-3 fatty acid
uptake in vitro, creates a likely approach for decreasing early embryonic loss in vivo
associated with post breeding inflammation commonly seen in the equine industry.
107
Table 4.1 Equine oligonucleotide primers used in this study
Gene Name Sequence Accession
number
Cox-1 F: 5’GCTACGCGAGCACAACCGTGT DQ246452
R: 5’GCATGAGTGGGTGCCAGTGGT
Cox-2 F: 5’GCCACGATTTGGCTGCGGGAA AB041771
R: 5’GGCACAAGGGGATGCCAGTGA
PGFS F: 5’GCCTGTCTGCAACCAGGTGGA NM_001081895
R: 5’AGGACTGGGGAGTTTGGGGCA
PGES F: 5’GAGGACGCCCTGAGACACGGA NM_001081935
R: 5’GGCCACGGTGTAGGCCAGAGA
PLA2 F: 5’TGTTCGTGCCCAGACCTCCGA NM_001081843
R: 5’AACCTCCGCCTGAGCCCAAGA
108
Table 4.2 Gene expression in equine endometrial explants cultured with PUFAs for 24 h
and stimulated with oxytocin or LPS for 24 h. Quantitative PCR was performed (n =7
except Cox-1, where n=4).
Gene of
Interest
Control ∆CT LPS ∆CT LPS
Fold ∆
Oxytocin
∆CT
Oxytocin
Fold ∆
Cox-1 3.9±0.7 4.3±0.7 0.77 1.7±0.9 4.67*
Cox-2 5.0±1.3 3.2±1.3 3.68* 3.1±1.5 3.74*
PGFS 7.8±0.9 7.8±0.4 1.04* 6.4±0.5 2.77*
PGES 4.6±1.7 4.0±0.9 1.51* 4.3±0.8 1.24*
PLA2 2.0±0.9 0.5±0.9 2.77* 0.4±0.5 3.22*
∆CT ± s.e.m. are presented for control and stimulated explants. Fold change (Fold ∆) in
stimulated explants from control explants was calculated by the 2-∆∆C
T method. Statistical
analysis was performed on ∆CT values with ribosomal protein S15 as the reference gene
(*P < 0.05).
109
Figure 4.1 Proportion of a) AA, b) EPA, and c) DHA content within equine endometrial
explants when cultured with 100 µM AA, 100 µM EPA, 100 µM DHA, or 50 µM EPA +
50 µM DHA for 24 h. Endometrial explants incorporated EPA and DHA and tended to
incorporate AA. *P < 0.05, **P < 0.001.
0
2
4
6
8
10
12
14
100µM 100µM 100µM 100µM 100µM
Control AA DHA EPA EPA/DHA
Pro
po
rtio
n o
f T
ota
l F
atty
Aci
d
(%)
AA
0
2
4
6
8
10
12
14
100µM 100µM 100µM 100µM 100µM
Control AA DHA EPA EPA/DHA
Pro
po
rtio
n o
f T
ota
l F
atty
Aci
d
(%) EPA
*
*
0
2
4
6
8
10
12
14
100µM 100µM 100µM 100µM 100µM
Control AA DHA EPA EPA/DHA
Pro
po
rtio
n o
f T
ota
l F
atty
Aci
d
(%)
DHA**
**
a)
b)
c)
110
Figure 4.2 Effects of a) stimulant and b) fatty acid treatment on PGF2α secretion in
equine endometrial explants cultured for 6 h in the presence of no stimulus (control),
LPS, or oxytocin. Due to non-homogeneity among the variances, data was transformed
using logarithmic 10 for statistical analysis; data presented is non-transformed means ±
s.e.m. a,b,c
Means with different superscripts differ (P < 0.0001), * P < 0.0001.
0
1
2
3
4
5
6
7
8
9
Control LPS Oxy
PG
F2α
Co
nce
ntr
atio
n
(pg/µ
g o
f p
rote
in)
c
a
b
0
1
2
3
4
5
6
7
8
9
No AA EPA DHA
PG
F2α
Co
nce
ntr
atio
n
(pg/µ
g o
f p
rote
in)
*
a)
b)
111
Figure 4.3 Effects of a) stimulant and b) fatty acid treatment on PGE2 secretion in equine
endometrial explants cultured for 6 h in the presence of no stimulus (control), LPS, or
oxytocin. Due to non-homogeneity among the variances, data was transformed using
logarithmic 10 for statistical analysis; data presented is non-transformed means ± s.e.m. a,b,c
Means with different superscripts differ (P < 0.0001), * P < 0.0001.
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
2
Control LPS Oxy
PG
E2
Co
nce
ntr
atio
n
(pg /
µg o
f p
rote
in)
a
bc
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
2
No AA EPA DHA
PG
E2
Co
nce
ntr
atio
n
(pg/µ
g o
f p
rote
in)
*
a)
b)
112
REFERENCES
Achard F, Gilbert M, Benistant C, Ben Slama S, DeWit DL, Smith WL, and
Lagarde M 1997 Eicosapentaenoic and docosahexaenoic acids reduce PGH synthase-1
expression in bovine aortic endothelial cells. Biochemical and Biophysical Research
Communications 241 513-518.
