The International Conference on Biosciences€¦ · Nyoman Adi Suratma, I Wayan Yustisia...

The International Conference on Biosciences “Advancing Biodiversity for Sustainable Food Security”

PROCEEDING 2017 I

PROCEEDING THE INTERNATIONAL CONFERENCE ON BIOSCIENCES “Advancing Biodiversity for Sustainable Food Security” Udayana University, Bali, 27th - 28nd July 2016 Held by:

Postgraduate Study on Biology, Faculty of Mathematics and Natural Sciences, Udayana University, Bali, Indonesia

and The North Dakota State University, United States of America

Editors:

Prof. Kalidas Shetty, Ph.D. Drs. Yan Ramona, M.App.Sc., Ph.D. Dr. Iriani Setyawati, S.Si., M.Si. Ir. Ida Ayu Astarini, M.Sc, Ph.D.

Reviewers:

Dr. Pande Gde Sasmita J., S.Si., M.Si. Dra. Ni Luh Watiniasih, M.Sc, Ph.D. Dra. Inna Narayani, M.Sc. Dr. Dra. Retno Kawuri, M.Phil. Dr. Anak Agung Ketut Darmadi, M.Si. Ni Luh Arpiwi, S.Si., M.Sc, Ph.D.

Published by: Udayana University Press ISBN 9-786022-941491 Copyright© January, 2017


PROCEEDING 2017 II

PREFACE - CHAIRMAN OF THE ORGANIZING COMMITTEE

This proceeding compiles all papers presented in the International Conference on Biosciences 2016 held at the Udayana University, Bali on 27th - 28nd July 2016, which was aimed to gather scientists, government officers, and industries in Biosciences-related disciplines, so that they could discuss and share their expertise, experience and expand networking.

This International conference was an implementation of MoU between the Postgraduate Study on Biology and The North Dakota State University and held in accordance to the 54th Anniversary of Udayana University. The conference consisted of 5 plenary sessions in which all honorable invited speakers delivered their works covering general aspects of Biosciences related topics. They came from Australia, India, Indonesia, Japan, Malaysia, and USA. Besides these plenary sessions, we also had four satellite symposia, covering areas of: (1) Ecology and environmental biology, (2) Physiology and developmental biology, (3) Biotechnology, genetics, molecular biology, (4) Health and microbiology, and (5) Food and agriculture. Totally more than 100 contribution papers (oral and poster presentation) were presented in this conference. The efforts of the presenters to prepare their contribution papers for this conference are highly appreciated.

This Conference was financially supported by the Rector of Udayana University, Faculty of Mathematics and Science, Udayana University, Postgraduate Study on Biology, Udayana University, and NDSU through GIFSA Institute founded by Prof. Kalidas Shetty. Therefore, in this occasion, on behalf of the committee, I would like to thank their generous supports on this conference.

My special thanks should also go to all people who have been involved in the committee of the conference. Without their hard working and efforts, I am afraid we would not be able to make this event to happen.

We hope that all papers presented in this proceeding will prove useful for further studies in Biosciences-related areas. Once again, thank you very much for your participation in this conference, and see you again in 2018.

Chairman of the Organizing Committee

Drs. Yan Ramona, M. App.Sc., Ph.D.


PROCEEDING 2017 III

TABLE OF CONTENTS

Page

1 Preface - Chairman of The Organizing Committee II 2 Table of Contents III

ECOLOGY AND ENVIRONMENTAL BIOLOGY

1

The Potency of Biomass and Carbon Stocks in Smallholder Rubber Trees (Hevea brasiliensis Muell. Arg), North Sumatera, Indonesia Muhdi, Diana Sofia Hanafiah, Evan Satria Saragiha, Frans Rinaldo Sipayung, and Frits Melky Sedek Situmorang

1

2 Knowledge of The Sea Cucumber Diversity and Utilization in Coastal Tablasupa, Depapre, Jayapura Papua Puguh Sujarta and Suwarno Hadisusanto

6

3 The Potential of Fungal Endophytes from Potato Root and Tubers to Inhibit Potato Cyst Nematode (Globodera rostochiensis) Noor Istifadah, Maria Astriani and Toto Sunarto

10

4 Morphological Diversity of Local Corn Variety in Lakekun Village, Kobalima District, Malaka Regency, East of Nusa Tenggara Province Uslan, Nur R. Adawiyah Mahmud, and Margaretha Seuk Kiik

18

5 Begonia Edible Plants and Conservation in Bali Botanic Garden NKE. Undaharta and IG. Wawan Setiadi 23

6 Seasonal Energetics of The New Holland Honeyeater Near Hobart Tasmania Luh Putu Eswaryanti Kusuma Yuni and R.W. Rose

37

7 The Ecological Impact Of Segarssbeds Replacement Onto Sea Urchin, Tripneustes gratilla Linnaeus, 1758, At Serangan Island Bali Deny S.Yusup, Philipus Kristianto, and Job Nico Subagio

53

PHYSIOLOGY AND DEVELOPMENTAL BIOLOGY

8 Investigation of Heavy Metal Plumbum (Pb) and Cadmium (Cd) in The Tissues of Cattle Maintained in Landfill, Denpasar I Ketut Berata and I Made Kardena

60

9

Effects of Soaking Lamtoro Leaf Meal (Leucaena leucocephala) on Feed Intake and Seminiferous Tubule Diameter of Male Rat (Rattus

norvegicus) A.A. Istri Mas Padmiswari, Ngr. Intan Wiratmini, and I Wayan Kasa

66

10 Brood size variations of Trigona laeviceps in Tropical Areas Ni Luh Watiniasih and Ni Made Suartini 72

11 Zn and Fe Micronutrients Content in Local Rice Cultivar Grown at Jatiluwih Village, Tabanan Regency, Bali-Indonesia Made Ria Defiani and Ida Ayu Astarini

76


PROCEEDING 2017 IV

BIOTECNOLOGY, GENETICS AND MOLECULAR BIOLOGY

12

Detection of Mungbean Yellow Mosaic Virus (MYMV) using Polymerase Chain Reaction (PCR) in Yard Long Bean (Vigna sinensis L.) and Weeds I Putu Sudiarta, Trisna Agung Phabiola , I Gusti Putu Eka Saputra, I Dewa Nyoman Nyana and Gede Suastika

79

13 Expression of OsbZIP72 Gene in Bali Local Rice Under Drought Stress Made Pharmawati, Ni NyomanWirasiti, IGA SugiWahyuni, and Luh Putu Wrasiati

84

14

HMG-CoA Reductase Inhibitor Activity of Anthocyanin from Purple Sweet Potato (Ipomoea batatas L.) Ni Made Pitri Susanti, Ni Putu Linda Laksmiani, I Made Agus Gelgel Wirasuta, Ni Kadek Ayu Sandra Dewi, Mitsue Oka, Wayan Eka Heltyani, and I Gde Pande Anindhita Putra Wicaksana

89

15

Gene Action for Agronomy Characters in Segregating Generation (M2) of Soybean [Glycine max (L.)Merr.] Diana Sofia Hanafiah, Ratna Rosanty Lahay, Irdasafni, Eva S. Bayu, and Isman Nuriadi

95

16

Infection and Distribution Of Anisakis spp. Larvae On Sword Fish (Trichiurus lepturus) In Kedonganan Waters Nyoman Adi Suratma, I Wayan Yustisia Semarariana, Ida Bagus Made Oka, and Hapsari Mahatmi

100

HEALTH AND MICROBIOLOGY

17 Antibacterial Activity Against Staphylococcus aureus From Methanol Extract of Mangosteen Rind (Garcinia mangostana L.) Ketut Widyani Astuti and Ni Putu Ayu Dewi Wijayanti

104

18 The Potential of Honeycomb From Wild Bee Mochammad Junus 108

19 Characterization of Lactic Acid Bacteria Isolated from Kimchi with Aview for Development of Probiotic Potential Swastini D.A., Agestiawan I.G.A.M. and Ramona Y.

116

20

Detection of Antibacterial Compound of Piper betle L. Purified Extract Againts Propionibacterium acnes by Bioautography Ni Luh Putu Vidya Paramita, Ni Wayan Budiningrum, Anak Agung Gede Rai Yadnya Putra, Putu Sanna Yustiantara, and I Made Agus Gelgel Wirasuta

124

21 Role of Native Mycorrhizae Gigaspora, Acaulospora and Glomus sp. on the Growth of Cashew Nut (Anacardium occidentale L.) Seedlings Meitini Wahyuni Proborini

130

22 Microbial Contamination in Traditional Food Processing Pedetan Ni Made Ayu Suardani Singapurwa, A.A. Made Semariyani, and I Putu Candra

135


PROCEEDING 2017 V

23 Copper Hair Level on Children with HIV/AIDS Rasmaya Niruri, Wati K.D.K, Oktavianti K.A.D, and Cahyani M.R 141

24

Mechanisms of Antibiotic filtrate Streptomyces thermocarboxydus against Fusarium oxysporum F020 Ultrasructure through Scanning Electron Microscope and Transmission Electron Microscope Retno Kawuri

147

FOOD AND AGRICULTURE

25

Effect of Application Dosage Biokompos and Biochar Fermentation Results of Trichoderma spp. and Fumigasi on The Growth and Results of Soybean Plant in The Entisol Land West Lombok Sardian, I Made Sudantha, and Suwardji

153

26

Determining an Optimal Isolation Method of Carrageenan From Seaweed Kappaphycus alvarezii Doty That Meets FAO Standards Wijayanti N.P.A.D., Putra I.G.N.A.D., Laksmiani N.P.L., and Astuti K.W

163

27 Less Frequently Consumed Fauna in Recent Balinese Generation’s Diet Anak Agung Gde Raka Dalem 171

28 Innovation of Model Processing of the Local Food Sago Palm (Metroxylon sagu Rottb.) from Papua Linus Yhani Chrystomo, I Made Budi, and Aditya Krishar Karim

177

29

Determination of Pelleting Technique and Pellet Formulation of Rice Seed Anak Agung Keswari Krisnandika, Eny Widajati, and Wawan Hermawan

182

30

The Application of Benzyl Adenine (BA) and Indole Butyric Acid (IBA) Combinations on Strawberries (Fragaria x ananassa Var. Earlybrite) micropropagation Tia Setiawati, Linda Anggraini, and Ruly Budiono

186

31 Potato Farming at Bedugul Region, Bali, Indonesia Ida Ayu Astarini, Debora Margareth, Putu Wina Andriani Lestari, and Made Ria Defiani

192


PROCEEDING 2017 1

STUDY ON WET WEIGHT AND CARBON CONTENT IN

AGROFORESTRY OF RUBBER CROPS (Hevea Brasiliensis Muell.

Arg), NORTH SUMATERA, INDONESIA

Muhdi1*, Diana Sofia Hanafiah2, Evan Satria Saragih1, Frans Rinaldo Sipayung1,

Frits Melky Sedek Situmorang1

1Department of Forestry, University of Sumatera Utara, Medan

Jl. Tri Dharma Ujung No.1, Kampus USU Medan – 20154 Department of Agroecotechnology, University of Sumatera Utara, Medan

2Jl. Prof. Sofyan No. 9, Kampus USU Medan - 20154 *Corresponding author: [email protected]

Abstract

Rubber agroforestry of technologies should have been practiced in modern without leaving its function as a supporter of the local community in land management with rubber agroforestry patterns. The objective of the study was to know wet weight, biomass, volatile matter conten and ash mateer contents of rubber crops. Research was done in two steps of activities, namely the first stage of data collection in the field and the second stage of analyzing water content and carbon content carried out in laboratory. Biomass above ground level in this study measured using indirect methods (non-destructive) and direct methods (destructive). Results of the research showed that average of wet weight total of rubber trees was 154.62 kg/tree. Results research indicated that the stems part of plant has wet weight amount 57.80 %. The average of ash content on stems was 1.76 %, branches 1.81 % and leaves was 4.77 %, respectively. The average of carbon content on the stems, branches and leaves was 58.39 %, 45.91 % and 19.73 %, respectively.

Keywords: agroforesty, rubber tree, wet weight, carbon content

BACKGROUND

The existence of land cover affect biomass and carbon stocks. Mechanisms for reducing emissions from deforestation and forest degradation, rubber agroforestry farmers will gain an additional incentive. Farmers' knowledge increases and they no longer hesitate to plant rubber with agroforestry. For this reason, the evaluation of the accuracy of these models with new data and in different geographic locations is needed (Alvarez et al, 2012).

Plants have the ability to absorb CO2. Plants such as rubber crops, has a mechanism of photosynthesis (assimilation) that absorbs CO2 in atmosphere and solar energy and stored in the form of biomass (carbon stocks). In addition to the process of photosynthesis, plants also do respiration which produces CO2 into the earth's atmosphere. Therefore, it needs to be seen is its net absorption of CO2 that is absorbed less CO2 is released.

The problem that needs attention is the gap between the agroforestry of rubber cropps patterns that do the farming community with the concept and progress of research on agroforestry. Farmers are still struggling with poverty, while the rubber


PROCEEDING 2017 2

agroforestry researchers talk about CO2 flux. The objective of the study was to know wet weight, biomass, volatile matter conten and ash mater contents of rubber crops.

MATERIALS AND METHODS

Materials

The instruments of this study is used a chainsaw for felling, walking stick for measuring the total height and bole height, rope, scales for measure of weighing the sample cutting, oven to dry the sample cutting, digital cameras, calculators, stationery writing, personal computer and software SPSS 16.0. Material in this study was trees stand of rubber crops (Hevea brasiliensis Muell. Arg.).

Methods

This study collected data from a variety of age classes are derived in developing models equations. The number of samples is needed to make allometric equation was nine (9) rubber trees that plants derived from class 5 years, 10 years and 12 years, respectively. The data is combined and made allometric equation model assessment of above ground biomass and carbon content based on part of plants and on one or more variable dimensions.

The number of samples is needed to make as many allometric equation. Each sample had been on rod stands slash of each was three replications. Samples is taken that each repetition was 200 gram. Sample test of existing sub ± 200g which is then taken to the laboratory for ovening it at a temperature of 80 ° C for 48 hours.

The results of estimation of carbon deposits that have been obtained will be tested statistically with appropriate experimental design. The experimental design used is nested design. To analysis of differences in levels of carbon in tree parts is used further analysis with Tukey test.

RESULTS

Wet Weight

Figure 1 showed that average of wet weight total of rubber trees was 154.62 kg/tree. Resulted tis research indicated that the stems part of plant has wet weight amount 57.80 % .

Figure 1. Wet weight of rubber plant


PROCEEDING 2017 3

Results of this research showed that water content of stem and branches was 75.25 – 85.80 % and 77.59-86.48 %. However, the highest water content ini part of rubber plant was in leaves. Water content of leaves was 153.74-155.57 % (Figure 2).

.

Figure 2. Water content of rubber tree.

Volatile matter, ash matter and carbon content

The average levels of volatile matter of various parts of the rubber plant can be seen in Table 1.

Table 1. Volatile matter content of rubber tree.

No

Volatile matter (%)

Stems Branches Leaves

1 38.96 55.15 75.28

2 30.16 44.15 75.35

3 36.46 47.61 75.84

Average 35.19 48.97 75.48 Based on the results of laboratory analysis (Table 2) showed that average

volatile matter in stems was 35.19 %, branches 48.97 % and leaves 75.48 %, respectively. Table 1 indicated that levels of substances found on the largest was in leaves and the was in the stems.

The number of volatile and ash matter content had relationship with the amount of carbon content in plants. The higher levels of carbon bound in wood, the lower the ash content and volatile matter. Ash matter content found in remnant of burning materials that contain organic ingredients. Variations average ash content in every part of the rubber plant is presented in Table 2.

Table 2. Ash content of rubber tree.

No

Ash content (%)

Stems Branches Leaves

1 1.98 1.64 4.33

2 1.89 1.63 5.19

3 1.41 2.19 4.81

Average 1.76 1.81 4.77


PROCEEDING 2017 4

Table 2 showed that ash content on stems was 1.76 %, branches 1.81 % and leaves was 4.77 %, respectively. The largest ash content in rubber tree was in leaves. The results obtained that carbon content of the sample 100%, reduction of the levels of volatile matter and ash content. Based on the results of the calculation of carbon content results that every part of the rubber plant has a percentage of the average carbon content was differences. The average of carbon content contained on the stems, branches and leaves was 58.39 %, 45.91 % and 19.73 %, respectively. Based on the tukey test was done to determine the significant effect of differences amount each part of the plant with confidence level of 95 %.

DISCUSSIONS

The tree biomass is the sum of the content of each organ biomass of trees is a picture of total organic material result of photosynthesis. Through the process of photosynthesis, CO in the air is absorbed by the plant with the help of sunlight is then converted into carbohydrates, then distributed throughout the body of plants and deposited in the form of leaves, stems, branches, fruits and flowers (Hairiah and Rahayu, 2007).

Rubber crops process of photosynthesis to absorb CO2 and the earth's atmosphere and the solar energy stored in the form of biomass (carbon stocks). Biomass is the total amount of organic material of plants that live on land that is generated as plant dry weight per unit area. Branches and stembark of subalpine had higher P, and Ca concentrations than paper birch (Wang et al, 2000). Total biomass is the percentage of the amount of biomass at the plant to the total biomass.

Stems are part timber composed of cellulose. Cellulose is a linear sugar molecules composed of carbon, so the higher the carbon content of cellulose it will be higher. Horizontal growth resulted in a tendency of variation of density and also the composition of the wood. If the diameter bigger then the plant is thought to have the potential of cellulose and wood constituent substances will be greater (Aminuddin, 2008).

Tukey test was done to determine the significant effect of differences amount each part of the plant. it can be seen that each part of the plant had significant differences in carbon content. This is evidenced by the results of the test presented that the average carbon content each of part of plant was difference. The use of forest classification based on the life zone system systematically led can be seen statistical models to estimate above ground biomass at the individual scale and site scale (Alvarez et al, 2012). It is caused by various internal factors such as the growth of the plant contains cellulose, hemicellulose, lignin and extractive substances.

CONCLUSIONS

Results this research that the stems part of plant has wet weight amount 57.80 %. Results of laboratory analysis showed that water content of stem and branches was 75.25 – 85.80 % and 77.59-86.48 %, respectively. The average of ash content on stems was 1.76 %, branches 1.81 % and leaves was 4.77 %, respectively. This research indicated that carbon content on the stems, branches and leaves was 58.39 %, 45.91 % and 19.73 %, respectively.


PROCEEDING 2017 5

REFERENCES

Alvarez E, A. Duque, J. Saldarriaga, K. Cabrera, G. de las Salas, I. del Valle, A. Lema, F. Moreno, S. Orrego and L. Rodríguez. 2012. Tree above-ground biomass allometries for carbon stocks estimation in the natural forests of Colombia. Forest

Ecology and Management 267 : 297–308.

Aminuddin, S. 2008. Kajian Potensi Cadangan Karbon (Karbon Stock) Dengan Metode Karbonasi Pada Hutan Tanaman Jenis Acacia crassicarpa [Tesis]. Universitas Gadjah Mada. Yogyakarta.

Hairiah K dan S. Rahayu. 2007. Pengukuran karbon tersimpan di berbagai macam penggunaan lahan. Bogor: World Agroforestry Centre - ICRAF, SEA Regional Office, University of Brawijaya, Unibraw, Indonesia. 77 p.

Wang, J. R., T. Letchforda, P. Comeau and J.P. Kimmins. 2000. Above- and below-ground biomass and nutrient distribution of a paper birch and subalpine mixed-species stand in the Sub-Boreal Spruce zone of British Columbia. Forest Ecology

and Management 130:17-26.


PROCEEDING 2017 6

KNOWLEDGE OF THE SEA CUCUMBER DIVERSITY AND ITS

UTILIZATION IN COASTAL TABLASUPA, DEPAPRE,

JAYAPURA, PAPUA

Puguh Sujarta1*, Suwarno Hadisusanto2

1 Biology FMIPA Cenderawasih University, Jayapura 2 Faculty of Biology, Gadjah Mada University, Yogyakarta

*Corresponding author: [email protected]

Abstract

Sea cucumber are benthic organism which has very important role in aquatic ecosystems.The purpose of this study was to determine the diversity of sea cucumbers in coastal Tablasupa, investigate the knowledge of the Tablasupa people about the diversity of sea cucumbers, and its utilization for the Tablasupa people. This research was conducted in July-August 2007, May-August, 2013, and May 2016. The sampling method was performed by surveys, interviews, and documentation. The results showed that there were 10-13 species of sea cucumbers in the Coastal Tablasupa, the Tablasupa peoples only knew about 3-5 species of sea cucumber in local name term, and the utilization of sea cucumbers by the Tablasupa people were mostly for sale.

Key word : sea cucumber, benthic, ecosystem, Tablasupa, Jayapura

BACKGROUND

Papua region has reached 45 510 km² of water area containing various types of the marine lifes that have economic value. The coastal resources is one of the natural wealth that is commonly used by the peoples. The data of knowledge of the sea cucumbers and its utilization in the Papua region is lacking, especially in coastal Tablasupa, Depapre Jayapura are not yet known.

Sea cucumbers are organisms that have very important role in aquatic ecosystems as benthic biota and included groups of organisms epifauna nomads, which has a slow movement and occupy the waters are very shallow, so it is very easy to catch, and limited distribution (Purwati and Wirawati, 2009). Several studies of sea cucumbers have high protein content and has benefits for the people healths (Sendih and Gunawan, 2006).

Based on that research is very interesting to do. This research is expected to provide information about the benefits of sea cucumbers are more socially. The purpose of this study to determine the diversity of sea cucumbers in coastal Tablasupa, knowledge of the Tablasupa peoples about the diversity of sea cucumbers, and its utilization of the Tablasupa peoples.


This research material is the diversity of sea cucumbers in coastal Tablasupa Depapre Jayapura Papua (Figure 1. The Location Map). This research was conducted


PROCEEDING 2017 7

in July-August 2007, May-August, 2013, and May 2016. The sampling method using surveys, interviews, and documentation to the peoples about knowledge of the diversity and utilization of sea cucumbers. Then, the identification of sea cucumbers to determinations on the scientific name and the benefits its by reference.

Figure 1. The Location Map of Research

RESULTS AND DISCUSSIONS

In Indonesia there are 53 known species of sea cucumber includes the genus Holothuria, Actinopyga, Bohadschia, Thelenota, Stichopus, and Labiodemas. The sea cucumber species known 29 species utilized for trade. While sea cucumbers are utilized by people only 10% (Sukmiwati et. al., 2012).

The survey results diversity of sea cucumbers in coastal Tablasupa sampling period July-August 2007 consisted of 10 species of sea cucumber that is Actinopyga sp., Actinopyga mauritiana, Bohadschia sp., Bohadschia argus, Holothuria sp., Holothuria atra, Holothuria edulis, Holothuria leucospilota, Stichopus sp., dan Pearsonothuria gracffei. Based on this diversity is said that the waters are classified as good, it is a corelation with food that is available. Based on cucumbers diet is the organism deposit-feeders and suspension in water (Nybakken, 1992). In addition, sea cucumbers feed plankton, coral pieces of litter, small organisms such as diatom, protozoa, nematoda, copepoda, the filament algae, seaweed, foraminifera, and the shells of bivalves (Yusron dan Widianwari, 2004). The presence of sea cucumbers in the waters primarily due to the availability of feed (Sukmawati et al., 2012).

The results of the survey period May-August 2013 consisted of 13 species of sea cucumber that is Actinopyga sp., Actinopyga mauritiana, Bohadschia sp., Bohadschia argus, Holothuria sp., Holothuria atra, Holothuria edulis, Holothuria

leucospilota, Holothuria chloronatus, Stichopus sp., Pearsonothuria gracffei, Thelenota anax, dan Psolus sp. The survey results in this period that its more, because the sampling period is 4 period. The survey results show the water is also very good. The results of the survey period May 2016 showed less, because used to the sampling method is interview method. The results of interviews about the knowledge of coastal communities in Tablasupa are the diversity of sea cucumbers 29% of respondents its answered Yes (know the diversity of sea cucumbers), while 71% answered do not know. Respondents who answer Yes (know the diversity of sea cucumbers) age above 35 years old and work as a fisherman.


PROCEEDING 2017 8

The survey results are known six species of sea cucumber is known as a local name that is teripang susu, teripang nanas, teripang sepatu, teripang batu, teripang

benang, dan teripang belimbing. Results of identification based on morphologic characteristics of the six species of sea cucumber is Thelenota anax, Pearsonothuria

gracffei, Actinopyga sp., Actinopyga mauritiana, Holothuria sp., and Stichopus sp.

Figure 2. Comparison diversity of sea cucumbers

Based on this, then conducted a survey on the use of sea cucumbers by people

with some questions about sea cucumbers as below: Questions for the utilization of sea cucumbers by the public: 1. What is many species of sea cucumber in coastal Tablasupa ? 2. What is the comunities coastal using sea cucumber ? 3. What is it utilizations ?

