324
i THE FUNCTION OF ZINC TRANSPORTERS IN HUMAN CELLS BY LOVELEEN KUMAR, BSc., MSc. Submitted in fulfilment of requirements for the degree of Doctor of Philosophy DEAKIN UNIVERSITY JULY 2014
i
THE FUNCTION OF ZINC TRANSPORTERS IN HUMAN CELLS
BY
LOVELEEN KUMAR, BSc., MSc.
Submitted in fulfilment of requirements for the degree of Doctor of Philosophy
DEAKIN UNIVERSITY
JULY 2014
iv
Acknowledgements
I would sincerely like to thank my supervisor Professor Leigh Ackland for
giving me the opportunity to undertake my PhD under her invaluable
guidance with continual support, encouragement and infinite enthusiasm.
Thank you so much Leigh for having faith in me and being wonderful
supervisor one could ever wish for.
I would like to thank my co-supervisor Dr Agnes Michalczyk, not only for
providing invaluable supervision and encouragement but being a great friend
who I could talk to during hard times. Thanks a lot Agnes for being always
there to support me.
I am grateful to Professor Julian Mercer for allowing me to undertake my
PhD candidature in the CCMB. I would also like to thank him for his expert
advice at the discussion sessions that made me think in detail.
Special thanks to Prof Andy Sinclair for providing me the scholarship and the
mentoring sessions we had, it made me concentrate on the main goal.
I would like to thank my Lab Manager Mr. Michael Holmes for having faith in
my capability and providing me with opportunity to work as a technical officer
to financially support my family. I am very grateful to our school manager
Marita Reynolds to sanction my study leave to finish off my writting. I would
like to extend that thanks to all Technical staff, who gave enormous mental
support and friendly environment that helped me come out of my grief.
Special thanks to Maria and Linda who were always there to hear my long
v
conversations and gave me expert advice. Thank you so much for being
great friends.
Thanks to everyone from CCMB for being helpful especially David, Lee and
Dean for their technical advice. To everyone involved in teaching as I
enjoyed demonstrating undergraduate students.
I might have forgotten some names to mention but their great wishes have
been playing a big role along the journey of PhD. Thanks to them for their
well wishes that helped me to fulfil this goal.
Finally, I would like to save the biggest thanks to my husband Vivek and kids,
Vansh and Lehar for their unconditional love and faith in me. They are the
main reason for me to submit this work. I feel really lucky to have best kids
who understood the importance of their mums dream and spend days and
nights without me. My husband who stood like a strong pillar beside me
while, going through the tough times of our lives. Thank you so much. I don’t
have words to express my gratitude but would like to say
“Love, Affection, Care and Pride,
All were there by my side.
I bow my Heart with a glitter in my eye,
I owe you all Thanks for the rest of my life.”
At the end I would like to dedicate this thesis to my Dad and Grandpa, two
important members in my life, I lost during my candidature. It’s your
upbringing that set my mind to submit this work.
vi
Publications Arising from this Project
The data presented in thesis has been submitted or is currently in preparation for publication.
Kumar Loveleen, Michalczyk Agnes, McKay Jill, Ford Dianne, Kambe Taiho, Hudek Lee, Varigos George, Taylor Philip, and Ackland M Leigh. “Altered expression of zinc transporters SLC30A5 and 6 (ZnT5 and 6) underlie a mammary gland disorder of reduced zinc secretion into milk” Manuscript submitted to Human Molecular Genetics
Kumar Loveleen, Michalczyk Agnes and Ackland M Leigh. “Functional analysis to determine co-dependency of ZnT5 and ZnT6 in neuronal cells” Manuscript in preparation
Kumar Loveleen, Michalczyk Agnes, Suphioglu Cenk, Sinclair Andrew and Ackland M Leigh. “Effect of Zinc and DHA on hZnT5 and hZnT6 transporters in neuronal cells” Manuscript in preparation
Kumar Loveleen, Michalczyk Agnes and Ackland M Leigh. “In silico molecular characterization of ZnT family members” Manuscript in preparation
vii
List of Contents
Access to Thesis – A .......................................................................................... ii
Candidature Declaration ................................................................................... iii
Acknowledgements ........................................................................................... iv
Publications Arising From This Project ........................................................... vi
List of Contents ................................................................................................ vii
List of Figures .................................................................................................. xiv
List of Tables ................................................................................................... xvii
List of Abbreviations ..................................................................................... xviii
Abstract ............................................................................................................ xxi
Chapter 1 Introduction ....................................................................................... 1
1.1 History of Zinc .................................................................................... 2
1.2 Chemistry of Zinc ............................................................................... 2
1.3 Zinc homeostasis ............................................................................... 3
1.3.1 Zinc absorption ....................................................................... 4
1.3.2 Zinc distribution ...................................................................... 5
1.3.3 Zinc transport ......................................................................... 5
1.3.4 Zinc storage ............................................................................ 6
1.3.5 Zinc excretion ......................................................................... 6
viii
1.4 Biological/physiological roles of zinc .............................................. 7
1.4.1 Zinc and nucleic acids ............................................................ 7
1.4.2 Zinc and Membranes .............................................................. 8
1.4.3 Zinc and Cell signaling ........................................................... 9
1.4.4 Zn and immune system ........................................................ 11
1.4.5 Zn and oxidative stress......................................................... 11
1.4.6 Zn and apoptosis .................................................................. 12
1.5 Zinc Deficiency ................................................................................. 13
1.6 Neonatal requirement of zinc .......................................................... 16
1.7 Zinc supplementation ...................................................................... 17
1.8 Zinc and diseases ............................................................................ 18
1.8.1 Zinc and cancer .................................................................... 18
1.8.2 Zinc and Alzheimer’s disease ............................................... 19
1.8.3 Zn and cardiovascular disease ............................................. 19
1.8.4 Zinc and Wilson disease18 ................................................... 20
1.9 Inherited disorders of zinc deficiency ............................................ 20
1.9.1 Acrodermatitis enteropathica ................................................ 20
1.9.2 Mammary gland disorder of zinc secretion ........................... 21
1.10 Zinc and lipids interactions in the brain ...................................... 22
1.10.1 DHA .................................................................................... 23
1.10.2 DHA and Brain ................................................................... 23
1.10.3 Link between DHA and zinc ............................................... 24
1.11 Cellular zinc transport ................................................................... 25
1.11.1 Bacterial zinc transporters .................................................. 25
1.11.1.1 Cellular zinc import systems ............................... 25
ix
1.11.1.2 Cellular zinc export systems ............................... 27
1.11.2 Eukaryotic zinc transport .................................................... 28
1.11.2.1 Zrt, Irt-like Proteins (ZIP) or SLC39 family .......... 28
1.11.2.2 Cation Diffusion Facilitators (CDF) or SLC30
family .................................................................. 29
1.11.3 Zinc transport in Saccharomyces cerevisiae ...................... 32
1.11.3.1 Cellular zinc uptake ............................................ 32
1.11.3.2 Cellular zinc efflux .............................................. 33
1.11.4 Mammalian zinc transporters ............................................. 34
1.11.4.1 ZIP family ........................................................... 35
1.11.4.2 ZNT family .......................................................... 42
1.11.4.3 NRAMP (Natural Resistance-Associated
Macrophage Proteins) or SLC11 family .............. 54
1.12 Project aims .................................................................................... 55
Chapter 2 - Material and Methods ................................................................... 57
2.1 Case history summaries .................................................................. 58
2.2 Sample collection and cell culture ................................................. 58
2.3 Plasmid preparation and cell transfection ..................................... 61
2.4 siRNA Construction and Transfection ........................................... 61
2.5 Quantitative Real Time PCR (qRT-PCR) ......................................... 64
2.6 PCR and sequencing for coding & promoter regions ................... 67
2.7 Transcription Factor Binding Site Analysis ................................... 71
2.8 Western Blots ................................................................................... 71
x
2.9 Immunofluorescence ....................................................................... 74
2.10 Alkaline phosphatase assay ......................................................... 75
2.11 ZnT5 and ZnT6 Pyrosequencing Assay ....................................... 76
2.12 Physiological zinc uptake and efflux ............................................ 77
2.13 Bioinformatic in silico analysis..................................................... 79
2.14 Statistical Analysis ........................................................................ 80
Chapter 3 - Altered expression of zinc transporters SLC30A5 and
SLC30A6 (ZnT5 and 6) underlie a mammary gland disorder
of reduced zinc secretion into milk ............................................. 81
3.1 Introduction ...................................................................................... 82
3.2 Results ....................................................................................... 87
3.2.1 mRNA expression levels of hZnT5 and hZnT6 are
reduced in Mothers 1 and 2 ................................................ 87
3.2.2 Sequencing of hZnT2. .......................................................... 89
3.2.3 Sequence analysis of hZnT5 and hZnT6 cDNA from
patient cells and controls .................................................... 89
3.2.4 Analysis of exon-intron structure of hZnT6 gene .................. 90
3.2.5 Promoter Analysis ................................................................ 92
3.2.6 Western Blot analysis of hZnT5 and hZnT6 ......................... 92
3.2.7 Intracellular localization ........................................................ 95
3.2.8 Alkaline phosphatase activity ............................................... 98
3.2.9 DNA methylation .................................................................. 98
3.2.9.1 hZnT5 methylation .............................................. 98
3.2.9.2 hZnT6 methylation ............................................ 101
xi
3.3 Discussion ..................................................................................... 102
3.4 Conclusion ..................................................................................... 113
Chapter 4 - Functional analysis to determine co-dependency of ZnT5
and ZnT6 in neuronal cells ........................................................ 114
4.1 Introduction .................................................................................... 115
4.2 Results ..................................................................................... 117
4.2.1 Overexpression constructs ................................................. 117
4.2.2 Knockdown constructs ....................................................... 120
4.2.3 ZnT5 and ZnT6 interactions ............................................... 121
4.2.4 Alkaline phosphatase activity ............................................. 124
4.2.5 65 Zn accumulation ............................................................. 124
4.2.6 65 Zn Efflux ......................................................................... 126
4.3 Discussion ..................................................................................... 129
4.4 Conclusion ..................................................................................... 136
Chapter 5 - Effect of Zinc and DHA on hZnT5 and hZnT6 transporters in
neuronal cells ............................................................................... 137
5.1 Introduction ................................................................................... 138
5.2 Results ..................................................................................... 141
5.2.1 Pre-treatment of neuronal cells with DHA induced zinc
efflux ................................................................................. 141
5.2.2 DHA treatment reduced intracellular pools of labile zinc .... 143
5.2.3 DHA treatments enhanced neurite outgrowth ..................... 143
xii
5.2.4 hZnT5 and hZnT6 contains DHA regulatory elements in
their promoter regions....................................................... 145
5.2.5 hZnT5 and hZnT6 mRNA levels were influenced by DHA
and zinc ............................................................................ 148
5.2.6 High doses of DHA in presence of Zn increased the
protein expression of hZnT5 and hZnT6 ........................... 150
5.2.7 DHA does not affect localisation of hZnT5 and hZnT6 in
M17 neuronal cells ........................................................... 153
5.2.8 DHA does not influence the alkaline phosphatase activity . 155
5.2.9 hZnT5 and hZnT6 predicted variants in M17 neuronal
cells by RT-PCR ............................................................... 155
5.3 Discussion ..................................................................................... 161
5.4 Conclusion ..................................................................................... 168
Chapter 6 - In silico molecular characterization of ZnT family members .. 169
6.1 Introduction .................................................................................... 170
6.2 Results ..................................................................................... 172
6.2.1 Characteristic features of ZnT family members .................. 172
6.2.2 Transmembrane domain (TMD) analysis of ZnT members 172
6.2.3 Identity/Similarity Matrix Results ......................................... 180
6.2.4 Phylogenetic analysis of SLC30 (ZnT) family members ..... 180
6.2.5 Analysis of promoter region ................................................ 180
6.2.6 Syntany analysis of transcription binding factors in
promoter region of ZnT family members ........................... 183
6.2.7 Analysis of miRNA in the 3’ region of ZnT family members 187
xiii
6.2.8 Predicted three dimensional structure of ZnT’s .................. 189
6.3 Discussion..................................................................................... 194
6.4 Conclusion .................................................................................... 204
Chapter 7 – Summary ..................................................................................... 205
References ...................................................................................................... 209
xiv
List of Figures
Figure 1.1 Comparison of the effects of zinc intoxication versus deficiency ....... 14
Figure 1.2 Predicted structure of the members of ZIP family .............................. 30
Figure 1.3 Predicted structure of the members of ZnT family ............................. 31
Figure 3.1 Photograph of patient (infant number 1) showing dermatitis on feet .. 85
Figure 3.2 Real-time RT-PCR analysis of hZnT mRNAs in cells from Mother
1 or Mother 2 and corresponding controls ......................................... 88
Figure 3.3.1 Analysis of fragments of hZnT6 cDNA from lymphoblasts and
fibroblasts from Mother 1, Mother 2 and corresponding controls to
elucidate splice site variants .............................................................. 91
Figure 3.3.2 Diagram to illustrate the different exon-intron structure of the
hZnT6 gene. ...................................................................................... 93
Figure 3.4 Diagramatic presentation of promoter region of hZnT5 and hZnT6
genes ................................................................................................ 94
Figure 3.5 Western blot analysis of proteins from two mothers with zinc
deficient infants ................................................................................. 96
Figure 3.6 Intracellular/Subcellular localization of hZnT5 and hZnT6 ................. 97
Figure 3.7 Alkaline phosphatase activity ............................................................. 99
Figure 3.8 Bislphide pyrosequencing for DNA methylation of hZnT5 and
hZnT6 genes ................................................................................... 100
Figure 3.9 ZnT5 and ZnT6 changes in mothers producing zinc deficient milk .. 112
Figure 4.1 Overexpression and knockdown constructs of ZnT5 ....................... 118
Figure 4.2 Overexpression and knockdown constructs of ZnT6 ....................... 119
xv
Figure 4.3 Expression of ZnT5 in response to ZnT6 overexpression and
Knockdown ...................................................................................... 122
Figure 4.4 Expression of ZnT6 in response to ZnT5 overexpression and
knockdown ...................................................................................... 123
Figure 4.5 Alkaline phosphatase activity ........................................................... 125
Figure 4.6 65Zinc accumulation ......................................................................... 127
Figure 4.7 65Zinc Efflux ..................................................................................... 128
Figure 5.1 65Zinc efflux studies ......................................................................... 142
Figure 5.2 Intracellular pools of labile zinc ........................................................ 144
Figure 5.3 Impact of DHA on morphology of M17 neuronal cells ...................... 146
Figure 5.4 RAREs and MREs in the promoter region of hZnT5 and hZnT6 ...... 147
Figure 5.5 SYBR-Green Real-time RT-PCR analysis of hZnT5 and hZnT6
mRNA from Zn and DHA treated M17 neuronal cells ...................... 149
Figure 5.6 SYBR-Green Real-time RT-PCR analysis of hZnT5 and hZnT6
mRNA from Vitamin E and DHA treated M17 neuronal cells ........... 151
Figure 5.7 Western blot analysis of proteins from Zn and DHA treated M17
neuronal cells .................................................................................. 152
Figure 5.8 Immunofluoresence analysis of hZnT5 and hZnT6 protein
localisation in M17 neuronal cells .................................................... 154
Figure 5.9 Alkaline phosphatase activity ........................................................... 156
Figure 5.10 Predicted variants for hZnT5 gene................................................. 157
Figure 5.11 Predicted variants for hZnT6 gene................................................. 158
Figure 6.1 Diagram to illustrate Exon-Intron structure of ZnT9 ......................... 174
Figure 6.2 Analysis of transmembrane domains of ZnT members .................... 175
Figure 6.2.1 Analysis of transmembrane domains of ZnT3 .............................. 177
xvi
Figure 6.2.2 Analysis of transmembrane domains of ZnT9 .............................. 178
Figure 6.2.3 Analysis of transmembrane domains of ZnT5 .............................. 179
Figure 6.3 Identity/Similarity Matrix ................................................................... 181
Figure 6.4 Phylogenetic tree of the ZnT family members ................................. 182
Figure 6.5 Microsyntany analysis of transcription binding factors present in
promoter region of ZnT family members ......................................... 186
Figure 6.6.1 Predicted 3-dimensional structures of ZnT2 and ZnT3 ................. 190
Figure 6.6.2 Predicted 3-dimensional structures of ZnT8 and ZnT6 ................. 191
Figure 6.7 Homology Model of ZnT3 homodimer .............................................. 193
Figure 6.8 Alternating access mechanism for Zn2+/H+ antiport by YiiP ........... 201
xvii
List of Tables
Table 2.1 Primer Table for overexpression and knock-down constructs ............. 63
Table 2.2 Real-Time PCR Primers ..................................................................... 66
Table 2.3 Primers used for Genomic DNA PCR ................................................. 68
Table 2.4 Primers used for RT-(Reverse transcriptase) PCR ............................. 70
Table 5.1 Splice variants generated by RT-PCR for hZnT5 and hZnT6 genes . 160
Table 6.1 Characteristic features of ZnT family members ................................ 173
Table 6.2 (i) Important transcription binding factors among all ZnT members .. 184
Table 6.2 (ii) Important transcription binding factors among all ZnT members . 185
Table 6.3 miRNA binding sites in 3’ region of ZnT family members .................. 188
xviii
List of Abbreviations
65Zn Radiolabelled zinc
Aβ β-amyloid
ABC ATP Binding Cassette
AD Alzheimer’s Disease
ALP Alkaline Phosphatase
Asp Aspartic acid
bp base pairs
BT Breast Tissue
CDF Cation Diffusion Fascilitators
CHO Chinese hamster ovary cells
CREB Cyclic AMP Response Element-Binding Protein
CT Threshold cycle
CTD C-terminal Domain
Cys Cysteine
DBD DNA Binding Domain
DHA Docosahexaenoic Acid
DMEM Dulbecco’s Modified Eagle Medium
DNA Deoxyribonucleic Acid
dNTP Deoxyribonucleotide Triphosphate
EDTA Ethylene di-amine tetra acetic acid
ER Endoplasmic reticulum
ERE Estrogen Responsive Element
ESP Early secretory pathway
EST Expressed sequence tag
EZS Early Zinc Signal
xix
FBS Fetal Bovine Serum
GAPDH Glyceraldehyde-3-phosphate dehydrogenase
His Histidine
IGF-1 Insulin-like growth factor-1
K.D. Knock Down
LBD Ligand Binding Domain
LPS Lipopolysaccharide
LBD Ligand Binding Domain
LZS Late Zinc Signal
MRE Metal Responsive Element
MT Metallothionein
MTF-1 Metal response element-binding transcription factor 1
O.E. Over Expression
ORF Open Reading Frames
PBS Phosphate Buffered Saline
PCR Polymerase Chain Reaction
PRE Progesterone Responsive Element
PUFA Poly Unsaturated Fatty Acids
RA Retinoic Acid
RAREs Retinoic Acid Responsive Elements
RNA Ribonucleic Acid
RND Resistance, Nodulation, Division protein family
RPMI Roswell Park Memorial Institute developed media
RT Reverse Transcriptase
RT-PCR Reverse Transcription Polymerase Chain Reaction
RXR Retinoic X Receptor
siRNA Small interfering RNA
xx
SNP Single Nucleotide Polymorphism
TBF Transcription Binding Factor
TBS Tris Buffered Saline
TGN trans-Golgi network
TMHMM Transmembrane Hidden Markov Model
TMD Trans Membrane Domain
TNAP Tissue Non-specific Alkaline Phosphatase
TPEN N, N, N, N-tetrakis (2-pyridylmethyl) ethyl-enediamine
Trp Tryotophan
UPR Unfolded protein response
UTR Untranslated Regions
ZIP Zrt Irt-like Proteins
ZIRTL Zinc-Iron Regulated Transporter-like
ZTL ZnT-Like Transporter
ZnT Zinc Transporter protein
Znu Zinc uptake protein
Zn Zinc
xxi
Abstract
Zinc is an essential micronutrient that is required for the normal growth and
development of all organisms. Hence uptake and transport play a vital role in
maintaining zinc homeostasis. Two membrane-bound protein families,
SLC30 (ZnT) and SLC39 (Zip) are involved in the transportation of cellular
zinc.
This study contributes to the knowledge of zinc homeostasis involving
members of the ZnT family, in particular ZnT5 and ZnT6, and their role in the
molecular basis of an inherited disorder of zinc metabolism in humans, and
their function in cultured neuronal cells.
Two cases of zinc deficiency in neonates were investigated. Zinc levels in the
milk of both mothers were reduced by at least 75% compared to normal. A
reduction in alkaline phosphatase activity in maternal lymphoblasts was
consistent with a loss of zinc transport activity. Significant reduction of mRNA
expression and protein levels of human zinc transporters, SLC30A5 (ZnT5)
and SLC30A6 (ZnT6), in maternal tissue were observed, suggesting a causal
link to the zinc deficiency disorder. Lymphoblasts and fibroblasts isolated
from both mothers showed altered DNA methylation in ZnT5 at epi-labile
CpG sites, and novel splice variants along with full-length expression in
ZnT6. Altered DNA methylation, likely accounts for reduced ZnT5 mRNA
expression and low protein levels in lymphoblasts. Reduced ZnT6 mRNA
expression and protein levels in lymphoblasts may be secondary to reduced
ZnT5 expression, given that ZnT5 and ZnT6 function as a heterodimer with
xxii
regards to zinc transport. These results suggest that these two cases of zinc
deficiency in neonates caused by a mammary gland disorder are due to
defects in the human zinc transporters ZnT5 and ZnT6.
The co-dependency of ZnT5 and ZnT6 on each other was investigated in
neuronal cells by using overexpressed and knockdown constructs of these
genes. ZnT5 expression levels of mRNA and protein in cells with
overexpression and knockdown constructs of the ZnT6 gene was not altered,
but on the other hand ZnT6 mRNA and protein levels in cells with
overexpression and knockdown constructs of the ZnT5 gene were altered by
the changes in ZnT5. This indicates the possibility of these two transporters
to work together in neuronal cells.
The omega-3 fatty acid, DHA is crucial for neurological function. Low dietary
intake of DHA has been linked to Alzheimer’s disease and DHA deficiency
causes neuronal cell death. Previous studies show that DHA affects zinc
transport and zinc transporter levels in neuronal cells. The aim of the current
study was to explore the molecular basis of the link between the omega-3
fatty acid DHA and zinc metabolism through the ZnT5 and ZnT6 transporters.
M17 neuronal cells exposed to DHA showed a significant reduction in
intracellular zinc levels and increased zinc efflux, compared to untreated
cells. DHA treatment induced neurite outgrowth in cultured cells. Both QRT-
PCR and western blot analysis showed high expression of ZnT5 and ZnT6
transporters at the transcription and translation levels. A link between DHA,
zinc and activation of ZnT5 and ZnT6 transporters was established where
RARE’s (retinoic acid responsive elements) were located in the promoter
regions of the ZnT5 and ZnT6 genes, for ligand activated transcription factors
xxiii
which could switch on gene expression. In conclusion, the ZnT5 and ZnT6
transporters may be regulated by DHA through a pathway involving changes
in zinc fluxes.
Using bioinformatics tools and soft-wares, all members of ZnT family were
analysed for their structure and the phylogenetic relationships between them.
Some of the members are very diverse from others. A total of 10 members of
ZnT family were characterized into four main subfamilies, according to the
similarity amongst different members based on their coding and promoter
regions. Hormonally influenced transcription binding sites present in
promoter region of the genes have been reported and considered in relation
to regulation of the transcription and translation of the genes. Three
dimensional structural models were generated and analysed by comparison
to Yiip where X-ray structure crystallography has previously been reported
The results presented in this thesis provide novel data about the role of ZnT5
and ZnT6 in an inherited disorder of zinc deficiency in premature babies and
in brain cells where a relationship between zinc fluxes, zinc transporter
expression and DHA exposure was found.
CHAPTER 1
Introduction
2
1.1 History of zinc
Zinc is an essential trace element that is required for growth and
development of all organisms. Zinc has been known to humans for
centuries. It was used as an alloy with copper, called brass since the 5th
Millennium BC. At the beginning of the sixteenth century metallic zinc was
isolated (Sieveking et al., 1970). Later on, it was found that zinc is
essential for the function of the living organisms when growth of bread
mould Aspergillus niger was found dependant on this mineral (Raulin et al.,
1869) similarly studies on higher plants, rodents and humans confirmed
the indispensability of zinc for growth and development of all forms of the
life (Maze, 1914; Todd et al., 1934; Prasad et al., 1963).
1.2 Chemistry of zinc
Zinc is a small, stable metal ion with d-shell filled with 2 s electrons. The
natural redox state for zinc is Zn (II) and it does not undergo oxidation or
reduction processes (Vallee and Falchuk, 1993). Other chemical features
that enable zinc to have a fundamental role in many biological processes
include its amphoteric character, which allows it to participate in both
hydrate and hydroxide metal complexes. Zinc’s Lewis acid properties and
its multiple coordination geometries, enable it to co-ordinate 2 to 8 ligands
with 4, 5 and 6 most frequently found in catalytic sites (Williams, 1984;
Auld, 2001). Considering all the features of zinc in addition to the relatively
rapid exchange of the ligands from its complexes (Vallee and Auld, 1993),
it is not surprising that zinc participates in almost all cellular processes
from cell division, development and differentiation to apoptosis (Beyersman
3
and Haase, 2001). Zinc, along with other elements including copper, iron,
selenium, is classified as an essential trace element as it is required in
milligram amounts in the diet and its absence results in severe malfunction
leading even to death if prolonged deficiency occurs.
1.3 Zinc homeostasis
Inside cells, approximately half of the zinc is located in the cytoplasm and
cytosolic organelles. An additional 30 to 40% is found in the nucleus while
a small proportion is associated with cell membranes (Vallee and Falchuk
,1993). The majority of the intracellular zinc is bound by proteins and only
very small proportion could be classified as free zinc. An estimation of the
free intracellular zinc concentration depends on selection of the
quantitative technique used and ranges from 24 pM using 65Zn
measurements (Simons, 1991) to 2 nM when the fluorescent probe Mag-
Fura-2 was used (Sensi et al., 1997).
The human body contains up to 2 g of zinc with the greatest proportion
present in muscle and bones (80%-90%) followed by skin, liver, retina,
prostate and other tissues (Jackson, 1989). The zinc content of most of
tissue remains constant even with the intake change as high as 10-fold.
This is mainly achieved through the homeostatic action of gastrointestinal
system regulating the zinc absorption and excretion in accordance to
requirements (Johnson et al., 1993).
4
1.3.1 Zinc absorption
Dietary zinc is absorbed in small intestine, mainly in the distal duodenum
and proximal jejunum where it enters the enterocytes and is transferred
across the basolateral membrane to portal circulation (Lee et al., 1989).
Studies measuring the fractional absorption of the zinc using stable isotope
tracers show that increased dietary zinc intake causes a decline in the
efficiency of zinc absorption (Jackson et al., 1984) while with reduced
intake fractional absorption dramatically increases (Wada et al., 1985;
Taylor et al., 1991; Lee et al., 1993). While the zinc content of the diet may
vary considerably, the intracellular zinc concentration remains relatively
constant, for example approximately 200 M in eukaryotic cells (Palmiter
and Findley, 1995). The absorption of zinc can also be affected by different
ligands present in the lumen of the gut that gets secreted by body or are
produced by consumed food. Some animal amino acids like cysteine,
histidine, tryptophan (Wapnir and Stiel, 1986) and low molecular weight
ligands like piconilic acid (Evans, 1983), citrate (Lonnerdal et al., 1980)
facilitates zinc absorption. Similarly other dietary nutrients like phytates,
reduce the zinc absorption by forming indigestible complexes with zinc
(O’Dell and savage, 1960). Other metals like calcium, cadmium, copper
and iron in high concentration can also reduce the absorption of zinc as
they will be competing against zinc for metabolic sites (Breskin et al., 1983;
Hill and matrone, 1970; Oberleas et al., 1966; Van Campen., 1969).
5
1.3.2 Zinc distribution
Absorbed zinc is transported into the blood. Although most of the blood
zinc (75-80%) is firmly bound to carbonic anyhydrase in erythrocytes, the
primary source of zinc accessible to the cells is found in the plasma and
represents less than 1% of whole body zinc (Vallee and Gibson, 1949).
The majority of plasma zinc (60-70%) is loosely bound to albumin and
tightly to 2-macroglobulin (~30%). The rest is associated with –globulin,
free amino acids present in ionic form (Prasad and Oberleas, 1970).
Radiolabelled zinc (65Zn) studies have indicated that virtually all absorbed
zinc is transported through the body by albumin (Smith and Cousin, 1980).
Plasma zinc concentrations are relatively constant despite the fact that all
absorbed zinc enters the circulation. Plasma zinc homeostasis is achieved
by maintaining a rapid plasma zinc turnover (~150 times a day) (King et al.,
2000). Plasma zinc concentrations only fall with short-term extremely low
zinc intakes, prolonged mild deficiency or marginal intake during increase
zinc demand: pregnancy, lactation and infancy (reviewed in Krebs, 2000).
1.3.3 Zinc transport
Zinc transporters mediate cellular zinc uptake, efflux and intracellular
distribution. Two major families of zinc transporters exist: Cation Diffusion
Facilitators (CDF) also known as the SLC30 family and Zrt Irt-like Proteins
(ZIP), known as the SLC39 family. The detailed function and
characterisation of these two families is described in section 1.11.
6
1.3.4 Zinc storage
Zinc is transported from small intestine to the liver from where it is
redistributed to the other tissues. The muscle, skin, hair, bones and testis
hold relatively high concentrations of zinc but in severe zinc deficiency the
decline in tissue zinc was only noticed in plasma, liver, testis and bones
(reviewed in Jackson et al., 1982). During such prolonged deficiencies,
firstly the plasma zinc decreases giving signal to selected tissues to
conserve zinc (King et al., 2000). The decline in bone zinc happens most
likely due to decrease zinc uptake rather than enhanced release (Zhou et
al., 1993).
1.3.5 Zinc excretion
The gut is the major organ in the regulation of zinc excretion from the body.
Fecal zinc consists of the unabsorbed exogenous fraction and a significant
fraction of endogenous excreted zinc, originating from pancreatic
secretion, bile and intestinal zinc release and sloughing of mucosal cells
(Krebs, 2000). Zinc is also excreted from the body through the urine but
these losses are low compared to gastrointestinal losses and do not
fluctuate readily with zinc uptake. Only very low levels of dietary zinc
intakes can rapidly reduce urinary excretion (Johnson et al., 1993).
Additional small amounts of zinc can be lost from the body with sweat,
menstrual blood and shedding of skin, hair and nails (reviewed in
Underwood, 1981).
7
1.4 Biological/physiological roles of zinc
Zinc is an essential trace element required for the structural stability of a
variety of proteins involved in transcription and protein trafficking, as well
as for the catalytic activity of metalloenzymes and serves as a cofactor in a
variety of biochemical reactions. Furthermore, many studies have been
undertaken to understand the role of zinc in various vital cell processes
such as in the function of nucleic acids, cell signalling, membrane stability
and cell death.
1.4.1 Zinc and nucleic acids
A direct role for zinc in DNA transcription became evident when some
classes of RNA polymerases were discovered to be zinc-dependant, for
example six subunits of yeast RNA polymerase II contain zinc-finger
domains (Cramer at al., 2000). Additionally, four structural proteins (L24,
L37, L37a and L44) of the large ribosomal subunit are also zinc-binding
molecules (Ban et al., 2000). The DNA binding domain of glucocorticoid
and estrogen receptors that enhance the expression of some genes in
response to specific hormones for example cortisol or estrogen contains
two atoms of zinc (Freedman et al., 1988).
Zinc deficiency reduces the activity of deoxythymidine kinase, an enzyme
responsible for the phosphorylation of deoxythymidine, a crucial step for
DNA synthesis (Chesters et al., 1990). Deoxythymidine kinase is not a
metalloenzyme but its expression is regulated by zinc-dependent factor
binding in the promoter region (Chesters et al., 1995). Also, most likely zinc
8
affects the chromatin structure and function through the binding to histone
deacetylases, which regulate transcription of DNA (Finnin et al., 1999).
In 1984 Ginsberg et al. discovered presence of zinc in TFIIIA transcription
factor from Xenopus laevis. One years latter conserved, repetitive motif of
TFIIIA containing Cys and His ligands were called zinc-finger domain (Miller
et al., 1985). The motif found in TFIIIA is classified as classical zinc-finger
and contains multiple Cys2His2 sequence separated by the TGEKP linker –
presumably DNA binding site (Laity et al., 2000). The example of classical
Cys2His2 zinc-finger transcription factor can be metal response element-
binding transcription factor MTF-1 (Bittel et al., 1998). Zinc enzymes and
proteins are used in most of the cellular processes from controlling of DNA
and RNA stability through transcription processes, cell signaling, membrane
stability and free radicals scavenging to cell apoptosis (for more details see
Section 1.4.2,1.4.3, 1.4.5).
1.4.2 Zinc and Membranes
Zinc deficiency affects erythrocytes and platelets plasma membranes. Zinc
depletion in rat red blood cells significantly decreased the plasma
membrane zinc content without an observable reduction in the total cellular
Zn content. Upon zinc repletion, the membrane zinc level was quickly
restored (Taylor et al., 1988). An increase in the osmotic fragility of
erythrocytes was another feature observed in Zn-deficient rats, and this
could be reversed by zinc supplementation (O’Dell et al., 1987).
9
The deleterious effects of zinc deficiency on membrane can be explained,
to some extent, by the repressed activity of enzymes for example the
calcium pump, Ca-ATPase (Johanning et al., 1990). Zinc may alter
membrane metabolism through alteration of membrane lipid metabolism.
Nutritional zinc deficiency affects synthesis of cholesterol, phospholipids,
fatty acids and lipoproteins (Cunnane, 1988). The mechanism of these
processes is not clear but Zelenski et al. (1999) has demonstrated the role
of a zinc metalloenzyme Site-2 protease in the control of cholesterol
biosynthesis. In this way zinc maintains the integrity and balance of the
membrane lipids.
1.4.3 Zinc and Cell signalling
Zinc plays important role in cell signalling from signal molecule production
and recognition through second messenger metabolism to protein
phosphorylation. Zinc itself can act as signalling ion in neurons, by
attenuating the activity of NMDA glutamate receptors or by increasing the
activity of GABA receptors (Westbrook and Mayer, 1987). In hepatocytes,
an increase in the extracellular zinc concentration increases the
intracellular concentration of calcium, through release of calcium from
cellular stores (McNulty and Taylor, 1999) leading to the activation of
calcium-dependent protein kinases. Intracellular glucocorticocoid and
estrogen receptor bind their substrate through the zinc domains. Zinc
deficiency decreases production of hepatic insulin-like growth factor-I (IGF-
I) (Roth and Kirchgessner, 1994) but also increases the expression of IGF-
I binding protein-3, which competes with IGF-I receptor in IGF-I coupling
10
(MacDonald et al., 1998). In a zinc sufficient state, the receptor activation
by IGF-I causes a cascade of phosphorylation and leads to cellular
response for example the induction of cell division (MacDonald, 2000).
Zinc levels influence second messenger metabolism through regulating the
activity of cyclic adenosine monophosphate (cAMP) and cyclic guanosine
monophosphate (cGMP). Francis et al. (1994) have found two zinc-binding
motifs in the catalytic region of cyclic nucleotide phosphodiesterase V,
which regulate its activity and hence the degradation of cAMP and cGMP.
Other members of cGMP and cAMP- families were shown to be inhibited
by zinc concentrations higher than 1 uM while in some cases low zinc
concentration was able to activate the enzyme (Percival et al., 1997;
Kovala et al., 1997; He et al., 2000). These observations suggest that zinc
may have a direct physiological role in regulating the activity of cyclic
nucleotides.
A direct role of zinc in protein phosphorylation is suggested from studies on
the regulation of protein kinase C. This enzyme contains two independent
zinc-binding domains, each able to link 2 atoms of zinc in the region of the
lipid-binding region (Quest et al., 1992; Hommel et al., 1994). The zinc
chelator 1,10-phenanthroline was able to inhibit activity of PKC, pointing to
a role of chelatable zinc pools in regulation of the enzyme (Forbes et al.,
1991).
11
1.4.4 Zinc and immune system
Zinc is crucial for immune responses, affecting proliferation of T and B-
lymphocytes, baseline and antibody dependent activity of killer
lymphocytes and phagocytotic and bacterial capacities of neutrophils. Zinc
deficiency induces impaired haemostasis as a result of defective platelet
aggregation and a decrease in T cell number (Tapiero and Tew, 2003). In
mast cells cytokine production gets altered as a result of reduced lytic
activity of natural killer T cells (NKT) due to zinc deficiency (Muzzioli et al.,
2009; Mochegiani et al., 2003). Zinc supplementation enhanced innate
immunity against enterotoxigenic E. coli infection in children due to
increased C3 complement along with increased phagocytosis and T cell
functionality (Sheikh et al., 2010).
1.4.5 Zinc and oxidative stress
Zinc deficiency enhances the production of free radicals that can lead to
peroxidation of lipids (Burke and Fenton, 1985) and protein oxidation
(DiSilvestro and Blostein-Fujii, 1997), hence can result in the susceptibility
of the organism to oxidative tissue injury. Zinc also increases the
production of metallothioneins that act as free radical scavengers (Maret,
1994). Zinc plays a protective role in preventing oxidation of δ-
aminolevulinate dehydrogenase sulphydryl groups from oxidation (Gibbs et
al., 1985).
In all living organisms, cells require adequate levels of antioxidants as a
defence mechanism to avoid any harmful effect of an excessive production
12
of reactive oxygen species (ROS), also known as free radicals. During the
inflammatory processes, the activation of phagocytes or the action of
bacterial products with specific receptors are capable of promoting the
assembly of NADPH oxidase, which catalyses the production of high
amounts of the superoxide anion radical. Neutrophils and macrophages
get recognized under these particular circumstances to produce
superoxide free radicals that are essential for defence against invading
microbes (Puertollano et al., 2011).
1.4.5 Zinc and apoptosis
Apoptosis is programmed cell death involved in several biological events
due to harmful substances or induced by organism due to physiological or
environmental changes. Zinc is described as an inhibitor of apoptosis,
where as its depletion induces death in many cell lines (Seve et al., 2002).
Low cellular zinc concentrations can enhance apoptosis in different cell
types eg fibroblasts, glioma, hepatocytes, T cell precursors and testicular
cells. Zinc acts as an inhibitor of caspase-3, caspase-8, and caspase-9
which are cysteine proteases and have basic role in apoptosis (Thornberry
and Lazebnik, 1998; Truong-Tran et al., 2001). The movement of
intracellular zinc is maintained by several zinc transporters to have a
balance between life and programmed cell death (Seve et al., 2002). Zinc
deficiency can also induce apoptosis by altering signal transduction growth
factors controlled by receptor tyrosine kinases (Clegg et al., 2005).
However zinc can have a negative effect in cases when excessive
accumulation in synaptic spaces mediates apoptotic cell death in the
13
developing rodent brain (Capasso et al., 2005; Cho et al., 2010). A
comparison of the effects of zinc deficiency and zinc intoxication (excess
zinc) have been illustrated in figure 1.1 (Plum et al., 2010).
1.5 Zinc Deficiency
The main symptoms of zinc deficiency are anorexia, loss of appetite, smell
and taste failure, severe skin lesions, impaired immune response,
diarrhoea, hypogonadism and neurological disorders.
Zinc is such an important element in human health that even a small
deficiency can lead to disaster. The history of recognizing the significance
of zinc in the human body is remarkably short considering the importance
of zinc in biology. In 1961, the first case of zinc deficiency was reported in
a man from Iran, outlining the symptoms of zinc deficiency with severe
anemia, growth retardation, hypogonadism, rough skin and mental lethargy
(Prasad et al., 1961). The anemia was successfully treated with iron
supplementation but the other symptoms only disappeared upon oral zinc
therapy (Prasad et al., 1963a, Prasad, 1966). Later in Egypt, patients
demonstrating similar symptoms were also studied. Their body zinc levels
were low relative to normal, classifying them as zinc deficient (Prasad et
al., 1963b). Similarly, many other studies recognised that zinc deficiency
was a widespread problem in the world.
Figure 1.1 Comparison of the effects of zinc intoxication
versus deficiency.
Intoxication by excessive exposure to, or intake of zinc (left hand side) and
deprivation of zinc by malnutrition or medical conditions (right hand side) and
their effect on different organ systems.
Effects that affect several organs or could not be attributed to a certain organ
system are classified as systemic symptoms.
14
Plum et al., 2010
15
In pregnant women, zinc deficiency may lead to fetal brain cells decrease
and may affect their development. Zinc deficiency in children can impact
normal growth and intellectual development. In adult males, zinc deficiency
may lead to prostatic hyperplasia, affecting the reproductive function and
fertility. Malnutrition and high phytate diet are the most common causes of
zinc deficiency not only in developing countries but also in some groups
from industralised countries including vegans, vegetarians and low
socioeconomic groups (Freeland-Graves et al., 1980; Ramakrishnan,
2002). National food balance datasheets were used to estimate that
approximately half of world’s population is at risk of zinc deficiency
(Wuehler et al., 2005).
A significant issue is the lack of a quick and reliable method to determine
body zinc status. Most of the time plasma zinc concentrations are used to
estimate zinc status, however it may not be affected in mild zinc deficiency
and even more plasma zinc levels are altered by infections or stress.
Plasma zinc concentrations can remain unchanged in case of severe zinc
deficiency because zinc can be released from tissues (reviewed in Aggett
and Comerford, 1995; Krebs and Hambidge, 2001). The zinc concentration
in red blood cells is not readily changed even in severe deficiency. The
response of leukocytes to zinc changes is more rapid but assay is very
laborious. Measurement of zinc in hair and nails can be misleading, as the
zinc concentrations may remain normal in severe deficiency due to growth
arrest of these tissues. Several others commonly used methods also
present some problems. Possibly the best approach to diagnosis of zinc
deficiency is to measure zinc levels in several body compartments and to
16
correlate it to the extent of which zinc supplementation ameliorates the
symptoms of the deficiency (reviewed in Thompson, 1991; Agget,t 1991;
Aggett and Comerford, 1995; Prasad, 1985; Krebs and Hambidge, 2001).
1.6 Neonatal requirement of zinc
Lactation is one of the physiological stages of life when demand for zinc
rapidly increases to compensate for the secretion into the milk in lactating
women. It was demonstrated that the fractional zinc absorption during
lactation increases nearly 2 fold while endogenous fecal loses may remain
unchanged (Fung et al., 1997). Zinc levels in human milk change with
progression of lactation from the highest in colostrums (~8.12 g/ml),
reduced to 50% (~4.56 g/ml) in first week of lactation and then through
gradually decline to ~ 20% in next 12 months to a level of ~0.9 g/ml
(Casey et al., 1985; Krebs et al., 1995; Krebs, 1998; Dorea, 2012).
Compared to cow’s milk, the zinc concentration in human milk is on
average two times lower but its bioavailability for infants is very high. The
fractional zinc absorption in infants reaches 55% from human milk (Krebs
et al., 1996).
The zinc requirements of the infant up to 6 months of age are usually met
by an exclusive breast-milk diet despite the decline in breast milk zinc
concentration, which is not compensated by the increase in volume of milk
consumed. It is mainly due to infant’s very efficient fractional absorption of
highly available zinc from the milk and conservation of endogenous losses
(Krebs and Hambidge, 1986). After 6 months, the breast milk diet needs
17
be complemented with additional food, especially meat, to provide
adequate zinc status in infants (Krebs and Westcott, 2002).
1.7 Zinc supplementation
The minimum zinc requirements for humans with satisfactory growth and
health vary a lot due to different factors like type of diet consumed, stress
and climatic conditions. The recommended daily intake ranges between 3-
5 mg/day for infants, 7-10 mg/day for children up to 10 years of age and
12-15 mg/day for older children and adults (Aggett and Comerford, 1995;
Tapiero and Tew, 2003; MacDonald, 2000), and the tolerable upper intake
level of zinc recommended is 25mg/day by Scientific Committee for Food
(SCF, 2003). The major source of the everyday zinc supply in humans is
dietary. The richest sources of dietary zinc include seafood, specifically
oysters, red meat, dairy products and nuts (Underwood, 1981). Many types
of food are relatively rich in zinc for example cereals, corn and vegetables
however intake of the zinc from the diet containing these foods may not be
adequate. The reason for this is the presence of phytate (inositol
hexaphosphate) in these foods, which have an inhibitory effect on zinc
absorption. The phosphate groups in phytate bind zinc, creating insoluble
complexes, which are not absorbed by gastrointestinal system through the
lack of phytases (Lonnerdal, 2000).
The efficiency of zinc supply is dependent on the dose and length of the
treatment. High doses of zinc supplementation and prolonged use can result
in zinc accumulation that can further impact the immune system
18
(Mocchegiani et al., 2001). Consumption of 12 mg Zn/day is considered a
physiological dose of zinc for a short period (1 month) and restores immune
efficiency in Down’s syndrome individuals (Licastro et al., 1993). Zinc
treatment has been successful in curing patients with acrodermatitis
enteropathica and Wilson’s disease. At the same time, there are cases of
acute and chronic zinc poisoning due to excess zinc which is toxic (Pagani et
al., 2007), therefore a suitable range between 0.1 and 0.5 mM cellular level
of zinc must be controlled within a cell (Eide, 2006).
1.8 Zinc and diseases
Zinc is one of the most important trace elements present in human body with
numerous functions therefore it is not surprising that zinc deficiency can have
devastating effect on human health and hence can lead to a variety of
diseases.
1.8.1 Zinc and cancer
Zinc plays an important role in prevention of cancer by providing host
defence against prognosis and the treatment of several malignancies
(Dhawan and Chadha, 2010). The involvement of zinc in cancer development
was shown by abnormal levels of zinc in different types of cancer (John et al.,
2010). Reduced zinc serum levels have been demonstrated in patients with
different malignancies, for example breast cancer (Schlag et al., 1978),
gallbladder (Gupta et al., 2005) and lung (Issell et al., 2006).
19
1.8.2 Zinc and Alzheimer’s disease
Zinc metabolism is altered in Alzheimer’s disease (AD) and other
neurodegenerative diseases (Aschner, 1996; Wang et al., 2010). In AD
patients brain β-amyloid (Aβ) plaques are formed and post-mortem studies of
AD brains showed accumulation of zinc in those A-Beta plaques (Dong et al.,
2003; Friedlich et al., 2004; Stoltenberg et al., 2005). Zinc is the only
physiologically available metal that can precipitate Aβ because Ab peptide
has zinc-binding sites. The abnormal increase of zinc in the brains of AD
patients demonstrated that zinc binding to Aβ plays a role in the formation of
amyloid plaques (Faller, 2009). Similarly zinc chelating agents like clioquinol
(CQ) and DP-109, that are known to modulate brain zinc levels can inhibit the
formation of amyloid plaques (Cherny et al., 2001; Bush, 2000, 2002; Lee et
al., 2004a). The disruption of zinc homeostasis is a potential therapeutic
strategy for AD (Wang et al., 2010).
1.8.3 Zinc, diabetes and cardiovascular disease
Worldwide cardiovascular disease (CVD) is the leading cause of deaths. With
advance age, plasma zinc levels drop and show a strong association with
increasing CVD cardiovascular disease (Little et al., 2010). The trace
element zinc is also known to play an important role in pancreatic islets
where it acts as a specific structural component of the insulin molecule and
helps in insulin secretion (Ynsa et al., 2009). It is also involved in synthesis
and signaling of insulin, glucagon secretion (Bosco et al., 2010). Shokrzadeh
20
et al (2009) showed a high excretion of zinc in the group with diabetes
mellitus and congestive heart failure.