Adams GP, Kastelic JP, Bergfelt DR, and Ginther OJ 1987 Effect of uterine
inflammation and ultrasonically-detected uterine pathology on fertility in the mare.
Journal of Reproduction and Fertility (Supplement) 35 445-454.
Akira S, Takeda K, and Kaisho T 2001 Toll-like receptors: critical proteins linking
innate and acquired immunity. Nature Immunology 2 675-680.
Allen WR and Rowson LEA 1973 Control of the mare's oestrous cycle by
prostaglandins. Journal of Reproduction and Fertility 33 539-543.
Alvarez C, Cachaldora P, Mendez J, Garcia-Rebollar P, and De Blas JC 2004
Effects of dietary conjugated linoleic acid and fish oil supplementation on performance
and egg quality in laying hens. British Poultry Science 45 524-529.
Arntzen KJ, Brekke OL, Vatten L, and Austgulen R 1998 Reduced production of
PGE2 and PGF2 alpha from decidual cell cultures supplemented with N-3 polyunsaturated
fatty acids. Prostaglandins & Other Lipid Mediators 56 183-195.
Arosh JA, Parent J, Chapdelaine P, Sirois J, and Fortier MA 2002 Expression of
cyclooxygenases-1 and -2 and prostaglandin E synthase in bovine endometrial tissue
during the estrous cycle. Biology of Reproduction 67 161-169.
Asselin E, Drolet P, and Fortier MA 1997 Cellular mechanisms involved during
oxytocin-induced prostaglandin F2alpha production in endometrial epithelial cells in
vitro: role of cyclooxygenase-2. Endocrinology 138 4798-4805.
Atli MO, Kurar E, Kayis SA, Aslan S, Semacan A, Celik S, and Guzeloglu A 2010
Evaluation of genes involved in prostaglandin action in equine endometrium during
estrous cycle and early pregnancy. Animal Reproduction Science 122 124-132.
Ball BA, Little TV, Weber JA, and Woods GL 1989 Survival of day 4 embryos from
young normal mares and aged subfertile mares after transfer to normal recipient mares.
Journal of Reproduction and Fertility 85 187-194.
Ball BA, Little TV, Hillman RB, and Woods GL 1986 Pregnancy rates at days 2 and
14 and estimated embryonic loss rates prior to day 14 in normal and subfertile mares.
Theriogenology 26 611-619.
113
Behrendt CY, Adams MH, Daniel KS, and McDowell KJ 1997 Oxytocin expression
by equine endometrium. Biology of Reproduction (Supplement) 56 134.
Betteridge KJ, Renard A, and Goff AK 1985 Uterine prostaglandin release relative to
embryo collection, transfer procedures, and maintenance of the corpus luteum. Equine
Veterinary Journal (Supplement) 3 25-33.
Bilby TR, Block J, do Amaral BC, Sa Fiho O, Silvestre FT, Hansen PJ, Staples CR,
and Thatcher WW 2006 Effects of dietary unsaturated fatty acids on oocyte quality and
follicular development in lactating dairy cows in summer. Journal of Dairy Science 89
3891-3903.
Bilby TR, Guzeloglu A, MacLaren LA, Staples CR, and Thatcher WW 2006
Pregnancy, bovine somatotropin, and dietary n-3 fatty acids in lactating dairy cows: II.
endometrial gene expression related to maintenance pregnancy. Journal of Dairy Science
89 3375-3385.
Blitek A and Ziecik AJ 2004 Prostaglandins F2 alpha and E2 secretion by porcine
epithelial and stromal endometrial cells on different days of the oestrous cycle.
Reproduction in Domestic Animals 39 340-346.
Boerboom D, Brown KA, Vaillancourt D, Poitras P, Goff AK, Watanabe K, Dore M,
and Sirois J 2004 Expression of key prostaglandin synthases in equine endometrium
during late diestrus and early pregnancy. Biology of Reproduction 70 391-399.
Boulton MI, McGrath TJ, Goode JA, Broad KD, and Gilbert CL 1996 Changes in
content of mRNA encoding oxytocin in the pig uterus during the oestrous cycle,
pregnancy, at parturition and in lactational anoestrus. Journal of Reproduction and
Fertility 108 219-227.
Briston L, Dudhia J, and Lees P 2010 Age-related differences in prostaglandin E2
synthesis by equine cartilage explants and synoviocytes. Journal of Veterinary
Pharmacology and Therapeutics 33 268-276.
Broughton SK, Hanh B, and Ross E 2009 Docosahexaenoic acid and eicosapentaenoic
acid affect ovarian prostaglandin levels differently in rats. Nutrition Research 29 510-
518.
Broughton SK, Rule DC, Ye Y, Zhnag X, Driscoll M, and Culver B 2009 Dietary
omega-3 fatty acids differentially influence ova release and ovarian cyclooxygenase-1
and cyclooxygenase-2 expression in rats. Nutrition Research 29 197-205.
114
Burns PD, Engle TE, Harris MA, Enns RM, and Whittier JC 2003 Effect of fish
meal supplementation on plasma and endometrial fatty acid composition in nonlactating
beef cows. Journal of Animal Sciences 81 2840-2846.