Results of interviews about the first question to some respondents showed that respondents could name only 3-5 species of sea cucumber. Although, on the whole the sea cucumber which there are more than 5 species. This limited knowledge because not all species can be used by the public or limited to any customer demand.

Results of interviews about the second and third questions showed that 10% of respondents consume sea cucumbers processed into food. While 90% of respondents answered catch sea cucumbers for sale. Criteria for sale consists of two causes that are sold to add to the family economy and sold if there is demand. The next search results about it, that sold to collectors (middlemen) to be dried and sold out of Papua. It is expected to be processed into medicines and other essential commodities. According Sendih and Gunawan (2006) that there are several studies of sea cucumbers have high protein content and has great benefits for public health.

Based on these, that required management and utilization of sea cucumbers wisely and prudently in order to maintain the diversity and abundance of its population. According Sujarta (2015) that the main advantage is the people in coastal Tablasupa have the wisdom in keeping the population of sea cucumbers. A setting of a good decision (period/ specific month or size of sea cucumbers) makes the population of sea cucumber still awake availability.

CONCLUSIONS

Based on the results of research and discussion can be concluded that there are 10-13 species of sea cucumber in the Coastal Tablasupa, knowledge of the


PROCEEDING 2017 9

Tablasupa peoples about the diversity of sea cucumbers knowing only 3-5 species of sea cucumber used local name, and utilization of sea cucumbers by the Tablasupa peoples mostly for sale.

REFERENCES

Allen, G. R. and R. Steene, 2005, Indo-Pasific Coral Reef Field Guide, Publisher Tropical Reef Research Singapore.

APHA, 1985, Standard Methods for The examination of Water and Wastewater, sixteenth edition, American Public Health Association, Washington DC.

Hadisusanto, S. and P. Sujarta, 2010, Retaid di Perairan Pesisir Barat Tablasupa Kabupaten Jayapura Papua, Jurnal Manusia dan Lingkungan, 17 (3) : 183-190.

Neville, C., 2004, Underwater Naturalist : Asia/Indo-Pacific Marine Life

Identification, National Library of Australia, Australia.

Nybakken, J.W. 1992, Biologi Laut Suatu Pendekatan Ekologi, PT. Gramedia Pustaka Utama, Jakarta.

Purwati, P., 2005, Teripang Indonesia Komposisi Jenis dan Sejarah Perikanan, Jurnal Oseana XXX (2) : 11-18.

Sendih, S. dan Gunawan, 2006, Keajaiban Teripang Penyembuh Mujarab dari Laut, AgroMedia Pustaka, Jakarta.

Sujarta, P. and H.L. Ohee, 2009, Pola Distribusi Teripang Di Sekitar Kawasan Konservasi Tiyaitiki Kampung Tablasupa Distrik Depapre Jayapura, Kaunia Jurnal

Sains dan Teknologi dalam Islam, V (1) : 38-43.

Sujarta, P., H.L. Ohee, and E. Rahareng, 2011, Kajian Keragaman Plankton dan Ikan di Perairan Teluk Tanah Merah Distrik Depapre Kabupaten Jayapura Papua, Jurnal Biologi Papua, 3 (2) : 67-73.

Sujarta, P., 2015, Kajian Status Sistem Tiyaitiki Di Perairan Pesisir Teluk Tanah Merah Jayapura Papua, Prosiding Seminar Nasional Biosains 2, Jurusan Biologi dan Program Studi Magister Biologi Universitas Udayana, Bali, 19-20 Nopember 2015, hlm 198-203.

Sukmiwati, M., S. Salmah, S. Ibrahim, D. Handayani, and P. Purwati, 2012, Keanekaragaman Teripang (Holothuroidea) di Perairan Bagian Timur Pantai Natuna Kepulauan Riau, Jurnal Natur Indonesia, 14 (2): 131-137.

Supriharyono, 2007, Konservasi Ekosistem Sumberdaya Hayati : Di wilayah pesisir

dan laut tropis, Pustaka Pelajar, Yogyakarta.

Yusron, E. and P. Widianwari, 2004, Struktur Komunitas Teripang (Holothuroidea) Di Beberapa Perairan Pantai Kai Besar Maluku Tenggara, Makara,

Sains, 8 (1) : 15-20 .


PROCEEDING 2017 10

THE POTENTIAL OF FUNGAL ENDOPHYTES FROM POTATO

ROOT AND TUBERS TO INHIBIT POTATO CYST NEMATODE

(Globodera rostochiensis)

Noor Istifadah1*, Maria Astriani2, Toto Sunarto1

1Department of Plant Pests and Diseases, Agriculture Faculty, Padjadjaran University 2Alumny of Department of Plant Pests and Diseases, Agriculture Faculty,

Padjadjaran University *Corresponding author: [email protected]

Abstract

Fungal endophytes, are fungi that living inside the plant tissue benignly. Even though part of them have neutral or negative effects on the host plant, many isolates can have beneficial effects to the host as they can increase plant growth and have antagonistic effect on the host pathogens. This paper discussed the results of the study aimed at examining the potential of fungal endophytes isolated from potato roots and tubers to inhibit potato cyst nematode, Globodera rostochiensis in vitro and in potato. The fungal endophytes were isolated from potato roots and tubers, obtained from several areas in West Java. The effects of the isolates on potato seedlings were tested to select the non-pathogenic isolates. The isolates that did not infect or inhibit potato seedlings were tested on their effect on G. rostochiensis in

vitro and the effective isolates were further tested to suppress the nematode in potato. Among 52 isolates of the fungal endophytes obtained, there were 32 isolates that non-pathogenic to potato seedlings. The results of in vitro test showed that there were 5 isolates in which their culture filtrate caused percentage of G. rostochiensis juvenile-2 (J2) damaged about 70.4-76.8 %. However the culture filtrate of those isolates only caused percentage of damaged eggs about 16.7-30.8%. In the greenhouse experiment, JCISU-8 isolate (Paecilomyces sp.) supressed the numbers of cysts and J2 of G. rostochiensis by 60% and 67.4% respectively. Keywords: culture filtrate, in vitro, eggs, juvenile-2,West Java

BACKGROUND

Potato is one of agricultural commodities with multifunction. One of limiting factors in potato production is potato cyst nematode (Globodera rostochiensis). This nematode is not only lead to the inhibiton of growth and potato productivity, but also lead to contamination of potato seedpieces and soil as it produces cyst that can survive for long period (Broddie et al., 1998).

This nematode is difficult to control as it produces cysts that can survive for years in the soil (Broddie et al., 1998). The synthetic nematicides can be used for controlling the pathogen. However, it may not be effective and the application of such compund to the soil can lead to pollution and kill beneficial soil microbes. Therefore, the pathogen should be controlled by integrated control measures including biological control.


PROCEEDING 2017 11

Microbes that are potential for biological control agents are fungal endophytes. Fungal endophytes are the fungi that living inside the plant tissues without trigerring any disease symptom (Petrini, 1991). Endophytes have been isolated from a wide range of plants, and therefore are considered to be a general phenomenon in all living plants (Stone et al., 2004).

The existance of fungal endophytes within the plant tissues can lead to several effects to the host plant. The effects can be neutral, beneficial or harmfull to the host plants. Many endophytic fungi did not have any influence on the host plants. Some fungi that isolated from healthy tissues, however, are probably latent pathogen, so that they may become pathogenic when the environment is favorable. In many cases, endophytes may have a mutualistic association with their host plants where both partners benefit.

For endophytes, the benefit gained from the host includes nutrient acquisition, protection from desiccation, insects, and antagonism by epiphytic microbes. For the host plants, the endophytes may improve the host growth and tolerance to abiotic or biotic stresses such as plant diseases (Saikkonen et al., 1998; Stone et al., 2004). The endophytes may also have antagonistic effects to the host plant pathogens (Bacon and White, 2000; Faeth et al., 2002; Backman and Sikora, 2008; Sikora et al., 2008).

The abilities of fungal endophytes to inhibit plant pathogens including nematodes have been reported (Backman and Sikora, 2008; Sikora et al., 2008; Agbenin, 2011). Fungal endophytes from cucumber roots reduced the number of galls of Meloidogyne incognita in cucumber (Yan et al., 2011). Endophytic fungi from tomato roots also suppressed the root knot disease and the number of juvenile 2 of Meloidogyne spp. in tomato rhizosphere (Istifadah & Nurcholis, 2012).

The endophytic fungi from banana roots have also been found to inhibit plant parasitic nematodes such as Radophulus similis (Pocasangre et al., 2000) and Pratylenchus goodeyi (Waweru et al., 2013). This paper discussed the results of the study that aimed at obtaining fungal endophyte isolates from potato roots and tubers that suppress G. rostochiensis.


Isolation of fungal endophytes

Fungal endophytes were isolated from potato tubers and roots, obtained from several areas in Garut District (Samarang, Cikajang, Cisurupan), Bandung (Pangalengan and Ciwidey), Bandung Barat (Lembang). The tubers and roots were cleaned under running tap water. The roots were then cut into 1.5-2 cm segments, while the tubers were peeled and the rind was cut into pieces (0.5 x 0.5 cm). The segments were surface sterilized by submersion in 96 % ethanol for 1 minute, followed by submersion in solution containing 2 % chlorine for 3-5 minutes and submersion in 96 % ethanol for 30 seconds. The segments were then plated out on Potato Dextrose Agar (PDA), supplemented with chloramphenicol (50 mg l-1) and incubated in room temperature (20 oC). To ensure if the isolated fungi are endophytes, the segments were imprinted on PDA before culturing. Mycelia that emerged from the segments were sub-cultured to obtain pure cultures.


PROCEEDING 2017 12

The effects of fungal endophyte isolates on potato growth

Concerning that the fungal endophytes maybe latent pathogens, effects of the fungal endophyte isolates on the growth of potato were examined. Each isolates were eaxamined in three replications. Suspension of fungal endophyte inocula (107

spore/ml or 107 cfu/ml) was used to soak the potato seedpieces for an hour. The suspension (30 ml) was also applied in planting hole. The potato was planted in growth media (sterilised soil containing 5% charcoal husk). The growth of potato was observed by measuring the plant height and numbers of leaves. The observations were conducted every week. The isolates that inhibited the growth or causing disease symptom were excluded for further test. The isolates were considered as pathogenic if they caused disease symptom on the potato tubers or plants, while they were considered inhibit the growth if the growth of potato were ≤ 0.5 times than the growth of control plants. The isolates can increase the growth, if the potato growth was ≥ 1.5 times than that of control plants. The effects of fungal endophyte isolates on Globodera rostochiensis in vitro

The fungal endophytes were cultured on potato dextrose broth. A plug of fungal culture (0.5 diameter) was placed on the edge of medium and incubated as slanted culture for 14 days. The filtrate was collected, centrifuged and filterred (with microfilter 0.4 µm pore size). The nematode inocula were prepared from the cysts that were extracted from infested soil with floatation method.

The soil was mixed with sterile water containing 0.05 % glucose (1:2, v/v), stirred and incubated for 5 min. To the floated debris was filtered and cysts were collected under microscope. To obtain the juvenile 2 and eggs, the cyst was ruptured and soaked in the water for 2-3 days to encourage the emergence of juvenile 2 (J2).

The endophte culture filtrate (2 ml) was mixed with 1 ml of inoculum suspension of G. rostochiensis (about 40-45 J2 and eggs/ml) and then incubated for 72 hours. The percentage of J2 and eggs damaged was counted. The isolates that caused >50% damaged J2 or eggs were tested again to confirm their effect.

The effects of fungal endophyte isolates on Globodera rostochiensis in potato

From the in vitro test it was found 8 isolates that showed more than 50% juvenile of the nematode damaged. The experiment was arranged in Randomized complte block design with treatments, isolates of fungal endophytes and check. Each treatments were replicated three times. The suspension of fungal endophyte inocula was used to soak the potato seedpieces and also it was inoculated in the planting holes (30 ml per planting hole). To ensure that the fungi are acted as endophytes rather than as rhizosphere fungi, the two week-old potato plants were transplanted into polybag containing 2 kg of pasteurized growth media, one plant per polybag. The nematode was inoculated one weeks after potato was transplanted,. The suspension of nematode inocula (containing about 4000 J2 and eggs of G.

Rostochiensis was pipetted in the 5 holes surrounding the plants (about 5 cm form the basal stem).

The destructive observation was conducted 7 weeks after the nematode inoculation. The variables observed were numbers of cysts and juvenile-2 of G.

rostochiensis in 100 g soil. Other variables observed were fresh and dry weight of potato shoot and roots.


PROCEEDING 2017 13


The effects of fungal endophyte isolates on potato growth

There were 52 isolates of fungal endophytes obtained from tubers and roots of potato from several areas in West Java. The numbers of isolates obtained from potato tubers were 30 isolates, while from the roots were 22 isolates. Among the isolates tested, there were 20 isolates that pathogenic and inhibited the growth of potato. Inoculation of the pathogenic isolates caused the potato tubers become rotted. Certain isolates (15 isolates), however, increased the growth of potato. These isolates and also 17 other isolates that had no effect on the growth were used for the further test. The various effects of endophyte fungal isolates on their host plant were also found in other studies (Istifadah & Suganda, 2010).

Table 1. The effect of fungal endophyte isolates on potato

The effect on potato growth Number of Isolates Percentage of all isolates (%) Pathogenic 16 30,7 Inhibited the growth 4 7,7 Neutral 17 32,7 Increase the growth 15 28,9

The effects of the fungal endophytes on G. rostochiensis in vitro

Result of in vitro experiment showed that the culture filtrate of fungal endophytes had toxic effects to the juvenile-2 (J2) and also the eggs of G.

rostochiensis. The juvenile-2 that was exposed to the filtrate become death in which the nematode body was stiff and their cytoplasm became aggregated. In some cases, the nematode cell walls were lysis. Fungal endophytes are known to produce secondary metabolites with antimicrobial effects (Schulz et al., 2002; Strobel et al., 2003). The toxicity of fungal endophyte culture filtrate was varied depended on the isolates. Among 32 non-pathogenic isolates, there were 26 isolates (74.3 %) showed little effects on the nematode, G. rostochiensis. These isolates only resulted in less than 30% of the juvenile-2 death. The filtrate of 8 isolates, however, could damage the juvenile-2 of G. rostochiensis by >51 % (Tabel 2).

Table 2. Percentage of J2 G. rostochiensis damaged and number of fungal endophyote isolates (First selection )

Percentage of damaged Juvenile (%)

Number of Isolates Percentage of isolates

(%) < 30 26 74,3

31- 50 1 2,8 51 – 70 3 8,6

>70 5 14,3 Among the isolate, there were 5 isolates that can resulted in more than 70%

juvenile 2 of G. rostochiensis damaged. The isolates that showed > 50% the J2 damaged were used for further experiments.

Based on results of two experiments, isolates that showed relatively higher mortality of juvenile-2 in both tests was JCISU-8 isolate. From microscopic


PROCEEDING 2017 14

examination, the isolate was identified as Paecylomyces sp., This genus is widely known as biological control agent of plant parasitic nematode. The filtrate of the fungus caused lysis of the juvenile-2 of G. rostochiensis. The filtrate of the fungus may contain enzyme that can degrade the wall of the nematode body. Fungal endophytes have been reported to produce enzymes that can degrade cell wall of pathogens (Li et al., 2004; Cao et al., 2009).

The results also showed that the effectiveness of fungal isolates in the first and second experiment tended to reduce. The reduction of the effects was probably due to the difference in the growth of the fungi. The more dense the colony, the higher concentration of secondary metabolites in the filtrate, so that it is more toxic to the nematode. Eventhough the culture filtrate of the isolates tested caused the nematode damaged or death, they did not effectively damage the eggs of G.

rostochiensis.

Table 3. The effects of fungal endophyte isolates on J2 G. rostochiensis

Treatment Average of J2 dead (%)

(first selection) Average of J2 dead (%)

(further selection) Isolate JCKJU 4 66,5 bc 48,1 b Isolate JCKJU 7 72,1 bc 60,0 b Isolate JCISU 8 76,8 c 67,5 b Isolate JPSWU 6 72,6 bc 55,6 b Isolate JLBU 14 53,1 b 46,5 b Isolate JPLU 3 64,6 bc 56,5 b Isolate JPLU 6 70,4 bc 46,1 b Isolate JCWA 2 71,4 bc 54,8 b Check (PDB) 9,8 a 9,6 a Check (water) 5,7 a 0,0 a

Note: Data in each column followed by different letters were significantly different (P < 0.05), based on Tukey HSD test (P< 0,05)

Table 4. The abilities of culture filtrate of endophytic fungi to cause G. rostochiensis

eggs damaged or death Treatments Percentage of the damaged eggs (%)

Isolate JCKJU 4 21,2 abc Isolate JCKJU 7 21,7 abc Isolate JCISU 8 20,2 abc Isolate JPSWU 6 18,7 abc Isolate JLBU 14 34,5 c Isolate JPLU 3 31,3 bc Isolate JPLU 6 30,8 bc Isolate JCWA 2 16,7 abc Check (PDB) 3,9 a Check (water) 9,0 ab

Note: Data in each column followed by different letters were significantly different (P < 0.05) , based on Tukey HSD test (P< 0,05)


PROCEEDING 2017 15

Even though the number of eggs damaged in several treatments of fungal endophyte isolates were significantly different to the check (water and PDB broth) the highest inhibition was only 34.5 % (Table 4). The damaged eggs was showed by the damaged on outer layers of the eggs and or/ the aggregation of cytoplasm of juvenile-1 inside the eggs. The damaged J1 inside the egg was perhaps due to the toxic metabolite that infiltrated the nematode cell wall. The difference on the effectiveness of the culture filtrate on the juvenile 2 and to the eggs was perhaps due to the difference on the structure of the walls. The egg wall is relatively thicker than the juvenile-2 cell wall and therefore the penetration of the toxic metabolites is more difficult.

The effects of the fungal endophytes on G. rostochiensis in potato plant

The isolates that showed antagonistic effects on G. rostochiensis in vitro was examined their effects on the nematode in potato plant. The results showed that all isolates significantly reduced the numbers of cyst and juvenile-2 of G. rostochiensis

(Table 5). All isolates tested suppressed the number of cyst per gram soil in potato rhizosphere by 22.7 – 60.0 % and juvenile-2 by 26.2-67.4 %. Among the isolates tested, isolates that showed higher suppressive effects on the nematode was JCISU 8 (Paecylomyces sp.). This isolates also showed highest antagonistic effects on the in

vitro test.

Table 5. The effects of the fungal endophytes on G. rostochiensis and potato growth (7 week after nematode inoculation)

Treatments Cyst Juvenile-2 Shoot Fresh Weight (g) Isolates

Average Number/ 100 g soil

% supression Number

Average/ 100 g soil

% suppression

JCKJU 4 7.0 bc 53.3 15.9 ab 47.6 28.5 a JCKJU 7 10.0 bcd 33.3 22.1 bc 26.2 39.0 ab JCISU 8 6.0 bc 60.0 9.9 a 67.4 35.5 ab JPSWU 6 7.0 bc 53.3 18.0 b 40.6 45.2 ab JPLU 3 9.0 bc 40.0 27.9 cd 7.8 42.4 ab JPLU 6 5.0 a 66.7 18.8 b 38.0 39.6 ab JCWA 2 11.0 cd 22.7 18.0 b 40.0 50.6 b Check 15.0 d - 30,3 d - 30.2 ab

Note: Data in each column followed by different letters were significantly different (P < 0.05), based on Tukey HSD test (P< 0,05)

In this experiment, the most of fungal endophytes tested did not significantly increase the growth of potato plants (Table 5). Only one isolate, JCWA 2, that significantly enhanced the growth of potato. Actually, some isolates showed growth- promotion effects on potato in the selection step. The difference in their effect was probably due to the difference on the level of fungal colonization in the potato roots. The overall results of this study showed that the effects of isolates of fungal endophytes from potato roots and tubers were varied. Some isolates showed antagonistic effects on G. rostochiensis in vitro and in vivo. The highest effects was


PROCEEDING 2017 16

showed by the Paecylomyces sp., the genera that is widely known as nematopathogen. The endophytic life style of the fungal isolate is advantageous as it can suppress the nematode after penetration. It may also survive in the rhizosphere so that it reduced the number of cyst and juvenile2 of G. rostochiensis. This isolate has potential to be further developed for bionematicide. To improve the cotrol effects, the isolates can be combined with other antagonis isolates such as rhizosphere bacteria. CONCLUSIONS

From the results of the study it can be concluded that : 1. Among 52 isolates of the fungal endophytes obtained, there were 32 isolates that

non-pathogenic to potato seedlings. The results of in vitro test showed that there were 5 isolates in which their culture filtrate caused percentage of G.

rostochiensis juvenile-2 (J2) damaged about 70.4-76.8 %. However the culture filtrate of those isolates only caused percentage of damaged eggs about 16.7-30.8%.

2. In the greenhouse experiment, all isolate tested reduced the number JCISU-8 isolate (Paecilomyces sp.) supressed the numbers of cysts and J2 of G.

rostochiensis by 60% and 67.4% respectively.

REFERENCES

Agbenin N.O. 2011. Biological control of plant parasitic nematodes: prospects and challenges for the poor Africa farmer. Plant Protect. Sci., 47: 62–67.

Backman, P.A and R.A Sikora. 2008. Endophytes: An emerging tool for biological control. Biological Control 46 :1–3

Brodie, B. B., Evans, K., and Franco, J. 1998. Nematode parasites of potato. Pages 87-132 in: Plant Parasitic Nematodes in Temperate Agriculture. K. Evans, D. L. Trudgill, and J. M. Webster, eds. CAB International, Wallingford, U.K.

Cao, R., Liu, X., Gao, K. 2009. Mycoparasitism of Endophytic Fungi Isolated From Reed on Soilborne Phytopathogenic Fungi and Production of Cell Wall-Degrading Enzymes In Vitro. Current Microbiology 59: 584-592

Istifadah, N and T. Suganda. 2010. Influence of fungal endophytes on the health of several vegetable crops. In Microbial Diversity and Plant Disease Management for Sustainable Agriculture (Singh, K.P and Shahi, D.K. Eds). VDM Verlag Dr. Muller, GmbH & Co. KG, Germany. Pp:106-122.

Istifadah, N. and Nurholis, 2012. The abilities of Endophytic Fungi from tomato roots to Control Meloidogyne spp. in tomato. Proceeding of International Conference on Sustainable Agriculture and Food Safety.

Li, H.M. R. Sullivan, M. Moy, D. Y. Kobayashi and F. C. Belanger. 2004.

Expression of a novel chitinase by the fungal endophyte in Poa ampla. Mycologia

96: (3) 526-536


PROCEEDING 2017 17

Petrini, O. 1991. Fungal endophytes of tree leaves. In Microbial Ecology of Leaves, (eds. J. H. Andrews and S. S. Hirano), pp. 179-197, Spring-Verlag, New York.

Pocasangre, L.E., Sikora, R.A., Vilich, V., Schuster, R.-P., 2000. Survey of banana endophytic fungi from Central America and screening for biological control of the burrowing nematode (Radopholus similis). Acta-Horticulturae 531, 283–289.

Saikkonen, Faeth, S. H., Helander, M. and Sullivan, T. J. 1998. Fungal endophytes: a continuum of interactions with host plants. Annual Review of Ecology and

Systematic 29, 319-343.

Schulz, B., Boyle, C., Draeger, S., Roemmert, A.-K. and Krohn, K. 2002. Endophytic fungi: A source of novel biologically active secondary metabolites. Mycological Research 106, 996-1004.

Sikora, R. A., L. Pocasangre., A. Z. Felde., B. Niere., T. T. V., and A.A. Dababat. 2008. Mutualistic Endophytic Fungi and in-Planta Suppressiveness to Plant Parasitic Nematodes. Biological Control 46 : 15–23.

Stone, J. K., Polishook, J. D. and White J. F, Jr. 2004. Endophytic fungi. In Biodiversity of fungi: Inventory and monitoring methods, (eds. G. M. Mueller, G. F. Bills and M. S. Foster), pp. 241-270, Elsevier Academic Press, Amsterdam.

Strobel, G. A. 2003. Endophytes as sources of bioactive products. Microbes &

Infection 5, 535-544.

Tan, R. X. and Zou, W. X. 2001. Endophytes: a rich source of functional metabolites. Natural Product Reports 18, 448-459.