1.8.4 Zinc and Wilson disease
Wilson disease is an inherited autosomal recessive disorder that results due
to copper imbalance and results in defect in ATP7B gene and neurological
disturbance. The zinc supplementation in Wilson’s disease enhances the
intestinal and hepatic metalothioneins (MTs) synthesis that protects the
hepatic system from high copper levels (Stefanidou and Maravelias, 2004).
The intensive zinc treatment does not cure Wilson patient’s, but it does
improve some clinical symptoms of these patients. Even though zinc
treatment has some side effects, none of them are severe and hence zinc
acetate is recommended for long-term management of patients with Wilson’s
disease (Huster, 2010; Shimizu et al., 2010).
Zinc deficiencies are also associated with number of other diseases for
example: renal disease, sickle cell anemia, alcoholism, AIDS, burns, and
others (Keen and Gershwin, 1990; Mocchegiani and Fabris, 1995; Fraker et
al., 2000; Mocchegiani et al., 2000).
1.9 Inherited disorders of zinc deficiency
1.9.1 Acrodermatitis enteropathica
Acrodermatitis enteropathica (AE) is rare, recessively inherited disorder,
described and named by Danbolt and Closs (1942). The symptoms of this
condition are similar to those of zinc deficiency and include skin lesions,
21
diarrhea, alopecia and neuropsychological disturbances. Symptoms appear
after weaning, suggesting a protective function of human milk (Danbold and
Closs, 1942). Expressed breast milk and an ionophore, diiodoquine were
firstly used to control effects of the disease but in 1974 Moynahan found that
zinc therapy rapidly corrected the symptoms. Low plasma zinc levels, low
alkaline phosphatase activity and a rapid response to zinc treatment were
shown to be good indicators for the presence of this disorder (Danks, 1985).
Atherton et al. (1979) demonstrated a defect of mucosal zinc uptake in the
small intestine of patients with acrodermatitis enteropathica, confirming a zinc
deficiency disorder. Kinetic assays in cultured fibroblasts from patients with
acrodermatitis enteropathica show decreased rate of cellular zinc
accumulation (Grider et al., 1998; Grider and Young, 1996). The region
suspected to carry the gene responsible for this disorder was recently
mapped to chromosome region 8q24.3 (Wang et al., 2001). Intensive search
of this region has identified a novel gene encoding a zinc transporting
molecule termed ZIP4, which harboured a selection of point mutations and
deletions in patients with acrodermatitis enteropathica (Wang et al., 2002;
Kury et al., 2002; Kury et al., 2001; Nakano et al., 2003).
1.9.2 Mammary gland disorder of zinc secretion
A disorder leading to zinc deficiency has been found in some premature
babies. This condition, unlike acrodermatitis enteropathica, manifests itself in
infants during breast-feeding. Plasma zinc levels and alkaline phosphatase
activity are reduced in zinc deficient infants but are normal in the mothers.
The zinc uptake from the small intestinal mucosa of affected babies is normal
or even increased (Aggett et al., 1980). The zinc levels in the breast milk zinc
22
from the mothers of the zinc deficient infants are significantly lower than in
control mothers of premature and term babies (Zimmerman et al., 1982). Oral
zinc supplements induce a complete remission of symptoms when given to
infants but have no effect on zinc levels in milk when provided to mothers
(Weymouth et al., 1982). These results strongly suggest a role for mammary
gland in regulation of zinc secretion into the milk and defect of such transport
in this disorder. The zinc requirements for premature infants are higher than
the term infants, as they are rapidly growing and their zinc storage is
inadequate. Also their capacity to absorb zinc may be impaired, making them
especially prone to develop acrodermatitis. Interestingly, some cases of term
babies suffering from this condition have also been reported (Kuramoto et al.,
1991; Glover and Atherton, 1988). Although this constellation of alimentary
zinc deficiency has been described as early as 1979 but still most of the
cases were initially misdiagnosed and received inappropriate topical and oral
therapy.
The ‘Lethal milk’ (lm) mouse is a murine model of the human premature
babies zinc deficiency as the pups nursed on lm/lm dams develop symptoms
characteristic for nutritional zinc deficiency and die before weaning (Piletz
and Ganschow, 1978a; Piletz and Ganschow, 1978b).
1.10 Zinc and lipids interactions in the brain
Zinc regulates neuronal cell proliferation, survival and differentiation. It play
a vital role in neural development, learning and memory (Frederickson et al.,
2005). Disturbances in lipid metabolism were reported in zinc deficient
23
patients and zinc-deficient pregnant rats had impaired transport of poly
unsaturated fatty acids (PUFA) to the foetus (Cunnane, 1988). These reports
showed the association between zinc and lipids specifically poly unsaturated
fatty acids.
1.10.1 DHA
DHA (Docosahexaenoic Acid) is a long-chain fatty acid that belongs to the
Omega-3 fatty acid family. Omega-3 are essential fatty acids that cannot be
synthesised by the human body and adequate amounts are required for
normal function of body. There are 3 main forms of Omega-3, Alpha-linolenic
acid (ALA), Eicosapentanoic acid (EPA) and DHA. DHA is the most complex
form of Omega-3 and is difficult to include in our diet as only few foods
contain a significant amount.
The retina has the highest concentration of DHA in the human body. DHA is
considered as an essential component of breast milk where newborn babies
utilise it for brain, nerve and eye tissue development. The minimum intake of
DHA is set to be 500 mg (Burr et al., 1989; Krishnamurti et al., 2002).
1.10.2 DHA and Brain
In human brains, fat content is greater than 50% by mass and DHA
represents 30% of brain mass. Epidemiological studies have shown an
inverse association between prognosis of Alzheimer Disease (AD) and
omega-3 dietary intake. Decreased blood levels of omega-3 fatty acids have
been associated with several neurodegenerative conditions eg. AD,
24
schizophrenia and depression (Fenton et al., 2000; Young and Conquer,
2005). A population based study in Netherlands demonstrated that
consumption of fish was inversely related to dementia and AD (Kalmijn et al.,
1997). In another human study progression of AD, total intake of DHA was
associated with reduced risk of AD (Morris at al., 2003). Overall communities
with regular consumption of fish have shown reduced prevalence of
neurodegenerative disease and cognitive decline in elderly men (van Glender
et al., 2007; He et al., 2004). Low levels of plasma DHA have been reported
with dementia and AD patients (Tully et al., 2003). Patients having highest
quartile of blood DHA concentration showed lower risk of developing
dementia as compared to patients having lowest three quartile of blood DHA
concentration with the mean value upto nine years (Schaefer et al., 2006).
1.10.3 Link between DHA and zinc
Alterations in both zinc and DHA homeostasis are associated with
neurodegenerative disorders (Lukiw et al., 2005; Cuajungco and Lees, 1997).
Rats fed an omega-3 DHA deficient diet showed altered zinc homeostasis
and demonstrated a strong link between DHA and zinc (Jayasooriya et al.,
2005). Abnormalities in brain zinc metabolism can trigger β-amyloid
formation (Bush et al., 1994). Zinc is one of the metals found in high levels in
brains from human AD patients and transgenic Tg2576 mice (APP mice),
which are prone to develop amyloid plaques (Suh et al., 2000). In studies of
AD brains, zinc chelation caused the precipitation of Aβ suggesting the
association of zinc with AD (Cherny et al., 1999). Similarly ZnT3 knockout
mice (APP mice) showed reduced amyloid plaques (lee et al., 2002). In
25
current study, ZnT5 and ZnT6 have shown association with DHA in presence
of zinc in neuronal cells (Discussed in chapter 5).
1.11 Cellular zinc transport
As any other metal or ion, zinc gets distributed in different cells by specific
transporters called zinc transporters. Different organisms have different
mechanism of transportation. Bacterial transport system has been well
studied and documented in literature, and provide the basic platform for
understanding transportation mechanisms in many other organisms. The
following sections discuss transportation of zinc in both prokaryotes and
eukaryotes.
1.11.1 Bacterial zinc transporters
Zinc is an essential trace element for bacteria as for any other organism.
More is known about bacteria than any other organism. Many different zinc
transporters have been discovered in various types of bacteria and
interestingly, almost every transport system is controlled by its own regulator
(Hantke, 2001). Transportation in bacteria has provided excellent approach
to investigate zinc transport function in eukaryotes. Three families for zinc
efflux and two families for zinc uptake have been reported in bacteria.
1.11.1.1 Cellular zinc import systems
The high affinity zinc uptake process in bacteria is mediated by the ABC
(ATP Binding Cassette) transporter family. The first described
representatives of this family were E. coli Znu (zinc uptake) proteins. The
26
znuA gene encodes protein localized to the periplasmic compartment while
ZnuB is part of cytoplasmic membrane and znuC gene encodes an ATPase
component, positioned in the cytoplasm. Together the whole znuABC
complex can transport Zn2+, Mn2+ and possibly Fe2+ (Patzer and Hantke,
1998; Hantke, 2001). This complex comes into action when bacteria grow in
environments characterized by very low zinc availability (Yatsunyk et al.,
2008). Another example of a transporter belonging to ABC family is the Pzp1
protein of Hemophilus influenzae. The growth of pzp1 mutant was inhibited,
indicating an important function of transporter in the life of organism (Lu et
al., 1997). Recent study showed involvement of another zinc uptake protein
ZinT (formerly known as YodA), which originally identified as cadmium stress
stimulated protein in E. coli (Puskarova et al., 2002; Ho et al., 2008). Zin T is
involved in periplasmic zinc binding under zinc limiting conditions (Kershaw
et al., 2007; Graham et al., 2009). Another study demonstrated the direct
interaction of ZinT with ZnuA for zinc uptake (Petrarca et al., 2010).
Another zinc transporter ZupT was found in bacteria, where metal uptake
was carried out under conditions of moderate zinc availability by the low-
affinity zinc uptake. ZupT (ygiE), represents the first bacterial member of the
ZIP family that mediates zinc uptake. Either ZupT (ygie) or znuABC is
necessary for growth under zinc-limited conditions (Gabbianelli et al., 2011;
Hantke, 2005). Pit transporter has also been proposed to influx zinc in
exchange for inorganic phosphate (Beard et al., 2000). YciABC membrane
protein in B. subtilis has been identified as possible low-affinity zinc
transporter (Gaballa and Helmann, 2002).
27
1.11.1.2 Cellular zinc export systems
Several members of the Cation Diffusion Facilitators (CDF) family have been
identified in bacteria and most of them play a role in export not only of Zn2+
but also of Co2+ and Cd2+. The zinc transporter CzcD from Ralstonia
metallidurans is a representative of this family, which has been found to
protect this organism against the high concentration of zinc present in
decantation tanks of a zinc factory where it was found (Anton et al., 1999).
zitB (formerly ybgR) encodes an additional zinc transporter that belongs to
the CDF family of proteins. Three bacterial CDF homologs, YiiP and ZitB
from E. coli and CzcD from Ralstonia have been characterized functionally
and are related to their mammalian counterparts (Lu and Fu, 2007).
The best characterised members of Resistance, Nodulation, Division (RND)
heavy metal efflux family are mainly from Cupriavidus (previously called
Ralstonia and Alcaligenes) in the form of three transporters CzcA, CzcB and
CzcC organised in sophisticated complex (Valencia et al., 2013). CzcA is
zinc-proton exchanger localized to the cytoplasmic membrane whereas CzcC
is found in outer membrane. Both of them are connected together through
CzcB, which resides in the periplasm. The whole complex forms channel,
allowing extrusion of toxic metals from the cytoplasm to the extracellular
space (Rensing et al., 1997). The RND types of exporters are only identified
in a few gram-negative bacteria (Hantke, 2001).
P-type ATPases are large family of cation transporting, ATP-dependant
proteins found in prokaryotes as well as in eukaryotes, which can transport
variety of ions: Cu+, Ag+, Zn2+, Cd2+ and Pb2+. The E. coli ZntA cytoplasmic
28
membrane protein is an example of such transporter, which confers
resistance to Cd2+ and Zn2+.
All three types of zinc efflux transporters can protect bacteria from high, toxic
concentrations of zinc.
1.11.2 Eukaryotic zinc transport
In eukaryotes the ATP-dependant zinc transporters have not been identified
to date. However members belonging to two metal transporter families have
been implicated in transmembrane transport of zinc but the detailed
mechanisms of their active zinc transport have yet to be elucidated. The Zrt,
Irt-like Proteins (ZIP) family is involved in transporting extracellular zinc into
cell or stored intracellular zinc into the cytoplasm. Many members of this
family has been identified in eukaryotes. The members of cation diffusion
facilitator (CDF) play a similar role in eukaryotes as it was described for
bacteria in the efflux of zinc out of the cell. Additionally they can also
sequester zinc into intracellular organelles.
1.11.2.1 Zrt, Irt-like Proteins (ZIP) or SLC39 family
The name of the family comes from the first identified members, iron
transporter from plant Arabidopsis thaliana (Irt1) and yeast Saccharomyces
cerevisiae the zinc transporter Zrt1 (Eide et al., 1996; Zhao and Eide, 1996a).
Over 80 genes have recently been included in this family, originating from
such distantly related organisms as for example, yeast and humans (Gaither
and Eide, 2001). Most of ZIP proteins have been predicted to contain eight
transmembrane domains and long, cytoplasmic, histidine-rich loop between
29
domains III and IV, which may facilitate zinc binding. Transmembrane
domains IV and V of all ZIP members contain conserved histidine residues
(Figure 1.2). They may help to bind and move zinc ion throughout the
transmembrane channel (Eng et al., 1998; Guerinot, 2000). The region
possibly accountable for recognition of the zinc is the loop between
transmembrane domains II and III (Gaither and Eide, 2001). However, the
mechanism of the zinc transport by ZIPs is not fully understood. Proposed
mechanisms include exchange of zinc with another ion or diffusion of zinc
through the plasma membrane due to concentration gradient (Eide, 2000).
1.11.2.2 Cation Diffusion Facilitators (CDF) or SLC30 family
The many members of the CDF family encode putative zinc efflux genes. The
recent analysis of database sequences has revealed the presence of 104
CDF members originating from all phylogenetic levels (Gaither and Eide,
2001). The predicted CDF gene products are proteins with six
transmembrane domains, except for the yeast Msc2 and the mammalian
ZnT-5 transporters (Li and Kaplan, 2001; Kambe et al., 2002). Their carboxy
and amino termini are localised to the cytoplasmic side of the cell membrane.
A histidine-rich intracellular loop, a potential zinc-binding region, is found
between transmembranes IV and V in all representatives of this family
(McMahon and Cousins, 1998). A second potential zinc binding region with
multiple histidines is found in the C-terminus (Figure 1.3).
Figure 1.2 Predicted structure of the members of ZIP family
Transmembrane domains are shown in purple and conserved histidine
residues are highlighted in green.
30
Figure 1.3 Predicted structure of the members of ZnT family
Transmembrane domains are shown in yellow and conserved histidine
residues are highlighted in green.
31
32
The most conserved domains among CDF family are highly amphipathic
transmembrane domains: I, II and V but their function has not yet been
elucidated (Gaither and Eide, 2001).
1.11.3 Zinc transport in Saccharomyces cerevisiae
Even though it is single-celled, the yeast has all the characteristic traits of
eukaryotic cells, including organelles and DNA confined to a nucleus. Yeast
chromosomes are not circular, which is a characteristic feature of
prokaryotes. Several yeasts, in particular S. cerevisiae, have been widely
used in genetics and cell biology, largely because it is a simple eukaryotic
cell, serving as a model for all eukaryotes, including humans. S. cerevisiae is
generally regarded as the most well understood eukaryotic organism
(Guldener et al., 2005). Studies on zinc transporters and their regulators in
the yeast Saccharomyces cerevisiae have facilitated our general
understanding of zinc transport.
1.11.3.1 Cellular zinc uptake
The first two uptake zinc transporters to be identified in yeast were the ZRT1
and ZRT2 gene products. The ZRT1 and ZRT2 genes share (44%) amino
acid sequence identity and a high similarity (67%) and both belong to the ZIP
family (Eide, 2003). The ZRT1 is a high affinity zinc transporter, which is
active in cells cultured in the presence of a low concentration of zinc. The
zrt1 yeast mutant grew poorly on zinc-deficient medium, demonstrating a
disruption to the high affinity zinc uptake system but not to the low affinity
one (Zhao and Eide, 1996a). This second system was found to be controlled
33
by the transporter ZRT2, a low affinity zinc transporter that is active in zinc
replete cells (Zhao and Eide, 1996b). Interestingly, the zrt1 zrt2 mutant was
found to be viable but required a high concentration of zinc to grow (Zhao
and Eide, 1996b). This finding suggests the existence of an additional uptake
system, which recently was attributed to iron, copper and zinc transporter
FET4 (Waters and Eide, 2002). FET4 is yeast specific and homology does
not match to any other eukaryotic member, although it can be related to
bacterial protein COG5478.
Another member of the ZIP family, ZRT3 was isolated from yeast and found
to be induced under the zinc limiting conditions. It is closely related to zinc
uptake transporter ZupT from E. coli (Grass et al., 2002). Out of remaining
ZIP proteins, only Atx2p has been characterized that resides in in the Golgi
complex. It’s involvement in zinc homeostasis has not been investigated yet
but might function in the transport of manganese from the lumen to the
cytoplasm (Lin and Culotta, 1996). Phosphate transporter Pho84 has also
been suggested to participate in uptake as ZnPO4 (Jensen et al., 2003). The
last ZIP protein in yeast, Yi1023cp is not fully characterized but is closely
related to human ZIP4 protein (lyons et al., 2004).
1.11.3.2 Cellular zinc efflux
An excess of the metal could be toxic for the organism, therefore a
detoxification mechanism is present to efflux extra zinc out of the cell or by
compartmentalization. In an abundance of intracellular zinc, Zrc1 and Cot1
facilitate the sequestration of zinc into the vacuoles. Both proteins are closely
related (60% identity) and demonstrate the conserved features characteristic
34
for CDF family (Eide, 1998). The ZRC1 gene was identified in search for
genes conferring resistance to zinc. Overexpression of ZRC1 allows cells to
withstand high zinc concentrations while the zrc1 mutant shows increased
zinc sensitivity (Kobayashi et al., 1996). The COT1 gene was isolated by a
similar method as a cadmium resistance gene (Conklin et al., 1992). Later its
suppression of zinc toxicity was also demonstrated (Conklin et al., 1994).
Zrc1 and Cot1 were found to localise to the membrane of vacuole, further
supporting their role in zinc detoxification (Li and Kaplan, 1998; MacDiarmid
et al., 2002). The mechanism of zinc transport into the vacuole by Zrc1 and
Cot1 is based on Zn2+/H+ exchange (MacDiarmid et al., 2002).
Another member of CDF family, Msc2 was discovered during the study on
chromatid recombination (Thompson and Stahl, 1999), is believed to
transport zinc into the lumen of the endoplasmic reticulum. The predicated
protein structure of Msc1 indicates 12 transmembrane domains with two
histidine-rich regions that is unusual for the CDF family but six of the C-
terminal domains show highly conserved region with other members of the
family (Gaither and Eide, 2001). Msc2 interacts with fourth CDF protein
Zrg17. These two proteins function as a complex to transport zinc into the
secretory pathway (Ellis, 2005).
1.11.4 Mammalian zinc transporters
Zinc metabolism came into existence by identification and characterization of
zinc transporters. Zinc transport proteins were identified in 1997/98. All of
these proteins have transmembrane domains and are encoded by two solute
linked carrier gene families ZnT (SLC30) and Zip (SLC39). In human cells
35
total of 10 ZnT’s and 15 Zip’s have been reported. These two families play
opposite roles in cellular zinc homeostasis. ZnT transporters tends to reduce
intracellular availability of zinc by promoting zinc efflux from cells or
sequestering into intracellular vesicles whereas Zip transporters increase
intracellular zinc availability by promoting extra cellular zinc uptake or by
releasing vesicular zinc into the cytoplasm. Both the ZnT and Zip transporter
families perform tissue specific expression and different response to dietary
zinc deficiency or to physiologic stimuli via hormones and cytokines.
Metallothionein is also included for its primary role in binding the intracellular
free zinc and redistributing it to zinc-dependant molecules.
1.11.4.1 ZIP family
The first members of ZIP family, ZIP1, ZIP2 and ZIP3 genes were isolated
from Arabidopsis thaliana when they restored the growth of zinc uptake yeast
mutant (zrt1 zrt2) on zinc-limited medium. The ZIP4 gene was identified by
plant database search however it did not rescue the growth of yeast mutant.
All mammalian ZIP sequences, isolated later, have been named after plant
transporters: ZIP1 to ZIP15. The study on yeast and plant ZIP family has
facilitated the characterization of the human genes.
ZIP1
The human Zip1 gene, hZip1 was identified in expressed sequence tag
(EST) database by homology to Arabidopsis thaliana ZIP1 gene (Grotz et al.,
1998; Lioumi et al., 1999). It is expressed in human prostate cells, where it
was found to be upregulated in response to testosterone and prolactin and
36
down-regulation in response to high zinc (Costello et al., 1999). In another
study, hZIP1 was isolated from prostate cDNA library and designated ZIRTL
(Zinc-Iron Regulated Transporter-Like) Gaiter and Eide (2001). In human
erythroleukemia (K562) cells overexpression of ZIRTL increased zinc uptake
activity and antisense oligonucleotide inhibition of hZIP1 expression reduced
zinc uptake. Similar results were obtained in prostate cell line (Franklin et al.,
2003). hZIP1 protein is associated with organelles in cells cultured in zinc
adequate medium but goes to the cell surface when zinc is limited (Wang et
al., 2004), where a di-leucine sorting signal of ZIP1 is required for the
endocytosis of protein (Huang and Krischke, 2007). In mice, ZIP1 was not
regulated by dietary zinc.
ZIP2
The human ZIP2 gene was identified by sequence homology to A. thaliana
ZIP2. Human erythroleukemia K562 cells transfected with hZIP2 construct
accumulated more 65Zn than control cells suggesting that hZIP2 was involved
in zinc uptake. hZIP2 mRNA is not detected in many human tissue and cell
lines, which may be related to the low levels of expression of this transporter
or its limited tissue distribution.
The ZIP2 protein was localised to the plasma membrane in K562 cells
(Gaither and Eide, 2000) and treatment of the cells with the zinc chelator
TPEN gave a 27-fold up-regulation. In response to zinc supplementation, the
expression of hZIP2 was only slightly down regulated (~1.5-fold) (Cousins et
al., 2003). These results confirm the potential role of hZIP2 in zinc uptake. In
mice, the gene is expressed in skin, liver, ovary and visceral yolk sac and did
37
not respond to dietary zinc deficiency (Dufner-Beattie et al., 2003). This gene
may be regulated in a cell-specific manner or post-translational mechanisms
are involved in its regulation.
ZIP3
The human ZIP3 gene has been identified by sequence homology to fungal
and plant ZIPs (Gaither and Eide, 2000) however no experimental data has
been reported. The mouse ZIP3 gene was identified from mouse ESTs. The
predicted mZIP3 protein shows 78% identity to human ZIP3. The expression
of mZIP3 gene in HEK293 cells resulted in increased zinc uptake. This
uptake was inhibited by Cu2+, Cd2+, Mn2+, Mg2+ and Ni2+ suggesting that
mZIP3 may be capable of transporting broad range of metals. The mRNA
expression of mZIP3 was limited to few tissues with highest level in testis.
Similarly to the mZIP1 and mZIP2 the transcriptional expression of mZIP3 in
small intestine and visceral yolk sac was not responsive to mouse nutritional
zinc deficiency (Dufner-Beattie et al., 2003).
ZIP4
The human ZIP4 gene was first identified by sequence homology to the other
ZIP members. The hZIP4 mRNA expression was detected in the kidney,
colon, duodenum, jejunum, and most of the intestinal tract. Two alternative
forms of the protein exist, short form of 622 amino acids and the long form of
647 amino acids. The hZIP4 gene spans 4.7kb and has 12 exons.
Using immunohistochemisny, hZIP4 was shown to localize to the luminal
plasma membrane of the enterocyte (Kury et al., 2002). ZIP4 transcriptional
38
up-regulation was observed during restricted zinc levels induced by the
transcription factor Kruppel-like factor 4 (KLF4) (Weaver et al., 2007).
Mutations in both of the hZIP4 alleles and heterozygous deletions result in
the zinc deficiency disorder, acrodermatitis enteropathica (Kury et al., 2002).
When treated with zinc, a quick recovery of patients with acrodematitis
enteropathica was observed, suggesting that hZIP4 may not be the only
functional zinc uptake protein (Wang et al., 2002). As zinc is necessary for
many different processes in the body, it may be required to transport zinc to
different cells and intracellular sites, through a variety of zinc transporters.
ZIP5
ZIP5 proteins share 30% homology with ZIP4 and mouse and human ZIP5
are very similar in sequence with 84% identity (Wang et al., 2004). It shows
high expression in liver, kidney, pancreas, small intestine and colon. Unlike
ZIP4, ZIP5 is present in the basolateral surface of these cell types under zinc
replete conditions but gets internalized during dietary zinc deficiency (Dufner-
Beattie et al, 2004). During zinc deficiency, ZIP5 mRNA remains associated
with polysomes while the protein is internalized and degraded in enterocytes,
acinar cells and endoderm cells (Weaver et al., 2007).
ZIP6
ZIP6 (LIV-1) was identified in MCF-7 and ZR-75 breast cancer cells for the
first time and their expression was stimulated by estrogen treatment
(Manning et al., 1988). It is considered as the founder of LZT (LIV-1
subfamily of ZIP zinc transporters) Tissues like placenta, mammary gland
39
and prostrate, which are sensitive to hormones, showed high expression for
ZIP6 gene (Taylor and Nicholas, 2003). These are present in the plasma
membrane of these cells and act as an importer of zinc. These also have
been associated with the prognosis of breast cancer and ZIP6 is considered
as a reliable marker for estrogen receptor positive cancers (Scheider et al.,
2006; Tozlu et al., 2006). In dendritic cells under decreased intracellular zinc
conditions, after exposure to lipopolysaccharide (LPS) ZIP6 expression goes
down. A cell-permeable zinc chelator, TPEN, mimicked the effects of LPS,
whereas zinc supplementation or overexpression of the gene encoding ZIP6,
a zinc transporter whose expression was reduced by LPS, inhibited LPS-
induced upregulation of major histocompatibility complex (MHC) class II and
costimulatory molecules (Kitamura et al., 2006).
ZIP7
ZIP7 was found originally by homology to mouse KE4 gene and the human
HKE4 gene was mapped to the centromeric side of the HLA class II region of
chromosome 6 (Ando et al., 1996). Protein expression of ZIP7 is repressed
under high zinc conditions, whereas there were no effects of zinc on ZIP7
gene expression and intracellular localization, neither did zinc deficiency
affect the intracellular distribution of ZIP7 in mammalian cells suggesting that
ZIP7 is a functional zinc transporter that acts by transporting zinc from the
Golgi apparatus to the cytoplasm of the cell (Huang et al., 2005; Taylor et al.,
2007). This transporter shows association with the prognosis of breast
cancer as studies on MCF-7 and tamoxifen-resistant (TamR) MCF-7
demonstrated that ZIP7 is required for increasing intracellular zinc levels that
40
can lead to activation of epithelial growth factor receptor/IGF-I receptor/Src
signaling as well as growth and invasion (Taylor et al., 2008).
ZIP8
Refining the mouse chromosomal location of cadmium lead to the
identification of mouse ZIP8 as the transporter responsible for cadmium
induced toxicity in the testis (Dalton et al., 2000; Dalton et al., 2005). ZIP8
was expressed in lung, kidney, testis, liver, brain, small intestine and the
membrane fraction of mature red blood cells (RBCs) (Wang et al., 2007; Ryu
et al., 2008). The localization of this transporter during zinc deficient
conditions is plasma membrane but during adequate zinc conditions it gets
internalized (Wang et al., 2007), in contrast, in mature RBCs after zinc
dietary deficiency no changes were observed in the localization (Ryu et al.,
2008). In primary human lung epithelia and BEAS-2B cell cultures, ZIP8
expression is stimulated by TNF-α. TNF-α induces the expression of a
glycosylated protein that gets translocated to the plasma membrane and
mitochondria. Increased Zip8 expression resulted in an increase in
intracellular zinc content and coincided with cell survival in the presence of
TNF-α. This study suggested that upregulation of Zip8 is sufficient to protect
lung epithelia against TNF-α-induced cytotoxicity (Besecker et al., 2008).
ZIP9
National Institute of Health Mammalian Gene collection Program identified
human and mouse ZIP9 by sequencing a cDNA clone containing a complete
ORF for gene (Strausberg et al., 2002). Sequence homology confirms this as
41
a member to ZIP family but this is the only member in subfamily I (Taylor et
al., 2007).
ZIP10
The expression of ZIP10 gets suppressed by induction of MTF-1 unlike ZNT1
zinc transporter (Wimmer et al., 2005). rZIP10 localises in plasma membrane
and high expression was observed with zinc supplementation, which is in
contrast to mouse and zebra fish where its expression goes down with zinc
supply (Pawan et al., 2007). mRNA expression of this transporter in breast
cancer samples suggested the association of ZIP10 with metastasis of breast
cancer to the lymph nodes (Kagara et al., 2007).
ZIP11
It is member of gufA subfamily of ZIP transporters and is named after the
Myxococcus xanthus gene, which has unknown function (Yu et al., 2013).
ZIP12
ZIP12 was found on the basis of screening of a schizophrenia susceptibility
locus on chromosome 10p for proteins that may be involved in zinc transport.
An association was demonstrated by missense homozygous mutation in
ZIP12 and frequency of schizophrenia development in a small group of
patients (Bly, 2006).
ZIP13
ZIP13 is a member of the LIV-I subfamily of ZIP zinc transporters (Taylor et
42
al., 2007). Mice deficient in Zip13 showed changes in bone, teeth and
connective tissue of the clinical spectrum of human Ehlers-Danlos syndrome
(EDS). The ZIP13 knockout mice show defects in the maturation of
osteoblasts, chondrocytes, odontoblasts, and fibroblasts. This study revealed
that a crucial role of ZIP13 in connective tissue development is due to its
involvement in the BMP/TGF-beta signaling pathways (Fukada et al., 2008).
ZIP14
This member belongs to LZT subfamily and its function has been associated
with inflammation. Zip14 expression was shown up-regulated through IL-6,
and suggested that it plays a major role in the mechanism responsible for
hypozincemia that accompanies the acute-phase response to inflammation
and infection (Liuzzi et al., 2005). Two different mRNA transcripts have been
identified so far ZIP14A and ZIP14B (Liuzzi and Cousins, 2004; Girijashanker
et al., 2008). Both ZIPA and ZIPB are localized to the apical surface of cells
(Tominaga et al., 2005; Liuzzi et al., 2005). An alternative transcript variant of
SLC39A14, caused by pre-mRNA splicing (SLC39A14-exon4B), has also
been suggested as a biomarker for colorectal cancer (CRC) (Sveen et al.,
2012).
1.11.4.2 ZNT family
Members of mammalian CDF family are denoted ZnT (zinc Transporters)
and were first described in rodents (Palmiter and Findley, 1995) but now
human othologues have been identified (Huang and Gitsher, 1997; Palmiter
et al., 1996a). The exact mechanism by which the ZnT proteins transport zinc
43
is unclear. A total of 10 mammalian members are known for this family. Their
detailed structural features like transmembrane domains (TMD), total length,
number of exons, N and C terminal regions are explained in chapter six.
ZnT1
ZnT-1 was the first described zinc transporter in mammalian cells and shows
similarity to the yeast metal efflux genes ZRC1 and COT1. It was discovered
in complementation studies by transforming a rat kidney cDNA library into
zinc sensitive strain of baby hamster kidney (BHK) cells and selecting cells
surviving in high concentration of zinc (Palmiter and Findley, 1995). The ZnT-
1 gene product is a small protein, comprising of 507 amino acids, which is
ubiquitously expressed (Palmiter and Findley, 1995). The ZnT1 mRNA
expression is zinc responsive (McMahon and Cousins, 1998) through MTF-1
(metal-responsive element-binding transcription factor-1), which binds to its
metal responsive element (MRE) in the promoter region (Langmade et al.,
2000). A recent study demonstrated that a tumor suppressor PTEN
(phosphatase and tensin homologue deleted on chromosome 10) modulates
the MTF-1 mediated expression of ZnT1 and metallothionein (Lin et al.,
2012). ZnT1 interacts with other proteins. For example, it decreases cell
surface expression of functional L-type calcium channels (LLCCs) by
interacting to β-subunit of LTCC (Levy et al., 2009) or downregulates the
transcription factors stimulated by MTF1, c-jun and Elk by forming
heterocomplexes with EVER proteins (Lazarczyk et al., 2008). It is also
known to modulate Raf-1 activity via direct interaction (Jirakulaporn and
muslin, 2004).
44
The ZnT1 protein is mainly localised to the plasma membrane (Palmiter and
Findley, 1995) but its subcellular localization shows diversification. It is
present in basolateral membrane in enterocytes but at the apical membrane
in pancreatic acinar cells (Cousins et al., 2006; Cousins and McMohan,
2000; Liuzzi and Cousins, 2004). Another study also revealed its presence in
the endoplasmic reticulum (ER) by forming complexes with EVER proteins in
human keratinocytes where it gives rise to rare autosomal recessive disorder
epidermodysplasia verruciformis (Lazarczyk et al., 2008). It’s mRNA and
protein expression has been studied for liver, intestine and brain (McMohan
and Cousins, 1998; Liuzzi et al., 2001)
ZnT2
Another member of the CDF family sharing all their features is the ZnT2 gene
product. Rat ZnT2 was isolated using a similar strategy as for ZnT1. The
remaining BHK zinc resistant clones, which did not contain ZnT-1 cDNA were
sequenced and one of the newly identified clone was termed ZnT2 as it
shared sequence similarity to ZnT1 (Palmiter et al., 1996a). Mouse intestine,
testis and kidney tested positively for ZnT2 mRNA expression (Palmiter et
al., 1996b). At the cellular level, the protein product of this gene was detected
in cytoplasmic vesicles characterised by their high zinc content as detected
by the Zinquin probe (Palmiter et al., 1996a). Zinc-sensitive BHK mutant cells
transformed with ZnT2 construct were resistant to high zinc concentrations,
but the total cell zinc content was increased, implying that this gene product
has a function in delivering access of zinc to secretory vesicles (Palmiter et
al., 1996a). ZnT2 expression has been observed in small intestine, kidney,
45
placenta and liver (McMohan and Cousins, 1998). ZnT2 expression gets
upregulated by prolactin a lactogenic hormone in mammary cells via
JAK2/STAT5 signalling pathway (Qian et al., 2009). STAT5 and
glucocorticoid receptor interaction regulates ZnT2 expression in pancreatic
acinar cells (Guo et al., 2010).
The subcellular localization for ZnT2 is very diverse. It has been localized in
secretory vesicles of mammary gland, pancreas and prostrate (Kelleher et
al., 2011). It has been observed in endosomal/lysosomal acidic
compartments (Falcon-Perez and Dell’Angelica, 2007; Palmiter et al.,
1996a). Mitochondrial localization of ZnT2 via its association with the inner
membrane has also been reported (Seo et al., 2011). SNPs (Single
Nucleotide Polymorphism) in ZnT2, changes the subcellular localization that
can affect cellular zinc metabolism (Seo and Kelleher, 2010). ZnT2 gene is
associated with 75% reduction of zinc levels in milk that resulted in transient
zinc deficiency and dermatitis in infants (Chowanadisai et al., 2006).
ZnT3
The third CDF zinc transporter gene, ZnT3 was cloned from a mouse brain
cDNA library using a rat ZnT2 cDNA probe. The gene product is highly
similar to ZnT2 (52% identity). It contains six transmembrane domains but
the histidine-rich fragment is shorter than in other ZnT family members. The
mRNA expression of ZnT3 was reported to be restricted to testis and brain
(Palmiter et al., 1996b) with strong expression in synapses of glutamatic
neurons in the hippocampus and neocortex, suggesting a role for it in
packaging zinc into synaptic vesicle (Sensi et al., 2009; Wenzel et al., 1997).
46
Synaptic vesicular zinc is depleted in Znt3-knockout mice (Cole et al., 1999).
As zinc released into the synaptic cleft is an important modulator of neuronal
activity (Sensi et al., 2009), ZnT3 plays an important role in presynaptic
Erk1/2 signalling during hippocampus dependent learning (Sindreu et al.,
2011).
Mice with mutant of AP-3 (mocha mouse) showed loss of ZnT3 or disturbed
localization hence indicates that synaptic localization of ZnT3 is controlled by
AP-3 (Kantheti et al., 1998). Estrogen decreases the expression of ZnT3 by
down regulating the expression of δ-subunit adaptor protein complex (AP-3
δ) that determines the level of ZnT3 (Lee et al., 2004). Knockouts of ZnT3
showed age dependent learning disabilities and memory loss (Adlared et al.,
2010; Martel et al., 2011). Other than its role in brain, it has been reported to
regulate insulin production in pancreatic β cells, where ZnT3-knoclout mice
showed mildly impaired glucose metabolism after streptozotocin treatment
(Smidt et al., 2009) and retinal cells (Smidt and Rungby, 2012).
ZnT4
The ZnT4 gene was found during an attempt to scan for the gene underlying
the ‘pallid’ mouse mutant (Huang and Gitschier, 1997). The ZnT4 protein, in
addition to all features characteristic for whole family, exhibited the presence
of a ‘leucine zipper’ motif in the N-terminal region, which may facilitate
protein-protein binding (Murgia et al., 1999). Ubiquitous expression of the
ZnT4 gene product was detected in rat tissue and cells with strongest signals
from the mammary gland, brain and testis. The ability of ZnT4 to transport
zinc was confirmed by complementation of a zinc-sensitive ( zrc1) yeast
47
mutant. The most interesting discovery was revealed following the
sequencing of ZnT-4 gene in the ‘lethal milk’ mouse. A nonsense mutation at
arginine codon 297 resulted in premature protein termination, producing a
nonfunctional protein (Huang and Gitschier, 1997). This finding suggested
the possibility that ZnT-4 was responsible for secreting zinc into the milk in
the mouse and hence may underline a zinc-deficiency disorder found in
premature babies. In 2003, however, Michalczyk et al., found no mutations or
changes in ZnT4, indicating that this gene did not cause the neonatal zinc
deficiency disorder.
Immunocytochemistry of a c-myc tagged protein revealed localisation of
ZnT4 to cytoplasmic vesicles mainly in close relation to the perinuclear
region (Murgia et al., 1999).Overall the localization has been seen in
intracellular vesicles, the trans-Golgi network as well as endosomal
compartments (Falcon-Perez and Dell’Angelica, 2007; Ho et al., 2004;
Palmiter and Huang, 2004). It also has been reported to be present in the
plasma membrane in some cells (Henshall et al., 2003; Overbeck et al.,
2008). Altered expression of ZnT4 has been reported in AD brain (Smith et
al., 2006), although no evidence to describe the underlying mechanism is
known.
ZnT5
Almost simultaneously two independent groups reported the identification of
another member of CDF family designated ZnT-5 or ZTL1 (ZnT-Like
Transporter). The ZnT-5 gene was isolated from the mouse EST sequences
while searched with ZRC1 gene. The mouse gene was estimated to code for
48
761 amino acids whereas human ZnT-5 with high homology to mZnT-5
(94%) consists of 765 amino acids. The predicted protein structure of both
mouse and human ZnT-5 transporters has showed 15 transmenbrane
domains with 6 C-terminal domains characteristic of CDF transporter family
(Kambe et al., 2002). The part of ZTL1 gene was isolated from EST
databases during the homology search with ZnT1 and then ZTL1 sequence
was extended using 5’RACE system. This 523 amino acids protein (172-666
amino acids identical to hZnT-5) has 12 predicted membrane-spanning
domains.
In promoter region of hZTL1 five metal response elements (MRE) were
identified, suggesting the regulation by MTF-1 (Cragg et al., 2002). Both
hZnT-5 and hZTL1 transcripts are widely expressed but hZnT-5 was the
most abundant in pancreatic cells (Kambe et al., 2002; Cragg et al., 2002).
The electron microscopy revealed the association of hZnT-5 protein with
zinc-rich secretary granules that accumulate insulin in cells suggesting a
role of this transporter in delivering zinc for formation of insulin crystals. In
the HeLa cells transfected with inducible hZnT-5, this gene product was
detected in Golgi apparatus. The 65Zn uptake into the isolated hZnT-5-
induced Golgi vesicles was higher than in uninduced vesicles. This transport
was dependant on time, temperature and concentration and was saturable
(Kambe et al., 2002).
The myc-tagged hZTL1 was localized to apical side of the CaCo-2 cells. The
endogenous expression of hZTL1 was induced in Caco-2 cells grown in high
zinc concentrations.Increased 65Zn uptake was recorded in Xenopus laevis
49
oocytes when injected with hZTL1 cRNA demonstrating saturable and pH
dependant features (Cragg et al., 2002). The ZnT-5-null mice showed poor
growth, muscle weakness and developed osteopenia due to impairment of
osteoblast maturation. More than half of hZTL1 knockout male mice died
from sinus bradycardia indicating that this protein is required for regulation of
cardiac conduction system (Inoue et al., 2002).
ZnT5 protein expression goes down in human ileal mucosa with high dietary
zinc intake (Cragg et al., 2005). Similarly exposure of high zinc to (human
epithelial colorectal) Caco-2 cells resulted in inhibition of ZnT5 transcription
and translation even though the the mRNA stability is increased by high
doses of zinc (Jackson et al., 2007). The expression of ZnT5 is
transcriptionally up regulated by unfolded protein response (UPR) inducer,
which is mediated by the transcription factor XBPI through the conserved
UPR element (5’-TGACGTGG-3’) in its promoter region (Ishihara et al.,
2006). ZnT5 expression is increased by LPS or interlukein-6 in the liver
(Lichten and Cousins, 2009; Liuzzi et al., 2005). ER (endoplasmic reticulum)
bound transcription binding factor, CREBH is activated in response to
proinflammatory cytokines and LPS and binds to UPR sequence (Zhang et
al., 2006). ZnT5 form heterodimer complexes with ZnT6 and participate in
TNAP (Tissue Non-specific Alkaline Phosphatase) activation in early
secretory pathway (explained in detail in chapter 5). Endogenous ZnT5 is
concentrated in cytoplasmic vesicles, such as COPII-coated vesicles in HeLa
cells (Suzuki et al., 2005a) and is associated with insulin granules membrane
in pancreatic β cells (Kambee et al., 2002).It also plays important role in
cellular events, for example it is essential for nuclear factor-kB activation
50
through the FcεRI-indused (Fc epsilon receptor I) translocation of the protein
kinase C (PKC) to plasma membrane in mast cells (Nishida et al., 2009).
ZnT6
The mouse ZnT6 transporter was discovered using the mouse ZnT-4
sequence to search EST databases. The amino acid sequence of mouse
ZnT-4 demonstrates similarities to rat ZnT2, mouse ZnT3 and ZnT4 (32%,
33% and 33% identities, respectively). The predicted protein structure of this
gene resembles the other members of ZnT family except it lacks histidines in
the second intracellular loop, presenting serine residues instead (Huang et
al., 2002). Site-directed mutagenesis demonstrated that these serines were
crucial for zinc binding function (Palmiter and Huang, 2004). An abundant
mRNA expression of mZnT-6 was detected in brain, liver and small intestine
whereas protein expression was demonstrated in brain, small intestine and
kidney but not in liver, suggesting tissue-specific translational or
posttranslational regulation. Expression of mZnT6 suppressed the growth of
yeast zrt1, zrt3 and msc2 mutant, defective in accumulation of
cytoplasmic zinc, when grown in media with normal zinc levels but zinc
supplementation rescued yeast growth.
In cultured rat NRK and human MCF-7 cells, the protein product of ZnT6 was
localized predominantly to the TGN however it was redistributed from TGN to
vesicular cytoplasmic compartment in response to zinc treatment. The
cellular role of ZnT-6 was suggested be either delivering zinc into zinc-
dependant enzymes in TGN or export of the excess of zinc through vesicular
transport (Huang et al. 2002). High expression of ZnT6 has been observed in
51
hippocampus gyrus of the human brain in AD and Pick disease (Ryu et al.,
2008).
ZnT7
The mouse ZnT7 transporter was discovered using the mouse ZnT1
sequence to search EST databases (Kirschke and Huang, 2003). The
closest homoloque of the mZnT-7 gene was the C-terminal part of the
mZnT5 gene (47% identity). The predicted protein structure of ZnT7
resembles other members of ZnT family with exception of the presence of a
second intracellular loop very rich in histidine residues. The mRNA
expression of mZnT7 gene was detected in most tissues tested but was most
abundant in the liver, spleen and small intestine. The mZnT7 protein was
detected in the small intestine and lungs at different sizes of 85, 65 and 43
kDa possibly due to some modifications, possibly phosphorylation or
glycosylation. Mouse ZnT7 protein was not expressed in brain, liver, kidney
and heart despite the presence of mRNA in these tissues, suggesting
translational or posttranslational regulation.
Perinuclear localization of mZnT7 protein was detected in small intestinal
epithelial cells and in lung fibroblasts where it co-localised with Golgi
apparatus markers. An additional punctuate vesicular cytoplasmic pattern
was found that was distinct from the punctuate staining of ZnT4 or ZnT6.
Accumulation of zinc in the Golgi apparatus was identified with Zinquin probe
in CHO cells expressing mZnT7 which had been exposed to increased
concentrations of zinc. Therefore it is possible that ZnT7 transporter delivers
zinc into the Golgi apparatus (Kirschke and Huang, 2003). ZnT7 is
52
predominantly localized in the cis-face or the forming face of the Golgi
apparatus (Chi et al., 2006). ZnT7 forms homo-dimers to activate TNAP in
early secretory pathway (Suzuki et al., 2005a). Disruption of ZnT7 in DT40
cells resulted in 20% decrease in TNAP suggesting partial dependence of
TNAP activity on ZnT7. ZnT7-knockout mice resulted in zinc deficient
phenotype that did not respond to dietary zinc supplementation and had
decreased body fat composition (Huang et al., 2007). ZnT7 has been shown
to up regulate insulin gene expression via Mtf1 (Huang et al., 2010). This
study suggests that ZnT7 plays a crucial role in maintaining cellular zinc
homeostasis and might be involved in the regulation of body composition.
ZnT8
ZnT8 was first time identified in the insulin granules of pancreatic beta cells
and shown to facilitate the accumulation of zinc from the cytoplasm into
intracellular vesicles (Chimienti et al., 2004). It was also expressed in other
tissues including glucagon secreting pancreatic α cells (Wijesekara et al.,
2010). The islet-specific expression of ZnT8 is regulated by the β cell
enriched transcription factor Pdx-1 through an intronic enhancer (Pound et
al., 2011; Tamaki et al., 2009). ZnT8 protein was expressed in fetal
pancreatic cells and showed down regulation in the islets of diabetic mice by
using mouse diabetic models (Tamaki et al., 2009). It also plays an essential
role in zinc accumulation in the insulin granules, where insulin binds to zinc
to form zinc-insulin crystals.