Burns PD, Tsai SJ, Wiltbank MC, Hayes SH, Graf GA, and Silvia WJ 1997 Effect of
oxytocin on concentrations of prostaglandin H synthase-2 mRNA in ovine endometrial
tissue in vivo. Endocrinology 138 5637-5640.
Buscher U, Chen FC, Riesenkampff E, Dehn DV, David M, and Dudenhausen JW
2001 Effects of oxytocin receptor antagonist Atosiban on pregnant myometrium in vitro.
Obstetrics & Gynecology 8 117-121.
Cabrera RA, Dozier BL, and Duffy DM 2006 Prostaglandin-endoperoxide synthase
(PTGS1 and PTGS2) expression and prostaglandin production by normal monkey
ovarian surface epithelium. Fertility and Sterility 86 1088-1096.
Cadario ME, Merritt AM, Archbald LF, Thatcher WW, and LeBlanc MM 1999
Changes in intrauterine pressure after oxytocin administration in reproductively normal
mares and in those with a delay in uterine clearance. Theriogenology 51 1017-1025.
Caldari-Torres C, Rodriguez-Sallaberry C, Greene ES, and Badinga L 2006
Differential effects of n-3 and n-6 fatty acids on prostaglandin F2 alpha production by
bovine endometrial cells. Journal of Dairy Science 89 971-977.
Calder PC 2009 Polyunsaturated fatty acids and inflammatory processes: new twists in
an old tale. Biochimie 91 791-795.
Campbell FM, Clohessy AM, Gordon MJ, Page KR, and Dutta-Roy AK 1997 Uptake
of long-chain fatty acids by human placental choriocarcinoma (BeWo) cells: role of
plasma membrane fatty acid-binding protein. Journal of Lipid Research 38 2558-2568.
Carnahan KG, Uzumcu M, Hu J, Sample GL, Braileanu GT, and Mirando MA
2002 Oxytocin stimulates secretion of prostaglandin F2 alpha from endometrial cells of
swine in the presence of progesterone. Domestic Animal Endocrinology 23 435-445.
Chapkin RS, Kim W, Lutpon JR, and McMurray DN 2009 Dietary docosahexaenoic
and eicosapentaenoic acid: emerging mediators of inflammation. Prostaglandins,
Leukotrienes, and Essential Fatty Acids 81 187-191.
Charpigny G, Reinaud P, Creminon C, and Tamby JP 1999 Correlation of increased
concentration of ovine endometrial cyclooxygenase-2 with the increase in PGE2 and
PGD2 in the late luteal phase. Journal of Reproduction and Fertility 117 315-324.
115
Cheng Z, Abayasekara DR, and Wathes DC 2005 The effect of supplementation with
n-6 polyunsaturated fatty acids on 1-, 2- and 3-series prostaglandin F production by ovine
uterine epithelial cells. Biochimica et Biophysica Acta 1736 128-135.
Cheng Z, Robinson RS, Pushpakumara PG, Mansbridge RJ, and Wathes DC 2001
Effect of dietary polyunsaturated fatty acids on uterine prostaglandin synthesis in the
cow. The Journal of Endocrinology 171 463-473.
Chibbar R, Miller FD , and Mitchell BF 1993 Synthesis of oxytocin in amnion,
chorion, and decidua may influence the timing of human parturition. The Journal of
Clinical Investigation 91 185-192.
Childs S, Hennessy AA, Sreenan JM, Wathes DC, Cheng Z, Stanton C, Diskin MG,
and Kenny DA 2008 Effect of level of dietary n-3 polyunsaturated fatty acid supplement
on systemic and tissue fatty acid concentrations and on selected reproductive variables in
cattle. Theriogenology 70 595-611.
Chow JC, Young DW, Golenbock DT, Christ WJ, and Gusovsky F 1992 Toll-like
receptor-4 mediates lipopolysaccharide-induced signal transduction. The Journal of
Biological Chemistry 274 10689-10692.
Classen-Linke I, Kusche M, Knauthe R, and Beier HM 1997 Establishment of a
human endometrial cell culture system and characterization of its polarized hormone
responsive epithelial cells. Cell and Tissue Research 287 171-185.
Covens AL, Christopher P, and Casper RF 1988 The effect of dietary supplementation
with fish oil fatty acids on surgically induced endometriosis in the rabbit. Fertility and
Sterility 49 698-703.
Coyne GS, Kenny DA, Childs S, Sreenan JM, and Waters SM 2008 Dietary n-3
polyunsaturated fatty acids alter the expression of genes involved in prostaglandin
biosynthesis in the bovine uterus. Theriogenology 70 772-782.
Crofford LJ 1997 COX-1 and COX-2 tissue expression: implications and predictions.
The Journal of Rheumatology (Supplement) 49 15-19.
Dimock WW and Edwards PR 1928 Pathology and bacteriology of the reproductive
organs of mares in relation to sterility. Kentucky Agricultural Experiment Station Bulletin
(Research Bulletin) 286 157-237.
Dunlap KA and Stormshak F 2004 Nongenomic inhibition of oxytocin binding by
progesterone in the ovine uterus. Biology of Reproduction 70 65-69.