Waweru, B.W, T. Losenge , E. M. Kahangi, T. Dubois and D. Coyne. 2013. Potential biological control of lesion nematodes on banana using Kenyan strains of endophytic Fusarium oxysporum. Nematology 15 : 101-107

Yan, X. RA. Sikora, J. Zheng, 2011. Potential use of cucumber (Cucumis sativus L.) endophytic fungi as seed treatment agents against root-knot nematode Meloidogyne

incognita. Biomed & Biotechnol), 12(3):219-225


PROCEEDING 2017 18

MORPHOLOGICAL DIVERSITY OF LOCAL CORN VARIETY

IN LAKEKUN VILLAGE, KOBALIMA DISTRICT, MALAKA

REGENCY, EAST OF NUSA TENGGARA PROVINCE

Uslan 1*, Nur R. Adawiyah Mahmud2, Margaretha Seuk Kiik3

1, 2 Lecturer of Biology Education Study Program,

3 Student of Biology Education Study Program, FKIP Muhammadiyah University of Kupang *Corresponding author: [email protected]

Abstract

The aim of this research is to know the morphological diversity of local corn variety in Lakekun village, Kobalima district, Malaka regency, in East of Nusa Tenggara province. This research has been done by using survey method with 13 morphological characters of corn cob, i.e. include qualitative and quantitative character. Samples are 5 varieties of corn, i.e. batar mean, batarmutin, batarbotu, local pulut and common red. The data was analyzed by mean formula, then by MVSP program through UPGMA method at the equality coefficient of Nei& Li. The result shows that in accordance with qualitative and quantitative character, there is presence the variety of local corn in Lakekun village. Dendogramshows that the varieties of local corn in Lakekun village was divided in 4 categories at the equality coefficient 0.53 or 53%. The genetics relationship between closest variety present in batar mean and batarbotu varieties and it similarity index is 0.538, while for the farthest relationship present in batarmutin with 0.481 of similarity index.

Keywords: Morphological diversity, Local corn, Lakekun village

BACKGROUND

Corn is the second primary seed source after rice, and moreover it become major source of carbohydrate in some provinces in Indonesia, include East of Nusa Tenggara (NTT). In NTT society, corn is a primer crops from fieldthat planted together with another crops, i.e. field rice, bulb, and nuts, with mixed-cropping system planting. Indeed, this commodity is also planted in home yard. NTT corn productivity in 2013 is about 25.17 kw/ha, lower than the average of national productivity i.e. 48.44 kw/ha (BPS, 2014). This lower corn productivity in NTT is caused by farmer preference to plant more of local variety of corn wich have the lower productivity than hybrid corn. Subagio and Aqil (2013) had reported that corn planting in NTT was dominated by local variety of corn (37%), then followed by bersaribebasunggul corn (Lamuru variety, 16%) and hybrid corn (6%). Local variety corn had some specific advantages, i.e. more adaptive towards specific local agro ecology (Song Ail and Banyo, 2011), suitable with traditional seed saving system, suitable with consumption habit of local society, and resistant to pests after harvesting (Hosang et al., 2010 in Kusumadewi et al., 2015).


PROCEEDING 2017 19

Kobalima district in Malaka regency is one of NTT region, that in there, thefarmers still cultivate local variety of corn. Besides that, corn is the dominant food plants in Malaka regency and the corn productivity in 2014 is about 2.401 kw/ha. Their cultivating system of local corn is a simple system, so that its productivity is low (BPS, 2015). Maemunah (2008) reported that the low productivity of local corn is caused byunavailable of high quality seed of corn at the moment needed and it development had marginalized. This research had been done to identify and to characterize the morphology of local corn, in order to know the corn cultivars in Kobalima district region, Malaka regency, East of Nusa Tenggara.


This research has been done by using survey method. The survey location was determined by purposive sampling in folk field at Lakekun village, Kobalima district, Malaka regency.Previous information from local community said that there is present the divers potential of germ plasm of local corn in their region. Data in this research was collected from primer data. The primer data was collected by survey method and direct interview with correspondents. This research was held in March-April 2016, and by using randomly technique of sampling. Tools and materials used in this research are bucket, machete, calipers, ruler, peg samples, camera, labels, calculators and 5 varieties of local corn (batar mean, batarmutin, batarbotu, local pulut and common red).

Research procedure began from seed collection of some varieties through cruising methods in Lakekun village region. To examine the variation of morphological diversity we use 13 phenotype characters of corncob, i.e. include quantitative and qualitative characters. Data analysis using mean formula, then further test of genetic relationship between corn plants by virtue of it cob. Phenotypic data of each corn plant was processed using cluster analysis with quantitative and qualitative data. Differential clustering was done by scoring 1 if visible and 0 if invisible, and by making dendogram with UPGMA (Unweighted Pair Group Method Arithmetic) method according to similarity coefficient of Nei& Li through software program of MVSP (Multi Variate Statistical Package) (Mustofa et al., 2013).

RESULTS

Quantitative Characters

Quantitative character of five varieties of local corn in Lakekun village shows different values as in Table 1.

Table 1. Quantitative character of local corn variety in Lakekun village, Kobalima

No Character

Local corn variety 1 2 3 4 5

Batar mean

Batar mutin Batar botu Local pulut

Common red

1 Long of stalk cob (cm) 11.60 12.08 14.88 13.78 12.08 2 Long of cob (cm) 12.68 12.34 12.50 9.92 12.78 3 Diameter of cob 4.44 4.17 4.60 4.51 3.01 4 Rows number of corn kernels 10.6 13.60 11.40 12.20 11.20 5 Kernels number per rows 24.8 36.78 23.10 41.67 32.50


PROCEEDING 2017 20

Qualitative Characters

Qualitative character of five varieties of local corn showed in Table 2.

Table 2. Qualitative character of local corn variety in Lakekun village, Kobalima

No Character

Local corn variety 1 2 3 4 5

Batar mean

Batar mutin Batar botu

Local pulut

Common red

1 Color of stalk cob 11.60 12.08 14.88 13.78 12.08 2 Cob shape 12.68 12.34 12.50 9.92 12.78 3 Diameter 4.44 4.17 4.60 4.51 3.01 4 Rows number of corn

kernels 10.6 13.60 11.40 12.20 11.20

5 Kernels number per rows 24.8 36.78 23.10 41.67 32.50

Morphological of Cob and Kernels

The morphological and appearance of corn cob and corn kernels which planted in Lakekun village, Kobalima district is shown below:

Figure 1. Morphological of corn cob and corn kernels which planted in Lakekun village; (1) batar mean, (2) common red, (3) local pulut, (4) batar mutin, (5) batar

botu

Variation Test with MVSP (Multivariate Statistical Package)

Based on the data of qualitative and quantitative characters of corncob above, each kind of corn show a variation or diversity. Furthermore, the test using MVSP software based on the similarity coefficient of Nei & Li, was done to confirm the result from table 1 and table 2, by involving all of the corn characters above (Fig.2).

Table 3. Coefficient matrix of 5 local corn variety

Node Group 1 Group 2 Similarity Number of objects

in fused groups 1 Batar mean Batarbotu 0.538 2 2 Local pulut Common red 0.519 2 3 Node 1 Batarmutin 0.481 3 4 Node 3 Node 2 0.309 5


PROCEEDING 2017 21

Figure2. Dendogram of 5 local corn variety which planted in Lakekun village

DISCUSSIONS

Five varieties of local corn from Lakekun village shows a variety or a genetic diversity between varieties.Majority of characters in table 1 shows similar values between values of research result and origin natures. Mustofa et al. (2012) was explained that the diversity of values result above indicates that quantitative characters was controlled by not only a gen but also by a lot of gens as a phenotype composer, therefore the quantitative characters is often equated with phylogenic characters. Jusuf (1998) said that the appearance of a plant (phenotype) is determined by the interaction of genotype and environmental factors.

The similarities and differences in qualitative characters (table 2) is probably controlled by each gen and involving with the existing of environment influences. Similar characters between varietiesis caused by similar composer of phenotype gens and so did to the appearance of character differences between varieties that probably caused by different of gens (Mustofa et al., 2013). Dendogram shows that five varieties of local corn from Lakekun village have similarity value of 0.53 or 53% and divided to 4 clusters (Fig. 2). This values then confirmed by similarity index at the matrix of composite coefficient (table 3) which shows the similar values of each variety. The closer relationship present in local corn variety of batar mean and batarbotu, which located in Node 1. Both variety of local corns have the highest similarity index i.e. 0.538 or 53.80%. Singh (1999) explained that the higher of similarity index, the closer of kinship, and when the similarity index more than 50% describes that the compared varieties have closer similarity. Maemunah and Yusran (2011) argued that the small differences appeared shows that there are many similarities in morphology.

Batarmutin variety have lowest value of similarity index i.e. 0.491 or 48%, against which 4 other varieties. This value shows that batarmutin have furthestkinship. This furthest kinship probably because of it has not get crossbred. According to this research, phenotypic characters is suitable to identify and analyze varieties of 5 local corn in Lakekun village, Kobalima district, Malaka regency. Yatim (1986) explained that one way to knowing genetic diversity is through the


PROCEEDING 2017 22

study of its phenotypic diversity. That variety is a variety that based on phenotypic characters, so that the obtained result is also shows the phenotypic condition in the field. CONCLUSIONS

There is a variation in qualitative and quantitative character of five local variants of corn, i.e. batar mean, batarmutin, batarbotu, local pulut and common red, which planted in Lakekun village, Kobalima district, Malaka regency, East of Nusa Tenggara. At the similarity point of 0.53 or 53%, five local variants of corn form 4 clusters. The genetics relationship between closest variety present in batar mean and batarbotu varieties with similarity index is 0.538, while for the farthest relationship present in batarmutin with 0.481 of similarity index.

REFFERENCES

Badan Pusat Statistik Provinsi Nusa Tenggara Timur (BPS NTT). 2009. Nusa

Tenggara Timur dalam Angka 2009. BPS NTT, Kupang. Badan Pusat Statistik Kabupaten Malaka. 2015. Statistik Daerah Kecamatan

Kobalima 2015. BPS Kabupaten Malaka, Malaka. Jusuf, M. 1998. Genetika I: Struktur dan Ekspresi Gen. Institut Pertanian Bogor, Bogor. Kusumadewi, S.Y., Y.B. Charles, IGB. A. Adwita, M. Tri. 2015. Analisis Genetik Jagung RasLokal Nusa Tenggara Timur Umur Genjah Berdasarkan Karakter Agronomidan Inter Short Sequence Repeats. Jurnal Ilmu-ilmu Hayati. 14(3): 277-286 Maemunah. 2008. Produksi Mutu Fisiologis Benih Jagung Lokal ‘Pulut’ Terhadap Pemberian Nitrogen. Jurnal Agrisains. 9(3): 113-118 Maemunah and Yusran. 20011. Karakterisasi Morfologi Varietas Jagung Ketan di Kecamatan Ampanan Kota Kabupaten Tojo Una-Una. Jurnal Agroland. 18(1): 36-42 Mustofa, Z., I.M. Budiarsa, B.G. Non Sandas. 2013. Variasi Genetik Jagung (Zea

mays L.) Berdasarkan Karakter Fenotipik Tongkol Jagung yang Dibudidayakan di Desa Jono Oge. E-Jipbiol. Vol (1): 33-41 Singh, G. 1999. Plant Systematics Science Publisher. New Hampshire: Inc. Song Ali N and Y. Banyo. 2011. Konsentrasi Klorofil Daun sebagai Indikator Kekurangan Air padaTanaman. Jurnal Ilmiah Sains. 11(2): 166-173 Subagio, H. and M. Agil. 2013. Pemetaan Pengembangan Varietas Unggul Jagung di Lahan Kering Iklim Kering. Seminar Nasional Serealia 2013. 11-19. Yatim, W. 1986. Genetika. 5th ed. Bandung: Tarsito


PROCEEDING 2017 23

BEGONIA EDIBLE PLANTS AND ITS CONSERVATION IN

BALI BOTANIC GARDEN

NKE. Undaharta* and I.G. Wawan Setiadi

Bali Botanic Garden, Candikuning, Baturiti, Tabanan, Bali, 82191 * Corresponding author: [email protected]

Abstract

Begonia is an ornamental plants, but it can also be used as food and medicine. The method used in this study was literature and inventory, distribution of Begonia was also studied. The distribution of Begonia was deployed largely and become an ornamental plant, which also can be eaten. A total of 43 species of edible Begonia have been identified and many more species of Begonia may be edible and useful for medicine. Part edible plant parts largely comes from leaves and petiole. This study is helpfull and useful for knowledge about the plants species as a food ingredient.

Keywords: begonia, edible plants, conservation

BACKGROUND

Many people in Asia particularly in rural areas know the usefulness of Begonia as a food stuff (Kayang, 2007; Abdiyani, 2008; Girmansyah, 2009; Priyadi et al., 2010; Thomas, 2011; Umberto, 2012; Rajbhandary, 2013) whereas in urban communities don’t know if Begonia can be used as medicine and food, but not for all Begonia. Shifting diet and lifestyle of today’s modern man, impact on public health. Various chronic diseases arise from wrong food habits.

The trend of fast foods and processed products instantly, plus a sedentary lifestyle, or less active, triggering metabolic system disorders, which in turn increases the risk of chronic disease. Obesity, diabetes, heart and cardiovascular diseases and cancer are some diseases that are closely related to modern humans. Sort it out, now people trying to readopt the concept of urban naturopaty, lifestyle in the past, eating a pollution-free food chemical substances, or commonly known as organic food. In recent years there has been increased interest in food uses of plants commonly grown as ornamentals. Begonias, natives of the tropics but commonly used as houseplants in temperate regions (Smith, 1986).

Begonia is known as an ornamental plant but can also be used as sauce, juice, salad, or eaten immediately. Research on plants Begonia has been studied (Jagtab et al. 2009; Mays, 2014). In Indonesia the sour leaves and stems are eaten raw or cooked. In China, Indonesia and Brazil Begonias are used in salads (Abdiyani, 2008).

Bali Botanical Gardens as a conservation organization has collected Begonia obtained from the exploration in the many forests in eastern Indonesia. This study will inventory the species of Begonia which can be used as a foodstuff and the results of this study can provide information to the public and will be useful.


PROCEEDING 2017 24


This work was carried out during January to March 2016 by study literature about the uses of Begonias. The collected literature related to usability Begonia learned later in classification accordance with the purposes Begonia it self as anything edible, useful as a drug or any part that can be utilized. Habitat and distribution of Begonia is also studied.

RESULTS

Begonia as ornamental plants, Begonia is also potentially as a food ingredient. 43 species of Begonia which can be used as a food ingredient and will find even more later. Bali Botanical Garden has a collection of Begonia 97 species (Registration data June 2016) and 15 species can be used as a food ingredient have collected in Bali Botanic Garden.

Figure 1. Parts Begonia edible plants

DISCUSSIONS

Based on the results of the inventory and study of literature is known 43 species of Begonia which can be used as a food ingredient. Begonia can be eaten directly and used as a salad, juice or may be as sambal (sauce). Parts of Begonia that can be used as a food ingredient is the stem, leaves, petiole, shoot, stalk, flowers, bulbs, fruit and roots.


PROCEEDING 2017 25

Figure 2. Begonia collections Bali Botanic Garden

1. Begonia annulata K. Koch. Synonym Begonia barbata Wall. ex A. DC., Begonia

griffithii Hook. Leaves are used to prepare chutney (A. Kar et al., 2013). In East Indies and Burma, the leaves, called tengoor, are eaten by the natives as a pot-herb. Hooker says the stems of many species are eaten in the Himalayas, when cooked, being pleasantly acid (Laferriere, 1992). The stems are made into a sauce in Sikkim. Fresh leaf juice applied on leach bite to stop bleeding from the wound (Sturtevant, 1919; Umberto, 2012).

Figure 1. Begonia longifolia Blume 2. Begonia heracleifolia Cham. & Schltdl. 3. Begonia

lempuyangensis Girmansyah 4. Begonia isoptera Draynd. ex Sm. 5. Begonia incarnata Link & Otto

1 2

3 4 5


PROCEEDING 2017 26

2. Begonia × tuberhybrida Voss, A perennial plant, the flower there are pink, red, orange, yellow. The fleshy leaves and flower are edible, raw or cooked and used in salads. Chopped Begonia petals are mixed into a food processor or mixer with soft cream cheese, strawberry or other jelly or jam and some juice or liquid to prepare Begonia spread. The brightly coloured flowers have a delicious light, lemon taste and a crisp texture. Snipped petals are used as a garnish in salads and sandwiches or whole petals dipped in flavoured yogurt and serve as an appetizer. Eat raw or cooked in sauces (Laferriere, 1991; Laferriere, 1992). Begonia tuberhybrida is a complex group of cultivars developed from hybridization of several Andean species such as Begonia boliviensis with pink flower or Begonia pearcei with yellow flowers (Dewitte et al. 2011; USDA,ARS 2012). Other parental Andean species used in hybridization include Begonia veitchii and Begonia davisi. Tuberous Begonias are cultivated and not found wild. Tuberous Begonia thrive best in a mild cool summer climate and are totally intolerant of hight humidity levels or frost. The ideal conditions for tuberous Begonias are areas where evening temperatures do not fall below 150C and where day temperatures are less than 270C (on average). They grow best in partial to dappled shade, in well-drained fertile loamy-acidic soil rich in humus. The plants need protection from strong winds. Container plants may be brought indoors in fall and grown as winter houseplants.

3. Begonia baliensis Girmansyah, Stem brownish green to reddish brown, erect and cane-like, succulent, rhizomatous, hairy, herbaceous, seldom branched, 15-50 cm tall, 8-15 mm in diam. Leaves green to reddish brown, the seed length. Leaves and stem can be eaten in salads or cookes with fish. Distribution Bali (Indonesia). Humid forest, along trails at 1300–1800 m above sea level (Girmansyah, 2009).

4. Begonia baramensis Merr. Herb, pinkish flower, red flower stalk. Leaves are cooked as a vegetable or used as a flavouring for their sour (asam) taste, to relieve stomache (Kiew et al. 2015). Roots for amenorrhea and snakebites (Umberto, 2012). Distribution Brunei, Kalimantan, Sabah and Sarawak.

5. Begonia barkeri Knowles & Westc. synonym Begonia cardiocarpa Liebm. Herb, a fibrous rooted Begonia with erect brown. Stems will reach about 2 feet (60 cm) tall with broadly ovate and pointed leaves. Leaves wil reach 6 inches (15 cm) long by 4.5-8 inches. The petioles of all these Begonia species are eaten (Francisco et al. 2003). Distribution Nicaragua, Mexico.

6. Begonia cathcartii Hook. f. & Thomson, Has an upright rhizome. The leaves are ovate, about 2 or 3 inches wide and 6 inches long with a prominent drip-tip, mid-green and shiny with cranberry red veins on the back, sparsely haired and slightly dentate. Whole plant extract given as febrifuge and in cough and cold (Umberto, 2012). Distribution Himalaya, India.

7. Begonia comestibilis D.C.Thomas & Ardi, The leaves of Begonia comestibilis, used as a vegetable and either eaten raw for their sour and refreshing taste or as an ingredient for a sour sauce used for chicken dishes (Thomas et al. 2011). Distribution : South Sulawesi: Indonesia, This is a rainforest floor species, observed on a steep slope at c.1020–1040 m above sea level (Thomas et al. 2011).


PROCEEDING 2017 27

8. Begonia crenata Draynd. Small herbs, roots tuberous, stem usually red, smooth. Leaves alternate, hairy above and glabrous except the nerves beneath. Flowers pinkish. Whole plant juice taken against acidity. Distribution India (Umberto, 2012).

9. Begonia cucullata Willd. Synonym Begonia cucullata var. cucullata, Begonia

cucullata var. hookeri (A.DC.) L.B. Smm. & Schub., Begonia cuculifolia Hassk., Begonia dispar Rchb., Begonia hookeri Sweet, Begonia nervosa Kunth (Inval.), Begonia paludicola C.DC., Begonia sellowii Klotzsch, Begonia semperflorens Hook. (illeg.), Begonia semperflorens Link & Otto, Begonia semperflorens f. flavescens

C.DC., Begonia semperflorens var. sellowii (Klotzsch) C.DC., Begonia setaria Graham. Begonia cucullata have potential to be cultivated as edible flowers with an acceptable taste (Friedman et al. 2007). The fleshy leaves and flowers are edible raw or cooked and can have a slight bitter after taste (Laferriere 1992). Sauteed alligator meat with Begonia sauce represents a musty challenge to the palate. Chopped begonia petals are mixed into a food processor or mixer with soft cream cheese, strawberry, or other jelly or jam and some juice or liquid to prepare Begonia spread. In Paraguay the leaves are eatenfried or in soup or salads while the sap is used to treat sore throats (Laferriere, 1992). Brazil, The leaves are used as cooling salads.

10. Begonia flagellaris H. Hara, Herb, creeping, red succulent leafy stolons and bears ascending inflorescences, with pink or white flowers at their lower nodes. Due to its succulent petioles and sour taste the petioles and the stems are eaten raw by children and locals in the forest while herding cattle or while walking on the hills in Charikot, Dolakha district. The Gurungs of Chomrung and Sinwa in Kaski district and Tamang community in different parts of Rasuwa district (central Nepal) use the petioles mixed with the petioles of Begonia flagellaris and Begonia picta as pickle with a very very sour taste. It is an endemic species of Nepal, growing between 2200-2700 m above sea level (Rajbhandary, 2013).

11. Begonia floccifera Bedd. Herb, leaves to 18 cm across, reniform or orbicular, obliquely cordate, distantly toothed, floccose-pubescent below, nerves 11, prominent; petiole to 30 cm long. Leaves juice cooling, to cure heart diseases and to reduce body heat (Umberto, 2012). The methanol extracts of whole plants of Begonia malabarica and Begonia floccifera showed potent in vitro antioxidant activities. The phytochemical phenolics and flavonoids could be the reason for its antioxidant activity (Kalpanadevi, V. and Mohan, V.R., 2012).

12. Begonia fusca Liebm. Herb, grow 4 to 6 feet tall, the leaves are basically oval in shape, and have a great felty texture due to small hairs across the surface. The younger leaves are especially fuzzy. Petiole are edible (Francisco et al. 2003). Distribution East central and southern Mexico to Honduras Mexico (Burt-Utley, 1985). It likes filtered sun or bright shade and morning sun. Protect it from strong afternoon sun. Over about 40-50% humidity is recommended.

13. Begonia fusicarpa Irmsch. Synonym Begonia fusialata Warb. Herb, pinkish white flowers, male flowers in lax cymes. Juice applied to wounds (Umberto, 2012).


PROCEEDING 2017 28

14. Begonia gracilis Kunth Synonym Begonia gracilis var. annulata , Begonia gracilis var. depauperata A.DC., Begonia gracilis var. diversifolia (Graham) A.DC., Begonia gracilis var. martiana (Link & Otto) A.DC., Begonia gracilis var. membranacea A.DC., Begonia gracilis var. nervipilosa A.DC. Occasionally consumed by children. The stalks are juicy, mucilaginous, and pleasantly acidic. Shoots of Begonia are acidic due to the high concentration of oxalic acid, which is potentially toxic in large quantities. Fortunately, the children do not consume enough of these plants to cause noticeable harm. Shoots of Begonia gracilis are used in treating tooth ache or gum disease. Petiole are edible (Laferriere et al. 1991; Laferriere, J.E. 1992). Distribution Mexico. Growing in protected locations in shaded areas, common in moist.

15. Begonia grandis Dryand. Synonym Begonia grandis subsp. evansiana (Andres) Irmsch., Begonia grandis subsp. grandis , Begonia grandis var. simsii Irmsch. Leaves and stem use vegetable and can eaten raw (Dai, 1895; Umberto, 2012). Tuberous roots and fruits anodyne, antibacterial, antiphlogistic and antispasmodic; decoction in the treatment of traumatic pain, gonorrhea, postpartum vaginal discharge (Laferriere, 1992). Distribution E. Asia - China, Japan, Himalayas (Malaya).

16. Begonia hatacoa D. Don Synonym B. rubrovenia W. J. Hooker. Perennial, rhizomatous with ashort, erect, leafy flowering-stem. Stem to 35 cm tall, pinkish green with white lenticels or reddish brown. Leaves: often held upright; petiole green with a pink tinge. Tender shoot is edible (Kayang, 2007). Juice of the rhizome is used to kill intestinal worms or used as anthelmintic in Pharping, Kathmandu district (central Nepal) by Newar community. Balami, 2003 in Rajbhandary, 2013 reported similar use, but wrongly attributes this to as Begonia nepalensis (A.DC.) Warburg. It is found in central and eastern part of Nepal distributed 1200–2500 m above sea level. Distribution Bhutan, North India, Nepal.

17. Begonia heracleifolia Cham. & Schltdl. Synonym Begonia heracleifolia var. longipila (Lem.) A.DC., Begonia heracleifolia var. nigricans Hook.f., Begonia heracleifolia var. nigricans (Hook.) A. DC., Begonia heracleifolia var. paramadilio auct., Begonia heracleifolia var. punctata (Klotzsch) F.Cels, Begonia heracleifolia f. punctata (Klotzsch) Voss, Begonia heracleifolia var. sunderbruckii C.Chev. Petiole are edible. The foliar blade can also be used in the making of "paxnikak," a dish made on the basis of "ma- fafa" (Xanthosoma robustum Schott) leaves. Antibacterial and antifungal, strong antiproliferative activity towards tumor and immune cells (Umberto, 2012). Distribution Mexico, Amerika. Tolerate more sun than most other b Begonias (Tebbitt, 2005)

18. Begonia hirtella Link. A perennial herb with erect and branched stems. The plant height is about 30 cm. The leaves are green with small hairs. The flowers are white and small. The stamens are bright yellow. Fruit for drugs thrush (Abdiyani, 2008). Begonia hirtella is widely distributed native of the west Indies and Nothern South America (Tebbitt, 2005).