Insulin granules in Znt8-knockout mice are immature with pale insulin “pro-
granules” (Lemaire et al., 2009; Wijesekara et al., 2010). Overexpression of
53
ZnT8 in insulinoma cells enhances glucose-stimulated insulin secretion
(Chimienti et al., 2006). The non-synonymous SNP of ZnT8 (rs13266634)
that introduced the substitution (arginine to tryptophan) at amino acid 325 at
the C-terminal region is associated with increased susceptibility for type 2
diabetes (Sladek et al., 2007). Recent study suggests that ZnT8 contributes
to the risk of developing type 2 diabetes through β-cell- and non-β-cell-
specific effects (Hardy et al., 2012).
ZnT9
ZnT9 gene was originally isolated from human embryonic lung cells (Sim and
Chow, 1999). The total length consisting 569 amino acids protein has a
putative cation efflux motif, a DNA excision repair motif and a nuclear
receptor interaction sequence. It is considered to be associated with cytocol
and nuclear fractions and not to the membranes even though has predicted
six trans-membrane domains (Sim and Chow, 1999). ZnT9 also shares
homology with cation efflux domain (pfam01545), renamed as GAC63, as it
acts as a component of the p160 coactivator signal transduction pathway
(Chen et al., 2005). ZnT9 seems to be expressed ubiquitously and its mRNA
expression is not affected either by high dose of zinc or by zinc depletion in
peripheral blood lymphocytes (Overbeck et al., 2008). To date, no studies
have assessed the function of this protein.
ZnT10
ZnT10 was discovered using sequence homology with ZnT1 (Seve et al.,
2004). EST (expressed sequence tag) analysis revealed the fetal restricted
54
expression profile to the fetal brain and liver for ZnT10. Recently ZnT10 has
been reported to localize in the early/recycling endosomes in vascular
smooth muscle cells (Patrushev et al., 2012). ZnT10 along with ZnT3
regulates cellular senescence induced by angiotensin II in the vesicular
smooth muscle cells by reducing cytosolic zinc concentrations (Patrushev et
al., 2012). It plays key role in the regulation of manganese homeostasis,
although the mechanism is not yet discovered and reported to be involved in
parkinson’s by causing hypermanganesemia (Quadri et al., 2012; Tuschl et
al., 2012).
1.11.4.3 NRAMP (Natural Resistance-Associated Macrophage
Proteins) or SLC11 family
The DCT1/DMT1/Nramp2 gene is proton-coupled divalent metal transporter
playing a crucial role in intestinal iron uptake but also capable of Mn2+, Cu2+,
Zn2+ and PB2+ transport (Gunshin et al., 1997; Nevo and Nelson, 2006).
Mammalian members of the SLC11 family are thought to have 12
transmembrane domains (TMDs) (Czachorowski et al., 2009) with a
conserved hydrophobic core of 10 TMDs (Cellier at al., 1996; Cellier at al.,
1995), with no similarity to either ZIP of CDF families. Iron deficiency induces
the mRNA and protein expression of DCT1/DMT1/Nramp2 (Yeh et al., 2000).
The DCT1/DMT1/Nramp2 protein is localized to apical membrane of
duodenal enterocytes (Canonne-Hergaux et al., 1999) however in a variety of
other tissues it shows endosomal and lysosomal vesicular localization (Roth
et al., 2000; Tabuchi et al., 2000). The mammalian SLC11 family is
55
comprised of two members; SLC11A1 and SLC11A2. The specific role of this
transporter in zinc homeostasis has not been studied yet.
1.12 Project aims
Zinc is an essential trace element required by all organisms for normal
functioning, as it plays critical roles as a structural component of proteins and
a co-factor in catalysis of many enzymes. Even though many transporters
have been identified in bacteria, yeast and rodent cells, the biological
assimilation and transport of zinc into cells is still not well understood. The
functions of many of the ZnT/SLC30A (putative zinc exporters) and
ZIP/SLC39A transporters are yet to be elucidated. This thesis describes an
investigation into the molecular basis of an inherited disorder of zinc
deficiency in milk that identified defects in ZnT5 and ZnT6 zinc transporters.
Following this, further investigation to characterise the role of ZnT5 and ZnT6
was carried out in neuronal cells as these two transporters are known to be
linked with brain zinc homeostasis. The link between the omega-3 fatty acid
DHA and zinc fluxes was investigated as both have been proven to play a
crucial role in normal functioning of human brains. To better understand the
relationship of ZnT5 and ZnT6 with rest of the family members,
bioinformatics tools were used.
The main aims of this project are:
1. To analyse the role of ZnT family members in inherited disorder of premature
babies with zinc deficiency causing impaired zinc secretion into milk.
56
2. To investigate the dependency between hZnT5 and hZnT6 in M17
neuronal cells.
3. To establish the effect of the lipid, DHA, on zinc transporter expression in
M17 cells.
4. To characterize in-silico associations between different members of the
ZnT family.
CHAPTER 2
Materials and Methods
58
2.1 Case history summaries
Infant number I was born premature at 36 weeks and was breast-fed for
three months, without fortified milk. A red necrolytic rash developed at two
months of age (Figure 3.1a, b). Zinc deficiency was confirmed at three
months post-partum by tests showing zinc blood levels of 4.5 μmoles/l; 0.29
μg/ml (reference range 10.3–18.1 μmoles/l; 0.67-1.18 μg/ml). Breast milk zinc
from the mother of infant I (Mother 1) was 0.29 μg/ml, which was less than
one quarter that of the normal zinc level (1.35 μg/ml) at the corresponding
stage of lactation. Treatment with zinc (50 mg/day) to infant resulted in a
dramatic improvement in the rash within three days. Infant number II was
born premature at 37 weeks gestation and developed dermatitis affecting the
face and perioral skin, with scalp scale and similar symptoms as that of infant
number I. The maternal milk zinc level (Mother 2) at seven months was 0.2
μg/ml, which was considerably less than the normal zinc level (0.85 μg/ml).
On commencing treatment with zinc (50 mg/day), the rash cleared in three
days and hair started to grow fully (Michalczyk et al. 2003). It is interesting
that both mothers who produced zinc-deficient milk had no clinical symptoms
of zinc deficiency themselves.
2.2 Sample collection and cell culture
Ethical approval for the collection of blood and skin biopsies was obtained
from Deakin University Melbourne, Australia (EC32-2000) and the Royal
Children’s Hospital Parkville, Australia (ERC 2025B). Fibroblast and
lymphoblast cell lines from patients (Mother 1 and Mother 2) and respective
59
controls (two lymphoblast and two fibroblasts) from healthy mothers were
established as previously described (Michalczyk et al. 2003). Immortalised
fibroblasts from zinc deficient disorder mothers and two separate controls
from healthy people were cultured in BME supplemented with 10% FBS
(Bovogen; Melbourne, Australia). Lymphoblasts were grown as suspended
cultures in RPMI 1640 culture media (Thermo Fisher Scientific; Melbourne,
Australia) supplemented with 20% FBS. Normal resting breast tissue was
obtained from breast biopsies performed for diagnosis of breast disease. The
tissue was immediately frozen at -80ºC until use. The human epithelial breast
cell line PMC42-LA, a variant of PMC42 cell line, originally derived from a
pleural effusion (Whitehead et al., 1983), was cultured in RPMI 1640
supplemented with 10% FBS (Bovogen; Melbourne, Australia) at 37ºC in 5%
CO2. PMC42-LA and fibroblasts were passaged when confluent using 0.05%
trypsin-EDTA solution in PBS (Sigma-Aldrich; Sydney, Australia).
Lymphoblasts were pelleted when the culture reached high density by
centrifugation and distributed to new flasks.
Two different neuoblastoma cell lines M17 and SY5Y were cultured in
Nunclon 75 cm2 culture flasks in OPTI-MEM (Thermo Fisher Scientific;
Melbourne, Australia) and RPMI respectively supplemented with 10% FBS.
Cells were grown to confluency in 75 cm2 culture flasks before subculturing
into new flasks for experiments. After four to five days when cells reached up
to 70% confluency, five out of ten flasks were treated with different
concentrations of DHA (Sigma-Aldrich; MO, USA) (0, 5, 10, 15, 20 μg/ml) for
48 hours. Another five flasks received additional treatment of 5 μM of ZnCl2
along with different concentrations of DHA (0, 5, 10, 15, 20 μg/ml) for 48
60
hours. Cell culture media with specific amount of DHA and Zn were
incubated overnight in warm room at 37ºC on a medium speed shaker before
used for cell treatments. 0μg/ml DHA and 5 μM of ZnCl2 was considered as
control sample. To check the effect of vitamin E (Sigma-Aldrich, Sydney,
Australia) on DHA, cells were treated with and without vitamin E (0 μg/ml and
20 μg/ml) and DHA (0 μg/ml and 20 μg/ml). The cells were passaged when
confluent using 0.025% trypsin-EDTA solution in phosphate buffered saline
(PBS) (Sigma-Aldrich, Sydney, Australia). Cells were pelleted by
centrifugation, rinsed three times with PBS and immediately frozen at -80 C
for further analysis.
To induce cellular differentiation, M17 cells were grown on porous Transwell
filters (BD Falcon; Sydney, Australia) coated with thin layer of diluted (1in 5
dilution) extracellular matrix gel from Engelbreth Holm-Swarm mouse
sarcoma (Sigma-Aldrich; Sydney, Australia) (EHS matrix). Cells were treated
with 1μg/ml of Retinoic acid (RA) Sigma-Aldrich, Sydney, Australia) for 14
days. Media was changed every second day with fresh RA. Cells were
treated with 1 μM of mitotic inhibitor (5-fluoro-2’-deoxyuridine, 1-β-D-ribo
furano syluracil) (Sigma-Aldrich; Sydney, Australia) for four days.
Differentiated M17 cells were treated with different concentrations of Zn and
DHA as explained above for 48 hours. Cultures were viewed with an
Olympus CK2 inverted phase-contrast microscope.
Cells were grown in 75 cm2 culture flasks (Nunc; NY, USA) and collected for
western blot, Quantitative Real Time PCR, DNA sequence analysis, alkaline
61
phosphatase assay and methylation studies from all different cell lines
mentioned above.
2.3 Plasmid preparation and cell transfection
A previously developed hZnT5 and hZnT6 overexpressing cDNA in pA-puro
vector (Suzuki T et al., 2005a) were used to transfect M17 neuroblastoma
cells using polyethylenimine solution (Shin et al., 2005). Sequence identity
was confirmed with sequencing of the inserts using specific primers for puro
vector (Table 2.1). Specifically, 20 μg of plasmid DNA was diluted in 150 mM
NaCl to a concentration of 10 μg/ml. Polyethylenimine (Lecocq et al., 2000)
pH 5.0 was added to DNA/NaCl solution to a final concentration of 0.813
mg/ml. The mixture was vortexed for 10sec and incubated for 30 minutes at
room temperature. The mixture was diluted in 15ml RPMI with 10% FBS and
added to a 75cm2 culture flask containing 75% confluent M17 cells for
overnight. Transfected cells were selected using 2.5 μg/ml puromycin
(Invitrogen Life Technologies, Melbourne, Australia) in OPTI-MEM 10% FBS
medium over four weeks. Fresh medium with antibiotics was added every
three days.
2.4 siRNA Construction and Transfection
A pSilencer TM 4.1-CMV hygro Kit (Ambion, Australia) was used to create
hZnT5, hZnT6 and control siRNAs (short interfering RNA) according to the
manufacturer protocol. The sequence identity of the siRNA inserted region
for hZnT5 and hZnT6 knocked-down constructs were confirmed by sequence
analysis using CMV-4.1(F) and CMV-4.1(R) primers (Table 2.1). Three
62
different siRNA constructs were prepared for knock downs of ZnT5 and ZnT6
genes. The sequences of oligonucleotides are shown in Table 2.1.
After comparing the efficacy of each knocked-out construct, the best one was
chosen to continue the experiments.M17 cells were grown to 70% confluency
in OPTI-MEM 10% FBS medium. 20 μg of plasmid DNA containing siRNA for
ZnT5, ZnT6 and control were gently mixed with 3.75 ml of serum free OPTI-
MEM media and 6 μl of Reagent Plus (Lipofectamin transfection kit,
Invitrogen Life Technologies, Melbourne, Australia). After 5 mins of
incubation 15 μl of lipofectamin was added to the solution followed by a
gentle mix and incubation at room temperature for 30 minutes. The mixture
was added to 15 ml OPTI-MEM 10% FBS medium and transferred to a
75cm2 culture flask containing 70% confluent M17 cells. After overnight
incubation at 37ºC, cells were washed with normal media. Transfected cells
were selected using 400 μg/ml hygromycin B (Roche; Roche Diagnostics,
Germany) in OPTI-MEM 10% FBS medium over eight weeks. Fresh medium
with antibiotics was added every three days.
Cells with ZnT6 knocked down showed a great reduction in mRNA using all
three different siRNA but for ZnT5 transfections the best results were gained
by using one siRNA with forward and reverse sequence (ZnT5 S-3(F); ZnT5
S-3(R) (Table 2.1). The maximum number of passages for cells to retain the
disruption was three to four. Once siRNA was stably transfected and
checked by quantitative real-time PCR (qRT-PCR) and western blot analysis,
double knockdowns with two genes disrupted (ZnT5 + ZnT6 together) was
attempted.
Table 2.1 Primer Table for overexpression and knock-down constructs
63
Forward primer (5’-3’) Reverse primer (5’-3’)
ZnT5 S-1(F)
GATCCGAATAGTACAGCAGGTTACTTCAAGA
GAGTAACCTGCTGTACTATTCTTA
ZnT5 S-1(R)
AGCTTAAGAATAGTACAGCAGGTTACTCTCTT
GAAGTAACCTGCTGTACTATTCG
ZnT5 S-2(F)
GATCCGGATTAATATCATACCGAGTTCAAGA
GACTCGGTATGATATTAATCCTTA
ZnT5 S-2(R)
AGCTTAAGGATTAATATCATACCGAGTCTCTT
GAACTCGGTATGATATTAATCCG
ZnT5 S-3(F)
GATCCCACGTCCTGTCTGGAGGAGTTCAAGA
GACTCCTCCAGACAGGACGTGTTA
ZnT5 S-3(R)
AGCTTAACACGTCCTGTCTGGAGGAGTCTCT
TGAACTCCTCCAGACAGGACGTGG
ZnT6 S-1(F)
GATCCGGCTTTAAATAGGCTTCCTTTCAAGA
GAAGGAAGCCTATTTAAAGCCTTA
ZnT6 S-1(R)
AGCTTAAGGCTTTAAATAGGCTTCCTTCTCTT
GAAAGGAAGCCTATTTAAAGCCG
ZnT6 S-2(F)
GATCCGACCATGATAGACTCTAACTTCAAGA
GAGTTAGAGTCTATCATGGTCTTA
ZnT6 S-2(R)
AGCTTAAGACCATGATAGACTCTAACTCTCTT
GAAGTTAGAGTCTATCATGGTCG
ZnT6 S-3(F)
GATCCCTCCAGCTAAACCTAGTAGTTCAAGA
GACTACTAGGTTTAGCTGGAGTTA
ZnT6 S-3(R)
AGCTTAACTCCAGCTAAACCTAGTAGTCTCTT
GAACTACTAGGTTTAGCTGGAGG
CMV-4.1 (CMV-4.1 vector) (F)
AGGCGATTAAGTTGGGTA
CMV-4.1 (CMV-4.1 vector) (R)
CGGTAGGCGTGTACGGTG
Actin (pA-puro vector) (F)
GCAGCCAATCAGAGCGG
SV40pA (pA-puro vector) (R)
GAAATTTGTGATGCTATTGC
F primer (pA-puro vector)
TCGGCTTCTGGCGTGTGACCGGCGGCTCTA
R primer (pA-puro vector)
TTTCCACACCCTAACTGACACACATTCCAC
64
To attain double knock-downs, single gene disrupted (ZnT5 or ZnT6) M17
cells were tried to transfect with another siRNA, using the same method.
2.5 Quantitative Real Time PCR (qRT-PCR)
Patient and two different control fibroblasts from healthy mothers, PMC42-LA
grown in 75 cm2 culture flasks were collected by trypsinisation (0.05%) and
washed three times in PBS. M17 and SY5Y cells with different treatments
(cell culture section 2.2) were collected by 0.025% trypsinisation followed by
PBS washes. Retinoic acid induced differentiated M17 cells on transwell
filters were harvested for mRNA analysis by treating with 1 ml of 5 mg/ml
dispase (Gibco; Melbourne, Australia) dissolved in PBS for half an hour and
collected. Cells overexpressing ZnT5 and ZnT6 and cells with knockdown
siRNA ZnT5 and ZnT6 constructs were collected by trypsinisation (0.025%)
and PBS washes. Control and patient lymphoblasts were collected by
centrifugation.
Total RNA was extracted from cells using a QIAGEN RNeasy Mini kit
(QIAGEN; Melbourne, Australia), following manufacturer’s instructions.
Extracted RNA was purified by using DNase 1 treatment following the
manufacturer’s protocol of the DNA free kit (Ambion; Melbourne, Australia).
The purified RNA concentrations were estimated on a nanospec (Nanodrop
1000, Thermo Scientific) at wavelengths of 260/280 nm. Once quantified,
RNA was converted to cDNA using the High Capacity cDNA Reverse
Transcription Kit (Applied Biosystems; Melbourne, Australia) following the
manufactures protocol. Amplification reactions were performed with 20 μl
sample volumes containing 8 μl SYBR Green Master Mix (Applied
65
Biosystem; Melbourne, Australia), 0.3 μM of forward and reverse primers
(Table 2.2) and 20 ng cDNA (RNA content prior to RT step).
The PCR reaction was performed at 50ºC 2 min, 95ºC 10 min (1 cycle), 95ºC
15 sec, 60ºC 1 min (40 cycles). Samples were analysed in triplicate using
7500 Real Time PCR System (Applied Biosystems; Melbourne, Australia).
An internal control of -actin (Table 2.2) was used to normalise.
RNA quantities and efficiency of reverse transcription. Fluorescence
produced by incorporation of SYBR green dye into double stranded DNA was
recorded after the elongation phase of each repetitive cycle. The specificity
of each reaction was determined by analysis of the melting point dissociation
curve generated at the end of each PCR. The threshold cycle value (CT),
defined as the cycle number when fluorescence levels exceed the threshold
value was calculated after each reaction. The CT value of -actin was
subtracted from the transporter CT value to produce CT for each sample.
The relative RNA expression level of each sample was calculated using the
equation 2-ΔΔCT, where CT is the difference between the control CT and
the sample CT.
Amplification was performed for hZnT1, hZnT2, hZnT3, hZnT4, hZnT5,
hZnT6, hZnT7, hZnT8, hZnT9, hZnT10 for lymphoblast and fibroblast from
patient and control cells. Breast tissue from resting breast was analysed
using hZnT5 and hZnT6 primers. M17 and SY5Y neuronal cells with different
treatments of DHA and Zn, vitamin E, differentiated cells as explained in
(materials and method section cell culture 2.2).
Table 2.2 Real-Time PCR Primers
Primers to ZnT1were designed to GenBank sequence Accession No AF323590
Primers to ZnT2 were designed to GenBank sequence Accession No NM_032513
Primers to ZnT3 were designed to GenBank sequence Accession No U76010
Primers to ZnT4 were designed to GenBank sequence Accession No AF025409
Primers to ZnT5 were designed to GenBank sequence Accession No AF461760
Primers to ZnT6 were designed to GenBank sequence Accession No XM_059432
Primers to ZnT7 were designed to GenBank sequence Accession No AY094606
Primers to ZnT8 were designed to GenBank sequence Accession No NM_173851
Primers to ZnT9 were designed to GenBank sequence Accession No NM_006345
Primers to ZnT10 were designed to GenBank sequence Accession No NM_018713
Primers to -actin were designed to GenBank sequence Accession No E00829
Primers to GAPDH were designed to GenBank sequence Accession No NM_002046
66
Forward Primer
Reverse Primer
PCR product length in
(bp)
ZnT1-RealF1 CTGGTGAACGCCATCTTCCT
ZnT1-RealR1 CAATCTCGTGCGGCTCGAT
183
ZnT2-RealF2 TGTGATCCTGGTGTTGATGGA
ZnT2-RealR2 CAGGCTGTGCAGGGCTTCT
103
ZnT3-RealF1 CACCCTCCGAGACGTTCTTC
ZnT3-RealR1 GGCACCGACAACAGCGTAT
90
ZnT4-RealF2 AACCAGTCTGGTCACCGTCA
ZnT4-RealR2 CTATCCTGCCCATGGTTACG
93
ZnT5-RealF1 CCAGCGCTCGATTAACAAAATA
ZnT5-RealR1 TGTGAACAGCTTTTAGGAGATCA
134
ZnT6-RealF2 TCCTTTTTTGGCAAGTTGTTACG
ZnT6-RealR2 AAGCAGGAAGCCAGTACATATCAAG
111
ZnT7-RealF1 TTGCCCCTGTCCATCAAAG
ZnT7-RealF2 AGACCTAAACCAGCCCGAGATC
81
ZnT8-RealF1 GTGGCGGCCAACATTGTACTA
ZnT8RealF2 CACAAAAGCAGCTCTGACGCT
102
ZnT9-RealF1 ACACCAGATCCTTCTCATCCGT
ZnT9-RealF2 CAAGATAGTCCTGCACCCATCA
101
ZnT10-RealF1 CTTCCCGCTTATCAAGGAGACC
ZnT10-RealF2 GCTAATTCCAGGCACAGCAGAG
106
AC-RealF GACAGGATGCAGAACGAGAT
AC-RealR TGATCCACATCTGCTGGAAGGT
138
GAPDH-RealF CCACCCATGGCAAATTCC
GAPDH-RealR TGGGATTTCCATTGATGACAA
70
67
Overexpression and knocked-down constructs of ZnT5 and ZnT6 were
analysed using hZnT5, hZnT6 primers (Table 2.2).
2.6 PCR and sequencing for coding & promoter regions
DNA was isolated from patient and control fibroblasts and lymphoblast cells
using the Wizard® Genomic DNA Purification Kit (Promega) following the
manufacturer’s instructions. DNA concentrations were checked on a
nanospec (Nanodrop 1000, Thermo Scientific) at wavelengths of 260/280
nm. The promoter regions of hZnT5 and hZnT6 genes (4000bp upstream
from the start codon) were amplified using different primer sets (Table 2.3)
from patient and control lymphoblast and fibroblast cells. hZnT2 intron-exon
structure analysis was also performed using different set of primers
(Table2.3).
The coding regions of hZnT5, hZnT6 and hZnT2 were amplified by RT-PCR
(Reverse transcriptase) for patient and control lymphoblast and fibroblast
cells using cDNA. 5' and 3' untranslated regions (UTR) were analysed to find
any changes between patient and control samples for hZnT5 and hZnT6
genes (Table 2.4). Similarly hZnT2, hZnT5, hZnT6 open reading frames
(ORF) were analysed by RT-PCR using cDNA from M17 cells with different
Zn and DHA treatments (refer section cell culture 2.2).
PCR amplification was performed using 55 pmol of forward and reverse
primers. These were added to the PCR mixture consisting of 200 ng of
DNA/200 ng of cDNA, 200 μM of each dNTP, PCR buffer, 1.5 mM MgCl2 and
1U Taq DNA polymerase (Sigma-Aldrich, Melbourne, Australia).
Table 2.3 Primers used for Genomic DNA PCR
Primers to ZnT2 were designed to GenBank sequence Accession No NM_032513
Primers to ZnT5 were designed to GenBank sequence Accession No AF461760
Primers to ZnT6 were designed to GenBank sequence Accession No XM_059432
68
Forward Primer Reverse Primer PCR product length in (bp)
ZnT5-P1F TCAGGCTCCTCTCATTCTCC
ZnT5-P1R TGTTTCTTACAGCCCCGAAC
1105
ZnT5-P2F GGCAAGTCCATAAAGTGAAAGC
ZnT5-P2R CTGAGGAGGAGAATGGCTTG
1166
ZnT5-P3F CAAGCCATTCTCCTCCTCAG
ZnT5-P3R GACCAAAATTTGCCTCCTCA
994
ZnT5-P4F GAGACAGGGTTTTGCCATGT
ZnT5-P4R CAAGCAGAACACTCGCCTTT
931
ZnT5-P5F TGGGAATACAGCCCAGTAGG
ZnT5-P5R GACCAGCTTAATGCCAGAGC
443
ZnT5-P6F CCATACTGCCCAGACCCTTA
ZnT5-P6R ATGGCGAAACCCTGTCTCTA
787
ZnT5-P7F AGCCACAAAAGCAGTCACCT
ZnT5-P7R AAAATTTGCCTCCTCAGCAA
434
ZnT5-P9F TCCCCAAATTTCCCAGAGTA
ZnT5-P9R GTGGGGAGCTTACAAAATGG
670
ZnT5-P10F CCATACTGCCCAGACCCTTA
ZnT5-P10R GAGACCAGCCTGACCAACAT
805
ZnT5-P11F CCATCTGGACCCATCAGTCT
ZnT5-P11R CCTGGCCCTGAATTCTTTCT
718
ZnT5-P13F TGACCACAAGGCAGACAAAG
ZnT5-P13R AAGAATTCGAGGCAAGTCCA
1123
ZnT6-P1F AAGGGTGTCAGCAGAGATGG
ZnT6-P1R GGGACTGTCATGATGGGATT
882
ZnT6-P2F CACCTTCTCACCGTGTCCTT
ZnT6-P2R AGGCAGGAGAATTGCTTGAA
1185
ZnT6-P3F TCTCACCCAGGCTTCATCTC
ZnT6-P3R TGTAGCACGTGTGTTTGTCAGA
1263
ZnT6-P4F TTAAGCATTTGGGATGAAGGA
ZnT6-P4R GTGCTCGAGTTTTCCCAGAA
984
ZnT6-P5F GGAGGCCAAGGCAGGTAG
ZnT6-P5R GAATTGCTTGAACCCAGGAG
606
ZnT6-P6F TTTCTTCCTGGCTTGCAGAT
ZnT6-P6R GGTTTCACCATGTTGTGCAG
662
ZnT6-P7F ZnT6-P7R 255
69
TGGGCAGCTTAAATAACAGAAA GTGATTCAGCCTTTGGGAAG
ZnT6-P8F TCAGCAACCCTAATCCAACC
ZnT6-P8R TGTAGCACGTGTGTTTGTCA
434
ZnT6-P10F GGAGGCCAAGGCAGGTAG
ZnT6-P10R ATGGCAAAACCCCGTCTC
700
ZnT6-P11F ACCCATCAGAAGAAATAAACCA
ZnT6-P11R ATTTGAGGCCAGGCACAGT
958
ZnT2IE-1F CGTCCTCACTCAGCAACACC
ZnT2IE-1R TCTTCGTTCCCTCACCTCAC
657
ZnT2IE-2F AGGACTCCCATTCCCCTATC
ZnT2IE-2R AGGAGAATAACGTCACCCATGT
583
ZnT2IE-3F ATATTGGTGGCCCATTTCAC
ZnT2IE-3R ACAGAGGCCATGGTTGACAT
503
ZnT2IE-4F ATATGAGGGGTGGGGTAAGG
ZnT2IE-4R ACAGCTCCCAGTGTTCTTGG
527
ZnT2IE-5F GCCCTATCTCTCATGGCTGT
ZnT2IE-5R CCACCTACCCTTCAGGTTGT
533
ZnT2IE-6F TTCTGAACTGTGGTCTGTCCTT
ZnT2IE-6R GAACTGCCACACCTGAAAGC
501
ZnT2IE-7F TCAGTGTTAAGAGTGGAGAGGAA
ZnT2IE-7R AACCCCAGCCTCAGTTTCTT
530
ZnT2IE-8F TACCTGGCAGAGGAATGGAA
ZnT2IE-8R GAAAGGGAACATTTGGCTCA
848
ZnT2IE-9F TATGAATCTGAGCCCCTCCA
ZnT2IE-9R CAAGTGACCAAACCCACCTC
912
Table 2.4 Primers used for RT-(Reverse transcriptase) PCR
Primers to ZnT2 were designed to GenBank sequence Accession No NM_032513
Primers to ZnT5 were designed to GenBank sequence Accession No AF461760
Primers to ZnT6 were designed to GenBank sequence Accession No XM_059432
70
Forward Primer
Reverse Primer
PCR product length in
(bp) ZnT5-A GCAGCGGCGAGACATGAGGAG
ZnT5-B CACTACCACTCCTCCAGACAG
1113
ZnT5-C
TCTCTCATTATGCCTTTTGC ZnT5-D
GCATCTTTAATCAGTGGAACA 1127
ZnT5-E CAGCATTGGTGTGATCGTATC
ZnT5-F AAGATTCCTTGATCCAGTAGT
629
ZnT6-A AGAACGGCTTCCGGCGGG
ZnT6-B GAGGCATTGGGATTACGTGA
1124
ZnT6-C AAGTCTTACTCCAGACAACA
ZnT6-D AATGTGAACAAGACTACTAT
759
ZnT6-C1F TTGACTCCTTGGCTTCCAAT
ZnT6-C1R AAAGGAGAGAAACTTTAACAAAAATC
974
ZnT2-C1F AGACACGGGAGCGCTTG
ZnT2-C1R ATGATGTTCACAGCCACAGC
788
ZnT2-C2F GTGACGGGGGTACTGGTGTA
ZnT2-C2R TGCCTGACAGTCCTTCATGT
639
ZnT2-C3F TCGCCATTGCTCAGAATACA
ZnT2-C3R GGGAGGCTCAAATGAGAGTG
630
ZnT2-C4F GGACCCTCACACTCTCATTTG
ZnT2-C4R GCCAACTGGCTCTTGTTCTC
686
ZnT2-C5F ACTGGTGTACCTGGCTGTGG
ZnT2-C5R CCGAGTAGTCCTCGATCTGG
605
71
The following PCR amplification conditions were applied: one cycle at 94 °C
for 3 min, 35 cycles at 94 °C for 45 s, annealing temperature for 30 s, 72 °C
for 60 s, with final extension at 72 °C for 10 min. PCR products were run on
1.5% Agarose (Amresco; Ohio, USA) gels and bands were excised, purified
and sent for sequencing to Monash Sequencing Centre, Melbourne. Results
were aligned to the original sequence using Sequencer 4.2 software to
identify any modifications.
2.7 Transcription Factor Binding Site Analysis
Genomic sequences were entered into MatInspector (Genomatix Software -
http://www.genomatix.de/en/index.html) to determine transcription factor
binding sites in the regions of interest. The resultant data was exported to
excel. Transcription binding motifs relevant to lactation (STAT-5), metal
homeostasis (MRE) Metal Responsive Element and other hormonal
influenced transcription binding factors (ERE) Estrogen Responsive element,
(PRE) Progesterone Responsive Element and (RXR) Retinoic X Receptor
were identified manually by scanning the conserved binding motif sequences
through the promoter region upto 4000bp upstream of start codon for all
members of ZnT family.
2.8 Western Blots
Lymphoblasts and fibroblasts from patient and control cells, PMC42-LA cells
and resting breast tissue were collected were analysed for protein
expression. M17 cells treated with different Zn and DHA concentrations, cells
72
overexpressing ZnT5 and ZnT6 and with knockdowns containing siRNA
ZnT5 and ZnT6 constructs were also collected for protein analysis.
Cell pellets were resuspended in lysis buffer (1% w/v sodium dodecyl
sulphate (Sigma-Aldrich; Sydney, Australia), 10 mM Tris-hydrochloric acid,
pH of 6.8, containing one Mini EDTA-free protease inhibitor cocktail tablet
(Roche Applied Science) per 10 ml. Cells were disrupted by passing through
a 25-gauge needle 8-10 times and sonicated (40% power output, 30% duty
cycle) on ice, three times for 15 sec with 30 sec break between each
sonication, by using a Microsone Ultrasonic cell disrupter (Misonix
Incorporated, NY, USA). Samples were then stored at -80ºC until needed for
analysis.
Quantification of protein concentration in cell lysates were performed using
BCA protein assay kit (Pierce; Melbourne, Australia), following the
manufacturer’s instructions. Protein samples were prepared with 6x loading
dye (10% glycerol, 20% SDS, 1.5 M Tris-HCl pH 6.8, 1.8 M bromophenol
blue, dH2O, 10% merceptophenol). Page RulerTM Prestained Protein ladder
(Fermentas) was used as a protein molecular weight marker. Sixty
micrograms of each extract was fractionated by 10% SDS-PAGE using Bio-
Rad Mini Protein Gel system for 1.5 hours at 125 V according to
manufacturer’s instructions. Proteins were transferred to nitrocellulose
membranes (Whatman; Dassal, Germany) at 10 V for 90 minutes using a
Trans-Blot Transfer Cell (Bio-Rad) in 25 mM Tris, 200 mM glycine pH 8.3
and 20% methanol.
73
Membranes were then stained with 0.1% Ponceau S (Sigma-Aldrich;
Sydney, Australia). Ponceau S stain was removed with 0.1% NaOH (Sigma-
Aldrich; Sydney, Australia). Membrane was blocked for one hour with 1 %
casein in TBS (0.05 M Tris and 0.15 M NaCl). Blots were incubated overnight
at 4oC with monoclonal antibodies for ZnT5 (Kambe et al.; 2002 JBC
277:19049) diluted at 1:500 and ZnT6 (Abnova mouse monoclonal
#H00055676-M01) diluted at 1:250 in 1% casein (Sigma-Aldrich; Sydney,
Australia). After washes with TBS proteins were detected using 1:4000
dilution of HRP (horseradish peroxidase) conjugated sheep anti-mouse
antibody (Millipore; Melbourne, Australia) for 1.5 hours at room temperature.
After removal of excess secondary antibody, membranes were rinsed twice
in TBS for 10 min and then twice more in TBS with 0.1% tween 20 (Sigma-
Aldrich; Sydney, Australia). Proteins were detected by enhanced
chemiluminescence (Immobilon Western Chemiluminescent HRP Substrate;
Millipore; Melbourne, Australia) according to manufacturer’s instructions.
Images were captured using LAS-3000 FujiFilm Lumino-Image Analyzer (Fuji
Photo Film; Tokyo, Japan). Blots were stripped for 5-10 min using Reblot
Plus Strong (Millipore; Melbourne, Australia) solution and then reprobed with
β-actin monoclonal antibody diluted 1/5000 followed by goat anti-mouse
secondary antibody to determine the protein loading for lysates.
Densitometry to quantify results was performed using Fuji Film Multi Gauge
V3.0 computer software, and ratios for protein levels were calculated relative
to β-actin. β-actin and Ponceau S stains were used as controls.
74
2.9 Immunofluorescence
Fibroblasts from patients and controls and PMC42-LA cells were grown on
10mm diameter glass cover slips. Breast tissue (BT) blocks (1cm3) were
immersed in OCT (Tissue Tek; Sydney, Australia) and frozen in liquid
nitrogen for 3 minutes followed by sectioning (8-10 μm thickness) on gelatin
(5%) coated slides using Leica CM1800 cryostat at between -17 and -20ºC.
M17 cells were grown overnight in tissue culture treated 8 well μ-slide Ibidi
chambers (DKSH; Melbourne, Australia) followed by 0, 10, 20 μg/ml DHA
with and without 5 μM of zinc for 48 hours. Stably transfected overexpressing
ZnT5 and ZnT6 and knockdown cells containing siRNA ZnT5 and ZnT6 and
respective controls having empty vectors were grown in tissue culture treated
(8 well μ-slide) Ibidi chambers.
When cells reached 50% confluency on coverslips, they were rinsed with
PBS (after 48 hours for M17 treated chambers), and fixed in 4%
paraformaldehyde (Sigma-Aldrich; Sydney, Australia) for 5 minutes, 10min
for BT. After 2 washes with PBS (Amresco; Ohio, USA), they were
permeabilized with 0.1% TX-100 (Sigma-Aldrich; Sydney, Australia) for 10
minutes (Breast Tissue (BT) 5% for 5 min) followed by blocking in 1% BSA
for 10 minutes (3% for 90 min). Cells were incubated overnight at 4oC with
primary antibody diluted in 1% BSA in PBS (ZnT5 1/100, ZnT6 1/75). After
three PBS washes, a secondary antibody Alexa Flour 488 anti-mouse
(Chemicon; Melbourne, Australia) diluted at 1:2000 was added and then
incubated for 2 hours at room temperature following three washes with PBS.
Coverslips were mounted on glass slides, a rectangle coverslip was mounted
75
on BT slides, using ProLong Gold antifade reagent (Invitrogen; Melbourne,
Australia). Confocal images were obtained using a Leica confocal
microscope system TCS SP2 (Leica; Melbourne, Australia).
Cultured M17 cells were grown on 10 mm diameter glass cover slips in 12
well plates. Cells were treated with 10 μM ZnCl2 for one hour followed by
three washing with PBS of 2 mins each. Half of the wells were again treated
with 15 μg/ml of DHA for additional one hour at 37oC followed by three 2
mins PBS washes. Cells grown on coverslips without additional ZnCl2 and
DHA were used as a control. Immediate after different treatments all cells
were incubated for 30 mins with 5 μM of Zinquin ((ethyl-[2-methyl-8-p-
toluenesulfonamido-6-quinolyloxy]acetate), generously supplied by Dr Peter
Zalewski, Department of Medicine, University of Adelaide, Adelaide,
Australia) at 37oC.
Another set of cells treated with zinc and DHA were checked for the recovery
of fluorescence where after DHA treatment, cells were washed with PBS and
placed with fresh media for different times (3, 6, 9, 24 hours). After 3 PBS
washes coverslips were mounted on a drop of Fluoroguard (BioRad, Sydney,
Australia). Epifluorescence was viewed with an Olympus BX50 microscope
with a PlanApo 60X 1.4 oil objective using UV light filter range 365 nm-
395nm.
2.10 Alkaline phosphatase assay
Fibroblast and lymphoblast from patients and controls, PMC42-LA, breast
tissue, DHA and Zn treated M17 cells, overexpressing ZnT5 and ZnT6 or
76
with knockdowns containing siRNA ZnT5 and ZnT6 and respective controls
were collected for TNAP (Tissue Non specific Alkaline Phosphatase) activity.
Collected pellets were lysed using ALP lysis buffer (10 mM Tris-HCL, pH 7.5,
0.5 mM MgCl2, 0.1% Triton-X 100). 20 μg of total cellular proteins were pre-
incubated in lysis buffer for 10 minutes at room temperature. A 100ul volume
of substrate solution (2 mg/ml p-nitrophenyl phosphate in 1M diethanolamine
buffer, ph 9.8, containing 0.5 mM MgCl2) (Sigma-Aldrich; Sydney, Australia)
was added. After 10 minutes incubation at room temperature, p-nitrophenol
released by TNAP, a soluble yellow substance, was measured at 405 nm
absorbance. Shrimp ALP (Roche Applied Sciences, Germany) was used as
a standard.
2.11 ZnT5 and ZnT6 Pyrosequencing Assay
Bisulfite Pyrosequencing for DNA methylation analysis
Bisulfite conversion of DNA was performed using EZ DNA Methylation
Gold™ kit (Zymo Research) following the manufacturers’ protocol. Briefly,
2μg of genomic DNA was incubated with CT conversion reagent and
incubated at the following temperatures; 98°C for 10 min, 64°C for 2.5hr and
held at 4°C. DNA was then transferred to a spin column, washed,
desulphonated, purified and finally eluted in a 10μl volume.
Quantitative Bisulfite Pyrosequencing was used to determine the percentage
methylation at individual CpG sites within the ZnT5 and ZnT6 promoter
regions (NT_022184.15; 11212499-11212863). Briefly, 0.2 μg of bisulfite
treated DNA was added as a template in PCR reaction using 12.5 μl Hot Star
77
Taq mastermix (Qiagen), total volume 25 μl. Primer sequences and PCR
conditions are shown in Table X Biotin-labelled PCR products were captured
with streptavidin sepharose beads (GE Healthcare), and made single
stranded using a Pyrosequencing Vacuum Prep Tool (Qiagen). Sequencing
primers were annealed to the single stranded PCR product by heating to
80°C, followed by slow cooling. Pyrosequencing was then carried out on a
Pyromark MD system. Cytosine methylation was quantified using proprietary
PyroQ CpG 1.0.6 software. All PCR and pyrosequencing reactions were
carried out in duplicate.
Assay validations were carried out to rule out any amplification bias of
primers for methylated DNA and to assess assay reproducibility using
methods described previously (White et al 2006). All primers were found to
be unbiased and data reproducible. Zero and 100% methylated controls
(Epitect control DNA, Qiagen, 59568) were routinely run alongside samples
as internal controls.
2.12 Physiological zinc uptake and efflux
M17 cells containing overexpression constructs or siRNA for ZnT5 and ZnT6
and control cells containing empty vectors were seeded with similar numbers
of cells in 12 well plates (Nunc). At around 95-100% cell confluency, cell
cultured media was replaced with 400 l fresh media containing 5 M ZnCl2
and 1 Ci/ml of 65Zn (Oak Ridge National Laboratory, Oak Ridge, TN). The
plates were treated for 0, 5, 10, 20, 40 and 60 minutes in triplicates for
uptake experiments. For each experiment the triplicates represent one time
78
point. Immediately 400 l of media was removed for the zero time point and
cells were then washed with 5 mM EDTA to remove any surface bound zinc.
Cells were collected in 600 l of PBS. Cells in PBS and EDTA wash were
retained and the counts per minute of 65Zn were obtained (Perkin-Elmer 1480
automatic gamma counter). Cells in PBS were lysed with 10% SDS and
homogenised using 21 gauge needle and the total protein amounts were
measured using Pierce BCA protein assay kit (Thermo scientific). This
collection protocol was repeated for 5, 10, 20, 40 and 60 minutes time points.
Picomoles of zinc per microgram of protein were calculated for both
adsorbed and internalized zinc.
For efflux experiments, cells at 85% confluency were incubated in 5 M
ZnCl2 and 1 Ci of 65Zn/ml for 24 hours. The 65Zn was removed and the cells
were incubated in 5 M ZnCl2 with no 65Zn for 0, 5, 10, 20, 40 and 60
minutes. Cells in PBS, media and EDTA wash were retained for radioactive
analysis followed by protein estimation as described above for the uptake
experiments.
M17 cells were grown in the absence or presence of DHA (20 μg/ml) for 18
hours in culture medium containing radiolabelled 65Zn (1 Ci of 65Zn/ml) and 5
M ZnCl2. The culture medium was replaced with medium containing 5 M
ZnCl2 with no 65Zn and cellular zinc efflux was measured over a period of one
hour including time points at 0, 2, 5, 10, 20 and 60 minutes. The specific
activity of the zinc was determined and zinc efflux was expressed as pmol
Zn/μg DNA.
79
2.13 Bioinformatic in-silico analysis
All members of SLC30 family (total 10 members) coding region (ORF) and
the 5’ and 3’ UTR’s sequences were collected from NCBI database with
specific Accession numbers listed in Table 2.2. For phylogenetic analysis, the
nucleotide sequences were aligned using Clustal-X (version 1.83) algorithm.
A phylogenetic tree was created using the bootstrapped Neighbour Joining
(N-J) algorithm of 100 replicates. Tree view program was used to visualise
the tree.
TMD (Transmembrane domains) were analysed by submitting amino acid
sequences to “TMHMM” and “TOPCONS” online database for predicting total
number of TMD’s. The presence of miRNA (micro RNA) was checked by
using “miRBase” online database. Identity and similarity matrix was generated
using MatGAT v2.0 (version 2). to find out similarity or exact identity between
different members of ZnT family.
To predict 3D structures, the sp3 structure prediction database was used,
where amino acid sequences were submitted to online database and
neighbours were generated for viewing as multiple structural alignment or 3D
superimposition in PDB file formats and viewed using Cn3D 4.3.1software for
structure analysis. The list of neighbours is sorted by Z-score (A measure of
the statistical significance of the result relative to an alignment of random
structures already reported in database). Match was considered significant if
ZSCORE value was greater than 6.3. Similarities with a Z-score lower than 2
were considered spurious (not considered genuine or true).
80
To analyse the promoter regions, sequences up to 4000bp upstream of the
translation site were collected for analysis. A similarity/Identity matrix was
used to find the homology between different members of SLC30 family for
coding and promoter regions. Important Transcription Binding Factors (TBF)
(described in section 2.7) were reported for all members and further analysed
for micro syntany analysis by arranging them in order of their occurrence
between all members.
2.14 Statistical Analysis
All experiments were repeated in triplicate, and values expressed as means ±
SD. Two tailed t-Test was used to determine statistical variation between
treatments/ patients and controls. p<0.05 was considered significant.
Data distributions were examined by the Kolmogorov-Smirnov test and all
data sets were normally distributed. Analysis of variance was used to
examine methylation in patients vs. controls and type of sample (lymphocyte
vs fibroblast), and the interaction between these fixed factors, at each
individual CpG, and across the mean of the investigated CpGs in a given
gene. A P value of <0.05 was considered statistically significant.
CHAPTER 3 Altered expression of zinc transporters SLC30A5 and
SLC30A6 (ZnT5 and 6) underlie a mammary gland disorder of reduced zinc
secretion into milk
82
3.1 INTRODUCTION
The most frequently occurring form of zinc deficiency is caused by nutritional
insufficiency. In rare cases, however, zinc deficiency is found in breast-fed
babies, who present with symptoms characteristic of nutritional zinc
deficiency, including dermatitis, diarrhoea, alopecia, loss of appetite,
impaired immune function and neuropsychiatric changes (Aggett et al., 1980;
Prasad, 1985). This form of zinc deficiency is a consequence of reduced
levels of zinc in the maternal milk and has been reported in pre-term babies
(27 to 33 weeks gestation) (Aggett et al., 1980; Zimmerman et al., 1982;
Weymouth et al., 1982; Connors et al., 1983; Parker et al., 1982; Heinen et
al., 1995) and less commonly in full term babies (Stevens and Lubitz, 1998;
Glover and Atherton, 1988; Khoshoo et al., 1992; Bye et al., 1985).
Pedigree analysis indicates that the condition is inherited (Sharma et al.,
1988). Zinc levels in the maternal milk of the zinc-deficient breast fed babies
were less than 40% that of normal milk at matched weeks of lactation
(Weymouth et al., 1982; Zimmerman et al., 1982). Maternal zinc deficiency
was not responsible for the low zinc levels in breast milk (Weymouth et al.
1982; Zimmerman et al., 1982).
Several reports have linked zinc deficiency caused by reduced zinc levels in
the milk to defects in SLC30A2 (ZnT2). In a family where two exclusively
breast-fed infants developed zinc deficiency associated with low milk zinc
concentration, a mis-sense mutation that substituted a conserved histidine, at
amino acid 54, with arginine (H54R) was reported (Chowanadisai et al.,
2006). In another two unrelated families, the production of zinc-deficient milk
83
was linked to a (G87R) mutation that resulted in a glycine to arginine
substitution at a different locus from the previous study (Lasry et al., 2012).
More recently, two novel missense mutations in the SLC30A2 (ZnT2) genes
were reported in a Japanese mother, who secreted zinc-deficient breast milk
where milk zinc levels were reduced by 90% of that of normal (Itsumura et
al., 2013).
An inherited disorder of mice with similar phenotype to the human condition
of reduced secretion of zinc into milk has been described (Piletz et al., 1978).