116
Ealy AD, Eroh ML, and Sharp DC,3rd 2010 Prostaglandin H synthase type 2 is
differentially expressed in endometrium based on pregnancy status in pony mares and
responds to oxytocin and conceptus secretions in explant culture. Animal Reproduction
Science 117 99-105.
Eogan M and McKenna P 2004 Delaying preterm delivery at the threshold of viability.
Journal of Obstetrics and Gynaecology 4 459-460.
Fahmi HA, Hunter AG, Markham RJ, and Seguin BE 1985 Immunosuppressive
activity of bovine seminal plasma on bovine lymphocytes in vitro. Journal of Dairy
Science 68 2315-2321.
Fain JN, Wallace MA, and Wojcikiewicz RJH 1988 Evidence for involvement of
guanine nucleotide-binding regulatory proteins in the activation of phospholipases by
hormones. The Journal of the Federation of American Societies for Experimental Biology
2 2569-2574.
Farina M, Ribeiro ML, Weissmann C, Estevez A, Billi S, Vercelli C, and Franchi A
2004 Biosynthesis and catabolism of prostaglandin F2alpha (PGF2alpha) are controlled by
progesterone in the rat uterus during pregnancy. The Journal of Steroid Biochemistry and
Molecular Biology 91 211-218.
Flint APF and Sheldrick EL 1982 Ovarian secretion of oxytocin is stimulated by
prostaglandin. Nature 297 587-588.
Franczak A, Kotwica G, Kurowicka B, Oponowicz A, Woclawek-Potocka I, and
Petroff BK 2006 Expression of enzymes of cyclooxygenase pathway and secretion of
prostaglandin E2 and F2alpha by porcine myometrium during luteolysis and early
pregnancy. Theriogenology 66 1049-1056.
Gimpl G and Fahrenholz F 2001 The oxytocin receptor system: structure, function, and
regulation. Physiological Reviews 81 629-683.
Glasser SR, Julian J, Decker GL, Tang JP, and Carson DD 1988 Development of
morphological and functional polarity in primary cultures of immature rat uterine
epithelial cells. The Journal of Cell Biology 107 2409-2423.
Glatz JF, Luiken JFP, van Nieuwenhoven FA, and Van der Vusse GJ 1997
Molecular mechanism of cellular uptake and intracellular translocation of fatty acids.
Prostaglandins, Leukotrienes, and Essential Fatty Acids 57 3-9.
Goff AK, Pontbriand D, and Sirois J 1987 Oxytocin stimulation of plasma 15-keto-
13,14-dihydro prostaglandin F-2 alpha during the oestrous cycle and early pregnancy in
the mare. Journal of Reproduction and Fertility (Supplement) 35 253-260.
117
Gonzalez JM, Xu H, Ofori E, and Elovitz MA 2007 Toll-like receptors in the uterus,
cervix, and placenta: is pregnancy an immunosuppressed state? American Journal of
Obstetrics and Gynecology 197 296.e1-296.e6.
Gu W, Rice GE, and Brennecke SP 1994 Effects of lipopolysaccharide on human
placental prostaglandin F2 alpha production in vitro. Prostaglandins, Leukotrienes, and
Essential Fatty Acids 50 311-315.
Gutjahr S, Paccamonti DL, Pycock JF, Taverne MA, Dieleman SJ, and van der
Weijden GC 2000 Effect of dose and day of treatment on uterine response to oxytocin in
mares. Theriogenology 54 447-456.
Hall JA, Van Saun RJ, Tornquist SJ, Gradin JL, Pearson EG, and Wander RC
2004 Effect of type of dietary polyunsaturated fatty acid supplement (corn oil or fish
oil)on immune responses in healthy horses. Journal of Veterinary Internal Medicine 18
880-886.
Hamilton JA, Guo W, and Kamp F 2002 Mechanism of cellular uptake on long-chain
fatty acids: Do we need cellular proteins? Molecular and Cellular Biochemistry 239 17-
23.
Hearth S, Lilly ST, Fischer DP, Williams EJ, Dobson H, Bryant CE, and Sheldon
IM 2009 Bacterial lipopolysaccharide induces an endocrine switch from prostaglandin F2
alpha to prostaglandin E2 in bovine endometrium. Endocrinology 150 1912-1920.
Herath S, Fischer DP, Werling D, Williams EJ, Lilly ST, Dobson H, Bryant CE, and
Sheldon IM 2006 Expression and function of toll-like receptor 4 in the endometrial cells
of the uterus. Endocrinology 147 562-570.
Hornstra G, Van Houwelinge AC, Kivits GA, Fischer S, and Uedelhoven W 1991
Dietary fish and prostanoid formation in man. Advances in Prostaglandins,
Thromboxane, and Leukotriene Research 21A 225-228.
Irvine CHG 1995 The nonpregnant mare: A review of some current research and the last
25 years of endocrinology. Equine Reproduction IV, Biology Reproduction Monograph
Series 1 1 343-360.
Jacobs AL, Decker GL, Glasser SR, Julian J, and Carson DD 1990 Vectorial
secretion of prostaglandins by polarized rodent uterine epithelial cells. Endocrinology
126 2125-2136.