PROCEEDING 2017 29

19. Begonia humilis Aiton Synonym Begonia humilis var. glabrata Seem., Begonia

humilis var. humilis, Begonia humilis var. porteriana (Fisch., C.A.Mey. & Avé-Lall.) A.DC., Begonia lakobeensis Humbert ex Keraudren&Bosser, Begonia lucida Haw., Begonia meyeniana Walp., Begonia pavoniana A.DC., Begonia subhumilis A.DC. Herb teas for cough, cold, fever. Distribution Madagascar, West Indies to Peru and Brazil (Umberto, 2012).

20. Begonia incarnata Link & Otto Herb, erect branched perennial to 1 m tall. Stem, mid green, tinged purple. Leaves: petiole mid green tinged purple, hairless, 1.5-6 cm long, joining blade at an angle. The flower pink. Petiole are edible and eaten as a vegetable (Francisco, 2003 and Tebbitt, 2005). Growing on moist, semi shaded cliffs at an altitude of 1220-1370 m. (Tebbitt, 2005). Distribution East Central Mexico.

21. Begonia isoptera Draynd. ex Sm. Leaves paste applied to fractures, enlarged spleen. Asia tropical, Thailand, Malaysia, Indonesia (Doorenbos et al., 1998).

22. Begonia josephi A.DC. Synonym Begonia josephi var. macrocarpa A.DC., Begonia josephi var. minima C.B.Clarke. Perennial acaulescent herb with globose tuber and peltate leaves, mostly with white or pink flowers, This species is surprisingly not in use, but there is a local saying that if the plant is collected and brought down near a paddy fi eld, the paddy dies out before it matures, therefore: a very bad sign. Leaves cooked as vegetables. For stomachace and indigestion, bulbs eaten raw (Kayang, 2007). Tender shoots and petiole are eaten raw or fermented as pickle in most part of the Dolakhadistrict (central Nepal) by Brahmin, Chettries, and Newars, which has also been reported by Shrestha and Dhillion (2003). However, this species is eaten raw in Charikot area in Dolakha district (central Nepal) (Rajbhandary, 2013). In Maimajuwa Ilam district (eastern Nepal), Begonia josephii

is found dominant between 1800-2200 m above sea level. (Rajbhandary, 2013). Distribution in Central and eastern Nepal, India.

23. Begonia lempuyangensis Girmansyah Stem without a tuber, brownish green to red, erect, unbranched, glabrous, succulent, arising from a basal rhizome, up to 50 cm tall, Leaves distant, green to brownish green, glabrous. Can be eaten in salads or cookes with fish and used as a palliative medicinal for coughs. Distribution Bali (Indonesia). Humid shady situations, especially on the forest floor at 1000–2000 m above sea level. (Girmansyah, 2009).

24. Begonia leptoptera H. Hara Erect plant with tubers, long petioled, radicle leaves, and pink flowers. The species is very similar with B. josephii but differs in having non-peltate maculate leaves, simple umbellate infl orescences and lanceolate narrow ascending wing capsule. The red petioles are eaten raw or as pickle in Dolakha by Tamangs, Sherpas, Brahmins, Chettries, and Newars, and by Gurungs in Kaski district (central Nepal). Endemic species of Nepal, found between 1500-2600m. (Rajbhandary, 2013).

25. Begonia lombokensis Girmansyah Herb, stem cane-like, glabrous, rooting at the base, stem green, up to 1 m tall, erect, much branched, succulent, woody at the base;


PROCEEDING 2017 30

stipules narrowly triangular, green, glabrous, Leaves distant, green. Can be eaten and/or used medicinally. Distribution Lombok (Indonesia). Open areas and on the forest floor at 1000 – 2000 m above sea level. (Girmansyah, 2009).

26. Begonia longifolia Blume Synonym Begonia tricornis Ridl., Begonia inflata C.B. Clarke, Begonia crassirostris Irmsch., Diploclinium longifolium (Blume) Miq., Fl. Ned., Casparya trisulcata A.DC. Monoecious, branched erect leafy herb, to 2 m tall, lacking rhizomes. Stems green or redish, usually glabrous, occasionally sparsely hairy. Leaves green, fruit fleshy, green to reddish. The leaves and stems of this species, which have a bitter acidic taste, are occasionally eaten as a vegetable within northern Vietnam (Tebbitt, 2003).

27. Begonia macrocarpa Warb. Synonyms : Begonia macrocarpa var. pubescens

H.K. Krauss, Begonia auriculata auct. non Hook.f. Erect perennial herb up to 110 cm tall; stem succulent, swollen at the nodes, slightly hairy to glabrous. Leaves alternate, simple. In Gabon Begonia macrocarpa leaves are eaten as a cooked vegetable, as a substitute for sorrel (Rumex spp.). They are appreciated for their acidulous taste and combine well with fish or crocodile meat in stews (Burkill, 1985; de Wilde, 2002; Raponda and Sillans, 1961; Sosef, 1994). Begonia macrocarpa is widespread from Guinea to DR Congo and Angola (Lemmens, 2004). Begonia

macrocarpa occurs in primary and secondary forest (Baker, 1987), especially along roads and rivers, up to 1000 m altitude.

28. Begonia malabarica Lam. East indies, leaves are eaten as pot-herbs (Sturtevant, 1919). The methanol extracts of whole plants of Begonia malabarica and Begonia

floccifera showed potent in vitro antioxidant activities. The phytochemical phenolics and flavonoids could be the reason for its antioxidant activity (Kalpanadevi, 2012). Distribution S.E. Asia (Umberto, 2012).

29. Begonia manicata Brongn. Petiole. The foliar blade can also be used in the making of "paxnikak," a dish made on the basis of "ma- fafa" (Xanthosoma robustum Schott) leaves (Francisco, 2003 Bailey, 1976). Distribution : East central Mexico to Nicaragua (Burt-Utley, 1985).

30. Begonia mannii W. J. Hooker Synonym Begonia epiphytica Hook.f., Begonia excelsa Hook.f., Begonia ndongensis Engl. Scrambling or pendulous non-rhizomatous perennial with few-branched, golden brown stems to 5 m long. Stem, leaves, and ovaries sparsely to densely covered with star-shaped hairs. In China, Indonesia and Brazil Begonias are used in salads (Laferriere, 1992). Distribution West Africa.

31. Begonia megaptera A. DC. Herb, erect, with smooth green leaves having unequal base and white fl owers. The plant is locally known as ‘Amilchari’ in Daman, Makwanpur district (central Nepal), which means the plant having sour taste, and people eat raw petioles and stems. Similar, findings have been reported by Sigdel (Sigdel 2004) from Daman, Makwanpur district. The juice of the whole plant is used to kill intestinal worms and cure toe wounds in Daman, Makwanpur district


PROCEEDING 2017 31

(Sigdel 2004), and in Rasuwa district (Shrestha 2008). Distributed in central Nepal between 500-1500 m above sea level.

32. Begonia multibracteata Girmansyah Stem rhizomatous, rooting at base, green to reddish green, hairy, succulent, unbranched, up to 1 m tall. Leaves distant; petiole 7–13 cm long, green to reddish green, hairy. Can be eaten in salads or cookes with fish. Distribution Bali (Indonesia). On primary forest floor at 1000–2000 m above sea level. (Girmansyah, 2009).

33. Begonia muricata Blume The sour leaves and stems are eaten raw or cooked in Indonesia. Fever, blood cleanser, cough suppressant (Abdiyani, 2008). Like humid, stony sites. Grows at 1000-2000 m above sea level.

34. Begonia nelumbiifolia Cham. & Schltdl. Synonym Begonia caudilimba C.DC., Begonia derycxiana Lem., Begonia hernandiifolia Klotzsch, Begonia peltata Sessé & Moc., Gireoudia nelumbiifolia (Cham. & Schltdl.) Klotzsch. Petiole are edible (Francisco, 2003). Distribution Mexico to Colombia.

35. Begonia palmate D. Don Synonym Begonia laciniata Roxb., Begonia palmata Sessé & Moc., Begonia palmata var. bowringiana (Champ. ex Benth.) Golding & Kareg., Begonia palmata var. crassisetulosaa (Irmsch.) Golding & Kareg., Begonia palmata var. difformis (Irmsch.) Golding & Kareg., Begonia palmata var. gamblei (Irmsch.) H. Hara, Begonia palmata var. khasiana (Irmsch.) Golding & Kareg., Begonia palmata var. laevifolia (Irmsch.) Golding & Kareg., Begonia palmata var. palmata , Begonia palmata var. principalis (Irmsch.) Golding & Kareg. Whole plants paste eaten for stomachace and diarrhea, young shoots cooked as vegetable (Louis, 1981; Kayang, 2007). Distribution India, E. Asia - S. China, Himalayas. In shady moist places by streams, on rocks of valley, under dense forests of shady stony cliffs, under evergreen broad-leaved forests, on moist rocks; in shrubberies by streams; 100 - 3200 m.

36. Begonia panchtharensis S. Rajbhandary Perennial herb with elongated thick rhizome, basal, large and almost glabrous leaves, six tepaled female flowers and is distributed in eastern Nepal, growing on shady river banks and edge of the forest near rivers at. 2200-2300 m above sea level. In Memeng, Panchthar district (eastern Nepal), this plant is found to feed pigs and the decoction of the rhizome is given for stomach-aches mostly by Limbu and Rai ethnic groups. According to the local informants, this knowledge has have been passed down from generation to generation in many parts of Nepal. One good example is the medicinal use for the treatment of toe wounds which is one of the quickest cures. Most of the people still live in the rural areas and are still engaged in subsistence farming. Toe wounds caused by standing long periods in paddy field during the rainy season are very common in most part of Nepal. This is the main season for rice planting and the people stay, in the paddy field almost the whole day planting rice seedlings. As Begonia is mostly found growing in this season, it has become the easiest and cheapest remedy for the farmers mostly in the hilly region to cure toe wound, which takes two to three days to be cured completely. Use of plant paste for the treatment of toe wounds could be suggested for further research in chemical analysis to find out


PROCEEDING 2017 32

the important component of the species that might lead to the findings of new drug for toe wounds as this is a cheapest and quickest remedy but seasonal (Rajbhandary, 2013).

37. Begonia picta Sm. Perennial. The leaves have an acid taste and are used as food. The leaves can be eaten raw or cooked, an acid flavour the sour tasting leaf stalks and stems can be pickled, and the juice of the plant is drunk to relieve headaches. The crushed leaves can be used as a poultice on sore nipples. The root juice is used as eyewash to treat conjunctivitis. It is also consumed in the treatment of peptic ulcers (Tebbitt, 2005; Sturtevant, 1919). Begonia picta is found as the most common species in the study area in Nepal having a wide range of distribution both vertically as well as horizontally and also has widest use as food, medicine, ornamentals and occasionally in the preparation of dye (Rajbhandary et al. 2010). Distribution India. (Rajbhandary et al. 2010).

38. Begonia plebeja Liebm. Synonym Begonia plebeja var. kennedyi Ziesenh. Stems peeled, sap is used to make a drink (Laferriere, 1992).

39. Begonia robusta Blume Leaves and stems can be eaten and is a drug (Priyadi, 2010).

40. Begonia roxburghii A.DC. Erect sub shrub to 1.2 m tall. Stems green or burgundy with numerous red elongated lenticels. Leaves eaten in chutney (A. Kar et al., 2013). Leaves and shoots are cooked with dry fish (Kayang, 2007). To treat tongue abnormalities, stem extract is given to the children for drinking; to treat jaundice, whole plant extract is taken thrice daily (used by Chakma tribe in Bangladesh) (Rahman, 2007). Distribution E. Himalaya (Nepal, Sikkim), N.E. Bengal, Assam, Burma. 500 m above sea level.

41. Begonia rubella Buch. Ham. ex D. Don Perennial erect herb with green succulent petiole and globose elongated orange coloured tubers, with pink flowers are important Begonia species in having various uses. Petioles are eaten raw in Palpa district, while a leaf paste is applied on cuts and toe wounds due to long period in mud especially during monsoon in many places of central Nepal like, Parbat, Arghakhanche, Gulmi, Palpa, Baglung, Tanahu district and Pyuthan of western Nepal. Shakya (1994) reported similar findings from Palpa district, and Shrestha (2008) from Rasuwa district. In Tehrathum district (eastern Nepal), leaves of B.

rubella (Makarkachi) is taken for chest pains also reported by Rai (2003) for Rai, Limbu, Sherpa, Tamang, Magar, Gurung, and Newar ethnic communities. They are mostly found growing under moist shady sloped forest edges between elevations ranging from 600-1700 m above sea level. A plant having sour text and growing on slopes (Rajbhandary, 2013).

42. Begonia tribenensis Rao Another endemic species distributed in central and eastern Nepal, is mostly single-leaved tuberous herbs with long pinkish red petiole, and white flowers. The petiole of Begonia tribenensis is found to be eaten raw in Damauli, Tanahu district (central Nepal) as other species. Beautiful flowers and attractive leaves of Begonia species as observed during this study suggest the


PROCEEDING 2017 33

horticultural potential of Begonia in Nepal. It is found mostly in the tropical and subtropical region between the elevations of 150-600 m above sea level. It is a rare species growing on rock-crevices and boulders in shady areas along the river banks and edges. (Rajbhandary et al. 2010).

43. Begonia wallichiana Lehm. Synonym Begonia franconis Liebm., Begonia parviflora Liebm. Leaves and petioles are cooked as greens and added to soups. Petioles of many other Begonia species are edible, though of limited appeal. Distribution Mexico and Guatemala (Bailey, 1976).

Bali Botanical Gardens has a collection of thematic one collection is Begonia, Begonia collection is well laid out in the greenhouse and planted according to their natural habitats. Begonia collection in Bali Botanical Gardens as many as 97 species and based on the results of inventory and study of the literature on Begonia which can be used as a food ingredient as much 15 species of Begonia in Bali Botanical Gardens. Since there are many species that have not been collected in Bali Botanical Gardens should be conducted ex situ conservation of the Begonia which can be used as a food ingredient and dissemination of information that can be useful for the community needs to be done.

CONCLUSIONS

Generally Begonias is ornamental plants but useful as food and medicine. The use of Begonia is always seek advice from a professional before using a plant food and medicinally. There needs to be further research on the useful of Begonia. Utilization Begonia as groceries above necessary to study chemical or need to do further research, considering we need to know how much edible parts of plants.

REFERENCES

A. Kar, D. Bora, S.K. Bortakur, N.K. Goswami, D. Saharia, 2013. Wild edible Plant Resources used by the Mizos of Mizoram, India. Kathmandu University Journal of

Science, Engineering And Technology. 9 (1) : 106-126.

Abdiyani, S. 2008. Keanekaragaman Jenis Tumbuhan Bawah Berkhasiat Obat Di Dataran Tinggi Dieng. Jurnal Penelitian Hutan dan Konservasi Alam. 5 (2) : 79-92.

Balami, N.P., 2003. Ethno-ecology of medicinal and aromatic plants of Kharpa

Community Forest. M.Sc. Dissertation, Central Department of Botany, Tribhuvan University, Kirtipur, Kathmandu, Nepal.

Bailey Hortorium. 1976. Hortus Third : A Concise Dictionary of Plants Cultivated in

the United States and Canada. Liberty Hide Bailey Hortorium, Cornell University. Wiley. New York. 1312 pp.

Burkill, I.H., 1935. Economic Products of Malay Peninsular. 2 vols. Crown Agent for the Colonies, London.

Burkill, H.M., 1985. The useful plants of West Tropical Africa. 2nd Edition. Volume 1, Families A–D. Royal Botanic Gardens, Kew, Richmond, United Kingdom. 960 pp.


PROCEEDING 2017 34

Burt-Utley, K. 1985. A revision of Central American Species oof Begonia Section Gireoudia (Begoniaceae). Tulane Studies in Zoology and Botany. 25 (1) : 1-131.

de Wilde, J.J.F.E., 2002. Begonia section Tetraphila A.DC. Wageningen University Papers 2001–2. Wageningen University, Wageningen, Netherlands. 5–258.

Dewitte A, Twyford AD, Thomas DC, Kidner CA, Van Huylenbroeck J. 2011. The origin of diversity in Begonia: genome dynamism, population processes and phylogenetic patterns Grillo, O, Venora, G (eds). The dynamical processes of biodiversity - case studies of evolution and spatial distribution. InTech: Rijeka, Croatia.

Doorenbos, J., Sosef, M.S.M. & de Wilde, J.J.F.E., 1998. The sections of Begonia including descriptions, keys and species lists. Studies in Begonia 6. Wageningen Agricultural University Papers 98–2. Wageningen Agricultural University, Wageningen, Netherlands. 266 pp.

Francisco Basurto-Peña, Delia Castro-Lara and Miguel Angel Martínez-Alfaro, 2003. Edible Begonias from the North of Puebla, Mexico. Journal Economic Botany, 57 (1) : 48-53.

Friedman H., Rot I., Agami Y., Vinokur Y., Reznick N., Umiel N., Dori I., Ganot L., Shmuel D., Matan E., 2007. Edible flowers : new crops with potential health benefits. Acta Hort (ISHS). 755 : 283-289.

Girmansyah, D. 2009. A taxonomic study of Bali and Lombok Begonia (Begoniaceae). Reindwartia 12 (5) : 419-434.

Hooker, J.D. 1879. The flora of British India. London. 2. 636.

Jagtap, S. D., Deokule, S. S.1, Pawar, P. K. and Harsulkar, A. M. 2009. Traditional Ethnomedicinal Knowledge Confined to the Pawra Tribe of Satpura Hills, Maharashtra, India. Ethnobotanical Leaflets. 13: 98-115.

Kalpanadevi, V. and Mohan, V.R., 2012. In vitro antioxidant studies of Begonia

malabarica Lam. and Begonia floccifera Bedd. Journal of Tropical Biomedicine. 1572-1577.

Kayang, H., 2007. Tribal Knowladge on Wild Edible Plants of Meghalaya Northeast India. Indian Journal of Traditional Knowladge. 6 (1) : 177-181.

Kiew, R., Julia Sang, Rimi Repin and Joffre Ali Ahmad, 2015. A Guide To Begonias

of Borneo. Natural History Publications (Borneo).

Laferriere J.E, Weber CW., Kohlhepp E.A. 1991. Use and Nutritional Composition of some traditional Mountain PIMA Plants Foods. Journal Ethnobiol. 11(1): 93-114.

Laferriere, J.E. 1992. Begonias as food and medicine. (Notes on Economic Plants). Journal Economic Botany. 46 (1) : 114-116.

Lemmens, R.H.M.J., 2004. Begonia macrocarpa Warb. [Internet] Record from PROTA4U. Grubben, G.J.H. & Denton, O.A. (Editors). PROTA (Plant Resources of

Tropical Africa / Ressources végétales de l’Afrique tropicale), Wageningen, Netherlands.


PROCEEDING 2017 35

Louis Evan Grivetti, 1981. Agricultural Development : Present and Potential Role of

Edible Wild Plants. Part 3. India, East Asia, Southeast Asia, Oceania. Departments of Nutrition and Geography. University of Ccalifornia. Davis, California. 95616

Mays, J., 2014. Coastal Ecuadorian Ethnobotany. Third Millenium Alliance. Jama. Coaque Ecological Reserve.

Priyadi, H., Gen Takao, Irma Rahmawati, Bambang Supriyanto, Wim Ikbal Nursal, Ismail Rahman, 2010. Five Hundred Plant Species in Gunung Halimun Salak

National Park, West Java, A checklist including Sundanese names, distribution and

use. CIFOR. Bogor. Indonesia. ISBN : 978-602-8693-22-6

Rahman, M.A., SB. Uddin and CC. Wilcock., 2007. Medicinal plants used by chakma tribe in Hill tracts districts of Bangladesh. Indian Journal of traditional

Knowledge. 6 (3) : 508-517.

Rajbhandary, S. 2013. Traditional Uses of Begonia (Begoniaceae) in Nepal. Journal

of Natural History Museum. 27 : 25-34.

Raponda-Walker, A. & Sillans, R., 1961. Les plantes utiles du Gabon. Paul Lechevalier, Paris, France. 614 pp.

Shrestha, P.M. and S.S. Dhillion, 2003. Medicinal plant diversity and use in the highlands of Dolakha district. Nepal. Journal of Ethnopharmacology, 86:81–96

Smith, L.B., D.C. Wass-hausen, J. Golding and C.E. Karegeannes. 1986. Begoniaceae. Smithsonian Contr. Bot. 60.

Sosef, M.S.M., 1994. Refuge Begonias. Taxonomy, phylogeny and historical

biogeography of Begonia sect. Loasibegonia and sect. Scutobegonia in relation to

glacial rain forest refuges in Africa. Studies in Begonias 5. Wageningen Agricultural University Papers 94–1. Wageningen Agricultural University, Wageningen, Netherlands. 306 pp.

Sturtevant, Edward Lewis,1919. Edible Plants of The World. New York Agricultural Experiment Station Geneva, N.Y. pp 775.

Tebbitt, Mark C., 2003. Taxonomy of Begonia longifolia Blume (Begoniaceae). Brittonia. 55 (1) : 19-29.

Tebbitt, Mark C., 2005. Begonias Cultivation, Identification and Natural History. Timber Press. Inc. Portland, Oregon 97204-3527, U.S.A.

Thomas, D. C., W. H. Ardi & M. Hughes, 2011. Nine New Species Of Begonia (Begoniaceae) From South And West Sulawesi, Indonesia. Edinburgh Journal Of

Botany 68 (2) : 225–255

Umberto Quattrocchi, F.L.S. 2012. CRC World Dictionary of Medicinal and

Poisonous Plants: Common Names. Common names, Scientific names, Eponyms,

Synonyms and Etymology. CRC Press. Taylor&Francis Group. ISBN 13:978-14822-5064-0.

U.S. Departmenr of Agriculture, Agricultural Research Service (USDA) 2012. USDA

National Nutrient data base for standars reference, Release 25. Nutrient Data Laboratory Home Page, http://www.ars.usda.gov/ba/bhnrc/ndl.