Newborn pups who were nursed on ‘lethal milk’, homozygous mutant dams
(lm/lm), developed dermatitis, alopecia and showed stunted growth, leading
to death within a week. In the mouse disorder, a defect in the secretion of
zinc from the mammary gland was demonstrated (Ackland and Mercer, 1992;
Lee et al., 1992). A nonsense mutation at arginine codon 297 in the ZnT4
zinc transporter, resulting in premature protein termination, was reported to
be responsible for the mouse disorder (Huang and Gitschier, 1997). A study
of the human orthologue (hZnT4) of the murine ZnT4 gene in two women
with zinc-deficient milk including sequence analysis of cDNA, real time RT-
PCR and Western blot analysis of cells showed no differences between
patient and control cells, which demonstrated that unlike the mouse disorder,
defects in hZnT4 were not responsible for the human disorder of reduced
secretion of zinc into milk (Michalczyk et al., 2003). In these patients it is
likely, therefore, that the maternal mammary gland defect in zinc secretion is
different from the “lethal milk” mouse model and that other candidate hZnT
transporters may underlie the mammary zinc transport defect.
84
The following clinical presentation of two cases of zinc deficiency has
previously been reported (Michalczyk et al., 2003). Infant 1 was born
premature at 36 weeks and was breast-fed for three months. A red,
necrolytic rash developed at two months of age (Figure 3.1a, b). Zinc
deficiency was confirmed at three months post-partum by tests showing zinc
blood levels of 4.5 μmoles/l; 0.29 μg/ml (reference range 10.3–18.1 μmoles/l;
0.67 -1.18 μg/ml). The level of breast milk zinc from the mother of Infant 1
(Mother 1) was 0.29 μg/ml, which was less than one quarter that of the
normal zinc level (1.35 μg/ml) at the corresponding stage of lactation.
Treatment of the infant with zinc (50 mg/day) resulted in a dramatic
improvement in the rash within three days. Infant 2 was born premature at 37
weeks gestation and developed dermatitis affecting the face and perioral
skin, with scalp scale and similar symptoms as that of Infant 1. The maternal
milk zinc level (Mother 1) at seven months was 0.2 μg/ml, which was
considerably less than the normal zinc level (0.85 μg/ml). On commencing
treatment with zinc (50 mg/day), the rash cleared in three days and hair
started to grow fully. It is interesting to note that both mothers who produced
zinc-deficient milk had no clinical symptoms of zinc deficiency themselves.
A study of the human orthologue (SLC30A4) of the murine Slc30a4 gene in
these two mothers with zinc-deficient milk, including sequence analysis of
cDNA, real time PCR and Western blot analysis, showed no differences
between patient and normal control cells (two lymphoblasts and two
fibroblasts from healthy mother), which concluded that unlike the mouse
disorder, defects in SLC30A4 were not responsible for the human disorder of
reduced secretion of zinc into milk (Michalczyk et al., 2003). In these patients
Figure 3.1 Photograph of patient (infant number 1) showing
dermatitis on feet
Zinc-deficient Infant 1 born at 37 weeks gestation, showing necrolytic rash at
extremities with blistering and desquamation (a) and (b).
85
86
it is likely, therefore, that the maternal mammary gland defect in zinc
secretion is different from the “lethal milk” mouse model and that other
candidate SLC30A transporters may underlie the mammary zinc transport
defect. In this study we sequenced ZnT2 to detect mutations associated with
two unrelated mothers who produced zinc-deficient milk and investigated
whether modifications in other ZnT transporters may underlie this mammary
gland disorder. Analysis of cells from mothers of zinc deficient babies
showed alterations in ZnT5 and ZnT6 mRNA and protein, and epigenetic
changes to ZnT5, relative to unaffected mothers.
87
3.2 RESULTS
3.2.1 mRNA expression levels of hZnT5 and hZnT6 are
reduced in Mothers 1 and 2
Expression levels of hZnT1, hZnT2, hZnT3, hZnT4, hZnT5, hZnT6, hZnT7,
hznT8, hZnT9, hZnT10 mRNA were measured in control (lymphoblasts and
fibroblasts from healthy mother), Mother 1 and Mother 2 cells using real-time
RT-PCR, to detect changes in gene expression at transcription level. The
control reactions lacking either primers and/or template cDNA were negative
for all analysed samples. The dissociation curve analysis of all PCR products
revealed the single peaks of expected Tm (data not shown), confirming the
specificity of all designed primers.
The transcript levels of both hZnT5 and hZnT6 were significantly lower in
lymphoblasts from Mother 1 (hZnT5=0.26+/-0.12; hZnT6=0.22+/-0.12)
compared to controls (hZnT5=1+/-0.11 and hZnT6=1+/-0.09) (p<0.05, t-test).
In Mother 2, while the transcript levels of hZnT5 were significantly lower in
lymphoblasts (hZnT5=0.35+/-0.08) compared to controls (hZnT5=1+/-0.22),
there was no significant decrease in hZnT6 (0.81+/-0.1) compared to healthy
controls (1+/-0.15) (p<0.05, t-test) (Figure 3.2a).
In fibroblasts from Mother 1, hZnT5 and hZnT6 transcript levels
(hZnT5=0.14+/-0.09; hZnT6=0.4+/-0.11) were lower than in the control
(hZnT5=1+/-0.12 and hZnT6=1+/-0.13) (Figure 3.2b).
Figure 3.2 Real-time RT-PCR analysis of hZnT mRNAs in cells
from Mother 1 or Mother 2 and corresponding
controls.
SYBR-Green real-time RT-PCR analysis of hZnTs mRNA was performed
using the cells from Mother 1 or Mother 2 and corresponding controls. (a)
Comparison of the hZnT1, hZnT3, hZnT7, hZnT9 and hZnT10 relative mRNA
expression levels between Mother 2 cultured fibroblasts and corresponding
controls revealed no significant differences (p 0.05, t-test). The significant
reduction (p<0.05, t-test) of hZnT5 and hZnT6 transcript levels was detected
in Mother 2 cells in comparison to control. (b) No differences were observed
in hZnT1, hZnT3, hZnT7, hZnT9 and hZnT10 mRNA in lymphoblasts from
Mother 1 and Mother 2 versus controls (p 0.05, t-test) however significant
down-regulation (p<0.05, t-test) of Mother 1 and Mother 2 cells were found
as compared to controls for hZnT5 and hZnT6 transcripts. (c) In human
resting breast tissue the hZnT5 and hZnT6 expression was detected. The
difference of 48-fold was observed between hZnT5 and hZnT6 transcript
levels (p<0.05, t-test). The bars represent the mean (±SD) of 3 independent
experiments. Stars indicate statistically significant differences (p<0.05, t-test).
88
89
Mean value of two different lymphoblasts and fibroblasts from healthy
mothers was taken/used to put error bars. No differences in the mRNA
expression levels of hZnT1, hZnT3, hZnT4, hZnT7, hZnT9, hZnT10 of
fibroblasts and lymphoblasts from Mother 1 and Mother 2 were found
relative to controls (p>0.05, t-test) (Figure 3.2a, 3.2b). hZnT2 and hZnT8
mRNA transcripts were not found in any patient nor in control cells.
As the mammary gland was the source of the zinc deficient milk, human
breast tissue was analysed for the presence of ZnT5 and ZnT6 transcripts.
ZnT6 transcripts were 48 times more abundant than ZnT5 transcripts in
normal mammary tissue (Figure 3.2c).
3.2.2 Sequencing of hZnT2
As this transporter has been linked with the zinc deficiency disorder, the ORF
of hZnT2 was sequenced in lymphoblasts and fibroblasts from control and
patient samples. No nucleotide differences were seen between control,
Mother 1 and Mother 2. Exon-Intron splice variants were also analysed using
nine different set of primers (Table-2.3 and 2.4) corresponding to alternative
splice sites for hZnT2 gene. No changes were observed for this transporter.
3.2.3 Sequence analysis of hZnT5 and hZnT6 cDNA from
patient cells and controls
As there was reduced expression of hZnT5 and hZnT6 mRNA in fibroblast
and lymphoblast cells from Mother 1 and Mother 2 compared to control cells,
90
sequence analysis of cDNA was carried out to detect changes in the coding
regions of these genes. In hZnT5 two single nucleotide modifications from
the Genbank sequence (AF461760) at position 1692 (C T) and 1800 (T
A) from the start codon were identified in some control and patient cells.
These modifications did not alter the amino acid sequence of hZnT5.
cDNA sequencing indicated no differences in the coding region of the hZnT6
gene between patients and corresponding controls (lymphoblasts and
fibroblasts from healthy mothers) and in all lymphoblasts tested (both
patients and controls). A full-length hZnT6 mRNA and a variant that was
missing 43 nucleotides starting from position 216 (Figure 3.3a) were found in
lymphoblasts. Similarly, in all fibroblasts (patients and controls) two versions
of hZnT6 ORF were detected, one full length and another with 49 nucleotides
missing from position 757 to 806 from start codon (Figure 3.3b).
Sequence analysis was also performed at 5’ and 3’ untranslated (UTR)
regions of hZnT5 and hZnT6 genes to find any changes present in the micro
RNA (miR) binding regions. miR-1303 for ZnT6 and miR-1273 for ZnT5
transporter were found at position +356 and +217 from start codon
respectively, but no differences were found between patient vs control
samples.
3.2.4 Analysis of exon-intron structure of hZnT6 gene
To investigate whether the different hZnT6 mRNA variants found in fibroblast
and lymphoblast cells were due to alternate splicing, analysis of exon-intron
structure of the gene was performed.
Figure 3.3.1 Analysis of fragments of hZnT6 cDNA from
lymphoblasts and fibroblasts from Mother 1,
Mother 2 and corresponding controls to
elucidate splice site variants.
Fragment of hZnT6 cDNA from lymphoblast and fibroblast showing a deletion
of 43 and 49 nucleotides (double dots) respectively in control, Mother 1and
Mother 2 along with full length cDNA. (a, b).
91
92
The genomic sequence of hZnT6 was obtained using BLASTn search of
human genome available from GenBank. The hZnT6 gene consists of 14
exons positioned on chromosomes 2p22.3.
The variant detected in lymphoblasts corresponds with absence of exon IV
and the variant detected in fibroblasts corresponds with absence of exon IV
(Figure 3.3c). Thus the variants detected appear to result from alternative
splicing of the hZnT6 transcript.
3.2.5 Promoter Analysis
To establish whether reduced levels of hZnT5 or hZnT6 were due to changes
in the promoter regions of these genes, sequence analysis was carried out
on the DNA up to 4000 base pairs upstream from the start codons of hZnT5
and hZnT6. These regions both contained the following transcriptional
regulatory elements: MRE (Metal Responsive Element), STAT-5 (binding site
for prolactin), TATA binding site, PRE (Progesterone Responsive Element),
and GRE (Gonadotrophin Responsive Element). In addition the region in
hZnT5 contained an Insulin Responsive Element (IRE). Point changes were
observed at position -1155 (T :), -1325 (G C) from the start codon and -
545 (A G), -1735 (C T) in control and Mother 1 fibroblasts for hZnT5 and
hZnT6 respectively (Figure 3.4b), but did not affect any of the above
transcription factor binding sites.
3.2.6 Western Blot analysis of hZnT5 and hZnT6
Western blot analysis was used to detect the expression of hZnT5 and
hZnT6 proteins in patient and control fibroblasts and lymphoblasts.
Figure 3.3.2 Diagram to illustrate the different exon-intron
structure of the hZnT6 gene.
In lymphoblasts the full length mRNA coexisted with the alternatively spliced
form (missing exon IV); In fibroblasts, an alternatively spliced form of hZnT6
which did not show exon IX was present, together with full length version of
mRNA. (c)
93
Figure 3.4 Diagramatic presentation of promoter region of
hZnT5 and hZnT6 genes
(a) Diagramtic representation of important transcription factor binding sites
present 4000 bp upstream of the translation start point. The location and
order of the indicated transcription binding factors is only approximate as
hZnT5 and hZnT6 have multiple binding sites for different transcription
factors. The number of binding sites present in each sequence is indicated by
the number in the coloured box in the diagram for each gene. Abbreviations
used in the diagram: PRE (Progesterone Response Element), ERE
(Estrogen Response Element), Stat-5 (binding site for prolectin), IRE (Insulin
Response Element), MRE (Metal Response Element). (b) Point changes
identified at different positions on hZnT5 and hZnT6 genes in affected
mothers and controls.
94
95
A significant reduction in hZnT5 and hZnT6 proteins was observed for
Mother 1 and Mother 2 lymphoblasts as compared to control lymphoblasts
(mean value taken from two sepeate lymphoblasts and fibroblasts cells).
No changes were observed in fibroblasts for hZnT6 protein expression but
there was a significant reduction between Mother 2 and control for hZnT5. In
lymphoblasts the major band detected with the ZnT5 antibody was of size 57
kDa with a less intense band seen at 55 kDa, while in fibroblasts a single
band of size 55 kDa was detected (Figure 3.5a). In lymphoblasts, no
differences in ZnT5 band sizes were seen between control extracts and
extracts from Mother 1 and Mother 2. Using the ZnT6 antibody, two bands of
size 55 kDa and 57 kDa with equal intensity were found in lymphoblasts and
one band of 55 kDa in fibroblasts. Similar band intensity was observed in
control and in Mother 1 and Mother 2 extracts (Figure 3.5b). Lysates of the
human breast carcinoma line PMC42 and human breast tissue were tested
for the presence of hZnT5 and hZnT6 proteins. The hZnT5 antibody detected
a weak band of size 57kDa in PMC42 cell extracts while a strong band of 55
kDa was seen in breast tissue (Figure 3.5a). The ZnT6 antibody showed
negligible amounts of hZnT6 in the PMC42 cells and a strong band at 55 kDa
in the breast tissue (Figure 3.5b).
3.2.7 Intracellular localization
Confocal microscopy of patient and control fibroblast cells to determine the
intracellular localisation of hZnT5 and hZnT6 proteins showed a granular
cytoplasmic distribution for both hZnT5 and hZnT6 that was similar in Mother
2 (Figure 3.6a, 6e) and control fibroblasts (Figure 3.6b, 6f) respectively.
Figure 3.5 Western blot analysis of proteins from two
mothers with zinc deficient infants.
Expression levels of hZnT5 and hZnT6 protein were analysed using
appropriate antibodies.
A band of the predicted size of 55 kDa was detected in all the fibroblasts and
a major band of 57 kDa band along with minor band at 55 kDa was present
for all the lymphoblasts for hZnT5. Both lymphoblasts and fibroblasts showed
significant decrease in patient cells as compared to controls (a).
A band was detected around 55 KDa for all fibroblast cells (patient and
control) for hZnT6 gene. Lymphoblast showed two bands of equal intensity at
55 and 57 kDa sizes. No significant differences were observed between
control and patient fibroblasts but patient lymphoblasts showed significant
decrease as compared to controls (b).
PMC-42 showed band at ~57 kDa and BT breast tissue at ~55 kDa using
both antibodies. An antibody to housekeeping human β-actin along with
Ponceau S was used to indicate the relative levels of protein loaded on the
gel from mothers 1 and 2 and corresponding controls Densitometry was
performed to compare the results.
96
Figure 3.6 Intracellular/Subcellular localization of hZnT5 and
hZnT6
Immunostaining of hZnT5 (upper row) and hZnT6 (lower row) in control
fibroblast (a, e), Mother 2fibroblast (b, f), PMC-42 (c, g) and human breast
tissue (d, h) E denotes luminal epithelial cells and L denotes lumen of the
duct. Control and Mother 2 fibroblast cells grown on cover slips were fixed by
4% paraformaldehyde and stained with hZnT5 and hZnT6 antibodies
respectively followed by secondary antibody conjugated with Alexa 488.
hZnT5 and hZnT6 localization was also tested in PMC-42 cells and human
breast tissue cryo-sections following the same procedure. Images shows
granular cytoplasmic and peri-nuclear localization of hZnT5 (a, b, c, d) and
hZnT6 (e, f, g, h) in control fibroblast, Mother 2 fibroblast, PMC-42 and
human breast tissue respectively. Scale bar = 10 μm.
97
98
Images of lymphoblasts suggested a similar distribution of hZnT5 and hZnT6
between patient and control cells, although this was difficult to ascertain due
to the small volume of cytoplasm in lymphoblasts (data not shown).
A similar localization pattern was observed for PMC42 (Figure 3.6c, 6g) cells
and breast tissue (Figure 3.6d, 6h) for hZnT5 and hZnT6 respectively.
3.2.8 Alkaline phosphatase activity
Significantly reduced alkaline phosphatase activity was found in patient
lymphoblasts (Mother 1 and Mother 2) relative to control lymphoblasts
(Figure 3.7). In fibroblasts, alkaline phosphatase levels were low and no
significant differences were detected between Mother 1, Mother 2 and
controls (two different fibroblasts from healthy mothers were analysed).
Alkaline phosphatase activity was also detected in PMC42 cells and breast
tissue and overall breast tissue showed maximum activity.
3.2.9 DNA methylation
3.2.9.1 hZnT5 methylation
In lymphoblasts, CpG site 2 was found to be significantly less methylated in
Mother 1 (4%) and Mother 2 (4%) compared with control samples (13%)
(Figure 3.8a). In contrast the reverse was seen in fibroblasts where Mother 2
methylation (52%) was greater than in the control sample (38%) (Figure
3.8b), Methylation levels at all four sites were significantly higher in
fibroblasts than lymphoblasts with the exception of CpG1 and CpG2 for the
controls (Figure 3.8b).
Figure 3.7 Alkaline phosphatase activity
Total alkaline phosphatase activity was detected at 405nm wave length using
p-nitrophenol as a substrate for patient and control lymphoblast’s,
fibroblast’s, PMC-42 and breast tissue. Activity was measured in U/μg of total
protein. Significant differences were found for patient and control
lymphoblasts. Mother 1 showed maximum decrease in activity followed by
Mother 2 as compared to control lymphoblasts. No differences were
measured between Mother 2 and control fibroblasts. Breast tissue showed
maximum ALP activity. The bars represent the mean (±SD) of 3 independent
experiments. Stars indicate statistically significant differences (p<0.05, t-test).
99
Figure 3.8 Bislphide pyrosequencing for DNA methylation of
hZnT5 and hZnT6 genes
(a) Lymphoblasts showed statistical significant hypomethylation in Mother 1 and
Mother 2 as compared to control at CpG site 2 for hZnT5 gene. All other sites CpG 1,
3, and 4 showed no changes between patient and control samples. The bars
represent the mean (±SD) of 3 independent experiments. Stars indicate statistically
significant differences (p<0.05, t-test).
(b) Fibroblasts showed statistical significant hypermethylation in Mother 2 fibroblast
as compared to control at CpG site 2 for hZnT5 gene. All other sites CpG 1, 3, and 4
showed no changes between patient and control samples. The bars represent the
mean (±SD) of 3 independent experiments. Stars indicate statistically significant
differences (p<0.05, t-test).
100
101
3.2.9.2 hZnT6 methylation
Methylation within the ZnT6 gene was below the detectable levels in extracts
from Mother 1, Mother 2 and control samples in lymphoblasts and fibroblasts.
102
3.3 Discussion
Low levels of zinc in the maternal milk combined with a response by the
infants to zinc therapy indicated a defect in the maternal breast affecting
secretion of zinc into milk. The observation that neither mother was suffering
from zinc deficiency suggested that specific defects to zinc exporters in the
mothers’ breast tissue were involved in this pathology. Zinc transporters are
involved with the activity of tissue non-specific alkaline phosphatase (TNAP)
(Suzuki et al., 2005a). Significant reduction in the alkaline phosphatase
(ALP) activity of Mother I and Mother II lymphoblasts was detected relative to
control lymphoblasts. In fibroblasts, ALP activity was very low, and this may
have accounted for the lack of differences detected between the affected
Mothers and the control. The reduced TNAP in lymphoblasts is consistent
with a reduced function of zinc export in the Mother I and Mother II cells
relative to controls.
Missense mutations in ZnT2 have been reported to underlie cases of
maternal defects of zinc secretion into milk (Chowanadisai et al., 2006; Lazry
et al., 2012; Itsumura et al., 2013). All reported studies on ZnT2 in premature
babies with zinc deficiency have been based on patient's DNA extracted from
mother's blood cells for the identification of novel mutations or modified
tissue cultures for the expression levels (Chowanadisai et al., 2006; Itsumura
et al., 2013). No studies have previously reported hZnT2 expression in
human lymphoblast or fibroblast cell lines. In the two cases reported in the
current study, no detectable ZnT2 mRNA was found in either lymphoblasts or
fibroblasts from the two mothers who produced zinc-deficient milk. To rule
103
out the possibility of ZnT2 being responsible for this disorder, sequence
analysis of the ORF and exon-intron splice variants was performed on patient
and control samples from the two different cell types, but no changes were
found. This confirmed that ZnT2 mutations were not responsible for the
production of zinc deficient milk in mothers of premature babies with zinc
deficiency. This raised the possibility that more than one molecular defect
could be responsible for this condition. Multiple members of the solute carrier
family 30 (SLC30 zinc transport) may participate in the export of zinc into
milk and there may be some redundancy amongst zinc transporters. This
possibility is supported by observations that in mothers with ZnT2 mutations,
some zinc was still present in the milk (Itsumura et al., 2013: Lasry et al.,
2012).
Analysis of transcript levels of all other identified members of the mammalian
ZnT/SLC30A family was performed. Significantly reduced levels of hZnT5
mRNA in fibroblasts and lymphoblasts from Mother 1 and Mother 2
compared to controls were observed. A reduction of hZnT6 transcripts was
found in lymphoblasts and fibroblasts from Mother 1 but not in Mother 2,
relative to control cells. Thus it is feasible that defects in hZnT5 and/or
possibly hZnT6 may underline the mammary defect of reduced zinc secretion
into milk as both mRNA and proteins of these transporters were present in
human mammary tissue obtained from the resting breast. Both ZnT5 and
ZnT6 are located in the early secretory pathway (Kambe et al., 2002,
Kirschek, 2003; Huang et al., 2002; Kambe et al., 2011) consistent with a
role in transport of zinc into intracellular vesicles that are destined for
secretion. ZnT5 mRNA is highly expressed in β-cells and the protein is
104
located in insulin-containing cells where it may participate in transport of zinc
into secretory granules (Kambe et al., 2002; Suzuki et al., 2005a). Thus in
mammary epithelial cells the ZnT5 transporter may have compatible role in
sequestration of zinc into vesicles destined for secretion from mammary
epithelial cells.
Sequence analysis of hZnT5 from Mother 1, Mother 2 and control
lymphoblast and fibroblasts indicated that some samples had two single
nucleotide modifications compared with the GenBank sequence (AF461760)
at positions 1692 and 1800 from the start codon. These were silent
mutations, thus excluding defects in the ORF of hZnT5 as a causal factor in
relation to defective secretion of zinc into milk or in explaining the reduced
mRNA levels.
In cells from Mother 1, Mother 2 and controls, we found alternative splice
variants of ZnT6. In lymphoblasts, in addition to the full-length transcript, a
variant that lacked exon IV was present. In fibroblasts, a variant that lacked
exon IX was detected in addition to the full-length transcript. Similar
transcripts were found in extracts from both mothers and controls, indicating
that the alternate splicing was not associated with the zinc deficient
phenotype. Splice variants of ZnT5 differing in the 5’ and 3’ regions have
previously been found in Caco-2 cells, where one form contained all 17
exons, while the other lacked exons 1, 2, 4 and exons 15-17, (Jackson et al.,
2007; Thornton et al., 2011). We did not detect splice variants in either
lymphoblasts or fibroblasts.
Protein analysis indicated the presence of two isoforms for both hZnT5 and
105
hZnT6. Bands of 55 kD and 57 KDa were found in lymphoblasts. A 55 kDa
band was the only band seen in fibroblasts. The 55 kDa protein was also the
single dominant band in the mammary gland. The band sizes detected in
both mothers and control were consistent with previously reported sizes of 55
and 57 and 60 KDa found in a range of human cells and tissues (Kambe et
al., 2002; Cragg, 2002: Cragg, 2008). Identified bands of 55 kDa for the ZnT6
protein corresponded with predicted size of the splice variant found in
lymphoblasts where exon IV was missing 43 nucleotides (Fig 3.5b).
Although we found alternatively spliced mRNA in both lymphoblasts and
fibroblasts, we detected two protein sizes only in lymphoblasts for the ZnT6
transporter. This could be due to the low abundance of the protein product of
the shorter transcripts in fibroblasts. Alternatively our antibody might not
detect the variant found in fibroblasts.
The protein levels of hZnT5 and hZnT6 in lymphoblasts and fibroblasts were
measured to establish if they were reduced, consistent with the mRNA data,
in lymphoblasts from affected mothers. Both hZnT5 and hZnT6 protein levels
were reduced compared to the control. In fibroblasts however, the protein
levels of hZnT5 and hZnT6 of cells from the affected mothers were no
different from the control. The reasons for the differences in the fibroblast
data between mRNA and protein are not clear.
Both SLC30A6 mRNA and protein were more strongly expressed in normal
breast tissue than in isolated lymphoblasts and fibroblasts. The high
expression of the transporters in normal breast cannot necessarily be
attributed to a greater expression in mammary epithelial cells as the breast
106
tissue also contains lipids, endothelial cells and smooth muscle fibres. The
breast cancer epithelial cell line PMC42 expressed approximately one tenth
the amount of ZnT5 and ZnT6 protein of the mammary tissue and
considerably less than lymphoblasts and fibroblasts. This may be related to
the transformed state of these cells or their cancer origin. It is not known if
ZnT5 and ZnT6 are altered in breast cancer tissue or cell lines, although
recently expression of ZnT5 and ZnT6 has been found up-regulated in grade
IV gliomas as compared to grade II gliomas (Lin et al., 2013). ZnT5 mRNA
levels were also increased in prostate cancer (Franz et al., 2013).
The mammary gland hZnT6 mRNA levels were 48 times greater than ZnT5.
Assuming that ZnT5/ZnT6 operates as a heterodimer, this difference in
transcript levels suggests that hZnT6 may have an additional function in
mammary gland, possible accounting for the additional splice variants.
ZnT5 and ZnT6 form heterodimers within the early secretory pathway and
this oligomerization is required for their zinc transport function (Kambe,
2012). The ZnT5/6 heterodimer transports zinc from the cytosol into vesicles
in HeLa cells (Kambe et al., 2002). ZnT6 is not directly involved in zinc
transport across the cell membrane as it does not have a zinc-binding site
within the TMDs because of the lack of conserved hydrophilic residues but it
may function as a modulator (Fukunaka et al., 2009). Based on the X-ray
structure of YiiP, a ZnT homologue in E. coli, (Lu and Fu, 2009; Lu & Fu,
2007) has four hydrophilic residues in TMDs II and V form the zinc-binding
sites for ZnT6. Thus if one of either hZnT5 or hZnT6 protein is reduced it may
impair the function of the dimer in transporting zinc.
107
Changes in hZnT5 and hZnT6 mRNA and protein levels in the mothers
producing zinc-deficient milk indicate the possibility that these transporters
may be implicated in the zinc deficiency disorder although no mutations were
detected in the coding region. The suppression of gene expression could be
due to mutations in the gene promoter regions where important transcription
binding sites are present. Changes or mutations within these binding sites
can interfere with transcriptional machinery and hence suppressing
expression of the target gene.
Both hZnT5 and hZnT6 possess a number of hormone responsive elements
including MRE (Metal Responsive Element), STAT-5 (binding site for
prolactin), TATA binding site, PRE (Progesterone Responsive Element) and
GRE (Gonadotrophin Responsive Element). hZnT5 also includes an IRE
(Insulin Responsive Element). The presence of these elements is consistent
with these transporters having a hormone-responsive role in mammary
function, in particular milk secretion, which is controlled by prolactin. To
detect changes in important binding sites present in the promoter region of
our genes of interest, promoter analysis was performed 4000bp upstream of
the translation start site. However, no changes were observed within these
binding sites. We then investigated miRNAs present in 3’ region of these
transporters, as modifications at 3’ regions could alter the expression of
genes. Again, no changes were observed.
The immunolocalisation studies indicated that the distribution of both hZnT5
and hZnT6 protein was similar in fibroblasts, lymphoblasts and breast tissue
and were consistent with the vesicular described localisation of the two
108
proteins described previously (Huang et al., 2002; Suzuki et al., 2004; Suzuki
et al., 2005).
DNA methylation is an epigenetic modification that plays an important role in
regulation of gene expression. This determines whether a genome region is
transcriptionally active or repressed, and hence controls cell specific gene
expression (Robertson KD. 2005; Bird A., 2002). Since CpG islands are
present in the promoter region of hZnT5 and hZnT6 genes, their expression
may potentially be regulated by promoter methylation status. DNA
methylation is involved in the down-regulation of other members of the SLC
family of transporters (Hong et al., 2005; Kikuchi et al., 2006; Zschocke et al.,
2007; Philibert et al., 2007; Gonen et al., 2008). DNA hypermethylation
downregulates ZIP8 in cadmium resistant metallothionin null mice (Fujishiro
et al., 2009). Methylation caused by factors including diet may exert
influences during the neonatal development, seen for example with folate,
where a deficiency during pregnancy in mice leads to reduced Zip4
methylation in the offspring (McKay et al., 2011), where as folate is a methyl
donor. Promoter methylation of the hZnT5 gene contributes to reduced
expression of an associated reporter gene that leads to decreased zinc
absorption from intestinal cells (Coneyworth et al., 2009). Increased DNA
methylation of CpG islands in the promoter region of Zip6 was observed in
splenocytes of aged mice relative to young mice and contributed to age-
related deficiency of cellular zinc. Similar hypermethylation was found for
ZnT1 and ZnT5 zinc transporters (Wong et al., 2013). DNA hypomethylation
was responsible for homocysteine-induced cyclin-A gene silencing and
growth inhibition in endothelial cells (Jamaludin et al., 2007).
109
We investigated the possibility that DNA methylation could account for the
reduced levels of hZnT5 and hZnT6 transcripts found in cells from mothers
producing zinc-deficient milk. Methylation patterns are tissue-specific and
may differentially regulate gene expression in different cells (Thomson et al.,
2010; Schneider et al., 2010). In folate-methyl deficient rats, DNA
hypomethylation was found in hepatic tissue while DNA hypermethylation
was found in the brain (Pogribny et al., 2008) indicating differential tissue
response with the same nutritional deficiency. Our analyses indicated
differences in methylation levels between fibroblasts and lymphoblasts and
between affected mothers and controls. In fibroblasts, the methylation of
hZnT5 at one of 4 CpG sites measured was increased by 20% in Mother 2,
and this may account for reduced hZnT5 mRNA detected in these cells. In
lymphoblasts in Mothers1 and 2 the methylation of this same CpG site was
reduced by 65% compared to control lymphoblasts. A notable feature of the
methylation results was the large variation between control samples. In
contrast to this the variation within Mother 1 and Mother 2 samples was
smaller, but given the small numbers of samples it is not possible to
determine if the patients and controls actually differed in variability at this
position. Similar to the variations in nucleotide sequences within populations
(genetic polymorphisms), variations in methylation termed epi-
polymorphisms have been identified (Abraham et al., 2012), and may be
attributable to mechanisms including transposable elements (Waterland, and
Jirtle, 2003).
110
Hypermethylation at this variable CpG in fibroblasts could be responsible for
reduced expression of the hZnT5 gene. In lymphoblasts, this CpG site was
hypomethylated in affected mothers compared with controls, but expression
levels were reduced at both the mRNA and protein levels. Although promoter
DNA hypermethylation, rather than hypomethylation, is generally regarded as
the suppressive epigenetic modification, this relationship is not always
observed, particularly with respect to individual CpG sites. Another study
revealed that several genes where both gain and loss of DNA methylation at
specific CpG sites was associated with both increased or reduced expression
(Ions et al., 2013), although direct causality was not demonstrated. The
difference in DNA methylation at this specific CpG site between affected
mothers and controls could thus in theory contribute to the differences in
gene expression observed in both lymphoblasts and fibroblasts, but is clearly
not the only determinant. The proximity of two transcription factor binding
sites (CDF-1, DEAF) to this CpG site indicate that altered patterns of DNA in
this region may have functional manifestations that arise through effects on
the action of these transcription factors. CDF-1 plays a role in progression
through the cell cycle (Dohna et al., 2000) (Lucibello et al., 1995) (Zwicker et
al., 1995). Thus ZnT5 transcription may be regulated in parallel with the cell
cycle in manner affected by DNA methylation in this region.
DEAF-1 binds to its own promoter and also suppresses the expression of
PTA (peripheral tissue antigen) (Yip et al., 2009). It also has other functions
in regulating epithelial cell gene expression and mammary gland
morphogenesis (Barker et al., 2008). Further evidence supports that CHR is
111
a core element in transcriptional regulation by DREAM complexes (Muller et
al., 2012).
We detected no DNA methtylation in the (very selective) region of the hZnT6
promoter we analysed, thus can only conclude that differences in gene
expression were not associated with an increase in DNA methylation in this
region to a detectable level. We cannot exclude the possibility that DNA
methylation in other regions of the hZnT6 promoter differed between the
affected mothers and controls.
ZnT5 and ZnT6 genes in mothers producing zinc deficient milk are
summarized in Figure 3.9.
Figure 3.9 ZnT5 and ZnT6 changes in mothers producing zinc
deficient milk
Summary of results for two mothers producing zinc deficient milk. Significant
increase and decrease is represented via an upward and downwards arrow
respectively. No changes or undiagnosed results are shown via horizontal
line.
112
113
3.4 Conclusion
In summary, two cases of zinc deficiency in neonates caused by a maternal
defect in the transport of zinc into milk were investigated. Significant
reduction in hZnT5 and hZnT6 mRNA and protein were observed suggesting
a possible causal link to the zinc deficiency disorder. A significant functional
difference between affected mothers and control lymphoblasts was
confirmed by reduced alkaline phosphatase activity. There was an absence
of any modifications altering, amino acids in coding regions, transcription
binding sites in promoter region or 5’ and 3’ untranslated regions (UTR).
Novel splice variants along with full-length expression were detected in
hZnT6. Altered DNA methylation was observed in ZnT5 at epi-labile CpG
sites in lymphoblasts and fibroblasts from mothers producing zinc-deficient
milk compared with controls. This may account for reduced ZnT5 mRNA and
protein in lymphoblasts. The reduced hZnT6 mRNA and protein in
lymphoblasts may be secondary to reduced hZnT5 protein levels, given that
hZnT5 and hZnT6 function as a heterodimer in regards to zinc transport.
CHAPTER 4
Functional analysis to determine co-dependency of ZnT5 and ZnT6 in neuronal
cells.
115
4.1 Introduction
To elaborate the role of ZnT5 and ZnT6, further studies were carried out in
neuronal cells as zinc has a vital role in the normal functioning of neurons.
Out of a total of 10 members of the cdf family, each transporter works
differently in different cells. For example ZnT3 stores zinc in synaptic
vesicles; ZnT5, ZnT6 and ZnT7 stores zinc in the trans Golgi network. .Some
members of cdf family are important in brain and their altered expressions
have been linked to different disorders. ZnT6 levels are significantly
increased in the brain of Alzheimer disease (AD) patients (Lybartseva et al.,
2010; Lovell et al., 2006). Similarly elevated expression of ZnT6 have been
observed in hippocampus gyrus of the human brain with Alzheimer’s and
mild cognitive impairment (Smith et al., 2006).
ZnT5 and ZnT6 have been shown to work together to supply zinc to alkaline
phosphatases, a Zinc dependent enzyme, in the early secretory pathway
comprising the endoplasmic reticulum (ER) and Golgi apparatus (Suzuki et
al., 2005a). ZnT6 mRNA is expressed abundantly in the brain, liver and small
intestine but the protein has only been detected in brain and lung (Huang et
al., 2002; Yu et al., 2007; Suphioglu et al., 2010). These changes in mRNA
and protein levels suggest that ZnT6 expression is controlled at the
translational level in a tissue specific manner (Kambe et al., 2004).
ZnT5 is widely expressed in all mammalian tissues and ZnT5 null mice
develop muscle weakness, lean body composition, poor growth in male null
mice leading to death due to heart block at 15 weeks of age (Inoue et al.,
116
2002), suggesting that ZnT5 plays a crucial role in cell survival. Regulation of
ZnT5 expression occurs at the transcription and post transcription (mRNA
stability) levels. ZnT5 protein expression is reduced in human ileal mucosa
with high dietary zinc intake (Cragg et al., 2005). Similarly, exposure of Caco-
2 cells to high doses of zinc results in inhibition of ZnT5 transcription and
translation (Jackson et al., 2007). The formation of ZnT5/ZnT6 heterodimer
complexes using a gene disruption/re-expression system in chicken DT40
cells indicates the possibility that ZnT5 functions in zinc ion transport across
the cellular membrane with ZnT6 acting as a modulator to enhance zinc
transport activity to the complex (Fukunaka et al., 2009). ZnT5 has been
showed to work as both uptake and efflux pump (Valentine et al., 2007;
Thornton et al., 2011).
In the current study the main aim was to investigate the role of ZnT5 and
ZnT6 in M17 cells. To investigate mututal dependency, real time q-PCR and
western analysis were performed on cells harbouring knockdown and
overexpressing constructs of ZnT5 and ZnT6. An alkaline phosphatase
assay was performed to establish whether both are required for enzyme
activity in human neuronal cells. Immuno analysis and 65Zn accumulation and
efflux experiments were performed to establish the intracellular localization
and to determine if ZnT5 and ZnT6 are required for cellular zinc
accumulation or zinc efflux.
117
4.2 Results
4.2.1 Overexpression constructs
To investigate the function of ZnT5 and ZnT6 in neuronal cells, over-
expression and knocked-down constructs were created and the expression
levels of ZnT5 and ZnT6 mRNA were measured in control cells (containing
empty vectors) and cells overexpressing ZnT5 and ZnT6 constructs using
real-time PCR. Significant 48 and 50-fold increases in the mRNA expression
levels of ZnT5 and ZnT6 were found (p<0.05) between control and
overexpressed ZnT5 and ZnT6 genes respectively (Figure 4.1a, 4.2a). The
control reactions lacking either primers and or template cDNA were negative.
The dissociation curve analysis of all PCR products revealed single peaks of
expected Tm (data not shown), confirming the specificity of all designed
primers.
Significantly higher ZnT5 and ZnT6 protein expression levels were observed
in cells containing overexpression constructs of ZnT5 and ZnT6 genes as
compared to wild type controls. A 55 kDa band was detected using the ZnT5
antibody and the ZnT6 antibody produced a band approximately 57 kDa in
size (Figure 4.1b, 4.2b top bands). Densitometry performed to measure
differences in protein levels relative to β-actin, indicated significant increases
of 262% and 324% observed in cells overexpressing ZnT5 and ZnT6
respectively relative to control cells with empty vectors (p<0.05) (Figure 4.1b,
4.2b).
Figure 4.1 Overexpression and knockdown constructs of
ZnT5
SYBR-Green real time RT-PCR analysis of cells overexpressing ZnT5
showed significant increase (P<0.05, t-test) in ZnT5 mRNA compared to
control containing empty vector (a). Western blot analysis showed one major
band at 55 kDa and densitometry analysis after comparing with β-actin as a
control, showed significant increase (P<0.05, t-test) in intensity of band
strength for cells overexpressing ZnT5 compared to empty vector controls (b).
Localization of ZnT5 in overexpressing construct showed strong perinuclear,
cytoplasmic vesicular labelling (cii) as compared to less intense but similar
labelling in control cells (ci).
Real time PCR data showed significant decrease in ZnT5 knockdown cells as
compared to control empty vectors (P<0.05, t-test) (d). Protein estimation by
western blot analysis showed significant decrease of ZnT5 protein (P<0.05, t-
test), in knockdown cells as compared to controls (e). Immunolabelling of
ZnT5 showed similar localization but reduced signal in ZnT5 knockdown cells
(fi, fii).
RNA expression level of each sample was calculated using the equation 2-
∆∆CT. All data presented are the results of 3 independent experiments.
118
Figure 4.2 Overexpression and knockdown constructs of
ZnT6
Syber green real time analysis of cells overexpressing ZnT6 showed
significant increase in ZnT6 mRNA (P<0.05, t-test) compare to control
containing empty vector (a). Western blot analysis showed one major band at
~57 kDa and densitometry analysis after comparing with β-actin as a control,
showed significant increase (P<0.05, t-test) in intensity of band strength for
overexpressing ZnT6 as compared to control cells (empty vectors) (b).
Localization of ZnT6 in overexpressing construct showed strong perinuclear,
cytoplasmic vesicular labelling (cii) (indicating Trans Golgi consistent with
previous studies) as compared to less intense cytoplasmic vesicular labelling
in control cells (ci).
Real time analysis at mRNA level showed significant decrease in ZnT6
knockdown cells as compared to controls (P<0.05, t-test) (d). Protein
expression by western blot analysis showed significant decrease (P<0.05, t-
test) in ZnT6 knockdown cells as compared to controls (e). Immuno
localization of ZnT5 showed similar labelling but reduced signal in
knockdowns of ZnT6 as compared to control cells (fi, fii).
119
120
Confocal images were obtained from cells containing overexpression
constructs for ZnT5 and ZnT6 and with empty vector controls. In control cells
the ZnT5 and ZnT6 protein was distributed evenly in cytoplasm with a
vesicular pattern (Figure 4.1ci, 4.2ci). Cells with overexpressing constructs
showed pronounced perinuclear label consistent with previous reported
studies for both transporters (Figure 4.1cii, 4.2cii).
4.2.2 Knockdown constructs
To demonstrate that our knock-down constructs were functional, ZnT5 and
ZnT6 mRNA expression levels were measured using real time PCR in control
cells containing empty vectors and cells with ZnT5 and ZnT6 siRNA knock-
down constructs. Significant 0.7 and 0.5 fold decreases in mRNA expression
levels were observed (p<0.05) in cells with knock-downs of ZnT5 and ZnT6
constructs relative to the empty vector controls (Figure 4.1d, 4.2d). The
control reactions with no primers or template cDNA from control (empty
vectors) and knockdown constructs were negative.
Consistent with previous western results, the ZnT5 and ZnT6 antibidies
produced a 55 kDa and a ~57 kDa band size respectively (Figure 4.1e, 4.2e
top bands). Densitometry was performed to detect differences in protein
levels relative to -actin. Significant decrease of 46% and 52% in band
intensity were observed in cells containing knockdown of ZnT5 and ZnT6
respectively, relative to cells with empty vectors (p<0.05) (Figure 4.1e, 4.2e).
Immuno-localization of ZnT5 and ZnT6 proteins showed a cytoplasmic,
vesicular localization in control cells (Figure 4.1fi, 4.2fi), and cells with ZnT5
121
and ZnT6 knockdowns did not show altered localization of the proteins in
comparison to control. The only difference detected was reduced signal
intensity (Figure 4.1fii, 4.2fii).
4.2.3 ZnT5 and ZnT6 interactions
The effect of altered expression of ZnT5 and ZnT6 was investigated to
establish their inter-dependence. ZnT6 mRNA expression and protein levels
were measured in cells containing overexpression and knock-down ZnT5
constructs. Similarly ZnT5 mRNA and protein expression levels were
observed in cells containing overexpression and knockdown constructs of
ZnT6. When ZnT6 was overexpressed, no change was detected in
expression of ZnT5 mRNA (using ZnT5 specific real time PCR primers)
(Figure 4.3a) or in protein levels (ZnT5 antibody) (Figure 4.3b). Similarly no
changes in mRNA levels (Figure 4.3d) or band intensity for western blot
(Figure 4.3e) were observed in cells containing ZnT6 knock-down constructs,
compared to controls (empty vectors) using ZnT5-specific primers and ZnT5-
antibody (p>0.05). ZnT6 overexpression and knockdown had no impact on
the localization of ZnT5 protein (Figure 4.3ci, 4.3ciii; 4.3fi, 4.3fiii).
In contrast, ZnT6 showed responses following ZnT5 overexpression and
knockdown in M17 cells. Cells in which ZnT5 was overexpressed, showed a
3-fold increase in ZnT6 at the mRNA level (Figure 4.4a) and a 105%
increase at protein level (Figure 4.4b) (p<0.05). Similarly in cells with ZnT5
knockdown constructs there was a 57% decrease in ZnT6 mRNA (Figure
4.4d) and a 40% decrease at the protein level (Figure 4.4e) (p<0.05). No
differences were observed in band sizes for ZnT5 and ZnT6 genes.
Figure 4.3 Expression of ZnT5 in response to ZnT6
overexpression and Knockdown
Real time PCR analysis showed increased expression of ZnT5 in
overexpressing cells with ZnT5 gene but no differences in expression levels
between cells overexpressing ZnT6 and control were observed using ZnT5
qRT-PCR primers (a) (p>0.05, t-test). Western blot analysis showed no
differences in the band intensities (b) (p>0.05, t-test) between overexpressing
ZnT6 and control cells using ZnT5 antibody. Overexpressing ZnT6 had no
impact on the localization of ZnT5 (ci, ciii).
mRNA expression levels measured by Real time PCR showed no changes
between ZnT6 knockdown compared with respective controls (p>0.05, t-test)
using ZnT5 specific primers (d). Protein expression by western blot analysis
showed no differences in band intensities between ZnT6 knockdown and
control cells (e) (p>0.05, t-test). ZnT6 knockdown did not show any changes
of ZnT5 localization compared to controls (fi, fiii).
122
Figure 4.4 Expression of ZnT6 in response to ZnT5
overexpression and knockdown
Real time PCR analysis showed significant increase in cells overexpressing
ZnT5 and ZnT6 as compared to control cells using ZnT6 qRT primers at
mRNA level(P<0.05, t-test) (a). Western blot analysis showed increase in the
band intensities and showed significant increase in cells overexpressing ZnT5
as compared to control cells (empty vectors) using ZnT6 antibody (b)
(P<0.05, t-test). Overexpressing ZnT5 showed slight increase in the intensity
of perinuclear localization of ZnT6 as compared to respective control (ci, ciii).
A significant decrease was observed at mRNA level between ZnT5
knockdown compared to controls using ZnT6 qRT primers (P<0.05, t-test)
(d). Protein expression by western blot analysis showed significant decrease
(P<0.05, t-test) in band intensities between ZnT5 knockdown and control
cells using ZnT6 antibody (e). Slight decrease in labelling signal was
observed between ZnT5 knockdown as compared to controls (fi, fiii), but
localization pattern remained same.
123
124
Consistent with the real time and protein expression data, cells
overexpressing ZnT5 showed an increase in the perinuclear labelling of ZnT6
(Figure 4ci, 4ciii), and a decrease in ZnT6 signal intensity was observed for
ZnT5 knock-down cells compared to their respective controls (Figure 4.4fi,
4.4fiii).
4.2.4 Alkaline phosphatase activity
Alkaline phosphatase is a zinc-dependent enzyme that requires ZnT5 and
ZnT6 for its activity (Suzuki et al., 2005a; Suzuki et al., 2005b). TNAP (tissue
nonspecific alkaline phosphatase) activity was measured using total cellular
protein from cells with ZnT5 and ZnT6 overexpressing and knock-down
constructs with respective empty vector controls. When compared with
controls, cells overexpressing ZnT5 and ZnT6 genes showed an increase
from 0.2 U/μg of protein to 0.26 U/μg, an increase of 24% and 0.24 U/ μg an
increase of 16% respectively in alkaline phosphatase activity (p<0.05)
(Figure 4.5a). Similarly in cells harbouring a knock-down construct of ZnT5 a
reduction in alkaline phosphatase activity from 0.15 U/μg of protein to 0.10
U/μg (representing 31%) was found and in cells harbouring a ZnT6 knock-
down construct, 0.10 U/ μg (30%) reduction as compared to control cells was
found (p<0.05) (Figure 4.5b).