Katila T 1995 Onset and duration of uterine inflammatory repsonse of mares after
insemination with fresh semen. Biology of Reproduction Mono 1 515-517.
118
King SS and Evans WE 1987 Effects of arachidonic acid and oxytocin on equine
endometrial PGF2 alpha during normal cycles and pseudopregnancy. Theriogenology 7
303-308.
Kirkup SE, Cheng Z, Elmes M, Wathes DC, and Abayasekara DR 2010
Polyunsaturated fatty acids modulate prostaglandin synthesis by ovine amnion cells in
vitro. Reproduction 140 943-951.
Lee JS and Silvia WJ 1994 Cellular mechanisms mediating the stimulation of ovine
endometrial secretion of prostaglandin F2 alpha in response to oxytocin: role of
phospholipase A2. Journal of Endocrinology 141 491-496.
Lefebvre D, Giaid A, Bennett H, Lariviere R, and Zingg H 1992 Oxytocin gene
expression in rat uterus. Science 256 1553-1555.
Lehrer RI, Ganz T, Selsted ME, Babior BM, and Curnutte JT 1988 Neutrophils and
host defense. Annals of Internal Medicine 109 127-142.
Leung ST, Cheng Z, Sheldrick EL, Derecka K, Flint APF, and Wathes DC 2001 The
effects of lipopolysaccharide and interleukins-1alpha, -2, and -6 on oxytocin receptor
expression and prostaglandin production in bovine endometrium. Journal of
Endocrinology 168 497-508.
Livak KJ and Schmittgen TD 2001 Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25 402-408.
Mahfoudi A, Nicollier M, Propper AY, Coumes-Marquet S, and Adessi GL 1991
Establishment of endometrial glandular epithelial cell subculture in a serum-free,
hormonally defined medium, on a basement membrane matrix. Biology of the Cell 71
255-265.
Manhart DR, Scott BD, Eller EM, Honnas CM, Hood DM, Coverdale JA, and
Gibbs PG 2005 Effect of n-3 PUFAs on markers of inflammation in arthritic horses.
Equine Science Society Abstract 133-134.
Mann GE 2001 Hormone control of prostaglandin F2 alpha production and oxytocin
receptor concentrations in bovine endometrium in explant culture. Domestic Animal
Endocrinology 20 217-226.
Massaro M, Habib A, Lubrano L, Del Turco S, Lazzerini G, Bourcier T, Weksler
BB, and De Caterina R 2006 The omega-3 fatty acid docosahexaenoate attenuates
endothelial cyclooxygenase-2 induction through both NADP(H) oxidase and PKC
epsilon inhibition. Proceedings of the National Academy of Sciences of the United States
of America 103 15184-15189.
119
Mattos R, Staples CR, Williams J, Amorocho A, McGuire MA, and Thatcher WW
2002 Uterine, ovarian, and production responses of lactating dairy cows to increasing
dietary concentrations of menhaden fish meal. Journal of Dairy Science 85 755-764.
Mattos R, Guzeloglu A, Badinga L, Staples CR, and Thatcher WW 2003
Polyunsaturated fatty acids and bovine interferon-tau modify phorbol ester-induced
secretion of prostaglandin F2 alpha and expression of prostaglandin endoperoxide
synthase-2 and phospholipase-A2 in bovine endometrial cells. Biology of Reproduction
69 780-787.
Mattos R, Staples CR, Arteche A, Wiltbank MC, Diaz FJ, Jenkins TC, and
Thatcher WW 2004 The effects of feeding fish oil on uterine secretion of PGF2alpha,
milk composition, and metabolic status of periparturient Holstein cows. Journal of Dairy
Science 87 921-932.
Mattos R, Staples CR, and Thatcher WW 2000 Effects of dietary fatty acids on
reproduction in ruminants. Reviews of Reproduction 5 38-45.
McCracken JA 1980 Hormone receptor control of prostaglandin F2alpha secretion by
the ovine uterus. Biology of Reproduction 8 1329-1344.
McCracken JA 2004 Prostaglandin F2alpha: the luteolytic hormone. In The Eicosanoids,
pp 525-545. Anonymous, New York: John Wiley and Sons.
McCracken JA, Custer EE, and Lamsa JC 1999 Luteolysis: a neuroendrocrine-
mediated event. Physiological Review 79 263-323.
Meier S, Ledgard AM, Sato TA, Peterson AJ, and Mitchell MD 2009 Polyunsaturated
fatty acids differentially alter PGF(2alpha) and PGE(2) release from bovine trophoblast
and endometrial tissues during short-term culture. Animal Reproduction Science 111 353-
360.
Melin P, Vilhardt H, Lindeberg G, Larsson LE, and Akerlund M 1981 Inhibitory
effect of O-alkylated analogues of oxytocin and vasopressin on human and rat
myometrial activity. Journal of Endocrinology 88 173-180.
Mitchell JA, Kohlhass KL, Matsumoto T, Pollock JS, Forstermann U, Warner TD,
Schmidt HHHW, and Murad F 1992 Induction of NADPH-dependent diaphorase and
nitric oxide synthase activity in aortic smooth muscle and cultured macrophages.