PROCEEDING 2017 36

Appendix 1. Begonia edible plants, parts use and its collection Bali Botanic

Garden

Species Edible parts

Begonia annulata K. Koch Leaves and stem Begonia × tuberhybrida Voss Leaves Begonia baliensis Girmansyah* Stem and leaves Begonia baramensis Merr. Leaves Begonia barkeri Knowles & Westc. petioles Begonia cathcartii Hook. f. & Thomson Stem and leaves Begonia comestibilis D.C.Thomas & Ardi* Leaves Begonia crenata Draynd. Leaves Begonia cucullata Willd. * Flowers and leaves Begonia flagellaris H. Hara Petiole and stem Begonia floccifera Bedd. Leaves Begonia fusca Liebm. * Petiole Begonia fusicarpa Irmsch. Leaves Begonia gracilis Kunth Stalk and petiole Begonia grandis Dryand. Leaves and stem Begonia hatacoa D. Don Stem Begonia heracleifolia Cham. & Schltdl. * Petiole Begonia hirtella Link. * Leaves and fruit Begonia humilis Aiton Leaves Begonia incarnata Link & Otto* Petiole Begonia isoptera Draynd. ex Sm. * Leaves Begonia josephi A.DC. Leaves Begonia lempuyangensis Girmansyah* Stem and leaves Begonia leptoptera H. Hara Petiole Begonia lombokensis Girmansyah* Stem and leaves Begonia longifolia Blume* Leaves and roots Begonia macrocarpa Warb. Leaves Begonia malabarica Lam. Leaves Begonia manicata Brongn. * Petiole and leaves Begonia mannii W. J. Hooker Leaves Begonia megaptera A. DC. Petiole and stem Begonia multibracteata Girmansyah* Stem and leaves Begonia muricata Blume Leaves Begonia nelumbiifolia Cham. & Schltdl. Petiole Begonia palmate D. Don Shoots Begonia panchtharensis S. Rajbhandary Rhizome and leaves Begonia picta Sm. Leaves Begonia plebeja Liebm. Stem Begonia robusta Blume* Stem and leaves Begonia roxburghii A.DC. Leaves Begonia rubella Buch. Ham. ex D. Don Petiole Begonia tribenensis Rao Petiole Begonia wallichiana Lehm. Leaves and petiole

* Begonia collection Bali Botanic Garden


PROCEEDING 2017 37

SEASONAL ENERGETICS OF THE NEW HOLLAND

HONEYEATER NEAR HOBART TASMANIA

Luh Putu Eswaryanti Kusuma Yuni1* and R.W. Rose2

1 Program Study Biology, Faculty of Mathematic and Natural Sciences, Udayana University Bali, Indonesia

2 School of Biological Sciences, Faculty of Sciences and Engineering, University of Tasmania, Australia

* Corresponding author: [email protected]

Abstract

Partitioning of the total available time and energy among various activities related to self-maintenance and reproduction is one important aspect of an animal’s life history. Measures of energy expenditures can provide quantitative tests of a number of ecological theories on such topics as foraging strategies, resource competition and parental investment. In this study, the energy expenditures of the New Holland honeyeater Phylidonyris novaehollandiae was observed near Hobart, Tasmania, for one year thus covering all seasons of the year. Little is known about seasonal variation in energy expenditure of the New Holland honeyeater as earlier studies on their energy expenditure covered only part of the annual cycle. Observations of energy expenditures throughout the year would allow this study to determine whether the reallocation hypothesis or the increased demand hypothesis applies to the New Holland honeyeater in Hobart, Tasmania. The daily energy expenditures of the New Holland honeyeater near Hobart Tasmania were found to be higher than the same species from mainland Australia. The birds did not exhibit seasonal variation in their daily energy expenditures, which confirms that the reallocation hypothesis applies to this species in Hobart, Tasmania. However the costs of foraging, perching, flying and overnight maintenance were found to be seasonally different. There was no significant difference in cost of preening throughout the year. An increased daily energy expenditure was not required by this species as they were able to partition their time and energy allocations for their vital activities in facing the varying energy demands of their annual cycle. Keywords: energy expenditure, honeyeater, time budget, reallocation hypothesis

BACKGROUND

Many studies have been conducted to estimate the energy expenditure of free-living birds (e.g., Masman et al. 1986; Weathers et al. 1996; Cooper 2000; Schultner et al. 2010). Measures of energy expenditure can provide quantitative tests of a number of ecological theories such as foraging strategies, resource competition or parental investment (Goldstein 1988; Weathers et al. 2002; Portugal et al. 2016). There are several methods used to estimate the energy expenditure of birds namely time energy budget (e.g., Utter and LeFebvre 1973; Ashkenazie and Safriel 1979), doubly labeled water (e.g., Utter and LeFebvre 1973; Weathers et al. 1996;


PROCEEDING 2017 38

Schultner et al. 2010) and analysis of energy consumption and assimilation (e.g., Goldstein 1988). However, Buttemer et al. (1986) and Goldstein (1988) suggested that the most common way to estimate the energy expenditure is the time energy budget method. The time energy budget method is an indirect approach to estimate the energy expenditure of free-living birds under natural conditions (Whittow 1986). MacMillen and Carpenter (1977) stated that this technique measures the total time allocated to various activities and calculates the caloric equivalents from known information on ambient temperatures, metabolic costs of rest in the laboratory and parameters necessary for application of flight cost equations. Based on the percentage of time that the bird devotes to a particular activity and the known energy cost of that activity, it is possible to arrive at a figure for the energy expenditure of the bird without interfering with the bird’s normal activity (Whittow 1986). However, the time energy budget method has disadvantages because it requires an extensive knowledge of the activity costs and thermal biology of the animal (Goldstein 1988). Moreover, Weathers et al. (1984) stated that estimation of daily energy expenditures derived from time energy budgets were 20 - 40 % lower than those measured directly using the doubly labeled water. This lower value was due to the failure of taking into account the effects of solar radiation in the time energy budget (Whittow 1986).

On the other hand, Goldstein (1988; 1990) suggested that the time energy budget method has advantages because it analyzes two important resources namely time and energy, and requires a minimum of expense and equipment in the field (Utter and LeFebvre 1973). Walsberg (1983) agreed that this method potentially allows the simultaneous quantification of both behavioural and energetic patterns with minimal disturbance to the birds. Moreover, Masman et al. (1988) stated that the time energy budget method would allow us to analyze the energetic consequences of alternative behavioural options open to individuals of a species and to evaluate shifts in energy allocation over the annual cycle. Whittow (1986) indicated that another advantage of this method is that it is possible to partition the energy budget into the categories of activity used by the bird.

Studies on the energy expenditures of avian species have been found to support two alternative hypotheses for their seasonal energetic patterns, namely the reallocation hypothesis and the increased demand hypothesis (Weathers and Sullivan 1993). The reallocation hypothesis predicts little seasonal variation in the energy expenditures, whereas the increased demand hypothesis predicts that the energy expenditure varies seasonally and should reach an annual maximum during the breeding season. In this study, the energy expenditures of the New Holland honeyeater Phylidonyris novaehollandiae was observed near Hobart Tasmania for one year, thus covering all seasons of the year. Little is known about seasonal variation in energy expenditure of the New Holland honeyeater as earlier studies on their energy expenditure covered only part of the annual cycle, for example during moulting (Weathers et al. 1996). Observations of energy expenditures throughout the year would allow this study to determine whether the reallocation hypothesis or the increased demand hypothesis applies to the New Holland honeyeater in Hobart, Tasmania. This study aimed to estimate the daily energy expenditure of the New Holland honeyeater Phylidonyris novaehollandiae near Hobart, Tasmania using the time energy budget method. The study was conducted in all four seasons of the year. This study thus was able to determine whether their daily energy expenditures varied


PROCEEDING 2017 39

seasonally or not, and the strategies used to exist in their habitat. This study also aimed to observe whether the reallocation hypothesis or the increased demand hypothesis applied for this species in Tasmania.


Study species

The New Holland honeyeater Phylidonyris novaehollandiae is a member of the family Meliphagidae, and is also known as the yellow-winged honeyeater, the white-eyed honeyeater or the white-bearded honeyeater (Ford and Paton 1977; Longmore 1991). It is a small bird about 18 cm in length and averaging 20 g (Collins and Newland 1986). Both sexes are similar in appearance. They inhabits areas of woodland, heath, Banksia scrub and swampy thickets (Macdonald 1973; Westphal et

al. 2003; Kavanagh and Stanton, 2005). They are both solitary or live in flocks, sedentary and nomadic (Thomas 1979). The birds occur throughout Western Australia, South Australia, southern Queensland, New South Wales, Victoria, and Tasmania including the islands in Bass Strait (Macdonald 1973; Myers et al., 2010). In Tasmania, the New Holland honeyeater inhabits areas of coastal heath, savanna woodland, dry sclerophyll forest, wet sclerophyll forest, wet scrub, sedgeland and orchards (Thomas 1979, Yuni 2002; Yuni and Rose, 2005a). However, the bird is seen more commonly in suburban areas such as gardens and open places (Sharland, 1958; Parsons et al., 2006). Thomas (1979) stated that the bird was distributed throughout all parts of Tasmania.

Energy expenditure calculation

The daily energy expenditures of the New Holland honeyeater near Hobart, Tasmania were calculated using the time budget data (Yuni 2002) and the metabolic data obtained in other studies (Yuni and Rose 2005b), following equation 1 of Weathers and Sullivan (1989). The equation used in this study for calculating the daily energy expenditures of the New Holland honeyeater is as presented below: DEE = (tρHmρ) + (tαHmα) + (tapHap + tfoHfo + tflHfl + tpreHpre) Where t : duration (in hours) of the activity phases and of the type of activity H : the energy requirements for a given activity (in kJ hr-1)

ρ : inactive phase (nighttime) α : active phase (daytime)

m : maintenance metabolism ap : perching during active phase (daytime) fo : foraging fl : flying pre : preening

The first bracketed term (tρHmρ) represents the nighttime energy expenditure.

The energy requirements (Hm) were calculated using the basal metabolic rates of the New Holland honeyeater measured during the inactive phase (nighttime). The second bracketed term (tαHmα) represents the bird’s daytime maintenance energy requirement while the third (tapHap + tfoHfo + tflHfl + tpreHpre) represents the energy expenditure of the given activity that add to the daytime maintenance energy


PROCEEDING 2017 40

requirement. Their energy requirements were calculated using the basal metabolic rates of the birds measured at inactive phase (nighttime) except for the energy requirement for flying.

Energy cost of flight (Ef) is maintained constant which is assumed to be independent of ambient temperature and is assumed to incorporate maintenance metabolism (Walsberg 1977). The energy requirement for flying was calculated based on Carlson and Moreno’s (1992) equation for cost of short flight of a non-aerial forager. Thus the costs of flight in this study were calculated as 11.7 times the nighttime basal metabolic rate.

During the daytime when the bird is active, they feed and are exposed to sunlight whereas the basal metabolic rates used to calculate activity costs were measured on fasted birds resting in the dark. Both factors need to be considered in the calculation of the daily energy expenditure. Weathers and Sullivan (1989) included these factors in the activity cost for alert perching. In this study, the cost of alert perching was calculated as the difference between the metabolic rate of fed birds in the light (1.98 times the nighttime basal metabolic rate) and the metabolic rate of fasting birds perching in the dark, during the day (Weathers and Sullivan, 1989).

The data on daily energy expenditures obtained from calculation using equation 1 of Weathers and Sullivan (1989) as well as data from Yuni and Rose (2005b) and Yuni (2002), then were compiled for different seasons of the year so that differences through the year could be determined. To determine the seasonal variation in the daily energy expenditure of the New Holland honeyeater in this study, data were analyzed statistically using SPSS 10.0 one-way ANOVA. Significance levels of 0.05 were used and all data presented are means ± S.E.

RESULTS

The daily energy expenditures of the New Holland honeyeater near Hobart, Tasmania are presented in Figure 1 and Table 1 below.

Figure 1 Seasonal variation in the daily energy expenditures (DEE) of the New Holland honeyeater near Hobart Tasmania. Data are means ± S.E.

40

60

80

100

120

140

160

spring summer autumn winter

DE

E K

J d

ay

-1

Season


PROCEEDING 2017 41

Figure 2. Seasonal energy allocation of each activity in the New Holland honeyeater near Hobart, Tasmania. Data are means ± S.E.

Table 1. Seasonal daily energy expenditure (DEE) and cost of activity of the New Holland honeyeater near Hobart, Tasmania as calculated by the time energy budget

method, together with their basal metabolic rate values. Data are means ± S.E.

kJ day-1 Spring Summer Autumn Winter

DEE 153.95 ± 4.5 134.00 ± 7.5 130.10 ± 10.7 123.00 ± 7.5 BMR 63.58 ± 1.9 66.90 ± 3.7 67.08 ± 5.5 70.77 ± 4.3 Foraging 14.33 ± 0.4 20.24 ± 1.1 17.80 ± 1.5 21.64 ± 1.3 Perching 9.06 ± 0.3 10.75 ± 0.6 4.70 ± 0.4 1.55 ± 0.1 Flying 64.16 ± 1.9 33.27 ± 1.9 37.61 ± 3.1 26.56 ± 1.6 Preening 2.81 ± 0.1 2.84 ± 0.1 3.25 ± 0.2 2.48 ± 0.2 Night maintenance

28.61 ± 0.8 26.12 ± 1.5 36.87 ± 3.0 42.28 ± 2.6

This study found that the daily energy expenditure of the New Holland honeyeater near Hobart, Tasmania were not seasonally different (F 3,16 = 2.842; p > 0.05). The daily energy expenditure averaged 153.95 ± 4.53, 134.00 ± 7.5, 130.10 ± 10.7 and 123.00 ± 7.5 kJ day-1 in spring, summer, autumn and winter respectively. When compared to the basal metabolic rate measurement, the ratio of the daily energy expenditure to the basal metabolic rate of the New Holland honeyeater were 2.4, 2.0, 1.9 and 1.7 in spring, summer, autumn and winter respectively.

However the cost of foraging, perching, flying and overnight maintenance were found to be seasonally different (F 3,16 = 7.666; p < 0.05 for foraging, F 3,16 = 118.340; p < 0.05 for perching, F 3,16 = 56.510; p < 0.05 for flying, and F 3,16 = 11.895; p < 0.05 for overnight maintenance). There was no significant difference in cost of preening throughout the year (F 3,16 = 1.320; p > 0.05). Figure 2 shows that the New Holland honeyeater exhibits fluctuations in the cost of activity to balance daily energy expenditure. In spring, the New Holland honeyeater spent the highest proportion of the total energy expenditure flying (64.16 ± 1.9.kJ day-1).

0

10

20

30

40

50

60

70

Cos

t of

Act

ivity

(K

J da

y-1)

Activity

Spring

Summer

Autumn

Winter


PROCEEDING 2017 42

However, the birds were able to balance their energy expenditure because night maintenance (28.61 ± 0.8 kJ day-1) and foraging (14.33 ± 0.4 kJ day-1) costs were low. In summer, the night-maintenance cost decreased (26.12 ± 1.5 kJ day–1) significantly compared to winter (Post hoc tests Tukey HSD P = 0.001). The birds were able to allocate higher time energy for perching (10.75 ± 0.6 kJ day–1). Cost for foraging was similar to winter (Post hoc tests Tukey HSD P = 0.825).

In autumn, the New Holland honeyeater allocated higher energy cost for night maintenance (36.87 ± 3.0 kJ day-1) and flying (37.61 ± 3.1 kJ day-1). Then the birds balanced the total energy expenditure by decreasing the energy expended in perching (4.70 ± 0.4 kJ day-1). There was no significant difference in cost of foraging in this season compared to other seasons (Post hoc tests Tukey HSD P = 0.188 to spring; P = 0.467 to summer; P = 0.129 to winter).

In winter, the birds allocated the most energy to night-maintenance cost (42.28 ± 2.6), thus needed to increase the cost for foraging (21.64 ± 1.3 kJ day-1). The cost for perching (1.55 ± 0.1 kJ day-1) and flying (26.56 ± 1.6 kJ day-1) were decreased compared to autumn in this season.

DISCUSSIONS

The Seasonal Energetics Hypothesis

Several studies on the seasonal energetics of avian species have found that the daily energy expenditure varies seasonally, although the period of the greatest energy expenditure differs among those studies. Some studies found winter to be the time of the highest energy expenditure (e.g., Weathers and Sullivan 1993; Cooper 2000), since the thermoregulatory demand was high and much effort was required for foraging due to the scarcity of food at that time of year. However, other studies have found that the breeding period required the highest energy expenditure (e.g., Bryant and Westerterp 1980; Masman et al.1986) due to the demands of reproduction.

The daily energy expenditure of the New Holland honeyeater in this study was found not to differ seasonally. The mean values (± S.E.) were 153.95 ± 4.53, 134.00 ± 7.5, 130.10 ± 10.7 and 123.00 ± 7.5 kJ day-1 in spring, summer, autumn and winter respectively. Other studies have also found little seasonal variation in the daily energy expenditure. Weathers and Sullivan (1993) found that the daily energy expenditure of the Yellow-eyed juncos Junco phaeonotus and the Dark-eyed juncos Junco hyemalis not to be significantly different between winter and the breeding season. Daily energy expenditure was reported as 70.5 kJ day-1. Ashkenazie and Safriel (1979) also found that the daily energy expenditure of the Semipalmated sandpiper Calidris pussila was relatively constant throughout the year, which was 155 and 176 kJ day-1 for male and female respectively.

As no significant differences were found in the daily energy expenditure between seasons in this study, this indicates that the reallocation hypothesis might be applicable to this species in Hobart, Tasmania. Weathers et al. (1996) stated that diet appears to determine which pattern of those hypotheses prevails. The increased demand hypothesis is more likely to be exhibited by birds that foraged on prey that is difficult to capture. Masman et al. (1988) found that the daily energy expenditure was the highest during the reproductive season in Kestrel Falco tinnunculus, which was carnivorous bird, feeding mostly on small mammals.


PROCEEDING 2017 43

The New Holland honeyeater in this study primarily fed on nectar and to a lesser degree on other non-nectar carbohydrates such as manna, lerps or honeydew (Yuni 2002; Yuni and Rose 2005a). Nectar was available throughout the year in the study sites and therefore the birds were unlikely to experience seasonal food shortages. Moreover, nectar is a continually renewing resource and most nectar-feeders are able to control their feeding source by territorial defense (MacMillen and Carpenter 1977). The cost-effective method of foraging used by this bird in this study (perching whilst probing into flowers) also gave benefit as less energy was required for foraging. Therefore more net energy remained for self-maintenance and reproduction. Bryant (1997) stated that the highest energy cost for foraging was found for aerial foragers such as the hummingbird, which is flying/hovering whilst foraging for nectar.

Energy Allocation Strategy

Breeding (e.g., Bryant and Westerterp 1980; Masman et al. 1986), moulting (e.g., Whittow 1986) and wintering (e.g., Weathers and Sullivan 1993; Cooper 2000) were found to be the periods of high energy demand in birds. However, birds may maintain an economical strategy by timing the occurrence of those periods to different times of the year. Mugaas and King (1981) revealed that the periods of highest energy expenditure –reproduction, moult and thermoregulation – for the Black-billed magpie Pica hudsonia, occurred at different times of the year.

In this study, the New Holland honeyeater commenced breeding from early winter to midsummer (Yuni 2005a). Breeding did not occur during autumn, and the birds underwent moulting in this season. Paton (1985) stated that adults New Holland honeyeater commenced moult immediately after breeding. Ford (1989) stated that all birds need to moult at least once per year, and as this period requires additional energy, the breeding and the moulting periods rarely coincide. However, breeding also commenced in winter, and thus for the New Holland honeyeater two energy demanding activities coincided in winter (Yuni 2005a). New Holland honeyeaters are able to breed in winter probably because sufficient food was available allowing the birds to meet the high energy requirement for thermoregulation and breeding. It seems that the winter flowering plants in the study sites provide a high nectar concentration during that time. R.Wiltshire (pers.comm.) stated that those plants that flower predominantly in winter and require visits from birds for pollination, were likely to have high nectar concentrations. Moreover, Williams and Ternan (1999) stated that almost all passerines time their breeding season to coincide with a seasonal increase in food availability, thus facilitating an increased level of energy or nutrient intake during reproduction.

Since the breeding period of species in this study occurred from early winter to midsummer (Yuni 2005a), winter was expected to be the time of the year with the highest energy expenditure, since the thermoregulatory demand is also high. However, the increased daily energy expenditure in winter did not occur. Birds might compensate for changes in energy budgets by changing the time spent on activities and hence the energy allocation (Klaasen 1997). The Yellow-eyed juncos Junco

phaeonotus were found to forage longer during winter to maintain their energy balance (Weathers and Sullivan, 1993). Another example of time allocation was found for the Kestrel Falco tinnunculus. Its activity was economized by suppressing flight during the breeding period (Masman et al. 1988).


PROCEEDING 2017 44

In winter, the New Holland honeyeater balanced the time and energy allocation for its activities. During this season the bird spent the highest of their energy allocation on night-maintenance cost (42.28 ± 2.6 kJ day-1); the average night temperatures were the lowest (5.7oC) and the period of fasting overnight was the longest (14.34 hours) to this diurnally feeding bird. Thus the birds needed to increase time allocation for feeding (61.0 ± 2.5 – 67.8 ± 1.9 %) during this season so as to obtain more energy for self-maintenance and reproduction.

As a consequence, the time allocation for other activities such as perching (7.9 ± 1.3 – 12.6 ± 1.6 %) and flying (14.2 ± 1.1 – 14.9 ± 1.0 %) decreased (Yuni 2002). The cost for foraging increased (21.64 ± 1.3 kJ day-1) while the cost for perching (1.55 ± 0.1 kJ day-1) and flying (26.56 ± 1.6 kJ day-1) decreased in this season. Masman et al. (1986) stated that time allocation to foraging plays a crucial role in the energy budget since it determines the gross energy intake.

In summer, birds lowered their energy allocation for thermoregulatory maintenance, as the average of the night temperature was the highest (13.3oC) and the period of overnight fasting was the shortest (9.37 hours). The night-maintenance cost decreased (26.12 ± 1.5 kJ day–1) significantly compared to winter (Post hoc tests Tukey HSD P = 0.001). The birds were able to allocate more energy for perching especially at midday when they sought shelter as the part of their behavioural strategy to avoid overheating. Cost of foraging was similar to that in winter (Post hoc tests Tukey HSD P = 0.825) in order to cover the cost of reproduction.

In spring, the New Holland honeyeater spent the highest proportion of the total energy expenditure on flying (64.16 ± 1.9.kJ day-1). Flying is an energetically expensive activity, as it requires about 11.7 times the nighttime basal metabolic rate (Carlson and Moreno, 1992). The high incidence of flying in this season was due, in part, to the high levels of aggression among New Holland honeyeaters and other cohabiting nectar-feeding species during breeding territory establishment.

However, the birds were able to balance their energy expenditure because night maintenance (28.61 ± 0.8 kJ day-1) and foraging (14.33 ± 0.4 kJ day-1) costs were low. The low foraging cost was presumably related to the higher sugar concentration in nectar produced during this season. Wiltshire (pers.comm.) stated that in plants with a continuous flowering period, nectar concentration produced varies seasonally and the highest nectar concentrations are mostly produced in spring and early summer.

In autumn, there was a higher energy cost for night maintenance (36.87 ± 3.0 kJ day-1) and flying (37.61 ± 3.1 kJ day-1). The birds were moulting during this season. During the moult, both the surface area of the wing and wingspan are reduced and these affect energy expenditure in flight (Masman et al. 1988). The birds need to balance the total energy expenditure by decreasing the cost of perching (4.70 ± 0.4 kJ day-1). There was no significant difference in the cost of foraging in this season comparing to the other seasons (Post hoc tests Tukey HSD P = 0.188 to spring; P = 0.467 to summer; P = 0.129 to winter).

Energy obtained from foraging during this season was required to meet energy demands for the moulting period of this bird. Newton (1968) stated that during moulting, additional food intake was required to cover the cost of feather synthesis and to compensate for the additional heat loss because of reduced insulation and increased peripheral blood flow through growing feathers.


PROCEEDING 2017 45

Ratio of the Daily Energy Expenditures to the Basal Metabolic Rate

Masman et al. (1986) stated that the minimum amount of energy required by an individual bird is equal to the basal metabolic rate plus the expenditure in procuring and digesting food. Thus the absolute lower limit of the daily energy expenditure should be somewhere near 1.5 times basal metabolic rate. Under some circumstances, the rate of daily energy expenditure for birds apparently reaches a maximum sustainable level, estimated to be approximately four times the basal metabolic rate (Goldstein 1990) which is a consequence of energy processing constraints, such as the ability to transport nutrients through and across the alimentary tract.

Furthermore, Drent and Daan (1980) described that energy expenditure beyond 4 times basal metabolic rate on a daily basis could not be sustained, either because the animals could not physically maintain this or because exertion beyond this level would be detrimental to animal survival.

The ratios of daily energy expenditure to the basal metabolic rate in this study were 2.4, 2.0, 1.9 and 1.7 in spring, summer, autumn and winter respectively. The New Holland honeyeater in this study required energy between 1.7 – 2.4 of their BMR to exist in their habitat. The values obtained in autumn and winter are unusually low. Hulbert and Else (2000) stated that the daily energy expenditure of passerine and nonpasserine birds was about two to three times their basal metabolic rate. A study by Weathers et al. (1996) in South Australia on a conspecific bird found the ratio of daily energy expenditure to basal metabolic rate was 2.8. That study was conducted in summer when the birds had finished breeding and begun moulting.

The value of the ratio of daily energy expenditure to basal metabolic rate depends upon the BMR measurement used. The basal metabolic rate in this study was higher than earlier studies in mainland Australia (Yuni and Rose 2005b). If the basal metabolic rate is unusually high, then the percent of the daily energy expenditure that is expended on basal metabolic rate is high, and the ratio of daily energy expenditure to basal metabolic rate will be lower (S. Cooper pers.comm.). The basal metabolic rate measurements in this study were conducted on birds which were postabsorptive, resting in their resting phase, and in their thermoneutral zone (Yuni and Rose 2005b).

However, there are several factors known to affect the basal metabolic rate, namely season (Weathers and Caccamise 1975; 1978), climate (Weathers 1979; 1980), activity phase of the bird (Aschoff and Pohl 1970), diet (McNab 1988; Vitalli et al. 1999), length of fasting time prior to measurement (Whittow 1986; Weathers and Sullivan 1989), captivity effect (Warkentin and West 1990) and handling and capture stress (Siegel 1980; Speakman et al. 1993). Basal metabolic rate measurements could yield widely divergent results depending on these factors.

Comparison to Other Studies

Earlier studies on the daily energy expenditure of this species have been conducted in mainland Australia. The daily energy expenditures in this study were higher than those of earlier studies. Table 2 presents data of daily energy expenditures obtained in earlier studies on this species in mainland Australia.


PROCEEDING 2017 46

Table 2. The daily energy expenditures (DEE) obtained in earlier study on the New Holland honeyeater in mainland Australia together with the values obtained in this

study. Note: DLW is Doubly Labeled Water, TEB is Time Energy Budget.

Study DEE

kJ day -1 Method Season Study sites

Paton 1982

75 TEB Melbourne, Victoria

McFarland 1986

98 TEB Armidale, NSW

Weathers et al. 1996

77.6 DLW Summer South Australia

88 TEB Summer South Australia This study 153.95 ± 4.5 TEB Spring Hobart, Tasmania 134.00 ± 7.5 TEB Summer Hobart, Tasmania 130.10 ± 10.7 TEB Autumn Hobart, Tasmania 123.00 ± 7.5 TEB Winter Hobart, Tasmania

Differences in the methods used to obtain the daily energy expenditure might explain the differences obtained in these studies. There are four factors in the time energy budget method that might affect the daily energy expenditure. Firstly, the metabolic rates used for calculating the cost of activity. The metabolism values obtained in this study were higher than those values obtained in mainland Australia (Yuni and Rose 2005b). As the costs of activity and maintenance calculations were based on the metabolism data, the daily energy expenditure would be affected. Secondly, there are different methods for calculating the cost of flight.