4.2.5 65 Zn accumulation
To demonstrate the relative roles of ZnT5 and ZnT6 in zinc accumulation,
overexpression and knock-down constructs were created, and zinc
accumulation was measured up to one hour following the addition of 65Zn to
Figure 4.5 Alkaline phosphatase activity
TNAP of the total cellular protein was measured in cells containing
overexpressing and knockdown constructs of ZnT5 and ZnT6 along with their
controls (empty vectors). Activity was measured in U/μg of total protein.
Overexpressing ZnT5 (O.E.5) and ZnT6 (O.E.6) showed significant increased
activity as compared to controls (P<0.05) (a). Knockdown constructs of ZnT5
(K.D.5) and ZnT6 (K.D.6) showed significant decrease in alkaline
phosphatase activity compared to controls (P<0.05) (b). Each value is the
mean ±S.D. of triplicate experiments. Stars indicate the statistically significant
difference (P<0.05, t-test).
125
126
cells. Cells overexpressing ZnT5 and ZnT6 showed no differences in
accumulation of 65Zn, compared to controls at any given time point (p<0.05)
(Figure 4.6b, 4.6d). Cells with knock-downs of ZnT5 and ZnT6 also showed
no differences when compared to controls (P<0.05) (Figure 4.6a, 4.6c).
Overall, all cells, irrespective of knockdown or overexpression status showed
an increase in accumulation of zinc to 0.3 pmoles of Zn/μg protein at 60
minutes.
4.2.6 65 Zn Efflux
Zinc efflux was measured at different time points from zero up to one hour in
cells with overexpressed and knock-down constructs that had been treated
with 65Zn for 24 hours, followed by replacement of 65Zn-containing medium
with normal media. No statistical differences were observed between cells
overexpressing ZnT5 and ZnT6 compared to their respective controls (Figure
7b, 7d). Similarly no significant differences were observed between cells with
knock-down constructs of ZnT5 and ZnT6 compared to empty vectors
(p<0.05) (Figure 7a, 7c).
Figure 4.6. 65Zinc accumulation
Zinc accumulation was measured up to one hour starting from 0 minutes
followed by 5, 10, 20 and 40 minutes in pmoles of Zn/μg protein.
Overexpressing ZnT5 and ZnT6 cells showed no changes in accumulation of
zinc, compared to controls at any given time point (p<0.05) (b, d). ZnT5 and
ZnT6 knockdown cells also showed no differences (p<0.05) (a, c).
Knockdowns, overexpressions and controls, showed increase in
accumulation of zinc starting from 0 pmoles of Zn/μg protein to 0.3 pmoles of
Zn/μg by one hour. Each value is the mean ±S.D. of triplicate experiments.
127
Figure 4.7 65Zinc Efflux
Zinc efflux was measured for overexpression and knockdown constructs of
ZnT5 and ZnT6 and respective controls. After treatment 65Zn containing
medium was replaced with normal media. No differences were observed
between cells overexpressing ZnT5 and ZnT6 compared to their respective
controls at any given time upto one hour (p<0.05) (b, d). Similarly there were
no changes between knock-down ZnT5 and ZnT6 cells compared to empty
vectors (p<0.05) (a, c). Each value is the mean ±S.D. of triplicate
experiments.
128
129
4.3 Discussion
In this study we have shown an interactive relationship between ZnT5 and
ZnT6 at transcriptional and translational levels in human neuronal M17 cells.
In M17 cells, expression of all members of the ZnT family has been
previously reported, where ZnT6 showed highest expression level of mRNA
relative to other family members (Suphiouglu et al., 2010). The results of my
investigation on ZnT5 and ZnT6 interactions indicates a dependency of ZnT6
on ZnT5, where an overexpression construct containing the ZnT5 gene
induced a significantly higher expression of ZnT6 gene at both the
transcriptional (3 fold increase) and translational levels (105% increase).
Additionally M17 cells with knockdown constructs of ZnT5 produced down-
regulation of ZnT6 gene at transcriptional (57% decrease) and translational
(40% decrease) levels.
The magnitude of the differences between the mRNA levels and protein
expression are quite similar for both genes. In contrast to the dependence of
ZnT6 on ZnT5, ZnT5 expression was not dependent on ZnT6. It is possible
that ZnT5 can function independently from ZnT6 as well as participating in
ZnT5/ZnT6 heterodimer function. ZnT5 is found in the β-cells of pancreas
and involved in delivery of zinc into insulin granules (Kambe et al., 2002).
Similarly another study has found that ZnT5 is involved in processing and
activation of PKC (protein kinase C) and in Zn-mediated regulation of mast
cell-dependent allergic responses (Nishida et al., 2009). There is no evidence
for the involvement of ZnT6 in these processes.
130
ZnT6 lacks the His-rich region in the cytoplasmic loop between IV and V
transmembrane domain (TMD) that is a characteristic feature of ZnT
members. It also lacks two His residues in the transmembrane domain II and
V (instead has leucine 60 and phenylalanine 201) that are highly conserved
among all members and plays important role in zinc transport function
(Kambe et al., 2004), instead ZnT6 has many potential protein kinase C and
CK2 phosphorylation and N-glycosylation sites (Huang et al., 2002).
Fukunaka et al., (2009) demonstrated by changing leucine and phenylalanine
to conserved hydrophilic histidine residues (ZnT6L66H-F201H), that ZnT6 is not
involved in the zinc binding site of the ZnT5/ZnT6 heterodimers and is
unlikely to function in zinc transport across the cellular membrane. Another
study from Ohana et al., (2009) demonstrated by direct measurement of zinc
transport that ZnT5 is an essential component for zinc transport, where-as
ZnT6 is catalytically non-functional. ZnT6 is not directly involved in transport
of zinc but may function as a component that helps to facilitate the activity (as
have phosphorylation and glycosylation sites) of ZnT5 in ZnT5/ZnT6
heterodimer complex and hence zinc transport activity (Huang et al., 2002).
Oligomerization is essential for zinc transport activity. Most ZnT transporters
are thought to form homo-dimers. ZnT5, ZnT6 and ZnT7 have been
demonstrated to work together in early secretory pathway (ESP), where
ZnT7 forms homo-oligomers and ZnT5 and ZnT6 form heterodimers. A
number of transporters form heterodimers as an essential function for their
biological activity. For example Cis4/Zrg17 (Saccharomyces cerevisiae) and
Msc2p/Zrg17p (Schizosacchaomyces pombe) form heterodimers in yeast,
are homologues of ZnT5/ZnT6 and play crucial role in the early secretory
131
pathway in transport of zinc in endoplasmic reticulum and Golgi membranes
(Ellis et al., 2005; Fang et al., 2008). A recent study demonstrated the
possibility of ZnT3 and ZnT10 forming a hetero-oligomer although whether
that complex is functional is not yet known (Patrushev et al., 2012). Hetero-
oligomeric complex formation is not only important for biological activity but
could also play role in subcellular translocation. For example transporters
ABCG5 and ABCG8, members of the ATP binding cassette, remain in
endoplasmic reticulum when expressed alone and do not migrate to the
plasma membrane for excretion of sterol out of the cell (into bile) without
heterodimer formation (Graf et al., 2003), even though it's not the case for
ZnT5 and ZnT6.
ALP’s contain tightly bound zinc that is essential for the enzyme activity
(Suzuki et al., 2005a). The TNAP activity was higher in cells containing ZnT5
and ZnT6 over-expression constructs compared to their respective controls.
Significant reduced TNAP activity was detected in cells with knockdown
constructs of ZnT5 and ZnT6 genes. Similar to our results, in a previous
study ~45% and ~20% TNAP reduction has been reported in ZnT5 and ZnT6
knock-down cells respectively in chicken derived DT40 cells (Suzuki et al.,
2005b), while ‘overexpression’ of ZnT5 had no effect on TNAP activity. The
lack of effect of overexpression on TNAP in DT40 cells could be explained on
the basis of tissue specificity, as these transporters may function differently in
different cells. Furthermore, there may be redundancy between Zn
transporters that could mask the individual effects of transporters. The DT40
cell line derived from chicken lymphocytes has a high homologous
recombination activity, where genetic recombination revealed an
132
unexpectedly high frequency of targeted integration into the homologous
gene loci of DT40 and expresses most of the ZnT members and hence has
been extensively used in the molecular study on the expression and
interaction of the whole range of zinc transporters (Suzuki et al., 2005a).
Evidence supports the concept that metal transporters perform other roles in
addition to metal transport. For example the CTR1, copper transporter in
Xenopus laevis plays a critical role in membrane associated fibroblast growth
factor (FGF) signalling complex where it transduces FGF signals
independently of copper levels (Haremaki et al., 2007). ZnT5/ZnT6
heterodimers provide zinc for TNAP enzymatic activity in early secretory
pathway (Fukunaka et al., 2009), in a similar way that ATP7A interacts
directly with extracellular superoxide dismutase to supply copper in the early
secretory pathway (Quin et al., 2006). Fukunaka et al. (2011) suggested the
possibility that ZnT5/ZnT6 heterodimers are not only involved in supplying
zinc for enzymatic activity but also for the stabilization of TNAP. He explained
that the formation of these complexes activates TNAP with a two-step
mechanism by regulating TNAP stability in ER (Endoplasmic Reticulum),
which is independent of zinc transport activity and by providing zinc to TNAP
in early secretory pathway (ESP) in the Golgi apparatus, where apo ALP’s
(non-active form) gets converted to holo ALP’s (active form) after getting zinc
(Suzuki et al., 2005b). Stored zinc in the early secretory pathway may be
transported from intracellular compartments to the cytosol for different
physiological functions by ZIPs (Yamasaki et al., 2007) or other zinc
transporting proteins like calcium channels where L-Type calcium Channel
133
(LTCC) α1D subunit located on endoplasmic reticulum membrane acts as a
gatekeeper for zinc wave; (Yamasaki et al., 2012).
Consistant with our study, a 55 kDa band size was detected for ZnT5 in
different human derived cell lines, larynx carcinoma (Hep-2), cervix
carcinoma (HeLa), placental choriocarcinoma (JAR) (Kambe et al., 2002). In
mouse study band sizes of 51 and ~55 kDa were detected in brain and lung
respectively for ZnT6 as compared to 57 kDa size in present study, such
differences have been attributed to posttranslational modifications (Huang et
al., 2002).
Immuno-localization indicates that ZnT5 and ZnT6 proteins are located within
the interior of the cell. Similar cytoplasmic vesicular and perinuclear
localization was observed for ZnT5 and ZnT6 in Hep2 and HeLa cells (Suzuki
T., 2005b). An increase in intensity of label was observed in cells with
overexpression constructs of ZnT5 and ZnT6 genes compared to wild type
cells. The signal was strongest near the nucleus and was similar in
appearance to that previously report, where a Golgi marker GM130,
overlapped with ZnT5 (Kambe et al., 2002; Nishida et al., 2009). Similarly a
decreased signal was observed in cells with knock-down constructs,
compared to wild type cells, for both genes. No differences in localization
were detected in cells with ZnT5 overexpression and knock-down constructs
for ZnT6 expression and vice versa. This observation is consistent with
previous study where subcellular localization of ZnT5 and ZnT6 was the
same when they were expressed alone or together (co-localization) (Suzuki
et al., 2005b). The results indicate that even though these transporters show
134
some extent of dependency on each other, this interaction is not impacting
their localization in the neuronal cells.
We investigated a function for the zinc transporters ZnT5 and ZnT6 in M17
neuronal cells for a role in the accumulation and efflux of zinc using 65Zn.
Knock-down and overexpression constructs of ZnT5 and ZnT6 genes did not
affect cellular zinc accumulation or efflux over a period of 1 hour (Figure 4.6,
4.7). This result suggests that both transporters are not working at the
plasma membrane. Previous studies support these findings showing that
overexpression of ZnT5 and ZnT6 did not make the cells resistant to high
concentrations of zinc indicated by a growth inhibition analysis in yeast
(Kambe et al., 2002). Similarly in another study, knockouts of ZnT5 and ZnT6
showed no significant changes in the total cellular zinc contents as compared
to wild type cells (Suzuki et al., 2005). This observation is in contrast to that
found for the copper transporters ATP7A and ATP7B where overexpression
results in cell resistance to excess copper (Petris et al., 1996).
No changes observed with 65Zn experiment between overexpression,
knockdown and wild type constructs at any time point up to one hour
suggests that these transporters are not likely to be working in the early zinc
pathway. A theory classifies intracellular zinc signals into two categories
EZS, early transcription independent zinc signalling and LZS, late
transcription dependent zinc signalling (Hirano et al., 2008). EZS occurs in
the zinc wave where zinc levels in cell change rapidly within several minutes
with extracellular stimulation (Yamasaki et al., 2007). In LZS the extracellular
stimulus can affect intracellular signalling pathways by changing the
135
intracellular zinc levels mediated by changing the expression of zinc
transporters. This theory is consistent with our results observed discussed in
chapter 5, where external stimulus (DHA) changed the zinc fluxes after 48
hours. To relate these transporters to late transcription dependent zinc
signalling, our radiolabeled studies need to be extended for at least few
hours.
We attempted to prepare double knockdowns of ZnT5 and ZnT6 to study the
effect of removal of both proteins from the cells but our persistent attempts
were unsuccessful. In particular cells harbouring ZnT5 knockdowns did not
last more than three passages which indicates the importance of this
transporter for cell survival. This suggests that ZnT5 and ZnT6 may function
as a heterodimer in neuronal cells, similar to that found in other cells.
136
4.4 Conclusion
In summary, we conclude that ZnT5 and ZnT6 may function as a heterodimer
in neuronal cells, similar to that found in other cells. The ZnT5/ZnT6
heterodimer most likely has a role in transporting zinc in the secretory
pathway as the activity of ALP depends on both ZnT5 and ZnT6 expression.
ZnT6 expression was altered in ZnT5 knock out and overexpression cells,
suggesting some interdependency of ZnT6 on ZnT5. Both ZnT5 and ZnT6
may also function independently. The possibility of ZnT6 performing
additional functions in addition to form heterodimer with ZnT5, is suggested
by the number of splice variants reported in neuronal cells in chapter 5. To
our knowledge this is the first study on ZnT5/ZnT6 co-dependency to be
carried out with human neuronal cells.
CHAPTER 5
Effect of Zinc and DHA on hZnT5 and hZnT6 transporters
in neuronal cells
138
5.1 INTRODUCTION
The omega-3 polyunsaturated fatty acids (PUFA) are important components
of the human diet as they cannot be synthesized by mammals (Sinclair et al.,
2002). The mammalian brain is rich in PUFA. DHA is the main PUFA in brain
and makes up approximately 3% of the dry weight of the human brain
(Svennerholm et al., 1968). It has been demonstrated in a rat study where
the impaired brain functions due to DHA deficiency (rats fed on very low DHA
diet) can be recovered when DHA levels return to normal (Moriguchi and
Salem, 2003). In cultured rodent neuronal cells, DHA protects cells from
apoptotic death induced by serum deprivation (Kim et al., 2000) with an anti
apoptotic effect that was DHA-specific. DHA also helps in promoting
differentiation of developing photoreceptors (Rotstein et al., 1997).
Both DHA (docosahexaenoic acid) and zinc play crucial role in brain function.
Alterations in DHA levels and zinc homeostasis are key features of
degenerative brain disorders (Garcia and Kim, 1997; Cuajungco and Faget,
2003). A link between zinc and PUFA metabolism is established, where the
clinical symptoms of zinc deficiency and PUFA deficiency are similar. There
is a link between DHA deficiency and altered zinc homeostasis in the brain of
rats fed on a DHA-deficient diet, that resulted in high hippocampal zinc levels
(Jayasooriya et al., 2005). Although these studies demonstrated a
relationship between DHA metabolism and zinc homeostasis, the molecular
mechanisms of this interaction have not been clearly understood.
139
Zinc homeostasis in the brain, including the uptake and efflux of zinc from
cells, is regulated by membrane-bound zinc transporters. Such transporters
belong to members of the solute carrier 39 (SLC39) also known as Zip’s and
the solute carrier 30 (SLC30) or ZnT’s, respectively (Overbeck, 2008).
Differential expression of zinc transporters has been reported in the brain.
ZnT6 mRNA levels are higher in cortical regions of patients with Alzheimer
disease (Beyer et al., 2012). Increased ZnT6 expression was demonstrated
in the hippocampus gyrus of early and late Alzheimer disease subjects along
with a trend towards a significant elevation in mild cognitive impairment,
compared to age matched controls (Smith et al., 2006). An elevation of ZnT6
in hippocampus gyrus and cerebellum was also observed in preclinical
Alzheimer’s (Lyubartseva et al., 2010). Another study also found an
association of ZnT6 with neurofibrillary tangles (Leung et al., 2008). Among
all zinc efflux transporters, ZnT5 showed the strongest immunoreaction in A-
beta positive plaques of cerebral cortex from Alzheimer’s patient (zhang et
al., 2008).
In our previous study, we reported that zinc transporters were expressed in
human neuronal M17 cells and ZnT6 transporter was highly expressed
relative to other ZnT’s (Suphioglu et al., 2010). The reduced zinc uptake and
low intracellular levels of zinc in the DHA-treated cells was associated with a
reduction in the expression of ZnT3, a zinc transporter that regulates
vesicular zinc storage in neuronal cells (Suphioglu et al., 2010). ZnT5 and
ZnT6 have also been proven to form heterodimers and are known to function
together in transportation of zinc (Fukunaka et al., 2011). In neuronal NT2
140
cells, zinc deficiency impaired the ability of retinoic acid (that acts similar to
DHA), to induce differentiation (Gower winter et al., 2013).
The aim of the current study was to explore the molecular basis of the link
between the omega-3 fatty acid DHA and zinc metabolism through hZnT5
and hZnT6 transporters.
141
5.2 RESULTS
5.2.1 Pre-treatment of neuronal cells with DHA induced zinc
efflux
To test the effect of incorporated DHA on zinc efflux from cells, M17 cells
were grown with (20 μg/ml) and without (0 μg/ml) DHA enriched medium for
48 hours. Cells were then grown in 65Zn and further incubated for 18 hours,
with or without DHA. The culture medium was then replaced with medium
containing no 65Zn and cellular zinc efflux was measured over a period of one
hour. M17 that had been pre-treated with DHA showed an increased level of
zinc efflux, relative to untreated cells (Figure 5.1). Zinc efflux was measured
in pico moles (pm) of zinc per μg of DNA. At time 0 mins, the zinc
concentration in the culture media was less in DHA treated cells as
compared to untreated cells (+DHA 28.1±0.2 pm Zn/μg DNA; -DHA 41.6±2.5
pm Zn/μg DNA) (P<0.05) but at time intervals from 2 mins (+DHA 45±1.1 pm
Zn/μg DNA; -DHA 35.1±0.3 pm Zn/μg DNA), 5 mins (+DHA 59.7±1.7 pm
Zn/μg DNA; -DHA 53.1±0.6 pm Zn/μg DNA), 20mins (+DHA 94.3±0.1 pm
Zn/μg DNA; -DHA 79.5±1.9 pm Zn/μg DNA) to 60 mins (+DHA 104.1±0.8 pm
Zn/μg DNA; -DHA 77.7±0.9 pm Zn/μg DNA) mins the efflux of 65Zn was
progressively greater in the cells treated with DHA as compared to untreated
cells (P<0.05). At a time interval of 10 mins the changes in Zn efflux between
+DHA and –DHA were not significant (+DHA 65.3±2.0 pm Zn/μg DNA; -DHA
61.2±1.6 pm Zn/μg DNA) (P>0.05).
Figure 5.1 65Zinc efflux studies
M17 cells cultured in DHA-enriched medium (20 μg/ml) or control medium (0
μg/ml) for 2 days were incubated for 18 hours in culture medium containing
radiolabelled 65Zn, with or without DHA. The culture medium was replaced
with medium containing no 65Zn and cellular 65Zn efflux was measured in
pmol/μg DNA over a period of one hour. M17 cells that had been pre-treated
with DHA (solid bars) showed an increased level of zinc efflux in media,
relative to untreated cells (open bars) at different time points. The data are
shown as means (n = 3, *p<0.05).
142
143
5.2.2 DHA treatment reduced intracellular pools of labile zinc
Neuronal M17 cells were tested for the presence of labile zinc pools using
Zinquin after treating with zinc and DHA as described in Materials and
Methods section. Granular cytoplasmic labelling was observed for Zinquin in
all cells tested (Figure 5.2A, 5.2B). Significant differences were found
between control cells with no treatment (Figure 5.2Aa) where very weak
granular cytoplasmic label was observed that was in contrast to a strong
labelling visible in cells treated with10 M zinc for 30 mins (Figure 5.2Ab) and
cells treated with 10 M zinc for 30 mins followed by 15 g/ml DHA for 30
mins (Figure 5.2Ac) where almost no visible labelling was detected. Addition
of DHA caused significant reduction in the granular cytoplasmic labelling
(free zinc inside the cell) (Figure 5.2Ac). To confirm these results DHA
containing media was removed and cells were again incubated with normal
media for 3, 6, 9 and 24 hours. The strength of Zinquin staining was
progressively increased with the incubation time (Figure 5.2B). At 24 hours
incubation in normal media, the staining was almost regained to original
strength of control cells (Figure 5.2Bg).
5.2.3 DHA treatments enhanced neurite outgrowth
Along with release of zinc from the cells after incubation with DHA, we
observed another interesting aspect of DHA treatment, increase in the length
of the neuronal cells extensions, a process called neurulation (Ikemoto et al.,
1997, Frances et al., 2004).
Figure 5.2 Intracellular pools of labile zinc.
Neuronal M17 cells grown on cover slips with and without 10 M of zinc, and
15 μg/ml DHA were incubated for 30 mins in 5 M Zinquin. Labile zinc was
detected with UV filter range 365 to 395nm using Olympus microscope.
Maximum labile zinc was observed in cells treated with 10 M zinc (Ab)
followed by no treatment (Aa) and 10 M zinc followed by 15 g/ml DHA
(Ac). A gradual increase of labile zinc labelling was seen in recovered DHA
treated cells at 3 hours (Bd), 6 hours (Be), 9 hours (Bf) and 24 hours (Bg)
after replacing DHA enriched media with normal media. Scale bar represents
10μm.
144
145
With supplementation of DHA to M17 neuronal cells, not only neurite length
increased but also the number of branches per neuron increased (Figure
5.3b, 5.3d). Addition of zinc to the cells did not change the effect of DHA on
neurite length (Figure 5.3c).
5.2.4 hZnT5 and hZnT6 contains DHA regulatory elements in
their promoter regions
Greater efflux of zinc in DHA treated neuronal cells along with reduction in
Zinquin labelling in these cells indicate that DHA might play a role in zinc
fluxes. As zinc fluxes are mediated by zinc transporters, hZnT5 and hZnT6
efflux transporters were analysed for the presence of RAREs (Retinoic Acid
Responsive Elements) and MRE (Metal Responsive Element). RXR is a
member of nuclear hormone receptors family that comprises ligand activated
transcription factors. RXR binds to target genes at specific DNA sequence
called RAREs to promote transcription, resulting increase in target genes
expression (Blomhoff, 2006). DHA acts as an agonist to RA (Retinoic Acid)
and has been demonstrated to work as an endogenous ligand for the
activation of RXR (De Urquiza et al., 2000). The DHA binding motif, called
RAREs, with core sequence hexad (Ra/gGKg/tTCA) that can be configured
into variety of structured motifs (Glass, 1994) was identified in promoter
region of both hZnT5 and hZnT6 genes at specified positions along with MRE
(Metal Responsive Element) with core sequence (TGCRa/gCNC) starting
from the start codon. Multiple copies of core sequence of MRE’s (2, 3) and
RARE’s (3, 7) were found in 4000 bp upstream in the promoter region for
hZnT5 and hZnT6 respectively at specified positions (Figure 5.4a, 5.4b).
Figure 5.3 Impact of DHA on morphology of M17 neuronal
cells
Neuronal M17 cells cultured with and without DHA showed increased neurite
length along with more individual branches per neuron with DHA
supplementation as compared to DHA free media (b,d). The addition of zinc
had no influence on DHA induced neurite growth (a,c).
146
Figure 5.4 RAREs and MREs in the promoter region of hZnT5
and hZnT6
Diagrammatic representation of binding sites for important transcription
binding factors for DHA and metals (zinc in this study), RAREs (Retinoic Acid
Responsive Elements with conserved consensus sequence Ra/gGKg/tTCA)
and MREs (Metal Responsive Elements with conserved consensus sequence
TGCRa/gCNa/g/t/cC) at different positions in the promoter region (4000 bp)
upstream of the translation start point for hZnT5 (a) and hZnT6 (b) genes.
147
148
5.2.5 hZnT5 and hZnT6 mRNA levels were influenced by DHA
and zinc
To investigate if treatment with DHA changed the transcriptional levels of
ZnT5 and ZnT6, mRNA expression levels of both transporters were
measured in control cells and cells exposed to different zinc and DHA
treatments (as described in Materials and Methods section 2.5) using real-
time quantitative PCR. No differences in the mRNA expression levels of
hZnT5 and hZnT6 were found between cells exposed to different DHA
treatment without zinc (p>0.05, t-test) (Figure 5.5a, 5.5b). The addition of 5
μM of zinc added to the culture medium together with different amounts of
DHA, produced increase in expression for both hZnT5 and hZnT6 genes with
increase in DHA concentrations. At 5 μg/ml and 10 μg/ml of DHA, increased
trend in mRNA expression was observed but was not significant (p>0.05, t-
test). Significant increased expression was observed for hZnT5 and hZnT6
genes at 15 μg/ml (1.4; 1 fold increase) (2.40±0.35; 1.89±0.17) and 20 μg/ml
(1.7; 1.7 fold increase) (2.72±0.19; 2.57±0.38) (p<0.05, t-test) DHA levels
respectively (Figure 5.5a, 5.5b). Similar results were also observed with
another neuronal cell line SY5Y (data not shown). Retinoic Acid (RA) induced
differentiated M17 cells were also analysed by real time PCR to check the
effect of differentiation on mRNA expression levels for hZnT5 and hZnT6
genes but similar results as for undifferentiated cells were observed (data not
shown).
Figure 5.5 SYBR-Green Real-time RT-PCR analysis of hZnT5
and hZnT6 mRNA from Zinc and DHA treated M17
neuronal cells
Comparison of the hZnT5 and hZnT6 mRNA expression levels between no
zinc and different DHA treated cells revealed no significant differences
(p 0.05, t-test). With addition of 5 μM of zinc to different DHA treatments
significant increase was observed at 15 μg/ml and 20 μg/ml of DHA for hZnT5
and hZnT6 genes (p<0.05, t-test). No significant increase or decrease in
mRNA expression level was detected at 5 μg/ml and 10 μg/ml DHA treatment
with 5 μM zinc (p>0.05, t-test) (a, b).
The CT was calculated by subtracting the -actin cycle threshold (CT) value
(the cycle number in which the fluorescence emitted exceeds the threshold
level) from that of the hZnT5 and hZnT6. Relative RNA expression levels of
each sample was calculated using the equation 2-∆∆CT, where ∆∆CT is a
difference between the treated (DHA treatments) ∆CT and control ∆CT. All
data presented are the results of 3 independent experiments. The data are
shown as means (n = 3, *p<0.05).
149
150
To check the influence of vitamin E on DHA treatments, cell pellets collected
from different DHA and vitamin E treatments were analysed for hZnT5 and
hZnT6 by quantitative real time PCR analysis.
No significant mRNA differences were detected between –DHA ± vitamin E
(1.03±0.03; 1.08±0.14) for ZnT5 (1.05±0.14; 1.17±0.11) for ZnT6 (p>0.05, t-
test) and +DHA ± vitamin E (0.97±0.09; 1.08±0.03) for ZnT5 (1.09±0.19;
1.35±0.05) for ZnT6 (p>0.05, t-test) (Figure 5.6a, 5.6b). As vitamin E did not
impact the results of DHA treatment, vitamin E was not added in subsequent
experiments.
The control reactions lacking either primers and or template cDNA were
negative for all analysed samples. The dissociation curve analysis of all PCR
products revealed the single peaks of expected Tm (data not shown),
confirming the specificity of all designed primers.
5.2.6 High doses of DHA in presence of zinc increased the
protein expression of hZnT5 and hZnT6
To determine if the described above changes in mRNA levels translated to
different protein products, expression levels of hZnT5 and hZnT6 proteins
were analysed in all DHA treated cells with and without zinc for 48 hours,
using two different monoclonal antibodies (Materials and Methods section
2.8). The hZnT5 antibody produced a major 55 kDa band in all lanes
representing different treatments (Figure 5.7a). A major 57 kDa size band
was detected for different treatments using hZnT6 antibody (Figure 5.7b).
Figure 5.6 SYBR-Green Real-time RT-PCR analysis of hZnT5
and hZnT6 mRNA from Vitamin E and DHA treated
M17 neuronal cells
Comparison of the hZnT5 and hZnT6 mRNA expression levels between no
zinc and different DHA treated cells revealed no significant differences
(p 0.05, t-test). With addition of 5 μM of zinc to different DHA treatments
significant increase was observed at 15 μg/ml and 20 μg/ml of DHA for hZnT5
and hZnT6 genes (p<0.05, t-test). No significant increase or decrease in
mRNA expression level was detected at 5 μg/ml and 10 μg/ml DHA treatment
with 5 μM zinc (p>0.05, t-test) (a, b).
Vitamin E addition showed no significant changes to mRNA expression levels
with or without addition of DHA (p>0.05, t-test) (a, b).
151
Figure 5.7 Western blot analysis of proteins from zinc and
DHA treated M17 neuronal cells
Expression levels of hZnT5 and hZnT6 protein were analyzed using hZnT5
and hZnT6 antibodies. A predicted band size of 55 KDa and 57 KDa for
hZnT5 and hZnT6 respectively were present for all different treatments of
zinc and DHA (a, b top lane). The expression levels of a human β-actin along
with ponceau S staining was used to indicate the relative levels of protein
loaded on the gel (a, b middle lane). Densitometry analysis showed
significant differences with (p<0.05, t-test) at 15 μg/ml and 20 μg/ml of DHA
for hZnT5 and hZnT6 genes with consistent 5 μM of zinc in the culture
medium (a, b bottom bar graph). Overall increase expression was observed
with increase in the amount of DHA in presence of zinc for both genes but at
5 μg/ml and 10 μg/ml the differences were not significant. Data is
representative of three similar independent experiments. The data are shown
as means (n = 3, *p<0.05) .
152
153
Consistent with real time results no significant changes were detected with
different treatments of DHA without additional zinc added to the culture
medium (p>0.05, t-test). Significant differences were observed at 10 μg/ml
(50% increase; non-significant for hZnT6) (140±3.5), 15 μg/ml (85%; 80%
increase) (185±7.07; 180±0.70) and 20 μg/ml (118%; 135% increase)
(218±10.60; 235±7.77) of DHA for hZnT5 and hZnT6 respectively in
presence of 5 μM of Zn (p<0.05, t-test). No changes were detected at 5
μg/ml for hZnT5 and 5 μg/ml and 10 μg/ml DHA for hZnT6 in presence of 5
μM Zn (p>0.05, t-test).
Ponceau S stain was used to check relative levels of proteins transferred to
the membrane. A housekeeping control protein, -actin expression was also
tested and used as a loading control.
5.2.7 DHA does not affect localisation of hZnT5 and hZnT6 in
M17 neuronal cells
Confocal images were obtained following different zinc and DHA treatments
of M17 cells using hZnT5 and hZnT6 antibodies to determine the intracellular
localization of these transporters. The transporters were distributed evenly in
cytoplasm showing a vesicular pattern possibly associated with zincosomes
(Zaleweski et al., 1993) that store labile zinc inside the cell. DHA treatment
had no effect on the localisation of the hZnT5 (Figure 5.8a,b,c,d,e,f) and
hZnT6 (Figure 5.8g,h,i,j,k,l) zinc transporters as for all different treatments,
granular distribution throughout the cytoplasm with some perinuclear
localisation was observed.
Figure 5.8 Immunofluoresence analysis of hZnT5 and hZnT6
protein localisation in M17 neuronal cells
Neuronal M17 cells treated with 0 μM Zn 0 μg/ml DHA (a,g), 0 μM Zn 10
μg/ml DHA (b,h), 0 μM Zn 20 μg/ml DHA (c,i), 5 μM Zn 0 μg/ml DHA (d,j), 5
μM Zn 10 μg/ml DHA (e,k), 5 μM Zn 20 μg/ml DHA (f,l) for 48 hours and
grown in 8 well Ibidi chambers were stained with hZnT5 and hZnT6
antibodies followed by fluorescent secondary antibody conjugated with Alexa
488. Images shows granular cytoplasmic and peri nuclear localization of
hZnT5 (a,b,c,d,e,f) and hZnT6 (g,h,I,j,k,l). Different DHA treatments in and
absence of Zn did not change the protein localisation in cells for hZnt5 and
hZnT6. Scale bar represent 20 μm.
154
155
5.2.8 DHA does not influence the alkaline phosphatase
activity
Alkaline phosphatase activity assay has been used as an indicator of
enzymatically available intracellular zinc levels (Fukunaka et al, 2009).
Collected pellets were lysed with lysis buffer and total alkaline phosphatase
activity was detected at 405 nm wave length using p-nitrophenol as a
substrate in M17 cells exposed to different DHA and zinc treatments for 2
days. No significant differences were found between controls and any of the
treatments (p>0.05, t-test) (Figure 5.9).
5.2.9 hZnT5 and hZnT6 predicted variants in M17 neuronal
cells by RT-PCR
M17 neuronal cells with different DHA and zinc treatments were analysed for
an effect of DHA on alternative splice variants of hZnT5 and hZnT6 genes.
Different fragments covering the full ORF (Open Reading Frame) of hZnT5
and hZnT6 genes showing major band representing full length fragment
along with additional bands present were analysed irrespective of zinc and
DHA treatments (Figure 5.10.1, 5.10.2). This confirmed that DHA was not
influencing alternative splicing of ZnT5 and ZnT6. The bands shown in figure
could be novel splice variants associated specifically to neuronal cells.
Individual band sizes from different fragments were matched to intron-exon
map of full length expressed transcript from published NCBI database.
Figure 5.9 Alkaline phosphatase activity
To measure activity cell lysates were incubated with p-nitrophenyl substrate
following treatments with DHA and zinc for 48 hours. Total alkaline
phosphatase activity was detected at 405 nm wave length. First five lanes
with no zinc and increasing DHA levels from 0, 5, 10, 15 and 20 μg/ml and
second five lanes with consistent 5μM zinc and increasing levels of DHA as
before showed no significant differences (p>0.05, t-test) . All data presented
are the results of 3 independent experiments. The data are shown as means
(n = 3, *p<0.05).
156
Figure 5.10.1 Predicted variants for hZnT5 gene.
To see the effect of DHA, the full length of hZnT5 gene using three different
primer pairs was amplified by RT-PCR using cDNA from different treatments
of DHA with and without zinc for 48 hours as explained in section 2.6.
No differences were observed between cells with different treatments of DHA
and zinc, but additional bands (possible variants) were observed in gels for
hZnT5 gene along with full length gene. Individual band sizes from different
fragments were matched to intron-exon map of full length expressed
transcript from published NCBI data-base for hZnT5. After confirming the
sizes with NCBI sequences, all additional bands in gels correspond to
possible splice variants.
157
Figure 5.10.2 Predicted variants for hZnT6 gene
The full length of hZnT6 gene was amplified using two different primer pairs
by RT-PCR using cDNA from different treatments of DHA with and without
zinc for 48 hours (section 2.6).
No differences were observed between cells with different treatments of DHA
and zinc, but additional bands (possible variants) were observed in agarose
gels for hZnT6 gene along with full length expression. Individual band sizes
from different fragments were matched to intron-exon map of full length
expressed transcript from published NCBI data-base for hZnT6. After
confirming the sizes with NCBI sequences, all additional bands in gels
correspond to possible splice variants.
158
159
After comparing the sizes with NCBI sequences, all additional bands
corresponding to possible splice variants were identified (Table 5.1). To
further confirm that these additional bands are real splice variants, sequence
analysis is required.
Table 5.1 Splice variants generated by RT-PCR for hZnT5 and
hZnT6 genes
Table showing different predicted splice variants covering open reading
frame (ORF) for hZnT5 and hZnT6 genes generated by reverse transcriptase
PCR. Three and two separate fragments for ZnT5 and ZnT6 respectively
were analysed using specific primers to cover the whole length of the genes.
160
hZnT5Fragment 1 Fragment 2 Fragment 31113bp (Full length exons 1-9) 1127bp( Full length exon 9-13) 629bp( Full length exon 13-16)990bp (Exon 2 missing) 998bp (Exon 12 missing) 501bp (Exon 15 missing)749bp (Exon 2-5 missing) 841bp (exon 11, 12 missing)
hZnT6Fragment 1 Fragment 21124bp (Full length exon 1-14) 759bp( Full length exon11-14)1037bp (Exon 2 missing) 711bp (Exon 12 missing)952bp (Exon 2,3 missing) 642bp (Exon 12, 13 missing)909 (Exon2-4 missing)726bp (Exon 2-7 missing)362bp (Exon 2-10 missing)340bp (Exon 2,9,12,14 missing)259bp (Exon 2-13 missing)
161
5.3 DISCUSSION
The experiments described in the current chapter investigated the effect of
DHA on the expression of the hZnT5 and hZnT6 transporters, previously
reported to have a role in the mammalian brains (Lyubartseva et al., 2010;
Smith et al., 2006; Zhang et al., 2008).
M17 cells that had been treated for 48 hours with DHA and then incubated
with 65Zn showed a 20% increase in zinc efflux in comparison to untreated
cells. Previous experiments demonstrated the effect of DHA in cell culture,
where DHA treatment of human neuronal M17 cells resulted in a decrease in
the cellular uptake of 65Zn (Suphioglu et al., 2010). Consistent with this in
vivo studies reported a link between DHA and brain zinc metabolism where
mice raised on a DHA-deficient diet had higher hippocampal levels of free
zinc than control animals and where the free zinc was sequestered in the
brain tissue by up-regulation of ZnT3 transporter (Jayasooriya et al., 2005).
A different technique was used to confirm the zinc movement in cultured M17
cells where they were treated with the zinc fluorophore, Zinquin. Free zinc
was predominantly detected in fluorescently labelled cytoplasmic granules,
similar to that reported before "zincosomes" that are known to sequester free
zinc (Zalewski et al, 1993). The level of fluorescence in the M17 cells was
increased upon addition of 5μM extracellular zinc, indicating an increase in
intracellular free zinc located in zincosomes. The addition of DHA to zinc
treated cells resulted in a decrease of Zinquin fluorescence within first 30
minutes and when the DHA was removed, the Zinquin fluorescence
162
increased over the next few hours and by 12 to 24 hours, it returned to levels
seen in the absence of zinc. This is consistent with the 65Zn efflux results, an
observation where DHA inhibits zinc uptake and promotes zinc efflux
(Suphioglu et al., 2010). Removal of DHA resulted in restoration of the
intracellular zinc which commenced within hours and was complete over 24
hours. The cellular basis of the DHA effect is not clear but as it occurs over a
relatively short time it may involve a direct effect on membrane dynamics
rather than through an effect on gene expression. A direct effect of DHA on
membrane structure/function is possible and this may regulate the function of
transmembrane transporters including the ZnT’s but how specific this effect is
not clear. It has been observed that hydroxyl derivative of DHA (2-
hydroxyldocosahexaenoic acid) OHDHA can change the brain membrane
lipid composition by increasing the concentration of long chain PUFA in the
brain of a transgenic mouse model of Alzheimer’s disease (Torres et al.,
2013).
DHA may have long-term effects on cell membranes. An example of this is a
study where the phosphatidylserine (PS) content was increased post 24
hours DHA treatment and up to 48 hours and was found to modulate/facilitate
signal transduction pathway in neuronal membranes (Kim et al., 2000). There
are many examples of DHA-induced activation of molecules including DHA
playing a role in signal transduction pathways by increasing the
phosphatidylserine (PS) content in neuronal membranes which then can
promote the activation of Raf-1 and PI-3 kinase pathways (Kim et al., 2000;
Akbar and Kim 2002). Such evidence suggests that long term effect of DHA
treatment could be mediated by the transporters.
163
DHA treatment induced neurite outgrowth and branch formation of M17
neuronal cells that is consistent with previous reports. In vitro studies show
DHA enhances the NGF-induced neurite growth in PC12 cells (Ikemoto et al.,
1997). DHA supplementation in cultured foetal mouse brain cells can
stimulate the proliferation of neuronal cells (Bourre et at.,1983). Addition of
DHA promotes the extension of neurite length and number of branches in rat
hippocampal neuronal cells (Calderon and Kim 2004; Calderon and Kim
2007). Raf-1 and PI-3 kinase pathways have been shown to be engaged in
induction of neurite growth in H19-7 and PC12 hippocampal cell lines (Wood
et al., 1993; Kuo et al., 1996; Kobayashi et al., 1997; Kita et al., 1998).
Additionally following DHA deficiency, reduction of neurotrophic factor NGF in
hippocampus reduced the neurite and dendrite development (Ikemoto et al.,
2000). The effect of the DHA may be to induce neurite outgrowth to maximise
the cell surface area for uptake and efflux.
Zinc treatment did not affect neurite outgrowth in our experiments on M17
cells. However, Zip12 a putative zinc uptake transporter was needed for
neurite growth in frog suggesting that zinc is required for neurite outgrowth in
some systems (Chowandisai et al., 2012). The different transporters perform
specific functions in different cell lines. ZnT3 stores zinc in the synaptic
vesicles and ZnT5 and ZnT6 are known to provide zinc in trans-Golgi and
endoplasmic reticulum for making it available for TNAP (Tissue Non-Specific
Alkaline Phosphatase activity) which is then released into the cytoplasm,
probably by ZIPs. Studies have been carried out in rodents where low dietary
zinc intake in rats and mice impairs neurite outgrowth in the brain (Gao et al.,
2009; Dvergsten et al. 1984). CREB (Cyclic AMP Response Element-Binding
164
Protein) activity and neurite outgrowth are closely associated during neuronal
differentiation. RA induces rapid CREB phosphorylation which is a critical
step that controls CREB transcriptional activity and neurite outgrowth (Canon
et al., 2004)
The alterations of zinc fluxes may be mediated by members of the ZnT
family, thus DHA may influence zinc transport via controlling zinc transporter
expression. RARES are promoter sequences that are binding sites for RXR,
a nuclear transcription factor/nuclear hormone receptor that can be activated
by DHA (Lengqvist et al., 2004). RXR regulates many cellular processes
including differentiation. RXR can bind to DNA as a homodimer, heterodimer
with other nuclear receptors or as a monomer resulting in activation of
different signalling pathways (Mangelsdorf and Evans, 1995) (Chen et al.,
1998). hZnT5 has three RAREs and hZnT6 has seven RAREs binding sites
in the promoter region. Thus it is possible that DHA regulates ZnT5/ZnT6
transcription and hence can influence zinc fluxes.
The physiological effect of RXR action has been demonstrated where DHA
was shown to be a natural endogenous ligand that binds directly to the LBD
(Ligand Binding Domain) of RXR in mouse brain (De Urquiza et al., 2000).
DHA has potential effects on RXR mediated gene transcription in vivo by
playing an important role as an active signalling receptor complex (Lengqvist
et al., 2004). RXR is also involved in nervous system development (Solomin
et al., 1998; Mascrez et al., 1998). DHA is known to generate derivatives or
metabolites during the cell culture that can activate RXR (Mukherjee et al.,
2004).
165
Toshiyuli (2011) proposed a theory, where intracellular signals can be
affected by (EZS) transcription independent Early zinc Signalling and (LSZ)
transcription dependent Late zinc Signalling. ESZ happens within several
minutes upon extracellular stimulation and in LZS, intracellular zinc levels are
altered several hours after extracellular stimulation, through changes in zinc
transport expression. The external stimulus could be an RXR ligand eg DHA,
that may induce the transcription of zinc transporters by activation of RXR in
the LZS pathway, which occurs after few hours and is consistent with our
results. In the presence of DHA that acts as a true RXR ligand, gene
expression gets turned on by converting RXR apo-LBD (ligand binding
domain) to the holo form thus activating the formation of co-activator
complexes with histone acetyltranferase, to decompress/open chromatin that
will initiate or trigger transcription and hence translation (Moras and
Gronemeyer 1998) of ZnT5 and ZnT6 genes. Also this is supported by
previous study where DHA induces histone acetylation (Sadli et al., 2012),
and reduces hyperphosphorylation (Torres et al., 2013), but it still does not
explain involvement of zinc in DHA dependent transcription.
Zinc deficiency down-regulates the expression of RXR and impairs
differentiation of human neuronal precursor cells (Gower-Winter et al., 2013).
Reduced zinc availability impairs the ability of RXR to bind to response
elements altering the transcription of target genes, which would reduce the
ability of (RA) retinoic acid (agonist to DHA) to promote neuronal
differentiation that is needed for the mouse development and adult
neurogenesis (Morris and Levenson 2013). Zinc deficiency impairs the ability
of retinoic acid to induce differentiation in the human neuronal cell line (NT2)
166
which confirms that zinc plays a vital role in cell differentiation in similar way
as DHA (Gower-Winter et al., 2013). Furthermore zinc deficiency causes
apoptosis in mouse brain (Gao et al., 2009).
The zinc transporters ZnT5 and ZnT6 showed significant increased
transcriptional and translational expression levels with high doses of DHA (15
& 20μg/ml) in the presence of zinc. Our results suggest that zinc is required
for the DHA effect and under physiological zinc (5μM) levels and high doses
of DHA, DHA acts as a ligand and binds to RXR via LBD (Ligand Binding
Domain) which further binds to DBD (DNA Binding Domain) which has a
conserved consensus sequence complimentary to the RAREs present in the
promoter region of hZnT5 and hZnT6 genes. Zinc being a metal binds to
Metal Responsive Elements (MRE) and probably forms complexes with
RAREs to initiates transcription and hence can affect the protein expression
of these transporters.
The 10 μM DHA increased hZnT5 expression but had no effect on hZnT6
levels. Therefore the increased efflux in the presence of zinc could be a
result of increased ZnT5 protein levels. ZnT5 and 6 are known to form
heterodimers within the early secretory pathway and this oligomerization is
required for their zinc transport function (Kambe T, 2012). The ZnT5/6
heterodimer transports zinc from the cytosol into vesicles in HeLa cells
(Kambe et al., 2002). ZnT6 is not directly involved in zinc transport across the
cell membrane as it does not have a zinc-binding site within the TMDs due to
the lack of conserved hydrophilic residues but it may function as a modulator
(Fukunaka et al., 2009). Thus if one of either hZnT5 or hZnT6 protein is
167
reduced it may impair the function of the dimer in transporting zinc.
α-Tocopherol (Vitamin E) is a lipid soluble antioxidant and has been found
together with PUFA-enriched phospholipid domains of the cell membrane by
co-localization studies (Atkinson et al., 2010). Vitamin E deficiency during
embryogenesis depleted DHA and arachidonic acid, and increased hydroxy-
fatty acids derived from these PUFA, suggesting that vitamin E is necessary
to protect these critical fatty acids (Lebold et al., 2013). To determine the
effect of vitamin E on DHA treatments, cells were treated with and without
DHA and vitamin E but no changes were observed with the addition of
vitamin E.
M17 cells showed no effect of DHA on ALP activity. This means that the
increase in hZnT5 and hZnT6 caused by DHA does not affect the delivery of
zinc to ALP and its subsequent function.
DHA did not induce modifications in alternative splicing of hZnT5 and hZnT6
nor did it alter the localisation of the proteins within cells. Both hZnT5 and
hZnT6 proteins showed a granular cytoplasmic, perinuclear localization.