Molecular Pharmacology 104 189-219.
Moussavi AR, Gilbert RO, Overton TR, Bauman DE, and Butler WR 2007 Effects
of feeding fish meal and n-3 fatty acids on ovarian and uterine responses in early
lactating dairy cows. Journal of Dairy Science 90 145-154.
120
Muzio M and Mantovani A 2000 Toll-like receptors. Microbes and Infection 2 251-255.
Myers MJ, Scott ML, Deaver CM, Farrell DE, and Yancy HF 2010 Biomarkers of
inflammation in cattle determining the effectiveness of anti-inflammatory drugs. Journal
of Veterinary Pharmacology and Therapeutics 33 1-8.
Nash D, Lane E, Herath S, and Sheldon IM 2008 Endometrial explant culture for
characterizing equine endometritis. American Journal of Reproductive Immunology 59
105-117.
Nash DM, Sheldon IM, Herath S, and Lane EA 2010 Markers of the uterine innate
immune response of the mare. Animal Reproduction Science 119 31-39.
Neely PD, Kindahl H, Stabenfeldt GH, Edquist LE, and Hughes JP 1979
Prostaglandin release patterns in the mare: physiological, pathophysiological, and
therapeutic responses. Journal of Reproduction and Fertility (Supplement) 27 181-189.
Obata T, Nagakura T, Masaki T, Maekawa K, and Yamashita K 1999
Eicosapentaenoic acid inhibits prostaglandin D2 generation by inhibiting cyclooxygenase-
2 in cultured human mast cells. Clinical and Experimental Allergy 29 1129-1135.
O'Connor CI, Lawrenece LM, St. Lawrenence AC, Janicki KM, Warren LK , and
Hayes S 2004 The effect of dietary fish oil supplementation on exercising horses.
Journal of Animal Sciences 82 2978-2984.
Palin MF, Brochu-Gaudreau K, Beaudry D, Small J, and Petit H 2005 Effects of
feeding flaxseed on cyclooxygenase-2 (Cox-2 and peroxisome rpoliferator-activated
receptors (PPAR) delta and gamma mRNA levels at time of maternal recognition of
pregnancy in Holstein cows. Society for the Study of Reproduction Annual Meeting
Abstract.
Perez MA, Hansen RA, Harris MA, and Allen KG 2006 Dietary docosahexaenoic acid
alters pregnant rat reproductive tissue prostaglandin and matrix metalloproteinase
production. The Journal of Nutritional Biochemistry 17 446-453.
Petit HV, Dewhurst RJ, Scollan ND, Proulx JG, Khalid M, Haresign W,
Twagiramungu H, and Mann GE 2002 Milk production and composition, ovarian
function, and prostaglandin secretion of dairy cows fed omega-3 fats. Journal of Dairy
Science 85 889-899.
Pfaffl MW 2001 A new mathematical model for relative quantification in real-time RT-
PCR. Nucleic Acids Research 29 e45.
121
Phaneuf S, Asboth G, MacKenzie IZ, Melin P, and Bernal AL 1994 Effect of
oxytocin antagonists on the activation of human myometrium in vitro: Atosiban prevents
oxytocin-induced desensitization. American Journal of Obstetrics and Gynecology 171
1627-1634.
Pozzoli G, Costa A, Grimaldi M, Schettini G, Preziosi P, Grossman A, and Navarra
P 1994 Lipopolysaccharide modulation of eicosanoid and corticotrophin-releasing
hormone release from rat hypothalamic explants and astrocyte cultures in vitro: evidence
for the involvement of prostaglandin E2 but not prostaglandin F2 alpha and lack of effect
of nerve growth factor. The Journal of Endocrinology 140 103-109.
Pratt BR, Butcher RL, and Inskeep EK 1977 Antiluteolytic effect of the conceptus and
of PGE2 in ewes. Journal of Animal Science 45 784-791.
Pycock JF and Allen WE 1988 Pre-chemotactic and chemotactic properties of uterine
fluid from mares with experimentally induced endometritis. Veterinary Record 123 193-
195.
Raetz CRH and Whitfield C 2002 Lipopolysaccharide endotoxins. Annual Review of
Biochemistry 71 635-700.
Rigby SL, Barhoumi R, Burghardt RC, Colleran P, Thompson JA, Varner DD,
Blanchard TL, Brinsko SP, Taylor T, Wilkerson MK, and Delp MD 2001 Mares with
delayed uterine clearance have an intrinsic defect in myometrial function. Biology of
Reproduction 65 740-747.
Roberts JS, McCracken JA, Gavagan JE, and Soloff MS 1976 Oxytocin-stimulated
release of prostaglandin F2 alpha from ovine endometrium in vitro: Correlation with
estrous cycle and oxytocin-receptor binding. Endocrinology 99 1107-1118.
Robinson RS, Pushpakumara PGA, Chneg Z, Peters AR, Abayasekara DRE, and
Wathes DC 2002 Effects of dietary polyunsaturated fatty acids on ovarian and uterine
function in lactating dairy cows. Reproduction 124 119-131.