Paton (1982) used Tucker’s (1974) equation to calculate the cost of flight in his study, and McFarland (1986) and Weathers et al. (1996) most likely used the same method as they quoted Paton (1982). This study used Carlson and Moreno’s (1992) equation to calculate the cost for flying. This equation was chosen because it is more contemporary and was set for the cost of short flight by a non-aerial forager, which is suited to the flying type exhibited by the New Holland honeyeater. In addition, Rayner (1982) criticized a number of untested assumptions in Tucker’s (1974) equation regarding size variation of aerodynamic parameters and is probably no more accurate when applied to birds as a whole. Avian flight costs depend on body mass and aerodynamic properties, and their relationship to foraging mode and flight gait (Carlson and Moreno 1992).

The third factor that affects daily energy expenditure as calculated from the time energy budgets is the time budget estimation data. Different time budget data were most likely to be observed when data are collected from different geographic locations, collected under different climatic conditions, and some of the behavioural categories observed were not similar among studies. Moreover, time budget allocation appeared to be strongly constrained by the ecology of the bird; for example the food availability or the energy content of the food and the part of the annual cycle experienced by the bird, for instance breeding period or moulting, and when the study was conducted.


PROCEEDING 2017 47

Lastly, the method used for time budget estimation. Weathers et al. (1984) stated the same time budget data could give rise to widely differing daily energy budget estimation depending upon the time budget model chosen. McFarland (1986) calculated the time activity budget using continuous observation for 15 minutes. This study used the instantaneous sampling method of 10 seconds intervals for 5 minutes observation. Continuous reading measures true frequencies and durations and the times at which behaviour patterns stopped and started, while the instantaneous sampling method records behavioural activity which was expressed as the proportion of all sample points on which the behaviour pattern was occurs (Altmann 1974; Martin and Bateson 1996). The continuous recording might give the true frequencies, latencies and durations of an activity; however, the New Holland honeyeater is a very active species and different activities frequently occur in very short periods of time. Therefore it is difficult to measure the exact duration of that activity. The instantaneous sampling does not give true frequencies or durations. However, if the sample interval is short relative to the average duration of the behaviour pattern then this method can produce a record that approximates continuous recording (Martin and Bateson 1996). K. Herman (pers.comm.) found a significant difference between the time activity budget observed of the Black-headed honeyeater Melithreptus

affinis in Tasmania using either continuous recording or the time sampling method. Weathers et al. (1996) used the doubly labeled water (DLW) method

compared to the time energy budget method that was used in this study. The DLW technique provides a more direct and quite accurate measure of DEE (Goldstein 1990). However, there are some limitations of this method. Firstly, it provides only a single integrated measure of energy expenditure and such analysis can be costly (Goldstein, 1990). Secondly, the difficulty in recapturing marked individuals within the desired periods (24 to 48 hr). Bryant and Westerterp (1980) stated that the ability to recapture birds is an important prerequisite for the successful operation of the stable isotope technique. Thirdly, lack of knowledge of the animal’s diet might result in assigning incorrect energy equivalents to CO2 (Weathers et al. 1996). And lastly the method could only be applied to a limited number of animals while a much greater sample size would be required to avoid the variability resulting from weather, food availability and reproductive phase (Masman et al. 1988).

Time energy budget methods provide reliable values of daily energy expenditure when the maintenance and activity costs are determined for the study population in the same season as the time budgets data were recorded (Cooper 2000). Weathers et al. (1984) also stated that the time energy budget method would provide excellent daily energy expenditure as it appears to assess the thermoregulatory requirement accurately and it uses measured rather than assumed metabolic costs for behavioural assignments. This study calculated the daily energy expenditures based on measured energy cost for the activities and the maintenance. Both costs were measured in the same seasons as time activity budgets were recorded.

CONCLUSIONS

In summary, the daily energy expenditures of the New Holland honeyeater near Hobart Tasmania were found to be higher than the same species from mainland Australia. The birds did not exhibit seasonal variation in their daily energy expenditures, which confirms that the reallocation hypothesis applies to this species


PROCEEDING 2017 48

in Hobart, Tasmania. An increased daily energy expenditure was not required by this species as they were able to partition their time and energy allocations for their vital activities in facing the varying energy demands of their annual cycle.

REFERENCES

Altmann, J. 1974. Observational Study of Behaviour: Sampling Methods. Behaviour. 49. 227 -267.

Aschoff, J and H. Pohl. 1970. Rhythmic Variations in Energy Metabolism. Federation Proceedings. 29. (4). 1541 – 1552.

Ashkenazie, S. and U.N. Safriel. 1979. Time-energy Budget of the Semipalmated Sandpiper Calidris pusilla at Barrow, Alaska. Ecology. 60. 783 – 799.

Bryant, D.M. 1997. Energy Expenditure in Wild Birds. Proceedings of the Nutrition

Society. 56. (3). 1025 – 1039.

Bryant, D. M. and K.R. Westerterp. 1980. The Energy Budget of the House Martin (Delichon urbica). Ardea. 68. 91 – 102.

Buttemer, W.A., A.M. Hayworth, W.W. Weathers, and K.A. Nagy. (1986). Time-budget Estimates of Avian Energy Expenditure: Physiological and Meteorological Considerations. Physiological Zoology. 59. (2). 131 – 149.

Carlson, A. and J. Moreno. 1992. Cost of Short Flights in the Willow Tit Measured with Doubly-labeled Water. Auk. 109. (2). 389 – 393.

Collins, B.G. and C. Newland. 1986. Honeyeater Population Changes in Relation to Food Availability in the Jarrah Forest of Western Australia. Australian Journal of

Ecology. 11.63–76.

Cooper, S.J. 2000. Seasonal Energetics of Mountain Chickadees and Juniper Titmice. Condor. 102. 635 – 644.

Drent, R. H. and S. Daan. 1980. The Prudent Parent: Energetic Adjustments in Avian Breeding. Ardea. 68. 225 – 252.

Ford, H.A. 1989. The Ecology of Birds: An Australian Perspective. Surrey Beatty. Sydney.

Ford, H.A. and D.C. Paton. 1977. The Comparative Ecology of Ten Species of Honeyeaters in South Australia. Australian Journal of Ecology. 2. 399 – 407.

Goldstein, D.L. 1988. Estimates of Daily Energy Expenditure in Birds: The Time-Energy Budget as an Integrator of Laboratory and Field Studies. American Zoologist. 28. 829 – 844.


PROCEEDING 2017 49

Goldstein, D.L. 1990. Energetics of Activity and Free Living in Birds. Studies in

Avian Biology. 13. 423 – 426.

Hulbert, A.J and P.L. Else. 2000. Mechanisms Underlying the Cost of Living in Animals. Annual Review in Physiology. 62. 207 – 35.

Kavanagh, R.P. and M.A. Stanton. 2005. Vertebrate Species Assemblages and Species Sensitivity to Logging in the Forests of North-eastern New South Wales. Forest Ecology and Management. 209. (3). 309-341.

Klaassen, M. 1997. Physiological Flexibility and Its Impact on Energy Metabolism and Foraging Behaviour in Birds. In: Herbivores: Between Plants and Predators. Olff, H., Brown, V.K., and Drent, R.H. (eds.). The 38th Symposium of the British Ecological Society. Netherlands.

Longmore, W. 1991. Honeyeaters and Their Allies of Australia. Angus and Robertson. Australia.

Macdonald, J.D. 1973. Birds of Australia. A.H and A.W Reed. Sydney, Wellington, London.

MacMillen, R. E. and F.L. Carpenter. 1977. Daily Energy Costs and Body Weight in Nectarivorous Birds. Comparative in Biochemistry and Physiology. 56A. 439 – 441.

Martin, P and P. Bateson. 1993. Measuring Behaviour. An Introductory Guide. 2nd edition. Cambridge University Press. United Kingdom.

Masman, D., D. Daan, and H.J.A. Beldhuis. 1988. Ecological Energetics of the Kestrel: Daily Energy Expenditure throughout the Year Based on Time Energy Budget, Food Intake and Doubly Labelled Water Methods. Ardea. 76. 64 – 81.

Masman, D., M. Gordjin, S. Daan, and C. Dijkstra. 1986. Ecological Energetics of the Kestrel: Field Estimates of Energy Intake throughout the Year. Ardea. 74. 24 – 39.

McFarland, D.C. 1986. Breeding Behaviour of the New-Holland Honeyeaters Phylidonyris novaehollandiae. EMU. 86.161– 167.

McNab, B.K. 1988. Food Habits and the Basal Rate of Metabolism in Birds. Oecologia. 77. 343 – 349.

Mugaas, J.N and J.R. King. 1981. Annual Variation of Daily Energy Expenditure by the Black-billed Magpie: A Study of Thermal and Behavioral Energetics. Studies in

Avian Biology No. 5. 1 – 78.

Myers, S., G. Brown and S. Kleindorfer. 2010. Divergence in New Holland Honeyeaters (Phylidonyris novaehollandiae): Evidence from Morphology and Feeding Behavior. Journal of Ornithology. 151. (2). 287-296.


PROCEEDING 2017 50

Newton, I. 1968. The Temperatures, Weights, and Body Composition of Molting Bullfinches. Condor. 70. 323 – 332.

Parsons, H., R.E. Major, and K. French. 2006. Species Interactions and Habitat Associations of Birds Inhabiting urban Areas of Sydney, Australia. Austral Ecology. 31. (2). 217-227.

Paton, D.C. 1982. The Diet of the New-Holland Honeyeaters Phylidonyris novaehollandiae. Australian Journal of Ecology. 7. 279 – 298.

Paton, D.C. 1985. Do New-Holland Honeyeater Phylidonyris novaehollandiae Breed Regularly in Spring and Autumn? EMU. 85, 130 – 133.

Portugal, S.J., J.A. Green, L.G. Halsey, W. Arnold, V.Careau, P. Dann, P.B. Frappell, D. Gremillett, Y. Hendrich, G.R. Martin, T. Ruf, M.M. Guillemette, and P.J. Butler. 2016. Associations between resting, activity, and daily metabolic rate in free-living endotherms: no universal rule in birds and mammals. Physiological and

Biochemical Zoology. 89. (3). 000-006

Rayner, J. M. V. 1982. Avian Flight Energetics. Annual Review of Physiology. 44. 109 – 119.

Schultner, J., J. Welcker, J.R. Speakman, E.S. Nordoy, and G.W. Gabrielsen. 2010. Application of the two-sample doubly labelled water methods alter behaviour and affects estimates of energy expenditure in black-legged kittiwakes. The Journal of

Experimental Biology. 213. 2958 – 2966.

Sharland, M. 1958. Tasmanian Birds. Angus and Robertson Ltd. Sydney.

Siegel, H.S. 1980. Physiological Stress in Birds. Bioscience. 30. (8). 529 – 534.

Speakman, J.R., R.M. McDevitt, and K.R. Cole. 1993. Measurement of Basal Metabolic Rates: Don’t Lose Sight of Reality in the Quest for Comparibility. Physiological Zoology. 66. (6). 1045 – 1049.

Thomas, D.G. 1979. Tasmanian Bird Atlas (Fauna of Tasmania Hand Book; no. 2) Fauna of Tasmania Committee. University of Tasmania.

Tucker, V. A. 1974. Energetics of natural avian flight. Pages 298-333 in R. A. Paynter, ed. Avian energetics. Publ. Nuttall Ornithol. Club no. 15. Cambridge, Mass

Utter, J.M. and E.A. LeFebvre. 1972. Daily Energy Expenditure of Purple Martins (Progne subis) during the Breeding Season: Estimates Using D2O18 and Time Budget Methods. Ecology. 54. 597 – 604.

Vitali, S.D, P.C. Withers, and K.C. Richardson. 1999. Standard Metabolic Rates of three Nectarivorous Meliphagid Passerine Birds. Australian Journal of Zoology. 47. 385 – 391.


PROCEEDING 2017 51

Walsberg, G.E. 1977. Ecology and Energetics of Contrasting Social Systems in Phainopepla nitens (Aves: Ptilogonatidae). University of California Press. Los Angeles.

Walsberg, G.E. 1983. Avian Ecological Energetics. In: Avian Biology. Vol.7. 161 – 220.

Warkentin, I.G and N.H. West. 1990. Impact of Long-term Captivity on Basal Metabolism in Birds. Comparative Biochemistry and Physiology. 96A. (3). 379 – 381.

Weathers, W.W. 1979. Climatic Adaptation in Avian Standard Metabolic Rate. Oecologia. 42. 81 – 89.

Weathers, W.W. 1980. Seasonal and Geographic Variation in Avian Standard Metabolic Rate. Acta XVII Congress International of Ornithologist. 283 – 286.

Weathers, W.W., W.A. Buttemer, A.M. Hayworth, and K.A. Nagy. 1984. An Evaluation of Time-budget Estimates of Daily Energy Expenditure in Birds. The

Auk. 101. 459 – 472.

Weathers, W.W and D.F. Caccamise. 1975. Temperature Regulation and Water Requirements of the Monk Parakeet, Myiopsitta monachus. Oecologia. 18. 329 – 342.

Weathers, W.W and D.F. Caccamise. 1978. Seasonal Acclimatization to Temperature in Monk Parakeets. Oecologia. 35, 173 – 183.

Weathers, W.W., C.L. Davidson, C.R. Olson, M.L. Morton, N. Nur, and T.R. Famula. 2002. Altitudinal Variation in Parental Energy Expenditure by White-crowned Sparrows. The Journal of Experimental Biology. 205. 2915-2924.

Weathers, W.W., D.C. Paton, and R.S. Seymour. 1996. Field Metabolic Rate and Water Flux of Nectarivorous Honeyeaters. Australian Journal of Zoology. 44. 445 – 460.

Weathers, W.W. and K.A. Sullivan. 1989. Juvenile Foraging Proficiency, Parental Effort, and Avian Reproductive Success. Ecological Monographs. 59. (3). 223 – 246.

Weathers, W.W. and K.A. Sullivan. 1993. Seasonal Patterns of Time and Energy Allocation by Birds. Physiological Zoology. 66. (4). 511 – 536.

Westphal, M.I., S.A. Field, A.J. Tyre, D. Paton, H.P. Possingham. 2003. Effects of Landscape Pattern on Bird Species Distribution in the Mt. Lofty Ranges, South Australia. Landscape Ecology. 18. (4). 413. doi:10.1023/A:1026115807529

Whittow, G.C. 1986. Regulation of Body Temperature and Energy Metabolism. In: Avian Physiology. 4th edition. Sturkie, P.D (ed). Springer – Verlag. New York, Berlin, Heidelberg. Tokyo.


PROCEEDING 2017 52

Williams, T. D. and S.P. Ternan. 1999. Food Intake, Locomotor Activity, and Egg Laying in Zebra Finches: Contributions to Reproductive Energy Demand? Physiological and Biochemical Zoology. 72. (1). 19 – 27.

Yuni, L.P.E.K. 2002. Seasonal Energetic of the New Holland Honeyeater Phylidonyris novaehollandiae (Aves; Meliphagidae) near Hobart Tasmania. Master Thesis. University of Tasmania. Australia

Yuni, L.P.E.K. and R.W. Rose. 2005a. Breeding Biology of the New Holland Honeyeater (Phylidonyris novaehollandiae) Near Hobart, Tasmania. Journal

Biology. IX (2). December 2005: 65 – 69.

Yuni, L.P.E.Kusuma and R.W Rose. 2005b. Metabolism of Winter-acclimatized New Holland honeyeater (Phylidonyris novaehollandiae) from Hobart Tasmania. Acta Zoologica Sinica. 51(2): 338 – 343.


PROCEEDING 2017 53

THE ECOLOGICAL IMPACT OF SEGARSSBEDS

REPLACEMENT ONTO SEA URCHIN, Tripneustes gratilla

Linnaeus, 1758, AT SERANGAN ISLAND BALI

Deny S. Yusup1,2 * , Philipus Kristianto1, and Job Nico Subagio1,2

1 Study Program of Biology University of Udayana 2 Coastal and Marine Study Group of Math and Natural Science University of

Udayana *Corresponding author: [email protected]

Abstract

Serangan Island is one site at Bali waters that was reported to have good segrassbeds condition, however the area was replaced for seaweed farming. A research on to what extent does the habitat replacement govern the ecological of high value sea urchin, Tripneustes gratilla Linnaeus, 1758 was carried out by 2007 at 115’ 13’ 936” (E) and 08’ 44’ 907” (S). Three perpendicular transects with quadrat were used for sampling and the variable were spatial dispersion and density of sea urchin. The results showed that seaweed farming is becoming the barrier of sea urchin dispersion. The density of sea urchin at which seaweed farming established was lower than other sites without seaweed farming.

Keywords: Tripneustes gratilla, Seaweed, Farming, Seagrass, Serangan Island

BACKGROUND

Indonesia has 5,8 km2 marine ecosystem and the largest marine biodiversity (BAPEDA dan PKSPL IPB, 2000). The organism mostly inhabitant corall reef, amngrove and seagrass. Though less concern is adressed on to segrass importances, seagrass ecosystem has been widely known take significant ecological role as feeding ground, refuge area and spawning organism for various organism such as, invertebrate, fishes (McCloskey and Unsworth, 2015). These organisms could inhabitant seagrass ecosistem temporary (such as necton) or permanently dominated by small invertebrates faunas ( Junoy and Vieitez, 1992; Hutching et al., 1993).

Seagrass beds is one of the important ecosystem at Denpasar waters, various algae and faunas were found at the segrass beds i.e. echinoderm, mollusc and algae (Linawati, 2005, Kristianto,2009). The seagrass ecosystem deterioration at surounding Denpasar water tends to raise up progressively by 2005 due to establishment of break waters at Sanur and Nusa Dua waters and development seaweed farming at Serangan Island waters. The organism that woud get significant impact is the permanent organism when seagrass deterioration progresively increase. Therefore it is cruciall to observe the impact of such seagrass deterioration onto the permanent inhabitant faunas. One of the inhabitant fauna taht would be affected is seaurchin. Sea urchin is one of the most frequent fauna found at seagrass habitat. The research of Laning (2013) found 8 species from seagrassbeds at surounding Denpasar.


PROCEEDING 2017 54

Seaurchin has significant economical role and has been exploited since long time ago by local community, the local community harvests the egg of seaurchin to be consumed. The seaurchin species mostly harvested is Tripneustes gratilla and the species is widely speread at seagrass beds at surounding Denpasar waters. The objective of this study was to evaluate te impact of seaweed farming development on to seaurchin , Tripneustes gratilla.


The sampling site was at 115’ 13’ 936” (E) dan 08’ 44’ 907” (S). Sampling was undertake over low tide period by means of transect method.

= Sampling site

Figure 1. Sampling site at Serangan Island (source: Google Earth 2008)


PROCEEDING 2017 55

Three perpendicular transect were applied (± 300 m) and the interval was 25 m between the transect. Sampling area was (2 x 10 m) at each samling point and interval sampling point at each transect was 10 m (total sampling point at each transect was± 30) (Bachtiar dkk, 2000). Sampel were colected for measuring body size and population counting purposes. The book of Edgar (1997) , Allen and Roger (2000) were used for identification references. All sample were then released back to the habitat. Sampling point along transect was classified into three zones i.e. seaside area (0-50 m), sea weed farming area/mid area (60-160 m) and break water area (170-300 m). Sampling was undertaken by two periods representing raining season (Oktober – November) and post raining season (january up to March).

Varible analised were density (Pratiwi, 20007) and seagrass coverage (Short et al., 2001)

Density = Number of individual Total of sampling area

Figure 2. The morphology of Tripneustes gratilla (Edgar, 1997)

RESULTS

Seagrass coverage

Research area is located at reclamation zone of Serangan Island, the site is next to Benoa Harbour chanal (Fig .1). The area is managed by management of Bali Turtle Island Development (BTID). Eight species of seagrass plant were found at the site area i.e. Thallasia hemprichii, Cymodocea rotundata, Cymodocea serrulata,

Enhalus acoroides, Thallasia hemprichii, Cymodocea rotundata, Cymodocea serrulata, Enhalus acoroides. Thallasia hemprichii, Cymodocea rotundata, Cymodocea serrulata, Enhalus acoroides are the most dominant species in the research site. The seagrass indicated spatial coverage, the coverage was at range 30 – 40% , 0 - 5% and 20 – 30 % at sea side, seaweed farming and break water area respectively.

Seaweed Framing

The species of seaweed farmed is Eucheuma cotonii. The farming method applied was “bottom line”, the seaweed is grown over the bottom surface. The farmer prepares the farming site by clear cutting seagrass plant which is proposed to


PROCEEDING 2017 56

maximize sun light penetration and removing dead corral. The farming activity is initiated by 2005.

T. gratilla population

Total individual collected over sampling period was 195 individuals, consisting of 103 individual (at sea side), 7 individual (at seaweed farming area) and 85 individual (at break water area). The shell diameter was range from 30-80 mm and the body weight range was from 10-150 g. Temporal observation showed that the range and the average of shell diameter respectively were 30-80 mm and 50,17±12,87 mm (by January), 30-70 mm and 50,5±12,5 mm (by February), 30-70 mm and 50,2±11,4 mm (by March), 40-67 mm and 52,36±7,6 mm (by September), 36-63 mm and 50±7,6 mm (by October) and 47-63 mm and 55±5,34 mm (by November) (Figure 3)

The spatial density T. gratilla from sea side to break water area is shown at Fig. 4a. The figure indicated that the highest density was at sea side area and the lowest was at seaweed farming area. The density (individual/ m2

) was 0.057 (at sea side), 0.002 (seaweed farming area) and 0,0.17 (break water). The scatered dispersion from sea side to break water area depicted the spatial density among sites (Figure 4b)

Shell diameter (mm)


PROCEEDING 2017 57

Spatial variation of T. gratilla shell diameter showed that all shell size can be found at all sampling site. The data showed that less individual with diamater less that 30 mm , were found at the sampling site (Figure5).

DISCUSSIONS

The development of seaweed farming by local farmer was initiated by 2005. The BTID management allows the farmer to use the area until the period when the management will use the area. The farmer clear cut the seagrass plant at mid zone, the area is still inundated during low tide period. The farmer also remove dead corral from the site because the farmer applied bottom line method. Such seaweed farming development some extent exacerbates seagrass plant communities.

The percent coverage found at the study site showed lower than to those reported by Linawati (2005). Even, such percent cover is lower to those at Sanur water (Yusup and As’ary, 2010). Formerly, the site was one of the virtuous seagrass bed at surrounding Denpasar water. This study found unclear trend between shell diameter and sampling period, therefore the finding could not determine the spawning periode. Nevertheless, this study found lesser large individual (shell diameter > 60 mm) at the period of September up to November than those found


PROCEEDING 2017 58

from January up to March. It could be due to that such shell size was massively harvested.

The spatial analisis onto T. Gratilla density showed spatial variation within research areas (Fig 4a). Such spatial variation fix to the spatial percent cover of seagrass, the highest was at the sea side area at which percent cover is high and the lowest was at farming area having low percen cover of sea grass. This finding showed linier corelation between sea grass percent cover and sea urchin density. Such negative correlation indicated that low density at sea weed farming is likely due to removal of sea grass from the area leading to loss of feeding source and feeding groundn.

The other part of this study found four species are in gut content (i.e. Cymodocea rotundata, Enhalus aocroides, Thalassia hemprichii and Syringodium

isoetifolium). The other factor leading to such negative corelation is the increase of predatory risk and unsuitable environmental factor such water temperature. It is unlikely that such finding is related to the harvesting activities of T gratilla conducted by local fishermen. The local people only catch individual having mature egg or mature gonad aproximatelly above 40 mm in shell diameter.

The finding of spatial shell distribution (Figure 5) showed lack of individual < 40 mm in diameter found at farming area. This fix to the other finding of this study that individual (shell diamter > 40 mm) does not have mature gonad. On the other words that it supposed that individual < 40 mm in diameter found in the farming area because it is not the targeted individual of local fishermen. The fifinding of this study strengtenth again strengtenth the evidence that seagrass is very important for inhabitant animals. To some extent this study relevant to the result of Mamboya et al. (2009) reported that the sea urchin density was found at area having densely seagrass percent cover.

CONCLUSIONS

The results of this study can be concluded that anthropogenic activity (development of sea weed farming at seagrass beds area) to some extent had a significant impact on to the population of T. gratilla at Serangan Iland Bali.

REFERENCES

Allen, G.R., and S, Roger. 2000. Marine Life of Indonesia and The Indo-Pacific. Periplus Edition (Hk) Ltd. Singapore. p. 57-58.