Splice variants of ZnT5 affecting the 5’ and 3’ regions have previously been
found in Caco-2 cells, where one form contained all 17 exons, while the other
lacked exons 1, 2, 4 and exons 15-17, (Jackson et al., 2007; Thornton et al.,
2011). Even though no changes were observed in addition to DHA, RT–PCR
of the coding regions did show additional splice variants along with full length
expression indicating the possible additional roles of protein products of the
splice variants for hZnT5 and hZnT6 transporters, in processes different than
just pumping zinc in and out of the cell.
168
5.4 Conclusion
Significant increase in efflux of zinc with addition of DHA indicates
involvement of DHA in zinc transport across the plasma membrane. Higher
mRNA and protein expression with higher doses of DHA in the presence of
zinc suggests that DHA acts as a ligand for the activation of RXR which then
could turn on gene expression by interaction with RAREs and MREs present
within close proximity of transcription binding factor complexes in the
promoter region of ZnT5 and ZnT6 genes. There appears to be a short-term
effect of DHA visualised by Zinquin staining, but there may also be possible
longer-term effects mediated by ZnT5 protein.
CHAPTER 6
In silico molecular characterization of ZnT family
members
170
6.1 Introduction
Zinc transporters in mammals are classified into two metal transporter
families, the ZIP (ZRT/IRT-like proteins) and Cation Diffusion Facilitator (CDF
families) (Kambe et al., 2004; Liuzzi & Cousins, 2004). In bacteria, the ABC
transporters and P-type ATPases have been shown to function as zinc
transporters (Hantke K, 2001) but neither of them plays a physiological role in
zinc transport in eukaryotes (Gaither et al., 2001).
The Cation Diffusion Facilitator family was first established as a group that
encoded proteins that confer metal resistance to cells (Nies and Silver,
1995). The members of this large superfamily share similar topology across
diverse range of organisms including bacteria, fungi, nematodes, insects,
plants and mammals (Haney et al., 2005). The CDF family is also assigned
as solute carrier 30 (SLC30A). More than 100 members of the SLC30 family
are found in organisms at all phylogenetic levels. This family is divided into
three subfamilies. Subfamily I consists a large proportion of prokaryotic
members, whereas subfamily II and III contains eukaryotic and prokaryotic
members in a similar proportion (Gaither and Eide, 2001).
Ten different SLC30A (ZnT) members have been reported to date that
belong to the Zn-CDF group of CDF superfamily (Mountanini et al., 2007).
ZnT transporters are considered to mobilize zinc under physiological
conditions across the biological membranes (Fukada & Kambe, 2011;
Montanini et al., 2007). However recent reports have suggested that ZnT10
plays an important role as a manganese (Mn) transporter as when defective,
this gene causes Mn accumulation in liver and brain (Quadri et al., 2012;
171
Tuschl et al., 2012). Similarly ZnT4 can bind to other divalent cations such as
copper, nickel and cobalt (Murgia et al., 1999).
The x-ray structures of ZnT members have not yet been confirmed but
sequence homology to the Yiip crystal structure in E.coli helped researchers
to understand the function of these transporters (Lu and Fu, 2007).
Fluorescent imaging showed mammalian ZnT-mediated zinc transport is
catalysed by H+/Zn2+ exchange and identify the zinc binding site of ZnT
proteins that are essential for zinc transport (Ohana et al., 2009). Similar
studies in bacteria, yeast and plant ZnT homologues support this notion
(Guffanti et al., 2002; Kawachi et al., 2008; MacDiarmid et al., 2002).
The main aim of this study is to understand the relationship between different
members of ZNT family on the basis of their structure and similarity not just
by comparing with the coding region but by taking into the consideration of
important regulatory factors present in the promoter region. An analysis was
carried out on all members of the ZnT family using different softwares, for
prediction of their structure and transmembrane domains after comparing
sequence homology to YiiP. In the current study both coding and promoter
regions were analysed to characterize individual members within different
families. Other factors that played an important role in the overall regulation
of these genes/transporters were also considered as the part of analysis that
include transcription binding factors and microRNA’s.
172
6.2 RESULTS
6.2.1 Characteristic features of ZnT family members
A total of 10 different members of ZnT family have been characterised so far.
All members are present on different chromosomes either on the minus or
plus strand of the DNA. Most ZnT genes encode for one transcript but there
are some that can have different variants, for example ZnT2 (SLC30A2) and
ZnT5 (SLC30A5) have 2 variants and ZnT6 (SLC30A6) have 3 variants.
A characteristic feature of this family is the presence of 6 transmembrane
domains (TMD) with the exception of ZnT5 (SLC30A5) that has 15 and ZnT3
(SLC30A3) with 4 TMD. All members of the family have different no of exons
that give rise to total amino acid sequence (Table-6.1).
Out of ten distinct ZnTs, ZnT9 has not been described in detail, hence exon–
intron structure analysis was performed in the current study. A schematic
presentation of ZnT9 showed a total of 18 exons located on chromosome 4
at the plus strand encoding 568 amino acids (Figure 6.1). The total length of
the exons in base pairs (bp) is provided underneath the boxes.
6.2.2 Transmembrane domain (TMD) analysis of ZnT members
Transmembrane domains were analysed using TMHMM (Transmembrane
Hidden Markov Model) online database. The characteristic feature of ZnT
family members is the presence of 6 TMD with both C and N terminals facing
the cytoplasmic side (Figure 6.2a).
Table 6.1 Characteristic features of ZnT family members.
10 members of ZnT family were analysed to show their position on
chromosome, number.of exons, transmembrane domains (TMD), number of
variants and total number of amino acids contributing to the full length
protein.
173
Figure 6.1 Diagram to illustrate Intron-Exon structure of ZnT9
A total of 18 exons of ZnT9 gene interspersed by introns were found on
chromosome 4. The width of the exon boxes represents the length of
individual exons. The exact length in base pairs (bp) of each exon is written
underneath the box.
174
Figure 6.2 Analysis of transmembrane domains of ZnT
members
(ai) Six transmembrane domains of the ZnT members is shown in red,
cytoplasmic loops and C and N terminals are shown in blue and green
fragments represents extracellular loops.
(aii) The exact location of start and finish of transmembrane domain, inside
and outside loops for all ZnT members is compiled in table form. TMD2 and
TMD6 are highlighted for ZnT3 as low probability prediction by using TMHMM
software. Allocation of ZnT members in four different Groups on the basis of
TMD analysis is shown by different colours shading.
175
176
Using TMHMM data base, most of the members comply with the
characteristic feature of having six TMD with following exceptions: ZnT3
having 4 TMD with high probability and 2 with low probability, ZnT9 with 5
TMD and very unusual ZnT5 with 15 TMD (Figure 6.2.1b, 6.2.2c, 6.2.3d). To
confirm the probability of unusual numbers of TMD’s, another software called
TOPCONS was used for the prediction. Six TMD were predicted for ZnT3
with two additional TMD number 2 and 6 that were predicted with low
probability while the other four were predicted with high probability using
TMHMM database (Figure 6.2.1bi, bii). The two low probability TMD are
highlighted in the table (Figure 6.2aii). ZnT9 showed similar 5 TMD and ZnT5
predicted 16 TMD’s using TOPCONS online database (data not shown). ZnT
proteins usually have long C terminal tails with the longest found in ZnT6
(214 amino acids) and the shortest found in ZnT7 (89 amino acids). The
length and the amino acid sequences upstream of the first trans membrane
domain, at N terminal side varies among different members.
Comparison within all members of the ZnT family on the basis of total
number of TMD’s and their individual location, reveals four different groups.
Group II consist of, ZnT2, ZnT8, ZnT3 and ZnT4 that shows high similarity to
each other. Similarly, Group I comprises ZnT1 and ZnT10. ZnT6 and ZnT7
have been put in Group III where TMD’s position is very similar and the
fourth category Group IV consists of transporters that did not match to the
rest of the members and comprises ZnT5, ZnT9 and with additional splice
variants of ZnT2 and ZnT5. The table of comparison highlights all different
groups with different colours and position of trans membrane domains within
N and C terminus (Figure 6.2aii).
Figure 6.2.1 Analysis of transmembrane domains of ZnT3
(bi) Graphical representation of TMHMM data showing 4 TMD for ZnT3
transporter with C and N terminals inside the cell.
(bii) Graphical representation of TOPCON data showing 6 TMD for ZnT3
transporter with C and N terminals inside the cell.
177
Figure 6.2.2 Analysis of transmembrane domains of ZnT9
(c) Graphical representation of ZnT9 transporter showing 5 TMD’s with C
terminal facing outside the cell using TMHMM data.
178
Figure 6.2.3 Analysis of transmembrane domains of ZnT5
(di) Graphical representation of ZnT5 showing 15 TMD with C-terminal
outside the cell and N-terminal being inside.
(dii) Schematic presentation of TMD structure of ZnT5, stating the starting
point of each TMD from starting codon and total length underneath in base
pairs.
179
180
6.2.3 Identity/Similarity Matrix Results
Analysis of all members of ZnT family was performed using MatGAT
software to test for similarity and identity in the coding and promoter region.
The matrix of the coding region showed maximum similarity for ZnT2, ZnT3,
ZnT4 and ZnT8. ZnT9 was least similar to any rest of the transporters among
ZnT family (Figure 6.3a). When the promoter region was analysed, ZnT1,
ZnT2 and ZnT3 were similar and ZnT7 was the least similar to the rest of the
family members (Figure 6.3b).
6.2.4 Phylogenetic analysis of SLC30 (ZnT) family members
To investigate potential evolutionary relationships, human SLC30 proteins
were aligned using clustal X and a phylogenetic tree was constructed using
Neighbor-joining (N-J) algorithm. The robustness of the tree was confirmed
by the relatively high bootstrapping values for each branch and by comparing
it to the parsimony maximum likelihood PHYLIP 3.68 algorithm, which
produced a similar branching structure (data not shown). After analysis
different members were classified to different groups according to the
sequence similarity between them. Group I comprises ZnT2, ZNT3, ZnT4
and ZnT8, Group II has ZnT1 and ZnT10, Group III with ZnT5 and ZnT7 and
Group IV ZnT6 and ZnT9 (Figure 6.4).
6.2.5 Analysis of promoter region
The promoter region of a gene is considered as non-coding, but still can
regulate gene expression, as it consists of binding sites for transcription
Figure 6.3 Identity/Similarity Matrix
MatGAT v2.0 output matrix showing identity/similarity of ZnT family
members. The upper matrix contains the identity of the data set and the
lower is the similarity. (a) is showing identity and similarity data of coding
region from 10 different transporters from ZnT family (b) is showing
identity/similarity data of promoter region (4000bp from start codon) from 10
different transporters of ZnT family.
181
Figure 6.4 Phylogenetic tree of the ZnT family members
Amino acid sequences of human ZnT proteins were collected and aligned
using Clustal X, and a phylogenetic tree was generated using the Neighbor-
joining (N-J) algorithm and visualized with the Tree View program. Branch
labels indicate the robustness of the tree over 100 bootstrap replicates, while
the scale bar indicates an evolutionary distance of 0.05 amino acid
substitution per site.
182
183
factors. To analyse the important transcription binding factors (TBF) for all
members of ZnT family, 4000bp upstream of translation start site were
scanned manually. Metal Responsive Elements (MRE) and hormonal
influenced transcription binding factors like Estrogen Responsive Elements
(ERE), Gonadotrophin Responsive Elements (GRE), Insulin Responsive
Sequence (IRS) and Retinoic X Receptor (RXR), Stat-5 were analysed in this
study. TATA and CTC box are considered as the start of initial transcription
complex, hence they were also analysed. Some of the TBF had multiple
binding sites present in some of the transporters. Data on the presence of
TBF sites in promoter region of ZnT family members along with their
individual position from the start of translation start site (+1 ATG) is
summarised in Table 6.2i. ERE and PRE transcription binding factor sites
have long conserved sequences interspersed with random 3 nucleotides in
between them. The position of the individual consensus sequence for half
binding site is summarised in Table 6.2ii for all members of the ZnT family.
6.2.6 Syntany analysis of transcription binding factors in
promoter region of ZnT family members
Syntany analysis was performed on important transcription binding factors
sites (mentioned in previous section) present in the promoter region of all
reported ZnT’s. A schematic diagram was created showing similarity among
TBF present in different transporters (Figure 6.5). The TATA box was
considered a standard centre point and other transcription factors were
arranged around in the order of their occurrence in the promoter region.
Table 6.2 Important transcription binding factors among all
ZnT members
Table is showing important transcription binding factors of ZnT1 to ZnT10
along with their conserved binding sequence and number of times they are
present in the promoter region (4000bp) upstream from translation start side.
Their individual positions are also specified in base pairs from the start point.
TATA and CTC box that are considered to be the start of transcription along
with Metal Responsive Elements (MRE), Stat-5 and other hormonal
influenced transcription binding factors like Estrogen Responsive Elements
(ERE), Gonadotrophin Responsive Elements (GRE), Insulin Responsive
Sequence (IRS) and Retinoic X Receptor (RXR) have been summarised in
(Table 2i). ERE and PRE have long conserved site with two core segments
interspersed with three nucleotides between them. These half sites have
been highlighted with different colours and their positions are specified
underneath for all transporters with multiple existence in the promoter region
(Table 2ii).
184
185
Figure 6.5 Microsyntany analysis of transcription binding
factors present in promoter region of ZnT family
members
Schematic representation of important transcription binding factors present in
the promoter region among all members of ZnT family. The TATA box is
located in the centre of the diagram and the transcription factors are arranged
in relation to their proximity in the promoter region. MRE along with other
hormonal influenced transcription binding factors like ERE, GRE, IRS and
Stat-5 are considered in this diagram. After alignment, ZnT’s have been
classified in different subfamilies represented by different colours, according
to similarity of TBF sites arrangement between different members.
186
187
In the case where more than one TATA box was present for different ZnT
transporters, the closest to the translation site was considered for the
analysis. MRE along with other hormonal influenced transcription binding
factors like ERE, GRE, IRS and Stat-5 were considered in this analysis. After
alignment, transporters were been sorted/allocated to different subfamilies
according to their similarity in TBF sites occurrence in their promoters.
ZnT2/3/4 and ZnT8 were grouped together in Group I. ZnT1/10 were placed
in Group II, ZnT5/7 in Group III and ZnT6/9 in Group IV.
6.2.7 Analysis of miRNA in the 3’ region of ZnT family
members
Micro RNA’s ‘miRNA’ binding sites, are present in the 3’ end of the
untranslated regions of the gene and plays an important role in providing
stability. All members of SLC30A family were analysed using online
“miRBase” database and out of total 10 transporters ZnT3, ZnT5 and ZnT6
showed presence of single miRNA binding sites in Homo sapiens. The
position of miRNA sites in respective transporter was counted from the start
of translation and is shown in Table 6.3. ZnT7 did not have any reported
miRNA binding site in Homo sapiens but showed their presence in Mus
musculais and Canis familaris. Similarly ZnT3 shows additional miRNA
binding sites in Mus musculais and ZnT5 and ZnT6 in Pan troglodytes.
Details on all reported miRNA are summarised in Table 6.3.
Table 6.3 miRNA binding sites in 3’ region of ZnT family
members
Table showing reported miRNA sites present in different ZnT members along
with detailed information about their position and location on plus or minus
strand on the respective chromosomes. The bolded miRNAs in ZnT3, ZnT5
and ZnT6 have been reported previously in Homo sapiens. Position shown in
+number represent the prensence of miRNA from the start codon for
respective transporter. Additional miRNA shown in table (non-bolded) have
also been reported in other species like Mus musculais, Pan troglodytes and
Canis familaris.
188
189
6.2.8 Predicted three dimensional structure of ZnT’s
The three dimensional structures of ZnT transporters were predicted using
Cn3D 4.3.1software, after submitting PDB files generated from sp3 structure
prediction database. The list of neighbours were sorted by Z-score value (a
measure of the statistical significance of the result relative to an alignment of
random structures already reported in database). A match was considered
significant if the ZSCORE value was greater than 6.3. Out of all ZnT
members only four members came up with a significant ZSCORE, ZnT2
(6.52), ZnT3 (17.19), ZnT6 (6.95) and ZnT8 (6.74). Out of these four
transporters ZnT3, ZnT2 and ZnT8 showed homology with YiiP, ZnT
homologue in E.coli. ZnT6 showed similarity with mosquito-larvicidal Cry4aa
toxin from Bacillus thuringiensis (Boonserm et al., 2006).
In the three dimensional predicted structures generated using Cn3D
software, TMD’s were highlighted in yellow colour according to analysis using
THMM software. ZnT2 (Figure 6.6.1a), ZnT6 (Figure 6.6.2d) and ZnT8
(Figure 6.6.2c) showed six TMDs, which is a characteristic feature of this
family but ZnT3 (Figure 6.6.1b) showed four TMDs with high probability
(showed in yellow) and 2 with low probability (blue). As YiiP acts as a ZnT’s
homologue in E.coli, ZnT2, ZnT3 and ZnT8 were considered for further
analysis. Even though six TMDs were highlighted in predicted three
dimensional structure of ZnT6, the topology would not be considered
relevant, as it’s prediction is based on mosquito larvicidal Cry4aa toxin from
Bacillus thuringiensis which, phylogenetically is different to ZnT’s.
Figure 6.6.1 Predicted 3-dimensional structures of ZnT2 and
ZnT3
Diagram of three dimensional structure of ZnT2 (a) and ZnT3 (b) generated
by Cn3D 4.3.1software with sequence homology to YiiP. TMDs are
highlighted in yellow and numbered from T1-T6. ZnT3 which has four TMD’s
with high probability, shown in yellow are numbered and additional two TMD’s
with low probability shown in blue (b). Identical residues are highlighted with
red colour.
190
Figure 6.6.2 Predicted 3-dimensional structures of ZnT8 and
ZnT6
Diagram of three dimensional structure of ZnT8 (d) generated by Cn3D
4.3.1software with sequence homology to YiiP and ZnT6 (c) to mosquito-
larvicidal Cry4aa toxin from Bacillus thuringiensis. TMDs are highlighted in
yellow and numbered from T1-T6. Identical residues are highlighted with red
colour.
191
192
As the ZSCORE value was maximum for ZnT3, it was analysed in detail. All
of transporters are considered to form dimers with themselves (homo-dimers)
similarly to YiiP or between other members (hetero-dimers) for example
ZnT5/ZnT6.
Considering the highest similarity of ZnT3 with YiiP, homodimer formation
was analysed using YiiP sequence in 3-D structure (Figure 6.7). Chain A and
chain B representing each subunit/protomer from YiiP and Chain A from
ZnT3 transporter superimposed on YiiP on right side. The identical regions
between YiiP and ZnT3 were highlighted with red colour and transmembrane
domains were represented by pink colour and numbered 1 to 4 on right hand
side when aligned with YiiP structure having six transmembrane helixes,
represented by blue colour. α helices and β strands in C-terminal domain
(CTD) are labelled as H1 and H2 and S1 to S3 respectively. Zinc ions are
represented by grey spheres and labelled as Z1 to Z4 as there are four zinc
binding sites for Yiip’s and ZnT’s. Out of four sites Z1 is the known conserved
zinc binding site for ZnT’s (Lu and Fu 2007).
Figure 6.7 Homology Model of ZnT3 homodimer
The homology modelling was based on the crystal structure of YiiP and was
generated by the Cn3D 4.3.1 program. ZnT3 viewed from membrane plane
showing homo-dimers. Zinc ions are represented by grey spheres and are
labelled as Z1 to Z4. Transmembrane domains of ZnT3 are represented by
pink colour and numbered 1 to 6 on right hand side when aligned with YiiP
structure by X-ray crystallography having six transmembrane helixes
(represented by blue colour). Alpha helices and β strands in C-terminal
domain (CTD) are labelled as H1 and H2 and S1 to S3 respectively.
193
194
6.3 DISCUSSION
ZnT members (SLC30A family) are named starting from ZnT1 to ZnT10
based on their order of characterization (Palmiter and Huang, 2004). Out of
all members, exon-intron structures have already been described, except for
ZnT9 (Seve et al., 2004)
ZnT9 consists of 18 exons present on chromosome 4 at the + strand with 5
transmembrane domains and total length of 568 amino acids. ZnT9 was first
described as a human HUEL protein (Sim and Chow, 1999). ZnT9 has
stretches of homology to cation efflux domain pfam01545 and has been now
renamed as GAC63 because it acts as a component of the p160 co-activator
signal transduction pathway (Chen et al., 2005), and considered a misnomer
(where classification was inappropriate) in relation to being a member of ZnT
(Kambe, 2012).
Phylogenetic analysis along with Similarity/identity matrix, characterises ZnT
protein members into 4 groups according to their sequence homology to
each other. ZnT2/3/4 and ZnT8 were put together in group I, ZnT10/1 in
group II, ZnT5/7 in group III and ZnT6/9 in group IV. Similar results have
been reported recently where different members have been characterized in
subgroups or subfamilies (Kambe, 2012; Huang and Tepamorndech, 2013).
The characterization indicates that during evolution they have been
diversified to perform different functions in tissue specific manner.
195
The three dimensional structures of ZnT transporters have not yet
determined but the characteristic feature of this family is the presence of 6
TMD (transmembrane domains) with cytoplasmic C and N terminals. All
members comply with this topology with the exception of ZnT9 and ZnT5 that
are predicted to have an odd number of TMD, 5 and 15 respectively and the
C terminal remains outside the cell. ZnT5 is the longest among all
transporters of ZnT family with total of 765 amino acids. The carboxyl-
terminal with 365 amino acid residues consists of 6 TMD as a characteristic
feature of all members along with an exceptionally long amino terminal
consisting of additional nine TMD fused to the conserved six TMD at the N-
terminal end of the protein (Kambe et al., 2002). The function of this
additional region is not known. The predicted protein size for ZnT5 is 84 KDa
but none of the reported studies showed that high size instead different
reports showed a band size around 55 KDa, suggesting that not all of the
exons may be present in the mature protein. ZnT3 showed 4 TMD with high
probability with two additional TMD with low probability. As for ZnT3 it has
been reported to have 6 TMD. Another software called “TOPCONS” was
used in the current study to confirm the prediction and 6 TMD were predicted
with same additional low probability TMD numbered two and six. ZnT9
prediction of 5 TMD domains was the same using this additional prediction
software.
Most ZnT members have a histidine rich loop with an HX1-6H cluster (H is
histidine and X is often serine and glycine) between TMD IV and V that is
exposed to cytoplasm. This region is absent in ZnT6 and instead it has
196
serine-rich region (Fukanda and Kambe, 2011; Kambe et al., 2004). Deletion
and mutational analyses of this loop in ZnT transporters suggests that it
plays a key role as a potential zinc binding site or might be involved in zinc
delivery from cytoplasm to zinc binding site within TMDs (Kawachi et al.,
2008; Suzuki et al., 2005a). ZnT6 is not directly involved in transport of zinc
(Discussed in chapter 4 and chapter 5). His-rich region of AtMTP1 (metal
tolerance protein in Arabidopsis thaliana) acts as a buffering pocket to catch
and stock zinc in the vacuole and acts as a sensor of the cytoplasmic free
zinc ions (Kawachi et al., 2008). Similarly His-rich loop in ZnT5 is essential
for the activation of TNAP (tissue non-specific alkaline phosphatase) (Suzuki
et al., 2005b)
Both N and C terminals play an important role in zinc transport across the
cell membrane and ensure the structural stability of proteins. If there are
alterations in either of the region, transporters do not function properly, as it
was illustrated by deletion of C-terminal tail of ZnT1 and ZnT5 that produced
a toxic phenotype, where cells could not survive as this region is important
for the stability of the protein structure. Similarly at N-terminal deletion of the
first TMD of ZnT1 resulted in zinc sensitivity and deletion of first two
membrane spanning domains resulted in non-functional molecule (Fukunaka
et al., 2009; Palmiter and Findley., 1995). Consistent with these findings the
ZnT3 C-terminal region regulates intracellular zinc trafficking by forming a
covalent di-tyrosine bond in response to oxidative stress (Salazar et al.,
2009). The C terminal region of ZnT5 plays an important role in formation of
hetero-oligomer complex by identifying ZnT6 as a partner molecule
197
(Fukunaka et al., 2009). Interaction between ZnT1 and protein kinase Raf-1
also demonstrated the importance of C-terminal region in protein-protein
interactions where Raf-1 binds to the carboxyl-terminal of ZnT1 and its
activity is dependent on Znt1 function (Jirakulaporn and Muslin, 2004).
The function of some ZnT transporters can be related to the post
transcriptional modifications that create different splice variants of ZnT
transporters that might show different topology by lacking TMDs but still
retain their zinc transport activity. For example ZnT2 has two different
isoforms ZnT2-1 (long form) and ZnT2-2 (short form), and both forms are
functional and transport zinc to the secretory granules (long form) and to the
plasma membrane (short form) (Lopez and Kelleher, 2009). ZnT5 has two
isoforms; one is present in the trans-Golgi and forms heterodimers with ZnT6
to work as a zinc efflux; another splice variant, ZnT5B (hZTL1) is localized in
the plasma membrane and function as zinc uptake from the extracellular
environment, which is contradictory to function of all other members of ZnT
family (Valentine et al., 2007: Crag et al., 2002). ZnT5B has unique
characteristic features where it lacks 171 amino acids at N-terminal and
cytosolic C-terminal tail and instead has a non-conserved extra TMD at C-
terminal. Fukunaka, (2009) suggested that changes in C-terminus of ZnT5
transporter could make the topological changes in domains and can lead to
different localisation pattern of resulting proteins
Posttranslational modifications have been proposed for some transporters for
example ZnT6 produced different size proteins in different tissues (Huang et
al., 2002), but their exact functions are not known. ZnT2 is the only confirmed
198
example showing posttranslational modifications, where glycosylation
resulted in 52 kDa band size instead of non-glycosylated 42 kDa (Kelleher
and Lonnerdal, 2003).
Oligomerization is crucial for the zinc transport activity of ZnT transporters.
Most of the ZnT transporters form homo-dimers, apart from ZnT5 and ZnT6
which form heterodimers. In homodimer formation each oligomer contains a
zinc binding site within the TMDs. ZnT6 lacks that conserved hydrophilic
residues in TMD and is not directly involved in zinc transport across the cell
membrane but might function as modulator/facilitator (Fukunaka et al., 2009;
Fukunaka et al., 2011). Another recent study also highlights the possibility of
ZnT3 and ZnT10 forming an hetero-oligomer to prevent the increase in
reactive oxygen species (ROS) levels by modulating the expression of
catalse, although how these complexes may function is yet unknown
(Patrushev et al., 2012).
In analysing protein origin or phylogeny, the major emphasis is concentrated
on the coding region as the Open Reading Frame (ORF). New research
indicates the importance of the promoter region, where the surroundings of
the ORF may have a great impact on the regulation of the coding region. The
surrounding sequences of the ZnT transporters were analysed by looking for
the important transcription binding factor sites present in the promoter region
at the 5’ end and for micro RNAs present in the 3’ end that could play a vital
role in the regulation of different genes. For example miR-373 induces
tumour growth in pancreatic cancer, where zinc transporter ZIP4 activates
the zinc-dependent transcription factor CREB and requires this transcription
199
factor to increase miR-373 expression through the regulation of its promoter
(Zhang et al., 2013). Similarly miR-488 regulates zinc transporter ZIP8 during
osteoarthritis (Song et al., 2013). All reported micro RNA’s in ZnT
transporters have been listed in table 3 in different species along with Homo
sapiens. Similarly TBF’s present in the 3’ promoter region play an important
role in regulation of different genes. After arranging hormonally influenced
transcription binding factor sites around the TATA box (start of transcription),
a similar arrangement of their occurrence based on presence of TBF sites
showed the same characterisation in different groups of ZnT transporters as
for the coding region (Figure 6.5).
The 5 and 3 prime regions of all known transporter 3D structures were
analysed using online databases. Similarities with Yiip were seen and the
TMD were highlighted according to the TMHMM analysis (Figure 6.2aii). The
X-ray structure of Yiip has been determined (Lu and Fu, 2009; Lu and Fu
2007). Yiip is a ZnT homologue in E.coli and exists as a Y-shaped structure
that forms homo-dimers of two 33 kDa integral membrane proteins, have six
TMD with cytoplasmic C and N terminals.
The YiiP structure has provided a basic platform for researchers to
understand the structural and functional properties of CDF family as most of
the prediction is based on its X-ray structure. Each YiiP protomer/subunit
contains four zinc binding sites. Site A is present within TMD and is
considered as the primary zinc transport site and consist four conserved
hydrophilic residues Asp45, Asp49 in TM2 and His153 and Asp157 in TM5. Site
B resides at the interface between the membrane and cytoplasmic domain.
200
The other two are located in the cytoplasmic domain and considered as site
C which has a metallochaperone like structures with an αββα fold (Lu and
Fu, 2009; Lu and Fu 2007). Site C functions as a binuclear (two zinc binding
sites) zinc-sensing site in the cytoplasmic domain to activate the export of
zinc. Zinc binds at this site and induces a scissor like movement that affects
the helices orientation in TMDs and zinc coordination gets modulated at site
A (Kambe, 2012). In another alternative access mechanism for Zn2+/H+
antiport in YiiP explains that inward and outward facing conformation (Figure
6.8) can bind to Zn2+ or H+. This movement of proton can provide the driving
force to export zinc out of the cytoplasm. (Coudray et al., 2013).
Based on the structure of the YiiP, 3-D models of ZnT3, ZnT5 and ZnT8 have
been generated (Ohana et al., 2009; Salazar et al., 2009; Weijers, 2010).
Sites A is highly conserved among ZnT members. Four hydrophilic residues
in TMDs II and V that are involved in the formation of zinc binding site and
correspond to site A in YiiP, are highly conserved. One aspartic acid is
replaced with histidine in ZnT transporters and hence they have two histidine
and two aspartic acid residues in their TMDs. Mutations in the histidine and
aspartic acid conserved regions for ZnT5 abolish the zinc transport activity
(Ohana et al., 2009) and confirms that these sites Asp599 and His451 are
crucial for the zinc transport activity.
Figure 6.8 Alternating access mechanism for Zn2+/H+ antiport
by YiiP
This mechanism involves inward-facing (A and B) and outward-facing (C and
D) conformations where both inward and outward facing confirmations are
able to bind Zn2+ or H+. The movement of protons provides a driving force to
export Zn2+ out of the cytoplasm. The conformation in A corresponds to that
observed in the helical tubes, whereas the conformation in C corresponds to
the X-ray structure solved in the presence of Zn2+.
201
202
The zinc binding site in the cytoplasmic C-terminal portion that corresponds
to site C in YiiP, has not yet been investigated, hence there is no
confirmation on how ZnT transporters recognise the cytoplasmic zinc
concentration.
However, tyrosine mediated dimerization with putative conserved motif YXXE
at Y357-372 for transporter ZnT3 was observed at C-terminal and it might
play role in zinc transport function (Salazar et al., 2009). Our results for
predicting 4 TMD with high probability and 2 TMD with low probability for
ZnT3 when compared with previous reported 6 TMDs indicated that
predicted 4 TMD’s (high probability) using TMHMM software are same to
previous reported 6 TMD’s with the addition of TMD 2 and 6 with low
probability and still contain all the conserved regions for potential zinc
binding. The variation in results can be explained by the fact that these are
all predictions.
Homology models of ZnT8 with Yiip, predicted that both Arg325 and Trp325
amino acids located in the α2-helix of the C-terminal domain are shielded by
the planar surface of the three cytoplasmic β-strands and probably are
unable to affect the sensing capacity of the C-terminal domain to transport
zinc (Weijers, 2010).
All the data presented indicates that ZnT transporters play crucial role in
physiological and pathological events (Fukunaka & kambe, 2011; Kambe et
al., 2008). Recent work has greatly helped us in understanding their
architecture and functions, but the mechanisms involved in zinc mobilisation
203
and subsequent molecular events are still not fully understood. The main
limitation is lack of X-ray structures for the ZnT transporters. The regulatory
mechanisms involving post-translational modifications have still not been
described for known ZnT’s as compared to ZIPs. For example protein kinase
CK2 mediated phosphorylation was shown to regulate zinc transport by ZIP7
transporter (Taylor et al., 2012).
204
6.4 Conclusion
Overall after comparing promoter and coding region among different
members: ZnT2, ZnT3, ZnT4 and ZnT8 show high sequence homology to
one another, not only by comparing coding region but also similar pattern
were observed for the important transcription binding factors present in the
promoter region, which reinforces that these members can be put together in
Group I. They have very similar structures (3D structure analysis) to deal with
zinc and are under control of similar stimuli of hormones (TBF sites present
in promoter region for different hormones). Belonging to the same group,
hoewever, does not render these transporters to have similar physiological
functions. They are expressed in cell and tissue-specific ways. A different
transport mechanism has been described for ZnT3 in neurons, where the
activity of ZnT3 is increased by direct interaction with a chloride channel 3
(ClC-3), or vesicular glutamate transporter Vglut1 in neuroendocrine PC12
cells (Salazar et al., 2005; Salazar et al., 2004). Similar specific mechanisms
may also operate in other ZnT transporters in a cell or tissue specific
manner. ZnT7 and ZnT5 are put together in Group III. ZnT1 and ZnT10 are
considered in group II even though recent studies revealed the involvement
of ZnT10 in transport of Mn and so this group may potentially be sub-divided
further into separate group. ZnT6 and ZnT9 are put together in group IV with
the consideration that these two are least similar to any rest of the members.
CHAPTER 7
Summary
206
Zinc is an essential trace element that is required for all living organisms. In
recent years the mechanisms underlying zinc transport have received more
attention and molecular approaches have contributed new tools to better
understand the role of membrane-bound zinc transport proteins. The main
aim of my PhD project was to study the zinc transporters from SLC30A (ZnT)
family. The data presented within this thesis contributes to the current
understanding of mechanisms of zinc homeostasis in different human cell
types.
My first approach was to look for defects in the expression of zinc transporter
proteins of the SLC30 family that could contribute to or underlie an inherited
disorder of zinc deficiency that lead to the production of zinc-deficient milk.
We concluded that two cases reported in chapter 3 with neonatal zinc
deficiency are caused by a defect in the transport of zinc into milk with
significant reduction in both ZnT5 and ZnT6 transporters. Defects in these
two transporters have not previously been implicated in neonatal zinc
deficiency. Two additional novel splice variants were identified in fibroblasts
and lymphoblast cells. If more patients with this disorder were available,
further studies could be carried out to determine if they possessed the
methylation changes or mutations in ZnT2 gene, as have previously been
reported for this disorder. A larger cohort should be investigated to truly
demonstrate the observations arose from methylation studies at population
level. To further confirm the methylation effect on zinc transport, methylation
of these genes (ZnT5 and ZnT6) should be tested in culture using the
enzymes for gene methylations.
207
To further investigate the role of ZnT5 and ZnT6, their dependency on each
other was checked in neuronal cells as they are known to play a vital role in
brain. We concluded for the first time that in neuronal cells ZnT6 expression
(mRNA and protein) is dependent on ZnT5 gene. Overexpression and
knockdown constructs of ZnT5 and ZnT6 genes did not show any changes in
the accumulation or efflux of of zinc when compared to empty vectors
suggesting that their main role is not to pump zinc in and out of the cell but
probably to provide the zinc for zinc requiring enzymes for example alkaline
phosphatase by storing them in the vesicles. To understand the zinc wave
mechanism of transcription-dependent late zinc signalling mentioned by
(Fukada et al., 2011), further analysis using 65Zn experiments with additional
times up to 24 hours would provide more insights into ZnT5 and ZnT6-
mediated zinc transportation. There have been other zinc transporters that
have been proven to have some role in neuronal cells. It would be interesting
to know whether they have any relation with ZnT5 and ZnT6 or they work
independently to these two transporters.
After confirming the dependency of ZnT6 on ZnT5, the effect of DHA, a
polyunsaturated fatty acid and zinc was investigated in neuronal cells to
better understand their interactions. We found out that DHA reduces the
intracellular labile zinc pools with increases neurite outgrowth. The
expression levels of ZnT5 and ZnT6 proteins increases with higher DHA
concentrations in the presence of zinc, hence establishing a causal relation
between zinc and DHA metabolism. The DHA induced activation of ZnT5 and
ZnT6 is probably through retinoic acid responsive elements (RARE’s) located
208
in the promoter region of these genes. Future studies could be carried out to
confirm this notion by use of a luciferase assay for the promoter analysis.
The final object of this project was to understand how ZnT5 and ZnT6
transporters are related to rest of the ZnT family members. Our results
obtained by using different variety of bioinformatics softwares confirmed that
they are not similar to each other. ZnT5 showed close similarity with ZnT7
and ZnT6 showed similarity with ZnT9, but these two groups are very diverse
from other members and hence been put in two different subfamilies. Along
with phylogeny tree, to characterize all members in four subfamilies “syntany
analysis” was performed on the basis of occurrence of important transcription
binding sites present in the promoter region. For future studies similar
syntany analysis of ZnT related gene loci (genes present upstream and
downstream) can be analysed, as has previously been shown for Ikaros-
related genes (John et al., 2009). More detailed analysis of individual
members of ZnT family could be performed by identification of specific zinc
binding motifs and how they interact with zinc to transport this metal in and
out of the cell. To further understand their evolutionary history, a comparison
could be performed between ZnT’s and ZiP’s.
References
210
Abraham A.L., Nagarajan M., Veyrieras J.B., Bottin H., Steinmetz L.M. & Yvert G. (2012) Genetic modifiers of chromatin acetylation antagonize the reprogramming of epi-polymorphisms. PLoS Genet 8, e1002958.
Ackland M.L. & Mercer J.F.B. (1992) The Murine Mutation, Lethal Milk,
Results in Production of Zinc-Deficient Milk. J. Nutr. 122, 1214-8. Adlard P.A., Parncutt J.M., Finkelstein D.I. & Bush A.I. (2010) Cognitive loss
in zinc transporter-3 knock-out mice: a phenocopy for the synaptic and memory deficits of Alzheimer's disease? J Neurosci 30, 1631-6.
Aggett P.J. (1991) The assessment of zinc status: a personal view. Proc Nutr
Soc 50, 9-17. Aggett P.J., Atherton D.J., More J., Davey J., Delves H.T. & Harries J.T.
(1980) Symptomatic zinc deficiency in a breast-fed preterm infant. Arch Dis Child 55, 547-50.
Aggett P.J. & Comerford J.G. (1995) Zinc and human health. Nutr Rev 53,
S16-22. Akbar M. & Kim H.Y. (2002) Protective effects of docosahexaenoic acid in
staurosporine-induced apoptosis: involvement of phosphatidylinositol-3 kinase pathway. J Neurochem 82, 655-65.
Ando A., Kikuti Y.Y., Shigenari A., Kawata H., Okamoto N., Shiina T., Chen
L., Ikemura T., Abe K., Kimura M. & Inoko H. (1996) cDNA cloning of the human homologues of the mouse Ke4 and Ke6 genes at the centromeric end of the human MHC region. Genomics 35, 600-2.
Anton A., Grosse C., Reissmann J., Pribyl T. & Nies D.H. (1999) CzcD is a
heavy metal ion transporter involved in regulation of heavy metal resistance in Ralstonia sp. strain CH34. J Bacteriol 181, 6876-81.
Aschner M. (1996) The functional significance of brain metallothioneins.
FASEB J 10, 1129-36. Atherton D.J., Muller D.P., Aggett P.J. & Harries J.T. (1979) A defect in zinc
uptake by jejunal biopsies in acrodermatitis enteropathica. Clin Sci (Lond) 56, 505-7.
Atkinson J., Harroun T., Wassall S.R., Stillwell W. & Katsaras J. (2010) The
location and behavior of alpha-tocopherol in membranes. Mol Nutr Food Res 54, 641-51.
Auld D.S. (2001) Zinc coordination sphere in biochemical zinc sites.
Biometals 14, 271-313.
211
Ban N., Nissen P., Hansen J., Moore P.B. & Steitz T.A. (2000) The complete atomic structure of the large ribosomal subunit at 2.4 A resolution. Science 289, 905-20.
Barker H.E., Smyth G.K., Wettenhall J., Ward T.A., Bath M.L., Lindeman G.J.
& Visvader J.E. (2008) Deaf-1 regulates epithelial cell proliferation and side-branching in the mammary gland. BMC Dev Biol 8, 94.
Beard S.J., Hashim R., Wu G., Binet M.R., Hughes M.N. & Poole R.K. (2000)
Evidence for the transport of zinc(II) ions via the pit inorganic phosphate transport system in Escherichia coli. FEMS Microbiol Lett 184, 231-5.
Besecker B., Bao S., Bohacova B., Papp A., Sadee W. & Knoell D.L. (2008)
The human zinc transporter SLC39A8 (Zip8) is critical in zinc-mediated cytoprotection in lung epithelia. Am J Physiol Lung Cell Mol Physiol 294, L1127-36.
Beyer N., Coulson D.T., Heggarty S., Ravid R., Hellemans J., Irvine G.B. &
Johnston J.A. (2012) Zinc transporter mRNA levels in Alzheimer's disease postmortem brain. J Alzheimers Dis 29, 863-73.
Beyersmann D. & Haase H. (2001) Functions of zinc in signaling,
proliferation and differentiation of mammalian cells. Biometals 14, 331-41.
Bird A. (2002) DNA methylation patterns and epigenetic memory. Genes Dev
16, 6-21. Bittel D., Dalton T., Samson S.L., Gedamu L. & Andrews G.K. (1998) The
DNA binding activity of metal response element-binding transcription factor-1 is activated in vivo and in vitro by zinc, but not by other transition metals. J Biol Chem 273, 7127-33.
Blomhoff R. & Blomhoff H.K. (2006) Overview of retinoid metabolism and
function. J Neurobiol 66, 606-30. Bly M. (2006) Examination of the zinc transporter gene, SLC39A12.
Schizophr Res 81, 321-2. Boonserm P., Mo M., Angsuthanasombat C. & Lescar J. (2006) Structure of
the functional form of the mosquito larvicidal Cry4Aa toxin from Bacillus thuringiensis at a 2.8-angstrom resolution. J Bacteriol 188, 3391-401.
Bosco M.D., Mohanasundaram D.M., Drogemuller C.J., Lang C.J., Zalewski
P.D. & Coates P.T. (2010) Zinc and zinc transporter regulation in pancreatic islets and the potential role of zinc in islet transplantation. Rev Diabet Stud 7, 263-74.
212
Bourre J.M., Faivre A., Dumont O., Nouvelot A., Loudes C., Puymirat J. &
Tixier-Vidal A. (1983) Effect of polyunsaturated fatty acids on fetal mouse brain cells in culture in a chemically defined medium. J Neurochem 41, 1234-42.
Breskin M.W., Worthington-Roberts B.S., Knopp R.H., Brown Z., Plovie B.,
Mottet N.K. & Mills J.L. (1983) First trimester serum zinc concentrations in human pregnancy. Am J Clin Nutr 38, 943-53.
Burke J.P. & Fenton M.R. (1985) Effect of a zinc-deficient diet on lipid
peroxidation in liver and tumor subcellular membranes. Proc Soc Exp Biol Med 179, 187-91.
Burr M.L., Fehily A.M., Gilbert J.F., Rogers S., Holliday R.M., Sweetnam
P.M., Elwood P.C. & Deadman N.M. (1989) Effects of changes in fat, fish, and fibre intakes on death and myocardial reinfarction: diet and reinfarction trial (DART). Lancet 2, 757-61.
Bush A.I. (2000) Metals and neuroscience. Curr Opin Chem Biol 4, 184-91. Bush A.I. (2002) Metal complexing agents as therapies for Alzheimer's
disease. Neurobiol Aging 23, 1031-8. Bush A.I., Pettingell W.H., Multhaup G., d Paradis M., Vonsattel J.P., Gusella
J.F., Beyreuther K., Masters C.L. & Tanzi R.E. (1994) Rapid induction of Alzheimer A beta amyloid formation by zinc. Science 265, 1464-7.
Bye A.M., Goodfellow A. & Atherton D.J. (1985) Transient zinc deficiency in a
full-term breast-fed infant of normal birth weight. Pediatr Dermatol 2, 308-11.
Calderon F. & Kim H.Y. (2004) Docosahexaenoic acid promotes neurite
growth in hippocampal neurons. J Neurochem 90, 979-88. Calderon F. & Kim H.Y. (2007) Role of RXR in neurite outgrowth induced by
docosahexaenoic acid. Prostaglandins Leukot Essent Fatty Acids 77, 227-32.
Canon E., Cosgaya J.M., Scsucova S. & Aranda A. (2004) Rapid effects of
retinoic acid on CREB and ERK phosphorylation in neuronal cells. Mol Biol Cell 15, 5583-92.
Canonne-Hergaux F., Gruenheid S., Ponka P. & Gros P. (1999) Cellular and
subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood 93, 4406-17.
213
Capasso M., Jeng J.M., Malavolta M., Mocchegiani E. & Sensi S.L. (2005) Zinc dyshomeostasis: a key modulator of neuronal injury. J Alzheimers Dis 8, 93-108; discussion 209-15.
Casey C.E., Hambidge K.M. & Neville M.C. (1985) Studies in human
lactation: zinc, copper, manganese and chromium in human milk in the first month of lactation. Am J Clin Nutr 41, 1193-200.
Cellier M., Belouchi A. & Gros P. (1996) Resistance to intracellular infections:
comparative genomic analysis of Nramp. Trends Genet 12, 201-4. Cellier M., Prive G., Belouchi A., Kwan T., Rodrigues V., Chia W. & Gros P.
(1995) Nramp defines a family of membrane proteins. Proc Natl Acad Sci U S A 92, 10089-93.
Chen Y.H., Kim J.H. & Stallcup M.R. (2005) GAC63, a GRIP1-dependent
nuclear receptor coactivator. Mol Cell Biol 25, 5965-72. Chen Z.P., Iyer J., Bourguet W., Held P., Mioskowski C., Lebeau L., Noy N.,
Chambon P. & Gronemeyer H. (1998) Ligand- and DNA-induced dissociation of RXR tetramers. J Mol Biol 275, 55-65.
Cherny R.A., Atwood C.S., Xilinas M.E., Gray D.N., Jones W.D., McLean
C.A., Barnham K.J., Volitakis I., Fraser F.W., Kim Y., Huang X., Goldstein L.E., Moir R.D., Lim J.T., Beyreuther K., Zheng H., Tanzi R.E., Masters C.L. & Bush A.I. (2001) Treatment with a copper-zinc chelator markedly and rapidly inhibits beta-amyloid accumulation in Alzheimer's disease transgenic mice. Neuron 30, 665-76.
Cherny R.A., Legg J.T., McLean C.A., Fairlie D.P., Huang X., Atwood C.S.,
Beyreuther K., Tanzi R.E., Masters C.L. & Bush A.I. (1999) Aqueous dissolution of Alzheimer's disease Abeta amyloid deposits by biometal depletion. J Biol Chem 274, 23223-8.
Chesters J.K., Boyne R., Petrie L. & Lipson K.E. (1995) Role of the promoter
in the sensitivity of human thymidine kinase to lack of Zn2+. Biochem J 308 ( Pt 2), 659-64.
Chesters J.K., Petrie L. & Travis A.J. (1990) A requirement for Zn2+ for the
induction of thymidine kinase but not ornithine decarboxylase in 3T3 cells stimulated from quiescence. Biochem J 272, 525-7.
Chi Z.H., Wang X., Wang Z.Y., Gao H.L., Dahlstrom A. & Huang L. (2006)
Zinc transporter 7 is located in the cis-Golgi apparatus of mouse choroid epithelial cells. Neuroreport 17, 1807-11.