Roesler S 2007 Cattle Production News. Farm and Ranch Guide 6.
Roman AS, Schreher J, Mackenzie AP, and Nathanielsz PW 2006 Omega-3 fatty
acids and decidual cell prostaglandin production in response to the inflammatory
cytokine IL-1beta. American Journal of Obstetrics and Gynecology 195 1693-1699.
Saltiel A, Paramo R, Murcia C, and Tolosa J 1986 Pathologic findings in the oviducts
of mares. American Journal of Veterinary Research 47 594-597.
122
Sharma SC and Fitzpatrick RJ 1974 Effect of oestradiol-17β and oxytocin treatment
on prostaglandin F2 alpha release in the anoestrous ewe. Prostaglandins 6 97-105.
Sharp DC, Thatcher MJ, Salute ME, and Fuchs AR 1997 Relationship between
endometrial oxytocin receptors and oxytocin-induced prostaglandin F2 alpha release
during the oestrous cycle and early pregnancy in pony mares. Journal of Reproduction
and Fertility 109 137-144.
Silvia WJ, Lee JS, Trammell DS, Hayes SH, Lowberger LL, and Brockman JA 1994
Cellular mechanisms mediating the stimulation of ovine endometrial secretion of
prostaglandin F2 alpha in response to oxytocin: role of phospholipase C and
diacylglycerol. Journal of Endocrinology 141 481-490.
Silvia WJ, Lewis GS, McCracken JA, Thatcher WW, and Wilson L,Jr 1991
Hormonal regulation of uterine secretion of prostaglandin F2 alpha during luteolysis in
ruminants. Biology of Reproduction 45 655-663.
Slonina D, Kowalik MK, Subocz M, and Kotwica J 2009 The effect of ovarian steroids
on oxytocin-stimulated secretion and synthesis of prostaglandins in bovine myometrial
cells. Prostaglandins & Other Lipid Mediators 90 69-75.
Smith WL, Marnett LJ, and DeWitt DL 1991 Prostaglandin and Thromboxane
Biosynthesis. Pharmacology and Therapeutics 49 153-179.
Smith DM, El Sahwi S, Wilson N, and Moyer DL 1971 Effect of polymorphonuclear
leukocytes on the development of mouse embryos cultured from the two-cell stage
blastocysts. Biology of Reproduction 4 74-83.
Smith WL 1992 Prostanoid biosynthesis and mechanisms of action. The American
Journal of Physiology 263 F181-91.
Sompayrac L 2008 How the Immune System Works. 134.
Spearman KR, Ott EA, Kivipelto J, and Warren LK 2005 Effect of fatty acid
supplementation of the mare on milk and foal plasma composition and foal growth.
Equine Science Society Abstract 3-4.
Spencer TE, Becker WC, George P, Mirando MA, Ogle TF, and Bazer FW 1995
Ovine interferon-tau regulates expression of endometrial receptor estrogen and oxytocin
but no progesterone. Biology of Reproduction 53 732-745.
Starbuck GR, Stout TAE, Lamming GE, Allen WR, and Flint APF 1998 Endometrial
oxytocin receptor and uterine prostaglandin secretion in mares during the oestrous cycle
and early pregnancy. Journal of Reproduction and Fertility 113 173-179.
123
Stevenson KR, Parkinson TJ, and Wathes DC 1991 Measurement of oxytocin
concentrations in plasma and ovarian extracts during the oestrous cycle of mares. Journal
of Reproduction and Fertility 93 437-441.
Stillwell W and Wassall SR 2003 Docosahexaenoic acid: membrane properties of a
unique fatty acid. Chemistry and Physics of Lipids 126 1-27.
Stillwell W 2006 The role of polyunsaturated lipids in membrane raft function. Food &
Nutrition Research 50.
Stout TAE and Allen WR 1999 The Role of Oxytocin in Luteolysis in the Cycling
Mare. Reproduction of the Domestic Animal 34 351-354.
Stremmel W, Kleinert H, Fitscher BA, Gunawan J, Klaasen-Schluter C, Moller K,
and Wegener M 1992 Mechanism of cellular fatty acid uptake. Biochemical Society
Transactions 20 814-817.
Stull CL and Evans JW 1986 Oxytocin binding in the uterus of the cycling mare.
Journal of Equine Veterinary Science 6 114-119.
Tanikawa M, Lee HY, Watanabe K, Majewska M, Skarzynski DJ, Park SB, Lee DS,
Park CK, Acosta TJ, and Okuda K 2008 Regulation of prostaglandin biosynthesis by
interleukin-1 in cultured bovine endometrial cells. The Journal of Endocrinology 199
425-434.
Taylor CC and Terranova PF 1996 Lipopolysaccharide inhibits in vitro luteinizing
hormone-stimulated rat ovarian granulosa cell estradiol but not progesterone secretion.
Biology of Reproduction 54 1390-1396.
Tithof PK, Roberts MP, Guan W, Elgayyar M, and Godkin JD 2007 Distinct
phospholipase A2 enzymes regulate prostaglandin E2 and F2alpha production by bovine
endometrial epithelial cells. Reproductive Biology and Endocrinology 5 16.