Attrill, Martin . J.; J.A. Strong and A.A. Rowden. 2000. Are macroinvertebrate communities influenced by seagrass structural complexity?. Ecograph. 23 : 114-123.

Bachtiar, I. Dkk. 2000. Populasi Dua Jenis Bulu Babi Salmacis belli (Doderlein 1902) dan Tripneustes gratilla (Linnaeus 1758) (Echinoidea) Di Padang Lamun Gili Maringke, Lombok Timur.Jurusan FMIPA, FKIP Universitas Mataram.

BAPEDA, PKSPL IPB. 2000. Atlas Sumber Daya Wilayah Pesisir dan Laut Propinsi Bali. Denpasar, Indonesia.

Edgar, G.J. 1997. Australia Marine Life. Reed Books. Australia. P. 358-368.


PROCEEDING 2017 59

Hutching, P. A., T. J, Ward., J. H, Waterhouse. and L, Walker. 1993. Infauna of marine sediment and seagrass beds of Upper Spencer Gulf near Port Pirie, South Australia. Transsactions Royal Society of South Australia 117 (1-2):1-4.

Junoy, J. and Vieitez, J.M. 1992. Macrofaunal Abundance Analyses in the Ria de Foz (Lugo, Northwest Spain). Cashier de Biology Marine 33(3):33-345.

Kristianto, P. 2009Beberapa Aspek Ekologi Bulu Babi Jenis Tripneustes Gratilla

Linnaeus, 1758) Di Kawasan Padang Lamun Pantai Serangan, Denpasar-Bali. Skripsi Prodi S1 Biologi FMIPA – UNUD. Unpublished

Laning. 2013. Sebaran Spatial Bulu Babi Di Perairan Sekitar Denpasar. Laporan Kerja Lapangan Prodi S1 Biologi FMIPA UNUD. Unpublished

Linawati, D.S. Yusup dan J. Subagio. 20015. Struktur Komunitas Padang Lamun di Pantai Serangan dan Terora Nusa Dua. Jur. Biologi FMIPA UNUD. Unpubished

Mamboya F.; C. Lugomela; E. Mvungi; M. Hamisi; A.T. Kamukuru and T.J. Lyimo. 2009. Seagrass-sea urchin Interaction in Shallow Littoral Zones of Dar es Salaam, Tanzania. Aquatic Conserv: Mar. Fresh. Ecosyst. 19: S19-S26.

McCloskey and Unswort. 2015. Decrasing seagrass Density egatively influence associated fauna. PeerJ.3:e1053;DOI.10.7717/peerj 1053.

Pratiwi, Y. 2007. Diktat Ekologi Lingkungan. Jurusan Teknik Lingkungan Fakultas Sains Terapan Institut Sains dan Teknologi AKPRIND. Yogyakarta.

Short.F.T, L.J.McKenzie, R.G.Coles, K.P.Vidler.2001.Hand Out Seagrass –Watch Western Pacific Monitoring Methods: Summary Northern Fisheries Centre. Cairns.

Yusup, D.S. dan H. As’ary.2010. Komunitas Tumbuhan Lamun Di kawasan Perairan Sekitar Denpasar.Prosiding Seminar Nasional Biologi: Biodiversitas dan Bioteknologi Sumberdaya Akuatik. Purwokerto, 26 Juni 2010: hlm.26 – 29.


PROCEEDING 2017 60

INVESTIGATION OF HEAVY METAL PLUMBUM (Pb) AND

CADMIUM (Cd) IN THE TISSUES OF CATTLE

MAINTAINED IN LANDFILL, DENPASAR

I Ketut Berata*, Ni Nyoman Werdi Susari, and I Made Kardena

Pathology Laboratory of Veterinary Medicine Faculty, Udayana University P.B. Sudirman Street, Denpasar, Bali, Indonesia

*Corresponding author: [email protected] or [email protected]

Abstract

Many of bali cattle are risen at TPA in Denpasar which is high risk for heavy metal pollutant especially: plumbum (Pb) and cadmium (Cd). This research aim was to identifiy the existence of heavy metal Pb and cd in the tissue organs of bali cattle that risen at TPA Denpasar. As many as 5 bali cattle, 2 to 3 year old, that were risen at TPA since they were born, were used as samples in this study. The samples were sacrisfied and necropsied, then the organs of spleen, lungs, brain, ren, intestine, liver and muscle were collected and tested for the existence of Pb and Cd by atomic absorption spectrophotometry (AAS) method. The results showed that the existence of Pb and Cd in the tissue organs were still under Indonesia national standard of contain of Pb and Cd which were 2.0 ppm and 0.5 ppm respectively. Its concluded that the tissue organs of bali cattle that risen at TPA denpasar are relatively safe to be consumed. However, further research needs to be developed related to the Pb and Cd pollutants in the tissues organs of bali cattle in order to secure of the public health consumption. Keywords: Landfill, Plumbum, Cadmium, AAS, SNI

BACKGROUND

Many cattle are rising at landfills these days. One of the landfills in Bali is Denpasar landfill, which is located in Suwung Village, Denpasar City. Garbage in TPA generally divided into organic and inorganic garbage. The organic garbage can be food or plants that can be eaten by the cattle. While, the inorganic tends to be from house industry or manufacturing products.

Based on the result from communication with the cattle farmers who their cattle are rising at the landfill said that rising cattle at landfills have beneficiary for limited area that the farmers’ have to maintain their cattle. Additionally, it’s relatively easier to manage them, especially in providing feed for the cattle. More over, these farmers tend to have main jobs other than raisig cattle; and having cattle is another investment for them. Therefore, rising cattle at landfill also gives benefits for these farmers. However, the management of Denpasar landfill, state government in Denpasar, said that the existence of cattle at the landfill affects the process of garbage management in there. The cattle in the landfill often bother the garbage trucks when the trucks enter the landfill. Similarly, the cattle also tend to disturb the bulldozers in the landfill, when they try to arrange the garbage. The local government


PROCEEDING 2017 61

have been remained the farmers not to maintain their cattle at the landfill, but the farmers seem not to concern about the announcement.

Garbage at the landfill in Denpasar seems to dominate by the inorganic resulted in manufacturing products, which is getting increased in number. This rubbish contributes toward heavy metals containing in the landfill raised cattle’ body. A result study showed that plumbum (Pb) and cadmium (Cd) were detected in the blood of the cattle that were maintained at landfill (Berata et al, 2015). Heavy metals of Pb and Cd containing in beef are important to be evaluated in order to keep public health safety for consumption. The maximum containing standard for Pb and Cd in carcass in Indonesia have been determined at level 2.0 mg/kg and 0.5 mg/kg respectively. Where as, in internal organs, the level of Pb and Cd should not to be exceeded 2.0 mg/kg. The report on heavy metal containing in the tissue organs of bali cattle has not been reported. In fact, carcasses from the landfill cattle are delivered for public demand in Bali. Positive correlation between level of Pb and level of serum glutamate oxaloacetat transaminase (SGOT) shows that the Pb has been distributed to the whole of the tissue organ of the cattle (Berata et al, 2015). The distribution of the heavy metals, especially Pb and Cd in bali cattle that maintained in landfill are important to evaluate. This study aim is to assess the distribution of the existence of Pb and Cd in the tissue organs of bali cattle that maintained at Denpasar landfill. This report is important for public whenever they choose and buy the beef meat or organs for their consumption. MATERIALS AND METHODS

Research Sample

This research was descriptive observational study using 5 bali cattles. The cattle used had been maintained in Denpasar landfill since they were born. The cattle were chosen randomly before they were sacrifised and necropsied at Darmasaba slaughterhouse. The tissue organs, such as: spleen, liver, kidney, lungs, brain and muscle were collected for the evaluation of the Pb and Cd contamination. Determination level of Heavy Metal Pb and Cd

The tissue samples such as liver, kidney, spleen, small intestine, muscle, and brain were taken and then checked against the content of heavy metals Pb and Cd by using Atomic Absorption Spectrofotometry (AAS) method (Sikiric, et al., 2003). The sample was divided into two parts, 0,5ml for the positive control and 0,5ml to sample. Added 0.25 ml of standard solution of 1mg / l in the sample to create a spiked or positive control. Spiked evaporated on a hot plate at a temperature of 100ºC until dry. Samples and spiked added ashing furnace and cover half the surface. Ashing furnace temperature was raised gradually 100ºC every 30 minutes up to 450ºC and maintained for 18 hours. And spiked samples are removed from the furnace ashing and cool at room temperature. Once cool add 1 ml HNO3 65%, shaken carefully so that all the ash dissolved in acid and then evaporated on a hot plate at a temperature of 100ºC until dry. After drying the samples and spiked put back into the furnace ashing. The temperature is raised gradually 100ºC every 30 minutes up to 450ºC and maintained for 3 hours. After a perfectly formed white ash, and spiked sample was cooled to room temperature. Add 5 ml of HCl 6 M added to


PROCEEDING 2017 62

each sample and spiked shaked carefully so that all the acid insoluble ash. Evaporated on a hot plate at a temperature of 100ºC until dry. Added 10 ml of 0.1 M HNO3 and cooled at room temperature for 1 hour, the solution was transferred into a 50 ml flask polyproylene and added a solution of matrix modifier, align to mark boundaries using 0.1 M HNO3 Pb working standard solution prepared for each a minimum of five concentration points. Working standard solution, samples, and spiked read on spectrophotometer graphite fumace atomic absorption at a wavelength of 288.3 nm for Pb. Identification of heavy metals Cd was done in same way with the identification of Pb.

Data Analysis

Descriptive qualitative method was used to analyze the measurement level of Pb and Cd in ppm. RESULTS

Based on the examination of heavy metal plumbum (Pb) and cadmium (Cd) contamination in several tissues of the cattle grazing on the Denpasar landfill, the results obtained in the form of content and distribution are presented in Table 1. Table 1. Heavy metal of Pb and Cd contamination in the tissue organs of bali cattle

maintained in Denpasar landfill.

Heavy metal

Tissue Cattle 1 Cattle 2 Cattle 3 Cattle 4 Cattle 5 Average±SD

Pb (ppm)

Spleen 1.7650 1,5024 2,0267 1,7640 1,6532 1,7423±0.19 Lung 1.1335 1,0705 1,1966 1,1400 0,9914 1,1064±0.08 Brain 0,5582 1,2450 1,1864 0,9965 1,0034 0,9979±0.27

Kidney 0,5829 1,0504 1,1306 0,9213 0,9012 0,9173±0.21 Intestine 0,4346 1,2024 1,0653 0,9008 0,9007 0,9008±0.29

Liver 0,6918 0,4495 1,1396 0,7570 0,7600 0.7576±0.25 Muscle 0,6818 0,7015 0,6774 0,7120 0,6993 0,6944±0.13

Cd (ppm)

Spleen - - - - - - Lung - - - - - - Brain - - - - - -

Kidney - - - - - - Intestine - - - - - -

Liver - - - - - - Muscle - - - - - -

Description : negative (-) = undetected on limit 0,001mg/kg (UPT Lab Analitik Unud)

In Table 1 it appears the variation levels of heavy metals Pb in the spleen = 1.7423 ± 0:19 ppm; Lung = 1.1064 ± 0:08 ppm; brain = 0.9979 ± 0:27 ppm; kidney = 0.9173 ± 0:21 ppm; Intestinal = 0,90080.29 ppm; liver = 0.75760.25 ppm; Muscle = 0.6944 ± 0:13 ppm. No detectable contamination heavy metal cadmium (Cd) in all the tissues examined cattle.


PROCEEDING 2017 63

DISCUSSIONS

Municipal waste which contains inorganic materials can be risky to contaminate livestock to feed there. While it may seem selective in choosing feed, cattle grazing in the landfill is possible to eat inorganic materials such as plastics (Figure 1) and heavy metals. As a source of meat, the carcass of the cows must be free from contamination of heavy metals in their tissues, so that the health of consumers can be assured. The results of the examination of heavy metal Pb contamination in tissues organs of bali cattle that maintained at Denpasar landfill were varied, even though they were sampled from the same location. There was no contamination of heavy metal cadmium (Cd) observed in the body tissues of the cattle. This result is different with the examination report on heavy metals Pb and Cd contamination in cattle at the abattoir Nigeria which obtained an average yield content of Pb = 4.36 ± 0.79 and 1.48 ± 0.28 Cd = (Ekenma, et al, 2014 ). In dairy cattle in Egypt reported to contain heavy metals Pb and Cd were 4.404 ppm and 0.288 ppm respectively (Malhat, et al, 2012). Research on heavy metal contamination of Pb and Cd should continue to be done, because it seems Pb and Cd can also be derived from natural plants which are eaten by animals (Abdulkhaliq, et al 2012) The variation of Pb heavy metal contamination in the tissue organs is associated with the individual cattle selectivity in choosing feed and characteristics of tissue organs in binding the heavy metal Pb. Variations of heavy metals Pb and Cd in cattle is strongly influenced by breeds of cattle (Pilarczyk, et al, 2013). Alina et al (2012) have studied heavy metal contamination in fish in Selat Malaka, states that fish have varying selectivity in choosing their food, so that the levels of heavy metals in the body also varies. While Jie et al (2009) reported that the period of a Pb heavy metal accumulation in fish tissues in sequence occurs in the liver, kidney, gills and muscle. This seems to be good, because the consumption of fish muscle is likely take longer period to be contaminated by the Pb as the people tend to consump that part of the fish. In contrast, organs of cattle tend to consume by people such as liver, spleen, kidneys and brain. From the order of the average Pb contamination in the tissue organs of the cattle, the highest contamination was spleen, then followed by he lungs, brain, kidneys, intestines, liver and the lowest was in muscle. Spleen is an organ of the body's defenses as well as haemopoietic organs (blood-forming). In addition, liver is also the haemopoietic organs and important for detoxification of the body. In association with heavy metals Pb with Fe substitution in the hemoglobin, then the hemopietic tissue organ is the most efect by the heavy metal contamination. This is consistent with those reported by Apostoli et al (1988). Pb heavy metal contamination on the tissue organs in the cattle grazing in Denpasar landfill was still below the threshold of the provisions of ISO-2009 which is Pb maximum 2.0 ppm and Cd maximum 0.5 ppm. However, the heavy metals Pb in the body of animals and humans can be cumulative or chronic, so consuming food containing heavy metals Pb at low levels in the long term can accumulate into levels which may endanger animal or human health. The exceed level of the threshold may cause anemia and central nervous disorders in humans (Toscano and Guilarte, 2005), or liver damage (Jovanovic, et al, 2013). Therefore, consumers are hoped to be considered in choosing organs or beef to be consumped.


PROCEEDING 2017 64

CONCLUSIONS

The level of heavy metals Pb samples in 5 cattles that were maintained at the Denpasar landfill obtained the highest contamination is in spleen = 1.7423 ± 0:19 ppm and the lowest is in the muscles = 0.6944 ± 0:13 ppm. The average level of the contamination in tissue organs is still below the threshold provisions SNI = 2.0 ppm, so it is relatively still safe for consumption.

ACKNOWLEDGEMENT

Thanks to Directorate of Research and Public Service Ministry of Research, technology and High Education for the supporting fund in this research. REFERENCES

Abdulkhaliq A,Swaileh KM, Hussein RM. and Matani M. 2012. Levels of metals (Cd, Pb, Cu and Fe) in cow’s milk, dairy products and hen’s eggs from the West Bank, Palestine. International Food Res J 19 (3): 1089-1094

Alina M, Azrina A, Yunus, MAS, Zakiuddin MS, Effendi, MIH. And Rizal MR.2012. Heavy metals (mercury, arsenic, cadmium, plumbum) in selected marine fish and shellfish along the Straits of Malacca. International Food Res. J 19(1): 135-140 Apostoli P, Romeo L, De Matteis MC, Menegazzi, M, Faggionato G, Vettore L. 1988. Effects of lead on red blood cell membrane proteins. International Archieves of Occupational and Environmental Health. 61(1): 71-75 Badan Standardisasi Nasional (BSN). 2009. Standar Nasional Indonesia (SNI) 7387-2009 tentang Batas Maksimum Cemaran Logam Berat dalam Pangan. 1-25

Berata, IK., Ni Nyoman Werdi Susari, NNW., Kardena, IM. 2015. Deteksi Logam Berat Pb dan Cd, dan Hubungannya dengan SGPT/SGOT darah Sapi Bali yang Dipelihara di TPA Suwung Kota Denpasar. Prosiding ISBN 9786022940913.Seminar Nasional Sains dan Teknologi II 2015. Kuta 29-30 Oktober 2015. 1214-1218

Cave, M., Appana, S., Patel, M., Falkner, K.C., McClain, C.J., and Brock, G. 2010. Polychlorinated biphenyls, lead, and mercury are associated with liver disease in American adults: NHANES 2003–2004. Environmental Health Perspectives 118(12):1735–1742. Ekenma K, Anelon NJ, Ottah AA.2014. Determination of the Presence and Concentration of Heavy Metal in Cattle Hides Singed in Nsukka Abbatoir. J.of Vet.Med. and Anim.Health Vol7(1): 9-17


PROCEEDING 2017 65

Jie, HAN, Ren-ji, XU, Ying-qin, HE, Jian-hong, LI. 2009. Study on Accumulation Characteristics of Plumbum in Crucian Carp Carassius auratus. J. Hydroecology 2009 01 Malhat F, Hagag M, Saber A, and Fayz AE. 2012. Contamination of cows milk by heavy metal in Egypt. Bull Environ Contam Toxicol. 88(4):611-613 Jovanovic, B., Mihaljev, Z., Maletin, S. and Palic, D. 2013. Assessment of heavy metal loadin chub liver (Cyprinidae-Leuciscus cephalus) from the Nišava River (Serbia).Biologica Nyssana 2(1) 51-58 Pilarczyk R, Wójcik J, Czerniak P, Sablik P, Pilarczyk B, Tomza-Marciniak A. 2013. Concentrations of toxic heavy metals and trace elements in raw milk of Simmental and Holstein-Friesian cows from organic farm. Environ Monit Assess (2013) 185:8383–8392 Sikiric M. Brajenovic N. Pavlovic I. Havranek JL. Plavljanic, N. 2003. Determination of metals in cow's milk by flame atomic absorption spectrophotometry. Czech J.Anim. Sci. 48(11): 481–486. Toscano CD, and Guilarte TR. 2005. Lead neurotoxicity: from exposure to molecular effects. Brain Res Rev. 49(3):529-554


PROCEEDING 2017 66

EFFECTS OF SOAKING LAMTORO LEAF MEAL (Leucaena

leucocephala) ON FEED INTAKE AND SEMINIFEROUS

TUBULE DIAMETER OF MALE RAT (Rattus norvegicus)

A.A. Istri Mas Padmiswari 1*, Ngurah Intan Wiratmini 2, I Wayan Kasa2

1 Master Program of Biological Science, Udayana University

2 Biology Departement, Faculty of Mathematic and Natural Science, Udayana University, Bali Indonesis


Abstract

Lamtoro (Leucaena leucocephala) is one of the plant species who has high protein contents ranging from 25 to 35%. However, restricted use is considered due to a mimosine antinutrition factor. The mimosine can be reduced by several methods, one of them is by soaking in pure water. This research aim to determine the effect of soaked lamtoro leaf meal on feed intake and seminiferous tubule diameter of male rat. The experimental design used within study was a Completely Randomized Design (CRD) with four groups and each group consisted of eight male rat. The animal was fed pelleted soaked lamtoro leaf meal (SLLM) mixed with pig commercial feed. The control treatment (T1) was feeding group of commercial feed, the first treatment (T2) 92.5% commercial feed+7.5% SLLM, the second treatment (T3) 85% commercial fedd+15% SLLM and the third treatment (T4) 77.5% commercial feed+22.5% SLLM. Treatmens was applied everyday for 30 days. Data were statisticaly anallyzed using SPSS. The result showed that a significant decrease on feed intake in group T3 and T4 in comparison to T1 and T2. Whereas the diameter of seminiferous tubules analysis results showed no significantly difference between control and treatment. that substitution amount of soaking lamtoro leaf meal on diet until 22.5% is not significantly reduce size of seminiferous tubule diameter of male rat, however, at the rate of 15% and 22.5% decreased feed intake drastically. Keywords : lamtoro, soaked, feed intake, seminiferous tubule, rat

BACKGROUND

Generally animals can not stay along without any good food. To achieve high productity animal require both quality and quantity of food due to food play an important role in daily life fulfillment, pregnancy, lactation as well as reproduction to produce egg, meat and milk, therefore, overall for better healty body condition. Feedstuff usually be offered to animal are green forage and concentrate (Kanisius, 1983). High protein content of lamtoro leaf, good palatability, fast growing tree, easy to grow and fertile tropical tree make lamtoro as one of best feedstuff for animal (Widodo, 2005). According to Suprayitno (1981), feed intake and palatability of lamtoro dried leaf not affect feed consumption particularly when homogenous mixture is carried out to concentrate, thus such texture is similarly the same. As nutritious stuff, restrictive amount need to be considered since its antinutritious biological compound of mimosine content. Chemical formula of the mimosine is β-


PROCEEDING 2017 67

N-(3-hydroxypyridone-4)-α-amino-propenoic acid, under group of aromatic amino acid and toxic for animals (Brewbaker and Hylin, 1965).

Monogastric animal is affected intolerant to lamtoro leaf flour, when more than 10 % are applied in nutrition content (Rai et al., 1992). Research revealed that using 5 g/kg body weight of mimosine will cause irregular oestrous cycle in rat, meanwhile, higher dosage of 10 g/kg cause totally stop of oestrous cycle accident (D’Mello et al., 1991). Many researches have also been conducted to minimize the negative effect of mimosine on animal nutrition. For examples, soaking of lamtoro leaf in water for 12 hours could decrease 73% mimosine content (Wiratmini et al., 2014). However, research on effect of soaking lamtoro leaf to feed intake and seminiferous tubule diameter in male rat has not been conducted yet. Therefore, this experiment was designed on such interesting-important issue.


Lamtoro leaf used in this experiment is originated from Benoa village, district of Denpasar Bali. Separated lamtoro leaf were then soaked in water for 12 hours period prior to grinding process. Moreover, the leaf were dried naturally until constant weight was achieved. Futher step would be, the leaf was ground by using hummer meal in order to get good quality fine flour Wiratmini (2014). In addition, the flour would in turn to be mixed with commercial pig ration (CP 551) by employing standart experimental mixer. Experiment comprises of 4 treatments of 100% commercial feed ration without lamtoro meal as control (T1), 92,5% commercial feed + 7,5% lamtoro meal (T2), 85% commercial feed + 15% lamtoro meal (T3), and 77,5% commercial feed + 22,5% lamtoro meal (T4). Ultimately, pelleting procedure and oven drying under 600 C room temperature for 12 hours period (Wiratmini et al., 2014). This experiment employed 32 male rats devided into 4 groups each of 8 animals. Each rat was fed 20 gram/day soaked lamtoro leaf for 30 days. Daily feed intake was calculated by subtracting total feed given by end rest of the feed. At day 31st experimental aninal were killed applying general anesthesia standard procedure, it would then the right testes was taken out. Next step of the work was the paraffin method histologigal preparation using 10% buffer formaline and bouin as a fixative solution. Hematoxylin Ehrlich-Eosin colouring system was last step of all scientific work (Luna, 1968). Seminiferous tubule diameter was measured by operating scientific standard electrical microscope under 400x magnification with 5 different view field. Round shape of siminiferous tubule diameter was chosen by drawing a straight line between those two opposite different point of basal membrane (Adriani, 2012). Quantitative data analising was carried out by operating statistical computer programme (SPSS 22.0 for Windows). One way Anova statistical package was then used to investigate treatment effect of the experiment result. While significant effect of the result was found, next procedure was continued using Duncan Multiple Range Test (P < 0.05).

RESULTS

Data on the effect of soaking lamtoro meal on feed intake and siminiferous tubule diameter are presented in Table 1 and Figure 1. Decreased significant result


PROCEEDING 2017 68

on feed intake clearly showed in group T3 and T4 in comparison to T1 and T2 (P<0.05), meanwhile, no significantly different was found between T1 and T2 (P>0.05). Additionly, increase size on seminiferous tubule diameter could be seen on groups T2 and T3 compare to control treatment of T1. However, there was a decrease result was investigated on treatment T4, eventhough no significantly different were noted between treatment T1 and the rest of those three of treatment T2, T3 and T4 (P> 0.05).

Table 1.Mean ± SD of feed intake and seminiferous tubule diameter on male rat treated with soaking lamtoro leaf meal.