Chimienti F., Devergnas S., Favier A. & Seve M. (2004) Identification and
cloning of a beta-cell-specific zinc transporter, ZnT-8, localized into insulin secretory granules. Diabetes 53, 2330-7.
214
Chimienti F., Devergnas S., Pattou F., Schuit F., Garcia-Cuenca R.,
Vandewalle B., Kerr-Conte J., Van Lommel L., Grunwald D., Favier A. & Seve M. (2006) In vivo expression and functional characterization of the zinc transporter ZnT8 in glucose-induced insulin secretion. J Cell Sci 119, 4199-206.
Cho E., Hwang J.J., Han S.H., Chung S.J., Koh J.Y. & Lee J.Y. (2010)
Endogenous zinc mediates apoptotic programmed cell death in the developing brain. Neurotox Res 17, 156-66.
Chowanadisai W., Graham D.M., Keen C.L., Rucker R.B. & Messerli M.A.
(2013) Neurulation and neurite extension require the zinc transporter ZIP12 (slc39a12). Proc Natl Acad Sci U S A 110, 9903-8.
Chowanadisai W., Lonnerdal B. & Kelleher S.L. (2006) Identification of a
mutation in SLC30A2 (ZnT-2) in women with low milk zinc concentration that results in transient neonatal zinc deficiency. J Biol Chem 281, 39699-707.
Clegg M.S., Hanna L.A., Niles B.J., Momma T.Y. & Keen C.L. (2005) Zinc
deficiency-induced cell death. IUBMB Life 57, 661-9. Cole T.B., Wenzel H.J., Kafer K.E., Schwartzkroin P.A. & Palmiter R.D.
(1999) Elimination of zinc from synaptic vesicles in the intact mouse brain by disruption of the ZnT3 gene. Proc Natl Acad Sci U S A 96, 1716-21.
Coneyworth L.J., Mathers J.C. & Ford D. (2009) Does promoter methylation
of the SLC30A5 (ZnT5) zinc transporter gene contribute to the ageing-related decline in zinc status? Proc Nutr Soc 68, 142-7.
Conklin D.S., Culbertson M.R. & Kung C. (1994) Interactions between gene
products involved in divalent cation transport in Saccharomyces cerevisiae. Mol Gen Genet 244, 303-11.
Conklin D.S., McMaster J.A., Culbertson M.R. & Kung C. (1992) COT1, a
gene involved in cobalt accumulation in Saccharomyces cerevisiae. Mol Cell Biol 12, 3678-88.
Connors T.J., Czarnecki D.B. & Haskett M.I. (1983) Acquired zinc deficiency
in a breast-fed premature infant. Arch Dermatol 119, 319-21. Costello L.C., Liu Y., Zou J. & Franklin R.B. (1999) Evidence for a zinc
uptake transporter in human prostate cancer cells which is regulated by prolactin and testosterone. J Biol Chem 274, 17499-504.
Coudray N., Valvo S., Hu M., Lasala R., Kim C., Vink M., Zhou M., Provasi
D., Filizola M., Tao J., Fang J., Penczek P.A., Ubarretxena-Belandia I.
215
& Stokes D.L. (2013) Inward-facing conformation of the zinc transporter YiiP revealed by cryoelectron microscopy. Proceedings of the National Academy of Sciences 110, 2140-5.
Cousins R.J., Blanchard R.K., Popp M.P., Liu L., Cao J., Moore J.B. & Green
C.L. (2003) A global view of the selectivity of zinc deprivation and excess on genes expressed in human THP-1 mononuclear cells. Proc Natl Acad Sci U S A 100, 6952-7.
Cousins R.J., Liuzzi J.P. & Lichten L.A. (2006) Mammalian zinc transport,
trafficking, and signals. J Biol Chem 281, 24085-9. Cousins R.J. & McMahon R.J. (2000) Integrative aspects of zinc
transporters. J Nutr 130, 1384S-7S. Cragg M.S. (2008) The potential effect of statins on rituximab
immunotherapy. PLoS Med 5, e77. Cragg R.A., Christie G.R., Pkrebsips S.R., Russi R.M., Kury S., Mathers J.C.,
Taylor P.M. & Ford D. (2002) A novel zinc-regulated human zinc transporter, hZTL1, is localized to the enterocyte apical membrane. J Biol Chem 277, 22789-97.
Cragg R.A., Phillips S.R., Piper J.M., Varma J.S., Campbell F.C., Mathers
J.C. & Ford D. (2005) Homeostatic regulation of zinc transporters in the human small intestine by dietary zinc supplementation. Gut 54, 469-78.
Cramer P., Bushnell D.A., Fu J., Gnatt A.L., Maier-Davis B., Thompson N.E.,
Burgess R.R., Edwards A.M., David P.R. & Kornberg R.D. (2000) Architecture of RNA polymerase II and implications for the transcription mechanism. Science 288, 640-9.
Cuajungco M.P. & Faget K.Y. (2003) Zinc takes the center stage: its
paradoxical role in Alzheimer's disease. Brain Res Brain Res Rev 41, 44-56.
Cuajungco M.P. & Lees G.J. (1997) Zinc metabolism in the brain: relevance
to human neurodegenerative disorders. Neurobiol Dis 4, 137-69. Cunnane S.C. (1988) Role of zinc in lipid and fatty acid metabolism and in
membranes. Prog Food Nutr Sci 12, 151-88. Czachorowski M., Lam-Yuk-Tseung S., Cellier M. & Gros P. (2009)
Transmembrane topology of the mammalian Slc11a2 iron transporter. Biochemistry 48, 8422-34.
Dalton T.P., He L., Wang B., Miller M.L., Jin L., Stringer K.F., Chang X.,
Baxter C.S. & Nebert D.W. (2005) Identification of mouse SLC39A8 as
216
the transporter responsible for cadmium-induced toxicity in the testis. Proc Natl Acad Sci U S A 102, 3401-6.
Dalton T.P., Miller M.L., Wu X., Menon A., Cianciolo E., McKinnon R.A.,
Smith P.W., Robinson L.J. & Nebert D.W. (2000) Refining the mouse chromosomal location of Cdm, the major gene associated with susceptibility to cadmium-induced testicular necrosis. Pharmacogenetics 10, 141-51.
Danbolt N. & Closs K. (1942) Acrodermatitis enteropathica, Am Derm
Venerol, 23, 127-69.
Danbolt N. (1979) Acrodermatitis enteropathica. Br J Dermatol 100, 37-40. Danks D.M. (1985) Inborn errors of trace element metabolism. Clin
Endocrinol Metab 14, 591-615. de Urquiza A.M., Liu S., Sjoberg M., Zetterstrom R.H., Griffiths W., Sjovall J.
& Perlmann T. (2000) Docosahexaenoic acid, a ligand for the retinoid X receptor in mouse brain. Science 290, 2140-4.
Dhawan D.K. & Chadha V.D. (2010) Zinc: a promising agent in dietary
chemoprevention of cancer. Indian J Med Res 132, 676-82. DiSilvestro R.A. & Blostein-Fujii A. (1997) Moderate zinc deficiency in rats
enhances lipoprotein oxidation in vitro. Free Radic Biol Med 22, 739-42.
Dohna M., Reincke M., Mincheva A., Allolio B., Solinas-Toldo S. & Lichter P.
(2000) Adrenocortical carcinoma is characterized by a high frequency of chromosomal gains and high-level amplifications. Genes Chromosomes Cancer 28, 145-52.
Dong J., Atwood C.S., Anderson V.E., Siedlak S.L., Smith M.A., Perry G. &
Carey P.R. (2003) Metal binding and oxidation of amyloid-beta within isolated senile plaque cores: Raman microscopic evidence. Biochemistry 42, 2768-73.
Dorea J.G. (2012) Zinc and copper concentrations in breastmilk. Indian
Pediatr 49, 592. Dufner-Beattie J., Kuo Y.M., Gitschier J. & Andrews G.K. (2004) The
adaptive response to dietary zinc in mice involves the differential cellular localization and zinc regulation of the zinc transporters ZIP4 and ZIP5. J Biol Chem 279, 49082-90.
217
Dufner-Beattie J., Langmade S.J., Wang F., Eide D. & Andrews G.K. (2003) Structure, function, and regulation of a subfamily of mouse zinc transporter genes. J Biol Chem 278, 50142-50.
Dvergsten C.L., Fosmire G.J., Ollerich D.A. & Sandstead H.H. (1984)
Alterations in the postnatal development of the cerebellar cortex due to zinc deficiency. II. Impaired maturation of Purkinje cells. Brain Res 318, 11-20.
Eide D., Broderius M., Fett J. & Guerinot M.L. (1996) A novel iron-regulated
metal transporter from plants identified by functional expression in yeast. Proc Natl Acad Sci U S A 93, 5624-8.
Eide D.J. (1998) The molecular biology of metal ion transport in
Saccharomyces cerevisiae. Annu Rev Nutr 18, 441-69. Eide D.J. (2000) Metal ion transport in eukaryotic microorganisms: insights
from Saccharomyces cerevisiae. Adv Microb Physiol 43, 1-38. Eide D.J. (2003) Multiple regulatory mechanisms maintain zinc homeostasis
in Saccharomyces cerevisiae. J Nutr 133, 1532S-5S. Eide D.J. (2006) Zinc transporters and the cellular trafficking of zinc. Biochim
Biophys Acta 1763, 711-22. Ellis C.D., Macdiarmid C.W. & Eide D.J. (2005) Heteromeric protein
complexes mediate zinc transport into the secretory pathway of eukaryotic cells. J Biol Chem 280, 28811-8.
Eng B.H., Guerinot M.L., Eide D. & Saier M.H., Jr. (1998) Sequence
analyses and phylogenetic characterization of the ZIP family of metal ion transport proteins. J Membr Biol 166, 1-7.
Evans W.E. (1983) Picolinic Acid and Zinc Absorption, In Biological aspects
of Metals and metal Related Diseases (ed. Sarkar, B.) Raven Press, New York, pp. 81-88.
Falcon-Perez J.M. & Dell'Angelica E.C. (2007) Zinc transporter 2 (SLC30A2) can suppress the vesicular zinc defect of adaptor protein 3-depleted fibroblasts by promoting zinc accumulation in lysosomes. Exp Cell Res 313, 1473-83.
Faller P. (2009) Copper and zinc binding to amyloid-beta: coordination,
dynamics, aggregation, reactivity and metal-ion transfer. Chembiochem 10, 2837-45.
Fang Y., Sugiura R., Ma Y., Yada-Matsushima T., Umeno H. & Kuno T.
(2008) Cation diffusion facilitator Cis4 is implicated in Golgi membrane
218
trafficking via regulating zinc homeostasis in fission yeast. Mol Biol Cell 19, 1295-303.
Fenton W.S., Hibbeln J. & Knable M. (2000) Essential fatty acids, lipid
membrane abnormalities, and the diagnosis and treatment of schizophrenia. Biol Psychiatry 47, 8-21.
Finnin M.S., Donigian J.R., Cohen A., Richon V.M., Rifkind R.A., Marks P.A.,
Breslow R. & Pavletich N.P. (1999) Structures of a histone deacetylase homologue bound to the TSA and SAHA inhibitors. Nature 401, 188-93.
Forbes I.J., Zalewski P.D. & Giannakis C. (1991) Role for zinc in a cellular
response mediated by protein kinase C in human B lymphocytes. Exp Cell Res 195, 224-9.
Fraker P.J., King L.E., Laakko T. & Vollmer T.L. (2000) The dynamic link
between the integrity of the immune system and zinc status. J Nutr 130, 1399S-406S.
Francis S.H., Colbran J.L., McAllister-Lucas L.M. & Corbin J.D. (1994) Zinc
interactions and conserved motifs of the cGMP-binding cGMP-specific phosphodiesterase suggest that it is a zinc hydrolase. J Biol Chem 269, 22477-80.
Franklin R.B., Ma J., Zou J., Guan Z., Kukoyi B.I., Feng P. & Costello L.C.
(2003) Human ZIP1 is a major zinc uptake transporter for the accumulation of zinc in prostate cells. J Inorg Biochem 96, 435-42.
Franz M.C., Anderle P., Burzle M., Suzuki Y., Freeman M.R., Hediger M.A. &
Kovacs G. (2013) Zinc transporters in prostate cancer. Mol Aspects Med 34, 735-41.
Frederickson C.J., Koh J.Y. & Bush A.I. (2005) The neurobiology of zinc in
health and disease. Nat Rev Neurosci 6, 449-62. Freedman L.P., Luisi B.F., Korszun Z.R., Basavappa R., Sigler P.B. &
Yamamoto K.R. (1988) The function and structure of the metal coordination sites within the glucocorticoid receptor DNA binding domain. Nature 334, 543-6.
Freeland-Graves J.H., Bodzy P.W. & Eppright M.A. (1980) Zinc status of
vegetarians. J Am Diet Assoc 77, 655-61. Friedlich A.L., Lee J.Y., van Groen T., Cherny R.A., Volitakis I., Cole T.B.,
Palmiter R.D., Koh J.Y. & Bush A.I. (2004) Neuronal zinc exchange with the blood vessel wall promotes cerebral amyloid angiopathy in an animal model of Alzheimer's disease. J Neurosci 24, 3453-9.
219
Fujishiro H., Okugaki S., Yasumitsu S., Enomoto S. & Himeno S. (2009) Involvement of DNA hypermethylation in down-regulation of the zinc transporter ZIP8 in cadmium-resistant metallothionein-null cells. Toxicol Appl Pharmacol 241, 195-201.
Fukada T., Civic N., Furuichi T., Shimoda S., Mishima K., Higashiyama H.,
Idaira Y., Asada Y., Kitamura H., Yamasaki S., Hojyo S., Nakayama M., Ohara O., Koseki H., Dos Santos H.G., Bonafe L., Ha-Vinh R., Zankl A., Unger S., Kraenzlin M.E., Beckmann J.S., Saito I., Rivolta C., Ikegawa S., Superti-Furga A. & Hirano T. (2008) The zinc transporter SLC39A13/ZIP13 is required for connective tissue development; its involvement in BMP/TGF-beta signaling pathways. PLoS One 3, e3642.
Fukada T. & Kambe T. (2011) Molecular and genetic features of zinc
transporters in physiology and pathogenesis. Metallomics 3, 662-74. Fukada T., Yamasaki S., Nishida K., Murakami M. & Hirano T. (2011) Zinc
homeostasis and signaling in health and diseases: Zinc signaling. J Biol Inorg Chem 16, 1123-34.
Fukunaka A., Kurokawa Y., Teranishi F., Sekler I., Oda K., Ackland M.L.,
Faundez V., Hiromura M., Masuda S., Nagao M., Enomoto S. & Kambe T. (2011) Tissue nonspecific alkaline phosphatase is activated via a two-step mechanism by zinc transport complexes in the early secretory pathway. J Biol Chem 286, 16363-73.
Fukunaka A., Suzuki T., Kurokawa Y., Yamazaki T., Fujiwara N., Ishihara K.,
Migaki H., Okumura K., Masuda S., Yamaguchi-Iwai Y., Nagao M. & Kambe T. (2009) Demonstration and characterization of the heterodimerization of ZnT5 and ZnT6 in the early secretory pathway. J Biol Chem 284, 30798-806.
Fung E.B., Ritchie L.D., Woodhouse L.R., Roehl R. & King J.C. (1997) Zinc
absorption in women during pregnancy and lactation: a longitudinal study. Am J Clin Nutr 66, 80-8.
Gaballa A. & Helmann J.D. (2002) A peroxide-induced zinc uptake system
plays an important role in protection against oxidative stress in Bacillus subtilis. Mol Microbiol 45, 997-1005.
Gabbianelli R., Scotti R., Ammendola S., Petrarca P., Nicolini L. & Battistoni
A. (2011) Role of ZnuABC and ZinT in Escherichia coli O157:H7 zinc acquisition and interaction with epithelial cells. BMC Microbiol 11, 36.
Gaither L.A. & Eide D.J. (2000) Functional expression of the human hZIP2
zinc transporter. J Biol Chem 275, 5560-4.
220
Gaither L.A. & Eide D.J. (2001) Eukaryotic zinc transporters and their regulation. Biometals 14, 251-70.
Gao H.L., Zheng W., Xin N., Chi Z.H., Wang Z.Y., Chen J. & Wang Z.Y.
(2009) Zinc deficiency reduces neurogenesis accompanied by neuronal apoptosis through caspase-dependent and -independent signaling pathways. Neurotox Res 16, 416-25.
Garcia M.C. & Kim H.Y. (1997) Mobilization of arachidonate and
docosahexaenoate by stimulation of the 5-HT2A receptor in rat C6 glioma cells. Brain Res 768, 43-8.
Gibbs P.N., Gore M.G. & Jordan P.M. (1985) Investigation of the effect of
metal ions on the reactivity of thiol groups in human 5-aminolaevulinate dehydratase. Biochem J 225, 573-80.
Ginsberg A.M., King B.O. & Roeder R.G. (1984) Xenopus 5S gene
transcription factor, TFIIIA: characterization of a cDNA clone and measurement of RNA levels throughout development. Cell 39, 479-89.
Girijashanker K., He L., Soleimani M., Reed J.M., Li H., Liu Z., Wang B.,
Dalton T.P. & Nebert D.W. (2008) Slc39a14 gene encodes ZIP14, a metal/bicarbonate symporter: similarities to the ZIP8 transporter. Mol Pharmacol 73, 1413-23.
Glass C.K. (1994) Differential recognition of target genes by nuclear receptor
monomers, dimers, and heterodimers. Endocr Rev 15, 391-407. Glover M.T. & Atherton D.J. (1988) Transient zinc deficiency in two full-term
breast-fed siblings associated with low maternal breast milk zinc concentration. Pediatr Dermatol 5, 10-3.
Gonen N., Bram E.E. & Assaraf Y.G. (2008) PCFT/SLC46A1 promoter
methylation and restoration of gene expression in human leukemia cells. Biochem Biophys Res Commun 376, 787-92.
Gower-Winter S.D., Corniola R.S., Morgan T.J., Jr. & Levenson C.W. (2013)
Zinc deficiency regulates hippocampal gene expression and impairs neuronal differentiation. Nutr Neurosci 16, 174-82.
Graf G.A., Yu L., Li W.P., Gerard R., Tuma P.L., Cohen J.C. & Hobbs H.H.
(2003) ABCG5 and ABCG8 are obligate heterodimers for protein trafficking and biliary cholesterol excretion. J Biol Chem 278, 48275-82.
Graham A.I., Hunt S., Stokes S.L., Bramall N., Bunch J., Cox A.G., McLeod
C.W. & Poole R.K. (2009) Severe zinc depletion of Escherichia coli: roles for high affinity zinc binding by ZinT, zinc transport and zinc-independent proteins. J Biol Chem 284, 18377-89.
221
Grass G., Wong M.D., Rosen B.P., Smith R.L. & Rensing C. (2002) ZupT is a
Zn(II) uptake system in Escherichia coli. J Bacteriol 184, 864-6. Grider A., Lin Y.F. & Muga S.J. (1998) Differences in the cellular zinc content
and 5'-nucleotidase activity of normal and acrodermatitis enteropathica (AE) fibroblasts. Biol Trace Elem Res 61, 1-8.
Grider A. & Young E.M. (1996) The acrodermatitis enteropathica mutation
transiently affects zinc metabolism in human fibroblasts. J Nutr 126, 219-24.
Grotz N., Fox T., Connolly E., Park W., Guerinot M.L. & Eide D. (1998)
Identification of a family of zinc transporter genes from Arabidopsis that respond to zinc deficiency. Proc Natl Acad Sci U S A 95, 7220-4.
Guerinot M.L. (2000) The ZIP family of metal transporters. Biochim Biophys
Acta 1465, 190-8. Guffanti A.A., Wei Y., Rood S.V. & Krulwich T.A. (2002) An antiport
mechanism for a member of the cation diffusion facilitator family: divalent cations efflux in exchange for K+ and H+. Mol Microbiol 45, 145-53.
Guldener U., Munsterkotter M., Kastenmuller G., Strack N., van Helden J.,
Lemer C., Richelles J., Wodak S.J., Garcia-Martinez J., Perez-Ortin J.E., Michael H., Kaps A., Talla E., Dujon B., Andre B., Souciet J.L., De Montigny J., Bon E., Gaillardin C. & Mewes H.W. (2005) CYGD: the Comprehensive Yeast Genome Database. Nucleic Acids Res 33, D364-8.
Gunshin H., Mackenzie B., Berger U.V., Gunshin Y., Romero M.F., Boron
W.F., Nussberger S., Gollan J.L. & Hediger M.A. (1997) Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 388, 482-8.
Guo L., Lichten L.A., Ryu M.S., Liuzzi J.P., Wang F. & Cousins R.J. (2010)
STAT5-glucocorticoid receptor interaction and MTF-1 regulate the expression of ZnT2 (Slc30a2) in pancreatic acinar cells. Proc Natl Acad Sci U S A 107, 2818-23.
Gupta S.K., Singh S.P. & Shukla V.K. (2005) Copper, zinc, and Cu/Zn ratio in
carcinoma of the gallbladder. J Surg Oncol 91, 204-8. Haney C.J., Grass G., Franke S. & Rensing C. (2005) New developments in
the understanding of the cation diffusion facilitator family. J Ind Microbiol Biotechnol 32, 215-26.
222
Hantke K. (2001) Bacterial zinc transporters and regulators. Biometals 14, 239-49.
Hantke K. (2005) Bacterial zinc uptake and regulators. Curr Opin Microbiol 8,
196-202. Hardy A.B., Wijesekara N., Genkin I., Prentice K.J., Bhattacharjee A., Kong
D., Chimienti F. & Wheeler M.B. (2012) Effects of high-fat diet feeding on Znt8-null mice: differences between beta-cell and global knockout of Znt8. Am J Physiol Endocrinol Metab 302, E1084-96.
Haremaki T., Fraser S.T., Kuo Y.M., Baron M.H. & Weinstein D.C. (2007)
Vertebrate Ctr1 coordinates morphogenesis and progenitor cell fate and regulates embryonic stem cell differentiation. Proc Natl Acad Sci U S A 104, 12029-34.
He F., Seryshev A.B., Cowan C.W. & Wensel T.G. (2000) Multiple zinc
binding sites in retinal rod cGMP phosphodiesterase, PDE6alpha beta. J Biol Chem 275, 20572-7.
He K., Song Y., Daviglus M.L., Liu K., Van Horn L., Dyer A.R., Goldbourt U.
& Greenland P. (2004) Fish consumption and incidence of stroke: a meta-analysis of cohort studies. Stroke 35, 1538-42.
Heinen F., Matern D., Pringsheim W., Leititis J.U. & Brandis M. (1995) Zinc
deficiency in an exclusively breast-fed preterm infant. Eur J Pediatr 154, 71-5.
Henshall S.M., Afar D.E., Rasiah K.K., Horvath L.G., Gish K., Caras I.,
Ramakrishnan V., Wong M., Jeffry U., Kench J.G., Quinn D.I., Turner J.J., Delprado W., Lee C.S., Golovsky D., Brenner P.C., O'Neill G.F., Kooner R., Stricker P.D., Grygiel J.J., Mack D.H. & Sutherland R.L. (2003) Expression of the zinc transporter ZnT4 is decreased in the progression from early prostate disease to invasive prostate cancer. Oncogene 22, 6005-12.
Hill C.H. & Matrone G. (1970) Chemical parameters in the study of in vivo
and in vitro interactions of transition elements. Fed Proc 29, 1474-81. Hirano T., Murakami M., Fukada T., Nishida K., Yamasaki S. & Suzuki T.
(2008) Roles of zinc and zinc signaling in immunity: zinc as an intracellular signaling molecule. Adv Immunol 97, 149-76.
Ho L.H., Ruffin R.E., Murgia C., Li L., Krilis S.A. & Zalewski P.D. (2004)
Labile zinc and zinc transporter ZnT4 in mast cell granules: role in regulation of caspase activation and NF-kappaB translocation. J Immunol 172, 7750-60.
223
Ho T.D., Davis B.M., Ritchie J.M. & Waldor M.K. (2008) Type 2 secretion promotes enterohemorrhagic Escherichia coli adherence and intestinal colonization. Infect Immun 76, 1858-65.
Hommel U., Zurini M. & Luyten M. (1994) Solution structure of a cysteine rich
domain of rat protein kinase C. Nat Struct Biol 1, 383-7. Hong C., Maunakea A., Jun P., Bollen A.W., Hodgson J.G., Goldenberg
D.D., Weiss W.A. & Costello J.F. (2005) Shared epigenetic mechanisms in human and mouse gliomas inactivate expression of the growth suppressor SLC5A8. Cancer Res 65, 3617-23.
Huang L. & Kirschke C.P. (2007) A di-leucine sorting signal in ZIP1
(SLC39A1) mediates endocytosis of the protein. FEBS J 274, 3986-97.
Huang L., Kirschke C.P. & Gitschier J. (2002) Functional characterization of
a novel mammalian zinc transporter, ZnT6. J Biol Chem 277, 26389-95.
Huang L., Kirschke C.P., Zhang Y. & Yu Y.Y. (2005) The ZIP7 gene
(Slc39a7) encodes a zinc transporter involved in zinc homeostasis of the Golgi apparatus. J Biol Chem 280, 15456-63.
Huang L. & Tepaamorndech S. (2013) The SLC30 family of zinc transporters
- a review of current understanding of their biological and pathophysiological roles. Mol Aspects Med 34, 548-60.
Huang L., Yan M. & Kirschke C.P. (2010) Over-expression of ZnT7 increases
insulin synthesis and secretion in pancreatic beta-cells by promoting insulin gene transcription. Exp Cell Res 316, 2630-43.
Huang L., Yu Y.Y., Kirschke C.P., Gertz E.R. & Lloyd K.K. (2007) Znt7
(Slc30a7)-deficient mice display reduced body zinc status and body fat accumulation. J Biol Chem 282, 37053-63.
Huang L.K. & Gitschier J. (1997) A novel gene involved in zinc transport is
deficient in the lethal milk mouse. Nat Genet 17, 292-7. Huster D. (2010) Wilson disease. Best Pract Res Clin Gastroenterol 24, 531-
9. Ikemoto A., Kobayashi T., Watanabe S. & Okuyama H. (1997) Membrane
fatty acid modifications of PC12 cells by arachidonate or docosahexaenoate affect neurite outgrowth but not norepinephrine release. Neurochem Res 22, 671-8.
224
Ikemoto A., Nitta A., Furukawa S., Ohishi M., Nakamura A., Fujii Y. & Okuyama H. (2000) Dietary n-3 fatty acid deficiency decreases nerve growth factor content in rat hippocampus. Neurosci Lett 285, 99-102.
Inoue K., Matsuda K., Itoh M., Kawaguchi H., Tomoike H., Aoyagi T., Nagai
R., Hori M., Nakamura Y. & Tanaka T. (2002) Osteopenia and male-specific sudden cardiac death in mice lacking a zinc transporter gene, Znt5. Hum Mol Genet 11, 1775-84.
Ions L.J., Wakeling L.A., Bosomworth H.J., Hardyman J.E., Escolme S.M.,
Swan D.C., Valentine R.A., Mathers J.C. & Ford D. (2013) Effects of Sirt1 on DNA methylation and expression of genes affected by dietary restriction. Age (Dordr) 35, 1835-49.
Ishihara K., Yamazaki T., Ishida Y., Suzuki T., Oda K., Nagao M.,
Yamaguchi-Iwai Y. & Kambe T. (2006) Zinc transport complexes contribute to the homeostatic maintenance of secretory pathway function in vertebrate cells. J Biol Chem 281, 17743-50.
Issell B.F., Macfadyen B.V., Gum E.T., Valdivieso M., Dudrick S.J. & Bodey G.P. (2006) Serum zinc levels in lung cancer patients. Cancer 47:1845–1848.
Itsumura N., Inamo Y., Okazaki F., Teranishi F., Narita H., Kambe T. & Kodama H. (2013) Compound heterozygous mutations in SLC30A2/ZnT2 results in low milk zinc concentrations: a novel mechanism for zinc deficiency in a breast-fed infant. PLoS One 8, e64045.
Jackson K.A., Helston R.M., McKay J.A., O'Neill E.D., Mathers J.C. & Ford
D. (2007) Splice variants of the human zinc transporter ZnT5 (SLC30A5) are differentially localized and regulated by zinc through transcription and mRNA stability. J Biol Chem 282, 10423-31.
Jackson M.J., Jones D.A. & Edwards R.H. (1982) Tissue zinc levels as an
index of body zinc status. Clin Physiol 2, 333-43. Jackson M.J., Jones D.A., Edwards R.H., Swainbank I.G. & Coleman M.L.
(1984) Zinc homeostasis in man: studies using a new stable isotope-dilution technique. Br J Nutr 51, 199-208.
Jackson M.J. (1989) Physiology of Zinc: General Aspects, In Zinc in Human
Biology (ed. Mills, C.F.) Springer-Verlag, London, pp. 2-14.
Jamaluddin M.D., Chen I., Yang F., Jiang X., Jan M., Liu X., Schafer A.I.,
Durante W., Yang X. & Wang H. (2007) Homocysteine inhibits endothelial cell growth via DNA hypomethylation of the cyclin A gene. Blood 110, 3648-55.
225
Jayasooriya A.P., Ackland M.L., Mathai M.L., Sinclair A.J., Weisinger H.S., Weisinger R.S., Halver J.E., Kitajka K. & Puskas L.G. (2005) Perinatal omega-3 polyunsaturated fatty acid supply modifies brain zinc homeostasis during adulthood. Proc Natl Acad Sci U S A 102, 7133-8.
Jensen L.T., Ajua-Alemanji M. & Culotta V.C. (2003) The Saccharomyces
cerevisiae high affinity phosphate transporter encoded by PHO84 also functions in manganese homeostasis. J Biol Chem 278, 42036-40.
Jirakulaporn T. & Muslin A.J. (2004) Cation diffusion facilitator proteins
modulate Raf-1 activity. J Biol Chem 279, 27807-15. Johanning G.L., Browning J.D., Bobilya D.J., Veum T.L. & O'Dell B.L. (1990)
Effect of zinc deficiency on enzyme activities in rat and pig erythrocyte membranes. Proc Soc Exp Biol Med 195, 224-9.
John E., Laskow T.C., Buchser W.J., Pitt B.R., Basse P.H., Butterfield L.H.,
Kalinski P. & Lotze M.T. (2010) Zinc in innate and adaptive tumor immunity. J Transl Med 8, 118.
Johnson P.E., Hunt C.D., Milne D.B. & Mullen L.K. (1993) Homeostatic
control of zinc metabolism in men: zinc excretion and balance in men fed diets low in zinc. Am J Clin Nutr 57, 557-65.
Kagara N., Tanaka N., Noguchi S. & Hirano T. (2007) Zinc and its transporter
ZIP10 are involved in invasive behavior of breast cancer cells. Cancer Sci 98, 692-7.
Kalmijn S., Launer L.J., Ott A., Witteman J.C., Hofman A. & Breteler M.M.
(1997) Dietary fat intake and the risk of incident dementia in the Rotterdam Study. Ann Neurol 42, 776-82.
Kambe T. (2011) An overview of a wide range of functions of ZnT and Zip
zinc transporters in the secretory pathway. Biosci Biotechnol Biochem 75, 1036-43.
Kambe T. (2012) Molecular architecture and function of ZnT transporters.
Curr Top Membr 69, 199-220. Kambe T., Narita H., Yamaguchi-Iwai Y., Hirose J., Amano T., Sugiura N.,
Sasaki R., Mori K., Iwanaga T. & Nagao M. (2002) Cloning and characterization of a novel mammalian zinc transporter, zinc transporter 5, abundantly expressed in pancreatic beta cells. J Biol Chem 277, 19049-55.
Kambe T., Weaver B.P. & Andrews G.K. (2008) The genetics of essential
metal homeostasis during development. Genesis 46, 214-28.
226
Kambe T., Yamaguchi-Iwai Y., Sasaki R. & Nagao M. (2004) Overview of mammalian zinc transporters. Cell Mol Life Sci 61, 49-68.
Kantheti P., Qiao X., Diaz M.E., Peden A.A., Meyer G.E., Carskadon S.L.,
Kapfhamer D., Sufalko D., Robinson M.S., Noebels J.L. & Burmeister M. (1998) Mutation in AP-3 delta in the mocha mouse links endosomal transport to storage deficiency in platelets, melanosomes, and synaptic vesicles. Neuron 21, 111-22.
Kawachi M., Kobae Y., Mimura T. & Maeshima M. (2008) Deletion of a
histidine-rich loop of AtMTP1, a vacuolar Zn(2+)/H(+) antiporter of Arabidopsis thaliana, stimulates the transport activity. J Biol Chem 283, 8374-83.
Keen C.L. & Gershwin M.E. (1990) Zinc deficiency and immune function.
Annu Rev Nutr 10, 415-31. Kelleher S.L. & Lonnerdal B. (2003) Zn transporter levels and localization
change throughout lactation in rat mammary gland and are regulated by Zn in mammary cells. J Nutr 133, 3378-85.
Kelleher S.L., McCormick N.H., Velasquez V. & Lopez V. (2011) Zinc in
specialized secretory tissues: roles in the pancreas, prostate, and mammary gland. Adv Nutr 2, 101-11.
Kershaw C.J., Brown N.L. & Hobman J.L. (2007) Zinc dependence of zinT
(yodA) mutants and binding of zinc, cadmium and mercury by ZinT. Biochem Biophys Res Commun 364, 66-71.
Khoshoo V., Kjarsgaard J., Krafchick B. & Zlotkin S.H. (1992) Zinc deficiency
in a full-term breast-fed infant: unusual presentation. Pediatrics 89, 1094-5.
Kikuchi R., Kusuhara H., Hattori N., Shiota K., Kim I., Gonzalez F.J. &
Sugiyama Y. (2006) Regulation of the expression of human organic anion transporter 3 by hepatocyte nuclear factor 1alpha/beta and DNA methylation. Mol Pharmacol 70, 887-96.
Kim H.Y., Akbar M., Lau A. & Edsall L. (2000) Inhibition of neuronal
apoptosis by docosahexaenoic acid (22:6n-3). Role of phosphatidylserine in antiapoptotic effect. J Biol Chem 275, 35215-23.
King J.C., Shames D.M. & Woodhouse L.R. (2000) Zinc homeostasis in
humans. J Nutr 130, 1360s-6s. Kirschke C.P. & Huang L. (2003) ZnT7, a novel mammalian zinc transporter,
accumulates zinc in the Golgi apparatus. J Biol Chem 278, 4096-102.
227
Kita Y., Kimura K.D., Kobayashi M., Ihara S., Kaibuchi K., Kuroda S., Ui M., Iba H., Konishi H., Kikkawa U., Nagata S. & Fukui Y. (1998) Microinjection of activated phosphatidylinositol-3 kinase induces process outgrowth in rat PC12 cells through the Rac-JNK signal transduction pathway. J Cell Sci 111 ( Pt 7), 907-15.
Kitamura H., Morikawa H., Kamon H., Iguchi M., Hojyo S., Fukada T.,
Yamashita S., Kaisho T., Akira S., Murakami M. & Hirano T. (2006) Toll-like receptor-mediated regulation of zinc homeostasis influences dendritic cell function. Nat Immunol 7, 971-7.
Kobayashi M., Nagata S., Kita Y., Nakatsu N., Ihara S., Kaibuchi K., Kuroda
S., Ui M., Iba H., Konishi H., Kikkawa U., Saitoh I. & Fukui Y. (1997) Expression of a constitutively active phosphatidylinositol 3-kinase induces process formation in rat PC12 cells. Use of Cre/loxP recombination system. J Biol Chem 272, 16089-92.
Kobayashi S., Miyabe S., Izawa S., Inoue Y. & Kimura A. (1996) Correlation
of the OSR/ZRCI gene product and the intracellular glutathione levels in Saccharomyces cerevisiae. Biotechnol Appl Biochem 23 ( Pt 1), 3-6.
Kovala T., Sanwal B.D. & Ball E.H. (1997) Recombinant expression of a type
IV, cAMP-specific phosphodiesterase: characterization and structure-function studies of deletion mutants. Biochemistry 36, 2968-76.
Krebs N.E. & Hambidge K.M. (2001) Zinc metabolism and homeostasis: the
application of tracer techniques to human zinc physiology. Biometals 14, 397-412.
Krebs N.F. (1998) Zinc supplementation during lactation. Am J Clin Nutr 68,
509s-12s. Krebs N.F. (2000) Overview of zinc absorption and excretion in the human
gastrointestinal tract. J Nutr 130, 1374s-7s. Krebs N.F. & Hambidge K.M. (1986) Zinc requirements and zinc intakes of
breast-fed infants. Am J Clin Nutr 43, 288-92. Krebs N.F., Reidinger C.J., Hartley S., Robertson A.D. & Hambidge K.M.
(1995) Zinc supplementation during lactation: effects on maternal status and milk zinc concentrations. Am J Clin Nutr 61, 1030-6.
Krebs N.F., Reidinger C.J., Miller L.V. & Hambidge K.M. (1996) Zinc
homeostasis in breast-fed infants. Pediatr Res 39, 661-5. Krebs N.F. & Westcott J. (2002) Zinc and breastfed infants: if and when is
there a risk of deficiency? Adv Exp Med Biol 503, 69-75.
228
Krishnamurti C., Stewart M.W., Cutting M.A. & Rothwell S.W. (2002) Assessment of omega-fatty-acid-supplemented human platelets for potential improvement in long-term storage. Thromb Res 105, 139-45.
Kuo W.L., Abe M., Rhee J., Eves E.M., McCarthy S.A., Yan M., Templeton
D.J., McMahon M. & Rosner M.R. (1996) Raf, but not MEK or ERK, is sufficient for differentiation of hippocampal neuronal cells. Mol Cell Biol 16, 1458-70.
Kuramoto Y., Igarashi Y. & Tagami H. (1991) Acquired zinc deficiency in
breast-fed infants. Semin Dermatol 10, 309-12. Kury S., Devilder M.C., Avet-Loiseau H., Dreno B. & Moisan J.P. (2001)
Expression pattern, genomic structure and evaluation of the human SLC30A4 gene as a candidate for acrodermatitis enteropathica. Hum Genet 109, 178-85.
Kury S., Dreno B., Bezieau S., Giraudet S., Kharfi M., Kamoun R. & Moisan
J.P. (2002) Identification of SLC39A4, a gene involved in acrodermatitis enteropathica. Nat Genet 31, 239-40.
Laity J.H., Dyson H.J. & Wright P.E. (2000) DNA-induced alpha-helix capping
in conserved linker sequences is a determinant of binding affinity in Cys(2)-His(2) zinc fingers. J Mol Biol 295, 719-27.
Langmade S.J., Ravindra R., Daniels P.J. & Andrews G.K. (2000) The
transcription factor MTF-1 mediates metal regulation of the mouse ZnT1 gene. J Biol Chem 275, 34803-9.
Lasry I., Seo Y.A., Ityel H., Shalva N., Pode-Shakked B., Glaser F., Berman
B., Berezovsky I., Goncearenco A., Klar A., Levy J., Anikster Y., Kelleher S.L. & Assaraf Y.G. (2012) A dominant negative heterozygous G87R mutation in the zinc transporter, ZnT-2 (SLC30A2), results in transient neonatal zinc deficiency. J Biol Chem 287, 29348-61.
Lazarczyk M., Pons C., Mendoza J.A., Cassonnet P., Jacob Y. & Favre M.
(2008) Regulation of cellular zinc balance as a potential mechanism of EVER-mediated protection against pathogenesis by cutaneous oncogenic human papillomaviruses. J Exp Med 205, 35-42.
Lebold K.M., Kirkwood J.S., Taylor A.W., Choi J., Barton C.L., Miller G.W.,
Du J.L., Jump D.B., Stevens J.F., Tanguay R.L. & Traber M.G. (2013) Novel liquid chromatography-mass spectrometry method shows that vitamin E deficiency depletes arachidonic and docosahexaenoic acids in zebrafish (Danio rerio) embryos. Redox Biol 2, 105-13.
229
Lecocq M., Wattiaux-De Coninck S., Laurent N., Wattiaux R. & Jadot M. (2000) Uptake and intracellular fate of polyethylenimine in vivo. Biochem Biophys Res Commun 278, 414-8.
Lee D.Y., Shay N.F. & Cousins R.J. (1992) Altered zinc metabolism occurs in
murine lethal milk syndrome. J Nutr 122, 2233-8. Lee H.H., Prasad A.S., Brewer G.J. & Owyang C. (1989) Zinc absorption in
human small intestine. Am J Physiol 256, G87-91. Lee J.Y., Cole T.B., Palmiter R.D., Suh S.W. & Koh J.Y. (2002) Contribution
by synaptic zinc to the gender-disparate plaque formation in human Swedish mutant APP transgenic mice. Proc Natl Acad Sci U S A 99, 7705-10.
Lee J.Y., Friedman J.E., Angel I., Kozak A. & Koh J.Y. (2004a) The lipophilic
metal chelator DP-109 reduces amyloid pathology in brains of human beta-amyloid precursor protein transgenic mice. Neurobiol Aging 25, 1315-21.
Lee J.Y., Kim J.H., Hong S.H., Lee J.Y., Cherny R.A., Bush A.I., Palmiter
R.D. & Koh J.Y. (2004) Estrogen decreases zinc transporter 3 expression and synaptic vesicle zinc levels in mouse brain. J Biol Chem 279, 8602-7.
Lee S.H., Lancey R., Montaser A., Madani N. & Linder M.C. (1993)
Ceruloplasmin and copper transport during the latter part of gestation in the rat. Proc Soc Exp Biol Med 203, 428-39.
Lemaire K., Ravier M.A., Schraenen A., Creemers J.W., Van de Plas R.,
Granvik M., Van Lommel L., Waelkens E., Chimienti F., Rutter G.A., Gilon P., in't Veld P.A. & Schuit F.C. (2009) Insulin crystallization depends on zinc transporter ZnT8 expression, but is not required for normal glucose homeostasis in mice. Proc Natl Acad Sci U S A 106, 14872-7.
Lengqvist J., Mata De Urquiza A., Bergman A.C., Willson T.M., Sjovall J.,
Perlmann T. & Griffiths W.J. (2004) Polyunsaturated fatty acids including docosahexaenoic and arachidonic acid bind to the retinoid X receptor alpha ligand-binding domain. Mol Cell Proteomics 3, 692-703.
Leung K.W., Liu M., Xu X., Seiler M.J., Barnstable C.J. & Tombran-Tink J.
(2008) Expression of ZnT and ZIP zinc transporters in the human RPE and their regulation by neurotrophic factors. Invest Ophthalmol Vis Sci 49, 1221-31.
Levy S., Beharier O., Etzion Y., Mor M., Buzaglo L., Shaltiel L., Gheber L.A.,
Kahn J., Muslin A.J., Katz A., Gitler D. & Moran A. (2009) Molecular
230
basis for zinc transporter 1 action as an endogenous inhibitor of L-type calcium channels. J Biol Chem 284, 32434-43.
Li L. & Kaplan J. (1998) Defects in the yeast high affinity iron transport
system result in increased metal sensitivity because of the increased expression of transporters with a broad transition metal specificity. J Biol Chem 273, 22181-7.
Li L. & Kaplan J. (2001) The yeast gene MSC2, a member of the cation
diffusion facilitator family, affects the cellular distribution of zinc. J Biol Chem 276, 5036-43.
Licastro F., Mocchegiani E., Masi M. & Fabris N. (1993) Modulation of the
neuroendocrine system and immune functions by zinc supplementation in children with Down's syndrome. J Trace Elem Electrolytes Health Dis 7, 237-9.
Lichten L.A. & Cousins R.J. (2009) Mammalian zinc transporters: nutritional
and physiologic regulation. Annu Rev Nutr 29, 153-76. Lin M.C., Liu Y.C., Tam M.F., Lu Y.J., Hsieh Y.T. & Lin L.Y. (2012) PTEN
interacts with metal-responsive transcription factor 1 and stimulates its transcriptional activity. Biochem J 441, 367-77.
Lin S.J. & Culotta V.C. (1996) Suppression of oxidative damage by
Saccharomyces cerevisiae ATX2, which encodes a manganese-trafficking protein that localizes to Golgi-like vesicles. Mol Cell Biol 16, 6303-12.
Lin Y., Chen Y., Wang Y., Yang J., Zhu V.F., Liu Y., Cui X., Chen L., Yan W.,
Jiang T., Hergenroeder G.W., Fletcher S.A., Levine J.M., Kim D.H., Tandon N., Zhu J.J. & Li M. (2013) ZIP4 is a novel molecular marker for glioma. Neuro Oncol 15, 1008-16.
Lioumi M., Ferguson C.A., Sharpe P.T., Freeman T., Marenholz I., Mischke
D., Heizmann C. & Ragoussis J. (1999) Isolation and characterization of human and mouse ZIRTL, a member of the IRT1 family of transporters, mapping within the epidermal differentiation complex. Genomics 62, 272-80.
Little P.J., Bhattacharya R., Moreyra A.E. & Korichneva I.L. (2010) Zinc and
cardiovascular disease. Nutrition 26, 1050-7. Liuzzi J.P., Blanchard R.K. & Cousins R.J. (2001) Differential regulation of
zinc transporter 1, 2, and 4 mRNA expression by dietary zinc in rats. J Nutr 131, 46-52.
Liuzzi J.P. & Cousins R.J. (2004) Mammalian zinc transporters. Annu Rev
Nutr 24, 151-72.
231
Liuzzi J.P., Lichten L.A., Rivera S., Blanchard R.K., Aydemir T.B., Knutson
M.D., Ganz T. & Cousins R.J. (2005) Interleukin-6 regulates the zinc transporter Zip14 in liver and contributes to the hypozincemia of the acute-phase response. Proc Natl Acad Sci U S A 102, 6843-8.
Lonnerdal B. (2000) Dietary factors influencing zinc absorption. J Nutr 130,
1378s-83s. Lonnerdal B., Stanislowski A.G. & Hurley L.S. (1980) Isolation of a low
molecular weight zinc binding ligand from human milk. J Inorg Biochem 12, 71-8.
Lopez V. & Kelleher S.L. (2009) Zinc transporter-2 (ZnT2) variants are
localized to distinct subcellular compartments and functionally transport zinc. Biochem J 422, 43-52.
Lovell M.A., Smith J.L. & Markesbery W.R. (2006) Elevated zinc transporter-
6 in mild cognitive impairment, Alzheimer disease, and pick disease. J Neuropathol Exp Neurol 65, 489-98.
Lu D., Boyd B. & Lingwood C.A. (1997) Identification of the key protein for
zinc uptake in Hemophilus influenzae. J Biol Chem 272, 29033-8. Lu M., Chai J. & Fu D. (2009) Structural basis for autoregulation of the zinc
transporter YiiP. Nat Struct Mol Biol 16, 1063-7. Lu M. & Fu D. (2007) Structure of the zinc transporter YiiP. Science 317,
1746-8. Lucibello F.C., Truss M., Zwicker J., Ehlert F., Beato M. & Muller R. (1995)
Periodic cdc25C transcription is mediated by a novel cell cycle-regulated repressor element (CDE). EMBO J 14, 132-42.
Lukiw W.J., Cui J.G., Marcheselli V.L., Bodker M., Botkjaer A., Gotlinger K.,
Serhan C.N. & Bazan N.G. (2005) A role for docosahexaenoic acid-derived neuroprotectin D1 in neural cell survival and Alzheimer disease. J Clin Invest 115, 2774-83.