Troedsson MHT 1995 Uterine response to semen deposition in the mare. Proceedings
for the Society of Theriogenology 130-135.
Troedsson MHT 1999 Uterine clearance and resistance to persistent endometritis in the
mare. Theriogenology 52 461-471.
Troedsson MHT, Alghamdi AS, and Mattisen J 2002 Equine seminal plasma protects
the fertility of spermatozoa in an inflamed uterine environment. Theriogenology 58 453-
456.
124
Troedsson MHT, Liu IKM , and Thurmond M 1993 Immunoglobulin (IgG and IgA)
and complement (C3) concentrations in uterine secretion following an intrauterine
challenge of Streptococcus zooepidemicus in mares susceptible to versus resistant to
chronic uterine infection. Biology of Reproduction 49 502-506.
Troedsson MHT, Loset K, Alghamdi AM, Dahms B, and Crabo BG 2001 Interaction
between equine semen and the endometrium: the inflammatory response to semen.
Animal Reproduction Science 68 273-278.
Troedsson MH 2006 Breeding-induced endometritis in mares. The Veterinary Clinics of
North American Equine Practice 22 705-712.
Troedsson MH, Liu IK, and Crabo BG 1998 Sperm transport and survival in the mare:
a review. Theriogenology 50 807-818.
Vagnoni KE and Magness RR 1998 Estrogen and lipopolysaccharide stimulation of
prostacyclin production and the levels of cyclooxygenase and nitric oxide synthase in
ovine uterine arteries. Biology of Reproduction 59 1008-1015.
Valentine BA 2001 Muscle Glycogen, myopathy, and diet. World Equine Veterinary
Review 2 27-31.
Vallet JL, Lamming GE, and Batten M 1990 Control of endometrial oxytocin receptor
and uterine response to oxytocin by progesterone and oestradiol in the ewe. Journal of
Reproduction and Fertility 90 625-634.
Vanderwall DK 2008 Early Embryonic Loss in the Mare. Journal of Equine Veterinary
Science 28 691-702.
Vernon MW, Zavy MT, Asquith RL, and Sharp DC 1981 Prostaglandin F2alpha in
the equine endometrium: steroid modulation and production capacities during the estrous
cycle and early pregnancy. Biology of Reproduction 25 581-589.
Vineyard KR, Warren LK, and Kivipelto J 2010 Effect of dietary omega-3 fatty acid
source on plasma and red blood cell membrane composition and immune function in
yearling horses. Journal of Animal Sciences 88 248-257.
Vineyard KR, Warren LK, Webel SK, and Kivipelto J 2005 Effect of fish oil
supplementation on neutrophil function and antibody production in yearling horses.
Equine Science Society Abstract 13-14.
Waclawik A, Jabbour HN, Blitek A, and Ziecik AJ 2009 Estradiol-17 beta,
prostaglandin E2 (PGE2), and the PGE2 receptor are involved in PGE2 positive feedback
loop in the porcine endometrium. Endocrinology 150 3823-3832.
125
Wamsley NE, Burns PD, Engle TE, and Enns RM 2005 Fish meal supplementation
alters uterine prostaglandin F2alpha synthesis in beef heifers with low luteal-
progesterone. Journal of Animal Sciences 83 1832-1838.
Wathes DC, Abayasekara DRE, and Aitken RJ 2007 Polyunsaturated fatty acids in the
male and female reproduction. Biology of Reproduction 77 190-201.
Watson ED, Aubrey ES, Zanecosky HG, and Sertich PL 1992 Isolation and culture of
glandular epithelial and stromal cells from the endometrium of mares. Journals of
Reproduction and Fertility 95 269-275.
Watson ED, Bjorksten TS, Buckingham J, and Nikolakopoulos E 1997
Immunolocalisation of oxytocin in the uterus of the mare. Journal of Reproduction and
Fertility Abstract Series 20 31.
Watson ED, Strokes CR, and Bourne FJ 1988 Concentrations of immunoreactive
leukotriene B4 in uterine lavage fluid from mares with experimentally induced and
naturally occurring endometritis. Journal of Veterinary Pharmacology and Therapeutics
11 130-134.
Watson ED 2000 Post-breeding endometritis in the mare. Animal Reproduction Science
60-61 221-232.
Watson ED, Stokes CR, and Bourne FJ 1987 Cellular and humoral defence
mechanisms in mares susceptible and resistant to persistent endometritis. Veterinary
Immunology and Immunopathology 16 107-121.
Woodward AD, Nielsen BD, O'Connor CI, Webel SK, and Orth MW 2005 Dietary
long chain polyunsaturated fatty acids increase plasma eicosapentaenoic acid and
docosahexaenoic acid concentrations and trot stride length in horses. Equine Science
Society Abstract 101-105.
Yadav UC, Srivastava SK, and Ramana KV 2010 Inhibition of aldose reductase
attenuates endotoxin signals in human non-pigmented ciliary epithelial cells.
Experimental Eye Research 90 555-563.
Young SL, Lyddon TD, Jorgenson RL, and Misfeldt ML 2004 Expression of toll-like
receptors in human endometrial epithelial cells and cell lines. American Journal of
Reproductive Immunology 52 67-73.