Lyons T.J., Villa N.Y., Regalla L.M., Kupchak B.R., Vagstad A. & Eide D.J.
(2004) Metalloregulation of yeast membrane steroid receptor homologs. Proc Natl Acad Sci U S A 101, 5506-11.
Lyubartseva G., Smith J.L., Markesbery W.R. & Lovell M.A. (2010)
Alterations of zinc transporter proteins ZnT-1, ZnT-4 and ZnT-6 in preclinical Alzheimer's disease brain. Brain Pathol 20, 343-50.
232
MacDiarmid C.W., Gaither L.A. & Eide D. (2000) Zinc transporters that regulate vacuolar zinc storage in Saccharomyces cerevisiae. EMBO J 19, 2845-55.
MacDiarmid C.W., Milanick M.A. & Eide D.J. (2002) Biochemical properties
of vacuolar zinc transport systems of Saccharomyces cerevisiae. J Biol Chem 277, 39187-94.
MacDonald R.S. (2000) The role of zinc in growth and cell proliferation. J
Nutr 130, 1500s-8s. MacDonald R.S., Wollard-Biddle L.C., Browning J.D., Thornton W.H., Jr. &
O'Dell B.L. (1998) Zinc deprivation of murine 3T3 cells by use of diethylenetrinitrilopentaacetate impairs DNA synthesis upon stimulation with insulin-like growth factor-1 (IGF-1). J Nutr 128, 1600-5.
Mangelsdorf D.J. & Evans R.M. (1995) The RXR heterodimers and orphan
receptors. Cell 83, 841-50. Manning D.L., Daly R.J., Lord P.G., Kelly K.F. & Green C.D. (1988) Effects of
oestrogen on the expression of a 4.4 kb mRNA in the ZR-75-1 human breast cancer cell line. Mol Cell Endocrinol 59, 205-12.
Maret W. (1994) Oxidative metal release from metallothionein via zinc-
thiol/disulfide interchange. Proc Natl Acad Sci U S A 91, 237-41. Martel G., Hevi C., Kane-Goldsmith N. & Shumyatsky G.P. (2011) Zinc
transporter ZnT3 is involved in memory dependent on the hippocampus and perirhinal cortex. Behav Brain Res 223, 233-8.
Mascrez B., Mark M., Dierich A., Ghyselinck N.B., Kastner P. & Chambon P.
(1998) The RXRalpha ligand-dependent activation function 2 (AF-2) is important for mouse development. Development 125, 4691-707.
Maze P. (1914) Influences respectives des elements de la solution mineral
du mains, Ann Inst Pasteur (Paris), 28, 21-69.
McKay J.A., Waltham K.J., Williams E.A. & Mathers J.C. (2011) Folate depletion during pregnancy and lactation reduces genomic DNA methylation in murine adult offspring. Genes Nutr 6, 189-96.
McMahon R.J. & Cousins R.J. (1998) Regulation of the zinc transporter ZnT-
1 by dietary zinc. Proc Natl Acad Sci U S A 95, 4841-6. McNulty T.J. & Taylor C.W. (1999) Extracellular heavy-metal ions stimulate
Ca2+ mobilization in hepatocytes. Biochem J 339 ( Pt 3), 555-61.
233
Michalczyk A., Varigos G., Catto Smith A., Blomeley R. & Ackland L. (2003) Analysis of zinc transporter, hZnT4 (Slc30A4) gene expression in a mammary gland disorder leading to reduced zinc secretion into milk. Hum Genet 113, 202-10.
Miller J., McLachlan A.D. & Klug A. (1985) Repetitive zinc-binding domains in
the protein transcription factor IIIA from Xenopus oocytes. Embo j 4, 1609-14.
Mocchegiani E. & Fabris N. (1995) Age-related thymus involution: zinc
reverses in vitro the thymulin secretion defect. Int J Immunopharmacol 17, 745-9.
Mocchegiani E., Giacconi R., Cipriano C., Muzzioli M., Fattoretti P., Bertoni-
Freddari C., Isani G., Zambenedetti P. & Zatta P. (2001) Zinc-bound metallothioneins as potential biological markers of ageing. Brain Res Bull 55, 147-53.
Mocchegiani E., Muzzioli M. & Giacconi R. (2000) Zinc, metallothioneins,
immune responses, survival and ageing. Biogerontology 1, 133-43. Mocchegiani E., Muzzioli M., Giacconi R., Cipriano C., Gasparini N.,
Franceschi C., Gaetti R., Cavalieri E. & Suzuki H. (2003) Metallothioneins/PARP-1/IL-6 interplay on natural killer cell activity in elderly: parallelism with nonagenarians and old infected humans. Effect of zinc supply. Mech Ageing Dev 124, 459-68.
Montanini B., Blaudez D., Jeandroz S., Sanders D. & Chalot M. (2007)
Phylogenetic and functional analysis of the Cation Diffusion Facilitator (CDF) family: improved signature and prediction of substrate specificity. BMC Genomics 8, 107.
Moras D. & Gronemeyer H. (1998) The nuclear receptor ligand-binding
domain: structure and function. Curr Opin Cell Biol 10, 384-91. Moriguchi T. & Salem N., Jr. (2003) Recovery of brain docosahexaenoate
leads to recovery of spatial task performance. J Neurochem 87, 297-309.
Morris D.R. & Levenson C.W. (2013) Zinc regulation of transcriptional activity
during retinoic acid-induced neuronal differentiation. J Nutr Biochem 24, 1940-4.
Morris M.C., Evans D.A., Bienias J.L., Tangney C.C., Bennett D.A., Wilson
R.S., Aggarwal N. & Schneider J. (2003) Consumption of fish and n-3 fatty acids and risk of incident Alzheimer disease. Arch Neurol 60, 940-6.
234
Moynahan E.J. (1974) Letter: Acrodermatitis enteropathica: a lethal inherited human zinc-deficiency disorder. Lancet 2, 399-400.
Mukherjee P.K., Marcheselli V.L., Serhan C.N. & Bazan N.G. (2004)
Neuroprotectin D1: a docosahexaenoic acid-derived docosatriene protects human retinal pigment epithelial cells from oxidative stress. Proc Natl Acad Sci U S A 101, 8491-6.
Muller G.A., Quaas M., Schumann M., Krause E., Padi M., Fischer M.,
Litovchick L., DeCaprio J.A. & Engeland K. (2012) The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes. Nucleic Acids Res 40, 1561-78.
Murgia C., Vespignani I., Cerase J., Nobili F. & Perozzi G. (1999) Cloning,
expression, and vesicular localization of zinc transporter Dri 27/ZnT4 in intestinal tissue and cells. Am J Physiol 277, G1231-9.
Muzzioli M., Stecconi R., Moresi R. & Provinciali M. (2009) Zinc improves the
development of human CD34+ cell progenitors towards NK cells and increases the expression of GATA-3 transcription factor in young and old ages. Biogerontology 10, 593-604.
Nakano A., Nakano H., Nomura K., Toyomaki Y. & Hanada K. (2003) Novel
SLC39A4 mutations in acrodermatitis enteropathica. J Invest Dermatol 120, 963-6.
Nevo Y. & Nelson N. (2006) The NRAMP family of metal-ion transporters.
Biochim Biophys Acta 1763, 609-20. Nies D.H. & Silver S. (1995) Ion efflux systems involved in bacterial metal
resistances. J Ind Microbiol 14, 186-99. Nishida K., Hasegawa A., Nakae S., Oboki K., Saito H., Yamasaki S. &
Hirano T. (2009) Zinc transporter Znt5/Slc30a5 is required for the mast cell-mediated delayed-type allergic reaction but not the immediate-type reaction. J Exp Med 206, 1351-64.
Oberleas D., Muhrer M.E. & O'Dell B.L. (1966) Dietary metal-complexing
agents and zinc availability in the rat. J Nutr 90, 56-62. O'Dell B.L., Browning J.D. & Reeves P.G. (1987) Zinc deficiency increases
the osmotic fragility of rat erythrocytes. J Nutr 117, 1883-9. O'Dell B.L. & Savage J.E. (1960) Effect of phytic acid on zinc availability.
Proc Soc Exp Biol Med 103, 304-6. Ohana E., Hoch E., Keasar C., Kambe T., Yifrach O., Hershfinkel M. &
Sekler I. (2009) Identification of the Zn2+ binding site and mode of
235
operation of a mammalian Zn2+ transporter. J Biol Chem 284, 17677-86.
Overbeck S., Uciechowski P., Ackland M.L., Ford D. & Rink L. (2008)
Intracellular zinc homeostasis in leukocyte subsets is regulated by different expression of zinc exporters ZnT-1 to ZnT-9. J Leukoc Biol 83, 368-80.
Pagani A., Villarreal L., Capdevila M. & Atrian S. (2007) The Saccharomyces
cerevisiae Crs5 Metallothionein metal-binding abilities and its role in the response to zinc overload. Mol Microbiol 63, 256-69.
Palmiter R.D., Cole T.B. & Findley S.D. (1996a) ZnT-2, a mammalian protein
that confers resistance to zinc by facilitating vesicular sequestration. EMBO J 15, 1784-91 issn: 0261-4189.
Palmiter R.D., Cole T.B., Quaife C.J. & Findley S.D. (1996b) ZnT-3, a
putative transporter of zinc into synaptic vesicles. Proc Natl Acad Sci U SA 93, 14934-9.
Palmiter R.D. & Findley S.D. (1995) Cloning and functional characterization
of a mammalian zinc transporter that confers resistance to zinc. EMBO J 14, 639-49.
Palmiter R.D. & Huang L. (2004) Efflux and compartmentalization of zinc by
members of the SLC30 family of solute carriers. Pflugers Arch 447, 744-51.
Parker P.H., Helinek G.L., Meneely R.L., Stroop S., Ghishan F.K. & Greene
H.L. (1982) Zinc deficiency in a premature infant fed exclusively human milk. Am J Dis Child 136, 77-8.
Patrushev N., Seidel-Rogol B. & Salazar G. (2012) Angiotensin II requires
zinc and downregulation of the zinc transporters ZnT3 and ZnT10 to induce senescence of vascular smooth muscle cells. PLoS One 7, e33211.
Patzer S.I. & Hantke K. (1998) The ZnuABC high-affinity zinc uptake system
and its regulator Zur in Escherichia coli. Mol Microbiol 28, 1199-210. Pawan K., Neeraj S., Sandeep K., Kanta Ratho R. & Rajendra P. (2007)
Upregulation of Slc39a10 gene expression in response to thyroid hormones in intestine and kidney. Biochim Biophys Acta 1769, 117-23.
Percival M.D., Yeh B. & Falgueyret J.P. (1997) Zinc dependent activation of
cAMP-specific phosphodiesterase (PDE4A). Biochem Biophys Res Commun 241, 175-80.
236
Petrarca P., Ammendola S., Pasquali P. & Battistoni A. (2010) The Zur-regulated ZinT protein is an auxiliary component of the high-affinity ZnuABC zinc transporter that facilitates metal recruitment during severe zinc shortage. J Bacteriol 192, 1553-64.
Petris M.J., Mercer J.F., Culvenor J.G., Lockhart P., Gleeson P.A. &
Camakaris J. (1996) Ligand-regulated transport of the Menkes copper P-type ATPase efflux pump from the Golgi apparatus to the plasma membrane: a novel mechanism of regulated trafficking. EMBO J 15, 6084-95.
Philibert R., Madan A., Andersen A., Cadoret R., Packer H. & Sandhu H.
(2007) Serotonin transporter mRNA levels are associated with the methylation of an upstream CpG island. Am J Med Genet B Neuropsychiatr Genet 144B, 101-5.
Piletz J.A. & Ganschow R.E. (1978) Lethal milk mutation results in dietary
zinc deficiency in nursing mice. Am J Clin Nutr 31, 560-2. Piletz J.E. & Ganschow R.E. (1978) Zinc deficiency in murine milk underlies
expression of the lethal milk (lm) mutation. Science 199, 181-3. Plum L.M., Rink L. & Haase H. (2010) The essential toxin: impact of zinc on
human health. Int J Environ Res Public Health 7, 1342-65. Pogribny I.P., Karpf A.R., James S.R., Melnyk S., Han T. & Tryndyak V.P.
(2008) Epigenetic alterations in the brains of Fisher 344 rats induced by long-term administration of folate/methyl-deficient diet. Brain Res 1237, 25-34.
Pound L.D., Hang Y., Sarkar S.A., Wang Y., Milam L.A., Oeser J.K., Printz
R.L., Lee C.E., Stein R., Hutton J.C. & O'Brien R.M. (2011) The pancreatic islet beta-cell-enriched transcription factor Pdx-1 regulates Slc30a8 gene transcription through an intronic enhancer. Biochem J 433, 95-105.
Prasad A.S. (1966) Iron deficiency anemia as related to zinc. Minn Med 49,
59-64. Prasad A.S. (1985) Clinical manifestations of zinc deficiency. Annu Rev Nutr
5, 341-63. Prasad A.S., Halsted J.A. & Nadimi M. (1961) Syndrome of iron deficiency
anemia, hepatosplenomegaly, hypogonadism, dwarfism and geophagia. Am J Med 31, 532-46.
Prasad A.S., Miale A., Jr., Farid Z., Sandstead H.H. & Schulert A.R. (1963a)
Zinc metabolism in patients with the syndrome of iron deficiency
237
anemia, hepatosplenomegaly, dwarfism, and hypognadism. J Lab Clin Med 61, 537-49.
Prasad A.S., Miale A., Jr., Farid Z., Sandstead H.H., Schulert A.R. & Darby
W.J. (1963b) Biochemical studies on dwarfism, hypogonadism, and anemia. Arch Intern Med 111, 407-28.
Prasad A.S. & Oberleas D. (1970) Binding of zinc to amino acids and serum
proteins in vitro. J Lab Clin Med 76, 416-25. Puertollano M.A., Puertollano E., de Cienfuegos G.A. & de Pablo M.A. (2011)
Dietary antioxidants: immunity and host defense. Curr Top Med Chem 11, 1752-66.
Puskarova A., Ferianc P., Kormanec J., Homerova D., Farewell A. & Nystrom
T. (2002) Regulation of yodA encoding a novel cadmium-induced protein in Escherichia coli. Microbiology 148, 3801-11.
Qian L., Lopez V., Seo Y.A. & Kelleher S.L. (2009) Prolactin regulates ZNT2
expression through the JAK2/STAT5 signaling pathway in mammary cells. Am J Physiol Cell Physiol 297, C369-77.
Qin Z., Itoh S., Jeney V., Ushio-Fukai M. & Fukai T. (2006) Essential role for
the Menkes ATPase in activation of extracellular superoxide dismutase: implication for vascular oxidative stress. FASEB J 20, 334-6.
Quadri M., Federico A., Zhao T., Breedveld G.J., Battisti C., Delnooz C.,
Severijnen L.A., Di Toro Mammarella L., Mignarri A., Monti L., Sanna A., Lu P., Punzo F., Cossu G., Willemsen R., Rasi F., Oostra B.A., van de Warrenburg B.P. & Bonifati V. (2012) Mutations in SLC30A10 cause parkinsonism and dystonia with hypermanganesemia, polycythemia, and chronic liver disease. Am J Hum Genet 90, 467-77.
Quest A.F., Bloomenthal J., Bardes E.S. & Bell R.M. (1992) The regulatory
domain of protein kinase C coordinates four atoms of zinc. J Biol Chem 267, 10193-7.
Ramakrishnan U. (2002) Prevalence of micronutrient malnutrition worldwide.
Nutr Rev 60, S46-52. Raulin J. (1869) Etudes Clinique sur la vegetation, Annales des Science as
Naturelle: Botanique, 11, 93-299.
Rensing C., Pribyl T. & Nies D.H. (1997) New functions for the three subunits of the CzcCBA cation-proton antiporter. J Bacteriol 179, 6871-9.
Robertson K.D. (2005) DNA methylation and human disease. Nat Rev Genet
6, 597-610.
238
Roth H.P. & Kirchgessner M. (1994) Influence of alimentary zinc deficiency
on the concentration of growth hormone (GH), insulin-like growth factor I (IGF-I) and insulin in the serum of force-fed rats. Horm Metab Res 26, 404-8.
Roth J.A., Horbinski C., Feng L., Dolan K.G., Higgins D. & Garrick M.D.
(2000) Differential localization of divalent metal transporter 1 with and without iron response element in rat PC12 and sympathetic neuronal cells. J Neurosci 20, 7595-601.
Rotstein N.P., Aveldano M.I., Barrantes F.J., Roccamo A.M. & Politi L.E.
(1997) Apoptosis of retinal photoreceptors during development in vitro: protective effect of docosahexaenoic acid. J Neurochem 69, 504-13.
Ryu M.S., Lichten L.A., Liuzzi J.P. & Cousins R.J. (2008) Zinc transporters
ZnT1 (Slc30a1), Zip8 (Slc39a8), and Zip10 (Slc39a10) in mouse red blood cells are differentially regulated during erythroid development and by dietary zinc deficiency. J Nutr 138, 2076-83.
Sadli N., Ackland M.L., De Mel D., Sinclair A.J. & Suphioglu C. (2012) Effects
of zinc and DHA on the epigenetic regulation of human neuronal cells. Cell Physiol Biochem 29, 87-98.
Salazar G., Craige B., Love R., Kalman D. & Faundez V. (2005) Vglut1 and
ZnT3 co-targeting mechanisms regulate vesicular zinc stores in PC12 cells. J Cell Sci 118, 1911-21.
Salazar G., Falcon-Perez J.M., Harrison R. & Faundez V. (2009) SLC30A3
(ZnT3) oligomerization by dityrosine bonds regulates its subcellular localization and metal transport capacity. PLoS One 4, e5896.
Salazar G., Love R., Styers M.L., Werner E., Peden A., Rodriguez S.,
Gearing M., Wainer B.H. & Faundez V. (2004) AP-3-dependent mechanisms control the targeting of a chloride channel (ClC-3) in neuronal and non-neuronal cells. J Biol Chem 279, 25430-9.
SCF (Scientific Committee for Food) (2003). Opinion of the Scientific
Committee on Food on the Tolerable Upper Intake Level of Zinc. Thirty-first series. Nutrient and energy intakes for the European Community Commission of the European Communities, Luxembourg.
Schaefer E.J., Bongard V., Beiser A.S., Lamon-Fava S., Robins S.J., Au R., Tucker K.L., Kyle D.J., Wilson P.W. & Wolf P.A. (2006) Plasma phosphatidylcholine docosahexaenoic acid content and risk of dementia and Alzheimer disease: the Framingham Heart Study. Arch Neurol 63, 1545-50.
239
Schlag P., Seeling W., Merkle P. & Betzler M. (1978) Changes of serum-zinc in breast cancer. Langenbecks Arch Chir 2:129–133.
Schneider E., Pliushch G., El Hajj N., Galetzka D., Puhl A., Schorsch M., Frauenknecht K., Riepert T., Tresch A., Muller A.M., Coerdt W., Zechner U. & Haaf T. (2010) Spatial, temporal and interindividual epigenetic variation of functionally important DNA methylation patterns. Nucleic Acids Res 38, 3880-90.
Schneider J., Ruschhaupt M., Buness A., Asslaber M., Regitnig P., Zatloukal
K., Schippinger W., Ploner F., Poustka A. & Sultmann H. (2006) Identification and meta-analysis of a small gene expression signature for the diagnosis of estrogen receptor status in invasive ductal breast cancer. Int J Cancer 119, 2974-9.
Sensi S.L., Canzoniero L.M., Yu S.P., Ying H.S., Koh J.Y., Kerchner G.A. &
Choi D.W. (1997) Measurement of intracellular free zinc in living cortical neurons: routes of entry. J Neurosci 17, 9554-64.
Sensi S.L., Paoletti P., Bush A.I. & Sekler I. (2009) Zinc in the physiology and
pathology of the CNS. Nat Rev Neurosci 10, 780-91. Seo Y.A. & Kelleher S.L. (2010) Functional analysis of two single nucleotide
polymorphisms in SLC30A2 (ZnT2): implications for mammary gland function and breast disease in women. Physiol Genomics 42A, 219-27.
Seo Y.A., Lopez V. & Kelleher S.L. (2011) A histidine-rich motif mediates
mitochondrial localization of ZnT2 to modulate mitochondrial function. Am J Physiol Cell Physiol 300, C1479-89.
Seve M., Chimienti F., Devergnas S. & Favier A. (2004) In silico identification
and expression of SLC30 family genes: an expressed sequence tag data mining strategy for the characterization of zinc transporters' tissue expression. BMC Genomics 5, 32.
Seve M., Chimienti F. & Favier A. (2002) [Role of intracellular zinc in
programmed cell death]. Pathol Biol (Paris) 50, 212-21. Sharma N.L., Sharma R.C., Gupta K.R. & Sharma R.P. (1988) Self-limiting
acrodermatitis enteropathica. A follow-up study of three interrelated families. Int J Dermatol 27, 485-6.
Sheikh A., Shamsuzzaman S., Ahmad S.M., Nasrin D., Nahar S., Alam M.M.,
Al Tarique A., Begum Y.A., Qadri S.S., Chowdhury M.I., Saha A., Larson C.P. & Qadri F. (2010) Zinc influences innate immune responses in children with enterotoxigenic Escherichia coli-induced diarrhea. J Nutr 140, 1049-56.
240
Shimizu N., Fujiwara J., Ohnishi S., Sato M., Kodama H., Kohsaka T., Inui A., Fujisawa T., Tamai H., Ida S., Itoh S., Ito M., Horiike N., Harada M., Yoshino M. & Aoki T. (2010) Effects of long-term zinc treatment in Japanese patients with Wilson disease: efficacy, stability, and copper metabolism. Transl Res 156, 350-7.
Shin J.Y., Suh D., Kim J.M., Choi H.G., Kim J.A., Ko J.J., Lee Y.B., Kim J.S.
& Oh Y.K. (2005) Low molecular weight polyethylenimine for efficient transfection of human hematopoietic and umbilical cord blood-derived CD34+ cells. Biochim Biophys Acta 1725, 377-84.
Shokrzadeh M., Ghaemian A., Salehifar E., Aliakbari S., Saravi S.S. &
Ebrahimi P. (2009) Serum zinc and copper levels in ischemic cardiomyopathy. Biol Trace Elem Res 127, 116-23.
Sieveking Gde G., Craddock P.T., Hughes M.J., Bush P. & Ferguson J.
(1970) Characterization of prehistoric flint mine products. Nature 228, 251-4.
Sim D.L. & Chow V.T. (1999) The novel human HUEL (C4orf1) gene maps to
chromosome 4p12-p13 and encodes a nuclear protein containing the nuclear receptor interaction motif. Genomics 59, 224-33.
Simons T.J. (1991) Intracellular free zinc and zinc buffering in human red
blood cells. J Membr Biol 123, 63-71. Sinclair A.J., Attar-Bashi N.M. & Li D. (2002) What is the role of alpha-
linolenic acid for mammals? Lipids 37, 1113-23. Sindreu C., Palmiter R.D. & Storm D.R. (2011) Zinc transporter ZnT-3
regulates presynaptic Erk1/2 signaling and hippocampus-dependent memory. Proc Natl Acad Sci U S A 108, 3366-70.
Sladek R., Rocheleau G., Rung J., Dina C., Shen L., Serre D., Boutin P.,
Vincent D., Belisle A., Hadjadj S., Balkau B., Heude B., Charpentier G., Hudson T.J., Montpetit A., Pshezhetsky A.V., Prentki M., Posner B.I., Balding D.J., Meyre D., Polychronakos C. & Froguel P. (2007) A genome-wide association study identifies novel risk loci for type 2 diabetes. Nature 445, 881-5.
Smidt K., Jessen N., Petersen A.B., Larsen A., Magnusson N., Jeppesen
J.B., Stoltenberg M., Culvenor J.G., Tsatsanis A., Brock B., Schmitz O., Wogensen L., Bush A.I. & Rungby J. (2009) SLC30A3 responds to glucose- and zinc variations in beta-cells and is critical for insulin production and in vivo glucose-metabolism during beta-cell stress. PLoS One 4, e5684.
Smidt K. & Rungby J. (2012) ZnT3: a zinc transporter active in several
organs. Biometals 25, 1-8.
241
Smith J.L., Xiong S., Markesbery W.R. & Lovell M.A. (2006) Altered
expression of zinc transporters-4 and -6 in mild cognitive impairment, early and late Alzheimer's disease brain. Neuroscience 140, 879-88.
Smith K.T. & Cousins R.J. (1980) Quantitative aspects of zinc absorption by
isolated, vascularly perfused rat intestine. J Nutr 110, 316-23. Solomin L., Johansson C.B., Zetterstrom R.H., Bissonnette R.P., Heyman
R.A., Olson L., Lendahl U., Frisen J. & Perlmann T. (1998) Retinoid-X receptor signalling in the developing spinal cord. Nature 395, 398-402.
Song J., Kim D., Lee C.H., Lee M.S., Chun C.H. & Jin E.J. (2013) MicroRNA-
488 regulates zinc transporter SLC39A8/ZIP8 during pathogenesis of osteoarthritis. J Biomed Sci 20, 31.
Stefanidou M. & Maravelias C. (2004) Metallothioneins in toxicology. Curr
Top Toxicol 1:161–167.
Stevens J. & Lubitz L. (1998) Symptomatic zinc deficiency in breast-fed term and premature infants. J Paediatr Child Health 34, 97-100.
Stoltenberg M., Bruhn M., Sondergaard C., Doering P., West M.J., Larsen A.,
Troncoso J.C. & Danscher G. (2005) Immersion autometallographic tracing of zinc ions in Alzheimer beta-amyloid plaques. Histochem Cell Biol 123, 605-11.
Strausberg R.L., Feingold E.A., Grouse L.H., Derge J.G., Klausner R.D.,
Collins F.S., Wagner L., Shenmen C.M., Schuler G.D., Altschul S.F., Zeeberg B., Buetow K.H., Schaefer C.F., Bhat N.K., Hopkins R.F., Jordan H., Moore T., Max S.I., Wang J., Hsieh F., Diatchenko L., Marusina K., Farmer A.A., Rubin G.M., Hong L., Stapleton M., Soares M.B., Bonaldo M.F., Casavant T.L., Scheetz T.E., Brownstein M.J., Usdin T.B., Toshiyuki S., Carninci P., Prange C., Raha S.S., Loquellano N.A., Peters G.J., Abramson R.D., Mullahy S.J., Bosak S.A., McEwan P.J., McKernan K.J., Malek J.A., Gunaratne P.H., Richards S., Worley K.C., Hale S., Garcia A.M., Gay L.J., Hulyk S.W., Villalon D.K., Muzny D.M., Sodergren E.J., Lu X., Gibbs R.A., Fahey J., Helton E., Ketteman M., Madan A., Rodrigues S., Sanchez A., Whiting M., Madan A., Young A.C., Shevchenko Y., Bouffard G.G., Blakesley R.W., Touchman J.W., Green E.D., Dickson M.C., Rodriguez A.C., Grimwood J., Schmutz J., Myers R.M., Butterfield Y.S., Krzywinski M.I., Skalska U., Smailus D.E., Schnerch A., Schein J.E., Jones S.J. & Marra M.A. (2002) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci U S A 99, 16899-903.
Suh S.W., Chen J.W., Motamedi M., Bell B., Listiak K., Pons N.F., Danscher
G. & Frederickson C.J. (2000) Evidence that synaptically-released
242
zinc contributes to neuronal injury after traumatic brain injury. Brain Res 852, 268-73.
Suphioglu C., De Mel D., Kumar L., Sadli N., Freestone D., Michalczyk A.,
Sinclair A. & Ackland M.L. (2010) The omega-3 fatty acid, DHA, decreases neuronal cell death in association with altered zinc transport. FEBS Lett 584, 612-8.
Suzuki T., Ishihara K., Migaki H., Ishihara K., Nagao M., Yamaguchi-Iwai Y.
& Kambe T. (2005a) Two different zinc transport complexes of cation diffusion facilitator proteins localized in the secretory pathway operate to activate alkaline phosphatases in vertebrate cells. J Biol Chem 280, 30956-62.
Suzuki T., Ishihara K., Migaki H., Matsuura W., Kohda A., Okumura K.,
Nagao M., Yamaguchi-Iwai Y. & Kambe T. (2005b) Zinc transporters, ZnT5 and ZnT7, are required for the activation of alkaline phosphatases, zinc-requiring enzymes that are glycosylphosphatidylinositol-anchored to the cytoplasmic membrane. J Biol Chem 280, 637-43.
Sveen A., Bakken A.C., Agesen T.H., Lind G.E., Nesbakken A., Nordgard O.,
Brackmann S., Rognum T.O., Lothe R.A. & Skotheim R.I. (2012) The exon-level biomarker SLC39A14 has organ-confined cancer-specificity in colorectal cancer. Int J Cancer 131, 1479-85.
Svennerholm L. (1968) Distribution and fatty acid composition of
phosphoglycerides in normal human brain. J Lipid Res 9, 570-9. Tabuchi M., Yoshimori T., Yamaguchi K., Yoshida T. & Kishi F. (2000)
Human NRAMP2/DMT1, which mediates iron transport across endosomal membranes, is localized to late endosomes and lysosomes in HEp-2 cells. J Biol Chem 275, 22220-8.
Tamaki M., Fujitani Y., Uchida T., Hirose T., Kawamori R. & Watada H.
(2009) Downregulation of ZnT8 expression in pancreatic beta-cells of diabetic mice. Islets 1, 124-8.
Tapiero H. & Tew K.D. (2003) Trace elements in human physiology and
pathology: zinc and metallothioneins. Biomed Pharmacother 57, 399-411.
Taylor C.G., Bettger W.J. & Bray T.M. (1988) Effect of dietary zinc or copper
deficiency on the primary free radical defense system in rats. J Nutr 118, 613-21.
Taylor C.M., Bacon J.R., Aggett P.J. & Bremner I. (1991) Homeostatic
regulation of zinc absorption and endogenous losses in zinc-deprived men. Am J Clin Nutr 53, 755-63.
243
Taylor K.M., Hiscox S., Nicholson R.I., Hogstrand C. & Kille P. (2012) Protein
kinase CK2 triggers cytosolic zinc signaling pathways by phosphorylation of zinc channel ZIP7. Sci Signal 5, ra11.
Taylor K.M., Morgan H.E., Smart K., Zahari N.M., Pumford S., Ellis I.O.,
Robertson J.F. & Nicholson R.I. (2007) The emerging role of the LIV-1 subfamily of zinc transporters in breast cancer. Mol Med 13, 396-406.
Taylor K.M. & Nicholson R.I. (2003) The LZT proteins; the LIV-1 subfamily of
zinc transporters. Biochim Biophys Acta 1611, 16-30. Taylor K.M., Vichova P., Jordan N., Hiscox S., Hendley R. & Nicholson R.I.
(2008) ZIP7-mediated intracellular zinc transport contributes to aberrant growth factor signaling in antihormone-resistant breast cancer Cells. Endocrinology 149, 4912-20.
Thompson D.A. & Stahl F.W. (1999) Genetic control of recombination partner
preference in yeast meiosis. Isolation and characterization of mutants elevated for meiotic unequal sister-chromatid recombination. Genetics 153, 621-41.
Thompson R.P. (1991) Assessment of zinc status. Proc Nutr Soc 50, 19-28. Thomson J.P., Skene P.J., Selfridge J., Clouaire T., Guy J., Webb S., Kerr
A.R., Deaton A., Andrews R., James K.D., Turner D.J., Illingworth R. & Bird A. (2010) CpG islands influence chromatin structure via the CpG-binding protein Cfp1. Nature 464, 1082-6.
Thornberry N.A. & Lazebnik Y. (1998) Caspases: enemies within. Science
281, 1312-6. Thornton J.K., Taylor K.M., Ford D. & Valentine R.A. (2011) Differential
subcellular localization of the splice variants of the zinc transporter ZnT5 is dictated by the different C-terminal regions. PLoS One 6, e23878.
Todd W.R., Elvehjem C.A. & Hart E.B. (1934) Zinc in the nutrition of the rat,
Am J Physiol, 107, 146-56.
Tominaga K., Kagata T., Johmura Y., Hishida T., Nishizuka M. & Imagawa M. (2005) SLC39A14, a LZT protein, is induced in adipogenesis and transports zinc. FEBS J 272, 1590-9.
Torres M., Price S.L., Fiol-Deroque M.A., Marcilla-Etxenike A., Ahyayauch
H., Barcelo-Coblijn G., Teres S., Katsouri L., Ordinas M., Lopez D.J., Ibarguren M., Goni F.M., Busquets X., Vitorica J., Sastre M. & Escriba P.V. (2013) Membrane lipid modifications and therapeutic effects
244
mediated by hydroxydocosahexaenoic acid on Alzheimer's disease. Biochim Biophys Acta.
Tozlu S., Girault I., Vacher S., Vendrell J., Andrieu C., Spyratos F., Cohen P.,
Lidereau R. & Bieche I. (2006) Identification of novel genes that co-cluster with estrogen receptor alpha in breast tumor biopsy specimens, using a large-scale real-time reverse transcription-PCR approach. Endocr Relat Cancer 13, 1109-20.
Truong-Tran A.Q., Carter J., Ruffin R.E. & Zalewski P.D. (2001) The role of
zinc in caspase activation and apoptotic cell death. Biometals 14, 315-30.
Tully A.M., Roche H.M., Doyle R., Fallon C., Bruce I., Lawlor B., Coakley D.
& Gibney M.J. (2003) Low serum cholesteryl ester-docosahexaenoic acid levels in Alzheimer's disease: a case-control study. Br J Nutr 89, 483-9.
Tuschl K., Clayton P.T., Gospe S.M., Jr., Gulab S., Ibrahim S., Singhi P.,
Aulakh R., Ribeiro R.T., Barsottini O.G., Zaki M.S., Del Rosario M.L., Dyack S., Price V., Rideout A., Gordon K., Wevers R.A., Chong W.K. & Mills P.B. (2012) Syndrome of hepatic cirrhosis, dystonia, polycythemia, and hypermanganesemia caused by mutations in SLC30A10, a manganese transporter in man. Am J Hum Genet 90, 457-66.
Underwood E.J. (1981) Trace metals in human and animal health. J Hum
Nutr 35, 37-48. Valencia E.Y., Braz V.S., Guzzo C. & Marques M.V. (2013) Two RND
proteins involved in heavy metal efflux in Caulobacter crescentus belong to separate clusters within proteobacteria. BMC Microbiol 13, 79.
Valentine R.A., Jackson K.A., Christie G.R., Mathers J.C., Taylor P.M. &
Ford D. (2007) ZnT5 variant B is a bidirectional zinc transporter and mediates zinc uptake in human intestinal Caco-2 cells. J Biol Chem 282, 14389-93.
Vallee B.L. & Auld D.S. (1993) New perspective on zinc biochemistry:
cocatalytic sites in multi-zinc enzymes. Biochemistry 32, 6493-500. Vallee B.L. & Falchuk K.H. (1993) The biochemical basis of zinc physiology.
Physiol Rev 73, 79-118. Vallee B.L. & Gibson J.G., 2nd (1949) The zinc content of whole blood,
plasma, leukocytes and erythrocytes in the anemias. Blood 4, 455-66.
245
Van Campen D.R. (1969) Copper interference with the intestinal absorption of zinc-65 by rats. J Nutr 97, 104-8.
van Gelder B.M., Tijhuis M., Kalmijn S. & Kromhout D. (2007) Fish
consumption, n-3 fatty acids, and subsequent 5-y cognitive decline in elderly men: the Zutphen Elderly Study. Am J Clin Nutr 85, 1142-7.
Wada L., Turnlund J.R. & King J.C. (1985) Zinc utilization in young men fed
adequate and low zinc intakes. J Nutr 115, 1345-54. Wang B., Schneider S.N., Dragin N., Girijashanker K., Dalton T.P., He L.,
Miller M.L., Stringer K.F., Soleimani M., Richardson D.D. & Nebert D.W. (2007) Enhanced cadmium-induced testicular necrosis and renal proximal tubule damage caused by gene-dose increase in a Slc39a8-transgenic mouse line. Am J Physiol Cell Physiol 292, C1523-35.
Wang C.Y., Wang T., Zheng W., Zhao B.L., Danscher G., Chen Y.H. & Wang
Z.Y. (2010) Zinc overload enhances APP cleavage and Abeta deposition in the Alzheimer mouse brain. PLoS One 5, e15349.
Wang F., Dufner-Beattie J., Kim B.E., Petris M.J., Andrews G. & Eide D.J.
(2004) Zinc-stimulated endocytosis controls activity of the mouse ZIP1 and ZIP3 zinc uptake transporters. J Biol Chem 279, 24631-9.
Wang F., Kim B.E., Dufner-Beattie J., Petris M.J., Andrews G. & Eide D.J.
(2004) Acrodermatitis enteropathica mutations affect transport activity, localization and zinc-responsive trafficking of the mouse ZIP4 zinc transporter. Hum Mol Genet 13, 563-71.
Wang K., Pugh E.W., Griffen S., Doheny K.F., Mostafa W.Z., al-Aboosi M.M.,
el-Shanti H. & Gitschier J. (2001) Homozygosity mapping places the acrodermatitis enteropathica gene on chromosomal region 8q24.3. Am J Hum Genet 68, 1055-60.
Wang K., Zhou B., Kuo Y.M., Zemansky J. & Gitschier J. (2002) A novel
member of a zinc transporter family is defective in acrodermatitis enteropathica. Am J Hum Genet 71, 66-73.
Wang K., Zhou B., Kuo Y.M., Zemansky J. & Gitschier J. (2002) A novel
member of a zinc transporter family is defective in acrodermatitis enteropathica. Am J Hum Genet 71, 66-73.
Wapnir R.A. & Stiel L. (1986) Zinc intestinal absorption in rats: specificity of
amino acids as ligands. J Nutr 116, 2171-9. Waterland R.A. & Jirtle R.L. (2003) Transposable elements: targets for early
nutritional effects on epigenetic gene regulation. Mol Cell Biol 23, 5293-300.
246
Waters B.M. & Eide D.J. (2002) Combinatorial control of yeast FET4 gene expression by iron, zinc, and oxygen. J Biol Chem 277, 33749-57.
Weaver B.P., Dufner-Beattie J., Kambe T. & Andrews G.K. (2007) Novel
zinc-responsive post-transcriptional mechanisms reciprocally regulate expression of the mouse Slc39a4 and Slc39a5 zinc transporters (Zip4 and Zip5). Biol Chem 388, 1301-12.
Weijers R.N. (2010) Three-dimensional structure of beta-cell-specific zinc
transporter, ZnT-8, predicted from the type 2 diabetes-associated gene variant SLC30A8 R325W. Diabetol Metab Syndr 2, 33.
Wenzel H.J., Cole T.B., Born D.E., Schwartzkroin P.A. & Palmiter R.D.
(1997) Ultrastructural localization of zinc transporter-3 (ZnT-3) to synaptic vesicle membranes within mossy fiber boutons in the hippocampus of mouse and monkey. Proc Natl Acad Sci U S A 94, 12676-81.
Westbrook G.L. & Mayer M.L. (1987) Micromolar concentrations of Zn2+
antagonize NMDA and GABA responses of hippocampal neurons. Nature 328, 640-3.
Weymouth R.D., Kelly R. & Lansdell B.J. (1982) Symptomatic zinc deficiency
in a premature infant. Aust Paediatr J 18, 208-10. White H.E., Durston V.J., Harvey J.F. & Cross N.C. (2006) Quantitative
analysis of SNRPN(correction of SRNPN) gene methylation by pyrosequencing as a diagnostic test for Prader-Willi syndrome and Angelman syndrome. Clin Chem 52, 1005-13.
Whitehead R.H., Bertoncello I., Webber L.M. & Pedersen J.S. (1983) A new
human breast carcinoma cell line (PMC42) with stem cell characteristics. I. Morphologic characterization. J Natl Cancer Inst 70, 649-61.
Wijesekara N., Dai F.F., Hardy A.B., Giglou P.R., Bhattacharjee A., Koshkin
V., Chimienti F., Gaisano H.Y., Rutter G.A. & Wheeler M.B. (2010) Beta cell-specific Znt8 deletion in mice causes marked defects in insulin processing, crystallisation and secretion. Diabetologia 53, 1656-68.
Williams R.J. (1984) Zinc: what is its role in biology? Endeavour 8, 65-70. Wimmer U., Wang Y., Georgiev O. & Schaffner W. (2005) Two major
branches of anti-cadmium defense in the mouse: MTF-1/metallothioneins and glutathione. Nucleic Acids Res 33, 5715-27.
247
Wong C.P., Magnusson K.R. & Ho E. (2013) Increased inflammatory response in aged mice is associated with age-related zinc deficiency and zinc transporter dysregulation. J Nutr Biochem 24, 353-9.
Wood K.W., Qi H., D'Arcangelo G., Armstrong R.C., Roberts T.M. &
Halegoua S. (1993) The cytoplasmic raf oncogene induces a neuronal phenotype in PC12 cells: a potential role for cellular raf kinases in neuronal growth factor signal transduction. Proc Natl Acad Sci U S A 90, 5016-20.
Wuehler S.E., Peerson J.M. & Brown K.H. (2005) Use of national food
balance data to estimate the adequacy of zinc in national food supplies: methodology and regional estimates. Public Health Nutr 8, 812-9.
Yamasaki S., Hasegawa A., Hojyo S., Ohashi W., Fukada T., Nishida K. &
Hirano T. (2012) A novel role of the L-type calcium channel alpha1D subunit as a gatekeeper for intracellular zinc signaling: zinc wave. PLoS One 7, e39654.
Yamasaki S., Sakata-Sogawa K., Hasegawa A., Suzuki T., Kabu K., Sato E.,
Kurosaki T., Yamashita S., Tokunaga M., Nishida K. & Hirano T. (2007) Zinc is a novel intracellular second messenger. J Cell Biol 177, 637-45.
Yatsunyk L.A., Easton J.A., Kim L.R., Sugarbaker S.A., Bennett B., Breece
R.M., Vorontsov, II, Tierney D.L., Crowder M.W. & Rosenzweig A.C. (2008) Structure and metal binding properties of ZnuA, a periplasmic zinc transporter from Escherichia coli. J Biol Inorg Chem 13, 271-88.
Yeh K.Y., Yeh M., Watkins J.A., Rodriguez-Paris J. & Glass J. (2000) Dietary
iron induces rapid changes in rat intestinal divalent metal transporter expression. Am J Physiol Gastrointest Liver Physiol 279, G1070-9.
Yip L., Su L., Sheng D., Chang P., Atkinson M., Czesak M., Albert P.R.,
Collier A.R., Turley S.J., Fathman C.G. & Creusot R.J. (2009) Deaf1 isoforms control the expression of genes encoding peripheral tissue antigens in the pancreatic lymph nodes during type 1 diabetes. Nat Immunol 10, 1026-33.
Ynsa M.D., Ren M.Q., Rajendran R., Sidhapuriwala J.N., van Kan J.A.,
Bhatia M. & Watt F. (2009) Zinc mapping and density imaging of rabbit pancreas endocrine tissue sections using nuclear microscopy. Microsc Microanal 15, 345-52.
Young G. & Conquer J. (2005) Omega-3 fatty acids and neuropsychiatric
disorders. Reprod Nutr Dev 45, 1-28.
248
Yu Y.Y., Kirschke C.P. & Huang L. (2007) Immunohistochemical analysis of ZnT1, 4, 5, 6, and 7 in the mouse gastrointestinal tract. J Histochem Cytochem 55, 223-34.
Yu Y., Wu A., Zhang Z., Yan G., Zhang F., Zhang L., Shen X., Hu R., Zhang
Y., Zhang K. & Wang F. (2013) Characterization of the GufA subfamily member SLC39A11/Zip11 as a zinc transporter. J Nutr Biochem 24, 1697-708.
Zalewski P.D., Forbes I.J. & Betts W.H. (1993) Correlation of apoptosis with
change in intracellular labile Zn(II) using zinquin [(2-methyl-8-p-toluenesulphonamido-6-quinolyloxy)acetic acid], a new specific fluorescent probe for Zn(II). Biochem J 296 ( Pt 2), 403-8.
Zelenski N.G., Rawson R.B., Brown M.S. & Goldstein J.L. (1999) Membrane
topology of S2P, a protein required for intramembranous cleavage of sterol regulatory element-binding proteins. J Biol Chem 274, 21973-80.
Zhang K., Shen X., Wu J., Sakaki K., Saunders T., Rutkowski D.T., Back
S.H. & Kaufman R.J. (2006) Endoplasmic reticulum stress activates cleavage of CREBH to induce a systemic inflammatory response. Cell 124, 587-99.
Zhang L.H., Wang X., Stoltenberg M., Danscher G., Huang L. & Wang Z.Y.
(2008) Abundant expression of zinc transporters in the amyloid plaques of Alzheimer's disease brain. Brain Res Bull 77, 55-60.
Zhang Y., Yang J., Cui X., Chen Y., Zhu V.F., Hagan J.P., Wang H., Yu X.,
Hodges S.E., Fang J., Chiao P.J., Logsdon C.D., Fisher W.E., Brunicardi F.C., Chen C., Yao Q., Fernandez-Zapico M.E. & Li M. (2013) A novel epigenetic CREB-miR-373 axis mediates ZIP4-induced pancreatic cancer growth. EMBO Mol Med 5, 1322-34.
Zhao H. & Eide D. (1996a) The yeast ZRT1 gene encodes the zinc
transporter protein of a high-affinity uptake system induced by zinc limitation. Proc Natl Acad Sci U S A 93, 2454-8.
Zhao H. & Eide D. (1996b) The ZRT2 gene encodes the low affinity zinc
transporter in Saccharomyces cerevisiae. J Biol Chem 271, 23203-10. Zhou J.R., Canar M.M. & Erdman J.W., Jr. (1993) Bone zinc is poorly
released in young, growing rats fed marginally zinc-restricted diet. J Nutr 123, 1383-8.
Zimmerman A.W., Hambidge K.M., Lepow M.L., Greenberg R.D., Stover
M.L. & Casey C.E. (1982) Acrodermatitis in breast-fed premature infants: evidence for a defect of mammary zinc secretion. Pediatrics 69, 176-83.
249
Zimmerman A.W., Hambidge K.M., Lepow M.L., Greenberg R.D., Stover
M.L. & Casey C.E. (1982) Acrodermatitis in breast-fed premature infants: evidence for a defect of mammary zinc secretion. Pediatrics 69, 176-83.
Zschocke J., Allritz C., Engele J. & Rein T. (2007) DNA methylation
dependent silencing of the human glutamate transporter EAAT2 gene in glial cells. Glia 55, 663-74.
Zwicker J., Gross C., Lucibello F.C., Truss M., Ehlert F., Engeland K. &
Muller R. (1995) Cell cycle regulation of cdc25C transcription is mediated by the periodic repression of the glutamine-rich activators NF-Y and Sp1. Nucleic Acids Res 23, 3822-30.
![Understanding the Contribution of Zinc Transporters in the ...which are classified into three subgroups, namely Zn-CDF, Zn/Fe-CDF, and Mn-CDF [14,30]. All of the ZNT transporters are](https://static.documents.pub/doc/80x56/5e73c295a81e3b67c95c8c1a/understanding-the-contribution-of-zinc-transporters-in-the-which-are-classified.jpg)
![Ions channels/transporters and chloroplast regulation · transporters/pumps and secondary transporters (according to the Transport Classification system [1]). Channels transport](https://static.documents.pub/doc/80x56/601623c1d6936b1074546c48/ions-channelstransporters-and-chloroplast-transporterspumps-and-secondary-transporters.jpg)