Note: Figures within the same line with dissimilar superscript is significantly different (P < 0.05); T1 = control treatment of 100% commercial feed without soaking lamtoro leaf meal, T2 = 92.5% commercial feed + 7.5% with soaking lamtoro leaf meal,

T3 = 85% commercial feed + 15% with soaking lamtoro meal, T4 = 77.5% commercial feed + 22.5% with soaking lamtoro meal

Figure 1. Histological preparation of seminiferous tubule diameter of male rat treated

with soaking lamtoro leaf meal (400x)

Parameters Treatments T1 T2 T3 T4

Feed Intake 18.35 ± 0.51a 17.74 ± 0,61a 16.65 ± 0.58b 16.62 ± 0.86b Seminiferous tubule diameter

275.20 ± 8.94a 279.31 ± 5.58a 281.55 ± 8.08a 273.4 ± 11.01a

T1 T2

T3T4


PROCEEDING 2017 69

DISCUSSIONS

Feed Intake

Result showed no significant different statistically between control T1 and T2 treatment on feed intake. However, significantly different revealed on T2 and T3 treatments (P<0,05). Such the fact could probably be due to the additional used of soaking lamtoro leaf meal of 15 and 22.5% would decrease feed intake on male rat. therefore, there was no significantly effect found in seminiferous tubule diameter. The fact is in general agreement with NRC (1995) who stated that, requirement standart of feed intake for white male rat of sprague dawley strain during growth and reproductive periods is 15 to 20 gram/day. Similar result showed, increase amount of lamtoro leaf meal in ration will cause decrease feed intake in animal (Mustofa, et al., 2015). Another reason could also be due to less palatability of feed when increase soaked lamtoro leaf meal applied on male rat diet (Siregar, 1994), since palatability is close related with taste and odour of feed diet, thus, affect food intake itself. Subsequently, according to Widodo (2010) that decreased feed intake would also be caused by tannin content of lamtoro leaf meal as a result of astringent taste. Nitrgen retention of tannin is also one reason cause lower digestibility of amino acid, therefore, decrease protein absorption in diet. Similar pattern of the result was also reported by Wiratmini (2014), that high protein content on lomtoro meal diet tent to decreased feed intake, because crude protein has fulfilled standard basic requirement of rat. This phenomenon was clearly supported on other investigation that both crude protein and energy percentage of diet will affect total amount of feed intake (Rasyaf (1994). More in depth Wiratmini (2014) stated, palatability, high crude protein and high crude fibre contents in diet are all factors affecting reduction of feed intake. Based on experiment conducted by Ferket and Gernat (2006), such the fact has been due to overall nutrition composition and feed formulation, and if requirement standard in diet has been fulfilled, the animal will then totally stop consuming the feed. Moreover, the crude fibre needed by monogastric animal such as rat is 5% (Smith and Mangkoewidjojo, 1988), meanwhile, the figures varied from 5.14 to 6.73% when diet contain lamtoro leaf meal (Wiratmini et al., 2014). Dropped feed intake could also because of fully digestive tract when animal consume high amount of crude fibre in ration (Zuprial dan Kanal, 2005).

Seminiferous tubule diameter

Particular result on the effect of soaking lamtoro leaf meal in male rat clearly showed, non significantly different (P>0.05) of seminiferous tubule diameter among treatments, eventhough on the highest percentage of 22.5 of treatment. In addition, laboratory analysis Wiratmini et al. (2014) revealed, that memosine content in various diet contain 7.5%, 15% and 22.5% lamtoro leaf diet were 0.21%, 0.43% and 0.64% respectively, whichis less than 1%.

Data on histology of seminiferous tubule diameter is presented in Figure 1. From the Figure it could be evaluated, spermatogenic cell condition in each stage of the effect of all four treatments of T1, T2, T3 and T4 diet. Spermatogenic cells in seminiferous tubule spreaded from four to eight layers which occupy cavity between basal lamina and lumen of seminiferous tubule. Increase numbers of spermatogenic cell will be followed by bigger size of seminiferous tubule diameter. Spermatogenic


PROCEEDING 2017 70

cell comprises of spermatogonia, primary and scundary spermatocytes, and spermatids (Junqueira et al., 1995). Conversely, Rahman (1998) reported that diet with untreated lamtoro leaf in rabbit caused degeneration subsequency on seminiferous tubule as a result of no spermatogenic cell present in tubule. Experiment conducted by Holmes et al. (1981) clearly showed, that momosin-lamtoro leaf meal diet caused swelling effect on anterior pituitary gland. Such situation will then drop down LH hormone production who discharge the testosterone hormone any way. As it does realize, that slowing down the LH hormone secretion in anterior pituitary gland will in turn cause restriction of seminiferous tubule diameter itself (Cholifah et al., 2014).

CONCLUSIONS

Overall, it could be summarized, that substitution amount of soaking lamtoro leaf meal on diet until 22.5% is not significantly reduce size of seminiferous tubule diameter of male rat, however, at the rate of 15% and 22.5% decreased feed intake drastically.

REFERENCES

Adriani, S. 2012. “Pengaruh Pemberian Pakan Dengan Tambahan Bekatul terhadap Spermatogenesis Mencit (Mus musculus L.) Galur Swiss Webster” (skripsi). Bandung: Universitas Pendidikan Indonesia. Brewbaker, L.L. and J.W. Hylin. 1965. Variation in Mimosin Contain Among Leucaena Spesies and Related Mimmosaceae. Corp Sci. 348-349. Cholifah, S., Arsyad., and Salni. 2014. Pengaruh Pemberian Ekstrak Pare (Momordica charantia L.) Terhadap Struktur Histologi Testis dan Epididimis Tikus Jantan (Rattus norvegicus). Media Litbang Kesehatan. 46(2). D’Mello, J.P.F., C.M. Duffus, and J.H. Duffus. 1991. Toxic Substance in Crop Plant. The Royal Society of Chemisty, Edinburgh. 21-48. Ferket, P.R. and A.G. Gernat. 2006. Factors that afect feed intake of meat birds. Int.J. Poult. Sci. 5:905-911. Holmes, J.H.G., J.D. Humphrey, E.A.Walton, and J.D. Oshea. 1981. Cataracts, Goitre, and Fertility in Cattle Grazed on an Exclusive Diet of Leucaena Leucocephala. Australian Veterinary Journal. 57: 257-261. Junqueira, L.C., J. Carneiro and R.O. Kelley. 1995. Basic Histology. Appleton and Lange Stanford. Kanisius, A.A. 1983. Hijauan Makanan Ternak Potong, Kerja dan Perah. Erlangga. Yogyakarta.


PROCEEDING 2017 71

Luna, G.l. 1968. Manual of Histologic staining Methods of the Armed Force Institute

of Pathology Third Edition. New York ; Mc Graw Hill Book Company. Mustofa, A.R, E. Sudjarwo, and A.A. Hamiyanti. 2015. Pengaruh Penambahan Tepung Daun Lamtoro (Leucaena leucocephala) Pada Pakan Terhadap PenampilanPertumbuhan Puyuh (Coturnix coturnix japonica). Available: http://fapet.ub.ac.id/wpcontent/uploads/2015/04/pengaruh-penambahan-tepung-daun-lamtoro-leucaena-leucocephala-padapakan-terhadap penampilan-pertumbuhan-puyuh-Coturnix-coturnix-japonica.pdf. National Research Council. 1995. Nutrient Requirements of Laboratory Animals. Fourth Revised Edition. National Academic Press. Washington, D.C. Rahman M.H. 1989. Pathological effects of feeding Leucaena leucocephala to rats, Leuc. Res. Repts. (9) 33–34. Rai, A.K., N.D. Khanna, and S.P. Agarwal. 1992. Effect of feeding Leucaena leucocephala with Phaseolus aconitifolius on growth and thyroid status of camel calves. Indian Journal Anim. Sci. 62: 297-301. Rasyaf, M. 1994. Beternak Ayam Pedaging. Cetakan VIII. Penebar Swadaya. Jakarta. Siregar, B. 1994. Ransum Ternak Ruminansia. Penebar Swadaya. Jakarta. Smith, J.B. dan S. Mangkoewidjojo. 1988. Pemeliharaan, Pembiakan dan Penggunaan Hewan-Hewan Percobaan Di Daerah Tropis. Universitas Indonesia. Jakarta. Suprayitno. 1981. Lamtoro Gung dan Manfaatnya. Bhratara. Jakarta. Widodo, W. 2005. Tanaman Beracun dalam Kehidupan Ternak. UMM Press. Malang. Widodo, W. 2010. Dasar Ilmu Nutrisi. Available: https://docs.google.com/viewer.wahyuwidodo.staff.umm.ac.id. (Opened: 23 March 2016) Wiratmini, N.I. 2014. “Penampilan Reproduksi, Proliferasi dan Aktivitas Sel Sekretori Kelenjar Mammae Tikus Putih yang Diberi Daun Lamtoro (Leucaena

leucocephala) Hasil Perendaman” (disertasi). Denpasar: Universitas Udayana. Wiratmini, N.I., Oka, I.G.L., Putra, S., and Mahardika, I.G. 2014. The Effect of Detoxificated Leucaena leucocephala Leaf Meal to Prenatal Development of Wistar Rat Fetus. Int. J. Pure App. Biosci. 2 (6): 223-227. Zuprial and M. Kamal, 2005. Nutrisi dan Pakan Unggas. Jurusan Nutrisi dan Makanan Ternak. Fakultas Peternakan. Universitas Gadjah Mada.


PROCEEDING 2017 72

BROOD SIZE VARIATIONS OF Trigona laeviceps

IN TROPICAL AREAS

Ni Luh Watiniasih* and Ni Made Suartini

Department of Biology, Faculty of Mathematic and Basic Sciences, Udayana University, Bali, Indonesia


Abstract

Insects is well known and commonly spread all over the world, except in Arctic and Antarctic regions, with very high diversity. The most divers of it were found in tropical region, such as Indonesian archipelago. They vary either in terms of their species or individual within a colony. Trigona laeviceps is an insect, known as stingless bee that lives in a social colony. In a colony, it contains a queen, 1 or 2 young queens, adult males and females, and the broods. In Bali, from preliminary study found that they live from low land area up to 800m above sea level. This study proposed to investigate the variation of brood sizes from colonies collected from various altitudes. Colonies were collected form places with low (up to 500m asl.) and high (more than 500m asl.) altitudes. Brood size form larvae to late pupae from colonies collected from different altitudes were varied in size.

Keywords: Trigona laeviceps, brood size, altitude, social insect.

BACKGROUND

Bee (Hymenotera: Apidae) has been known worldwide as pollinator and honey productions, particularly the honey bee. Other bee, such as, stingless known to have no sting as their defense, have an important role as pollinators. Stingless bees are a large and diverse taxon comprising some 60 genera, many of which are poorly known (Rasmussen and Cameron, 2009). They found in abundance in warm humid forests around the globe. They are indispensable pollinators within tropical ecosystems (Roubik, 1989), and vary widely in both individual and colony size (Rasmussen and Cameron, 2010).

The nests of stingless bees are established in cavities where the bees build solid batumen plates to protect the colony, that Nests are constructed using wax in a mixture with resins, mud, feces, or other materials collected by the bees. The nest entrance provides access into the nest where the brood is located.Involucrum sheath, made of cerumen that are a mixture of wax with resins, may be built as a protective layer or sheath around the brood chamber (brood involucrum) or around the whole colony (external involucrum), including the storage vessels for honey and pollen (Rasmussen and Cameron, 2008).

The pollen deposition by the brood area and labyrinth (the nonbrood or food area within the scutellar covering of the nest) are in composite pattern. Nest content and architecture of the stingless bee have been studied (Rasmussen C and S.


PROCEEDING 2017 73

Cameron. 2008, Chinh et al., 2005, Wille, 1983), but there was no studied has been conducted particularlay investigating the brood size variation of stingless bee in tropical areas at different altitude.


Colonies of T. laeviceps were collected from three different places at different altitudes, those are Taro (±800m asl (above sea levels.), Petang (±600m asl.) and Mengwi (± 400m asl.). Nests were harvested before dark to ensure all colony member have been return from foraging. Nests were brought to the Laboratorium of Animal Structure and Development. Department of Biology, Faculty of Mathematics and Basic Science, Udayana University. Nests were opened and observed then the brood were harvested for further examination. Thirty individual of larvae and pupae were examined for each variable measured.


There are variation of brood cells and brood size of T. laeviceps live at different altitudes. The length of cocoon or cell of pupa were differ among sites with the longest cocoon were found at the colony in Mengwi and the shortest was at Taro (df=2 F = 5.949, p <= 0.003), but there was no differences in coccon width (df = 2, F = 1.179, p = 0.311) (Figure 1.). This differences may affected by the difference of altitude in that the individual in lower area, with warmer temperature developed faster than in colder area.

Figure 1. The cocoon of pupal length and weight of Trigona laeviceps collected from three sites at different altitude (Mengwi: ± 400m asl; Petang: ±600m asl,

and Taro: ±800m asl.


PROCEEDING 2017 74

Figure 2. The body length, abdomen length and the thorax witdh of Trigona

laeviceps larvae collected from three sites at different altitude (Mengwi: ± 400m asl; Petang: ±600m asl, and Taro: ±800m asl.

The development of brood were also differ among colonies from different

altitudes. The body length of brood were longer at warmer sites (Mengwi and Petang) compared to colder site (Taro) (df = 2, F = 14.176, p < 0.0001). The same pattern were also observed for the abdomen length (df = 2, F = 28.791, p < 0.0001). However, the brood thorax were developed at similar rate (df = 2, F =0.597, p =0.552), which may indicating that the brood size will have similar body width along their development (Figure 2).

Along the brood development, the weight of pupae were also differ among sites (df = 2, F = 120.551, p < 0.0001). The heavier pupae were found at the colony collected from Petang at 600 m asl (0.007 Mg ± 0.0001)., but lower at the other two sites (Figure 3).

Figure 3. The weight of yunger and older pupae of Trigona laeviceps larvae collected from three sites at different altitude (Mengwi: ± 400m asl; Petang: ±600m

asl, Taro: ±800m asl}.


PROCEEDING 2017 75

Species of insect has different temperature ambient for their development, therefore which can only develop over a limited range of temperatures (Dixon et

al.,2009). In addition, they found that the relationship between the minimum and maximum developmental rates affected species phylogeny. This may help identify the effect of seasonal and different temperature gradient of the physiological of insects. Other factors, such different food resources among sites may also play important role in brood development.

CONCLUSIONS

Trigona laeviceps brood development was differed between altitudes, that in lower altitude that has warmer temperature develop higher than that of colder temperature in higher altitude.

ACKNOWLEDGEMENT

This research was funded by The Directorate of High Education, Republic of Indonesia under the research scheme No. 468/UN14.2/PNL.01.03.00/2016, 16 Mei 2016.

REFERENCES

Chinh T X, M J Sommeijer. W J Boot, and C D Michener. 2005. Nest and Colony Character istics of Three Stingless Bee Species in Vietnam with the First Descrip tion of the Nest of Lisotrigona carpenteri (Hymenoptera: Apidae: Meliponini). Journal of The Kansas Entomological Society 78(4): 363–372

Dixon A F G, A Honek, P Keil, M Ali, A. Kotela, A L. Sizling and V Jarosík. 2009. Relationship between the minimum and maximum temperature thresholds for development in insects. Functional Ecology 23: 257-264.

Rasmussen C and S Cameron. 2008. A molecular phylogeny and the evoluti on of nest architecture and behavior in Trigona s.s. (Hymenoptera: Apidae: Meliponini).Apidologie 39:102–118

Rasmussen C and S Cameron. 2010. Global stingless bee phylogeny supports ancient

divergence, vicariance, and long distance dispersal. Biological Journal of the

Linnean Society 99:206–232.

Wille A. 1983. Biology of the stingless bees. Annual Review of Entomology 28:41–64.


PROCEEDING 2017 76

Zn AND Fe MICRONUTRIENTS CONTENT IN RICE

CULTIVAR GROWN AT JATILUWIH VILLAGE, TABANAN

REGENCY, BALI

Made Ria Defiani* and Ida Ayu Astarini

Biology Department, Math and Basic Sciences Faculty, Udayana University, Bali-Indonesia


Abstract

Rice as one of staple food in Indonesia has lots of cultivars. Each province has it’s own local cultivars. The study aimed to investigate the content of Zn and Fe micronutrient in some cultivars that have been grown at Jatiluwih Village as central of local rice production at Tabanan Regency. Micronutrient Zn and Fe are required for human metabolism especially for enzyme catalyst. Samples of rice cultivars (‘Beras Merah’, ‘Cempaka Putih’, ‘Injin’, ‘Ketan Jaka’, ‘Ketan Tahun’, ‘Ketan Bali Merah’) were collected from farmers at Jatiluwih ricefield. Rice samples were grounded, digested and analysed for Zn and Fe using ICP-E methods. Surprisingly, there were no Zn was detected for all rice samples. Content of Fe from the rice samples was detected and ranged between 0,06 – 0,25 mg.100g-1. Deficiency of Zn and Fe micronutrients in human metabolism for some extend of time may influence human health. Keywords: ICP-E method; deficiency; human health

BACKGROUND

Rice (Oryza sativa L.) as one of staple food in Indonesia has lots of cultivars. Each province has it’s own local cultivars. In Bali, there are some local cultivars that has been cultivated at Jatiluwih Village, Tabanan Regency as central rice production. The cultivars are ‘Beras Merah’, ‘Cempaka Putih’, ‘Injin’, ‘Ketan Jaka’, ‘Ketan Tahun’, ‘Ketan Bali Merah’. Based on colour of the rice grain, ‘Beras Merah’ and ’Ketan Bali Merah’ has red colour on the grain; ‘Cempaka Putih’, ‘Ketan Jaka’ and ‘Ketan Tahun’ has white grain; and ’Injin’ has black grain coloured. In processing for food consumption, rice is grouped as rice for staple food (‘Beras Merah’, ‘Cempaka Putih’) and glutinuous rice for snack or fermented rice or wine (‘Ketan Jaka’, ‘Ketan Tahun’, ‘Ketan Bali Merah’ and ‘Injin’). These kinds of rice cultivars are cultivated in Jatiluwih for two growing seasons without any rotation with other plants such as Leguminoceace to improve soil fertility and to prevent pest and disease damaged. Each growing season required 6 months from planting to harvesting.

Staple food such as rice should provide complete nutrition for human health. So far, rice is source of carbohydrate and vitamin B for some cultivars. Nio (1992) showed that energy from red rice (353 cal) is higher than white rice (349 cal). Protein of red rice (8.2 g) and red rice (6.8 gr) due to thiamine content in red rice (0.31 mg)


PROCEEDING 2017 77

higher than white rice (0.12 mg). USDA (2016) reported the composition of white rice for medium grain (per 100 g) as followed: calorie 360 kcal; protein 6.61 g; Zn 1.16 mg; Fe 4.36 mg. However, rice composition from Jatiluwih not yet published.

Micronutrients such as Zinc (Zn) and Iron (Fe) are also required for human nutrition, especially to support optimum growth and healthy minds. Zn nutrition for human is 15 mg per day. Zn deficiency caused potential risk in human health in many developing areas where staple food contains low micronutrient in the diet (Wang et al., 2011). Micronutrients deficiencies already affect growth of children in developing countries including Indonesia. Symptoms of Zn deficiencies are retard growth and hair loss. Zn as catalizator is required to improve enzyme activation. Fe nutrition for woman is 18.9 mg per day and for man is 8.5 mg per day. Symptom of Fe deficiency is mostly anemia. In order to protect human from micronutrients deficiencies, at least the staple food can provide the nutrient completely and no more other supplement to consume daily. The study aimed to investigate the content of Zn and Fe micronutrient in some cultivars that have been grown at Jatiluwih Village as central of local rice production at Tabanan Regency MATERIALS AND METHODS

Samples of rice cultivars (‘Beras Merah’, ‘Cempaka Putih’, ‘Injin’, ‘Ketan

Jaka’, ‘Ketan Tahun’, ‘Ketan Bali Merah’) were collected from farmers at Jatiluwih ricefield. Rice samples were grounded and digested using HNO3 and H2SO4 and analysed for Zn and Fe concentration using ICP-E 9000.

RESULTS

Zn concentration on rice

Based on Zn analysis using ICP-E, the result showed that there were no Zn was detected for all rice samples. There was no Zn in grain samples showed that Zn could not reach the grain due to some reasons.

Fe concentration on rice

Fe element could be detected using ICP-E. Content of Fe ranged between 0.06 – 0.25 mg.100g-1 (Figure 1). Red rice (‘Beras Merah’) contain the highest Fe content compared to others rice samples. In contrast, glutinuous rice (‘Ketan Jaka’) had the lowest Fe content. These two cultivars does not consume every day for people diet. Jatiluwih family usually consume ‘Cempaka Putih’ cultivars that only contain 0.08 mg.100g-1 of iron.

Figure 1. Fe content in Jatiluwih rice cultivars


PROCEEDING 2017 78

DISCUSSIONS

No Zn on the grain might be caused by cultivar inefficiency of Zn transportation from soil solution to the grain or Zn was not available in the soil solution. Zn transportation from soil and its distribution to other plant organs including wheat grain offered better understanding to achieve the best ways to improve Zn content in the grain (Wang et al., 2011). Solubilization and precipitation of Zn is influenced by pH and micro flora along rooting plant area. Tariq et al. (2007) found that Plant Growth Promoting Rhizobacteria (PGPR) activity assisted Zn absorption from soil solution and Zn mobilization to rice plant.

Concentration of Zn and iron in the xylem and phloem saps were available during growing season, and Zn concentration in the grain was 57 mg.kg-1, and Fe concentration was 29 mg kg-1 ). Zinc was transported from phloem through flag leaf. Iron also stored in the leaves and distributed to the grain using phloem transportation (Yoneyama et al.,2010).

Zinc is vital for healthy growth. Dwarfism, stunted growth and being underweight for their age may occur in children if their diet is deficient in zinc. Deficiency of Zn and Fe micronutrients in human metabolism for some extend of time may influence human health. Deficiency of Zn and Fe micronutrients in human metabolism for some extend of time may influence human health.

CONCLUSIONS

Rice samples from Jatiluwih contain no Zn in the grain. Fe content is very low, between 0.06-0.25 mg.g-1. These amount is very low for human daily intake.

REFERENCES

Tariq, M., S. Hameed, K. A. Malik, and F.Y. Hafeez. 2007. Plant root associated bacteria for zinc mobilization in rice. Pakistan J. Bot. 39(1):245-253. USDA.2016. National nutrient database for standard reference release 28: basic report 20050,Rice, white, medium grain, raw, enriched. https://ndb.nal.usda.gov/ndb/foods/show/6517?manu=&fgcd=&ds= (cited 5 Nov.2016) Wang, Y.X., A. Specht and W. J. Horst. 2011. Stable isotope labelling and zinc distribution in grains studied by laser ablation ICP-MS in an ear culture system reveals zinc transport barriers during grain filling in wheat. New Phytologist 189: 428-437. Yoneyama, T., T. Gosho, M. Kato, S. Goto and H.Hayashi. 2010. Xylem and phloem transport of Cd, Zn and Fe into the grainsof rice plants (Oryza sativa L.) grown in continuously flooded Cd-contaminated soil. Soil Science and Plant Nutrition 56: 445-453.


PROCEEDING 2017 79

DETECTION OF MUNGBEAN YELLOW MOSAIC VIRUS

(MYMV) USING POLYMERASE CHAIN REACTION (PCR) IN

YARD LONG BEAN (Vigna sinensis L.) AND WEEDS

I Putu Sudiarta1*, Trisna Agung Phabiola1, I Gusti Putu Eka Saputra1, I Dewa

Nyoman Nyana1, Gede Suastika2

1Agroecotechnology Department, Faculty of Agriculture, Udayana University

Jl. PB. Sudirman Denpasar 80232 Bali 2Faculty of Agriculture, Bogor Agriculture University (IPB)


Abstract

Detection of virus plant have been conducted long time by morphological

symptom, however need time and not absolutely correct. Base on that the faster and correctly method is needed, one of the fast methods is PCR method using specific DNA primers. The study was conducted to detect Mungbean Yellow Mosaic Virus

(MYMV) in yard long bean and some weeds in Mambal Village, Abiansemal District, Badung Regency, Bali using primers MY1 F (Forward) : (5’- TTACATGGTCCCTCGCAACC -3’) and MY2 R (Reverse): (5’- ACAGCCTTCTCTACCCCGAT -3’). This research was focused on three activities, are: 1) Determining the morphological symptom of Mungbean Yellow Mosaic Virus

(MYMV) disease on yard long bean and weeds; 2) Sampling of plants infected by MYMV; 3) Detection of MYMV in sample plants with polymerase chain reaction (PCR) method. The Research result showed the plant and weeds were predicted infected by MYMV base on the morphological symptom, to reconfirm the plants were actually infected by MYMV the PCR analysis was conducted. Finally after detected by PCR, some plants were positive infected by MYMV. The band of DNA of MYMV was appear with length 238 bp according with specific primers used. Keywords : yard long bean, mungbean yellow mosaic virus, weed, PCR

BACKGROUND

Yard long bean (Vigna sinensis L.) has been cultivated long time ago until now by the farmers in Indonesia. Yard long bean basically was come from India and Africa, and then has been produced around Asia including Indonesaia (Anto, 2013). Yard long bean have different name among the area: kacang lanjaran (Jawa), kacang turus (Pasundan), taukok (Cina), sitao (Philipina), kacang belut (Malaysia), paythenki, yardlong bean and asparagus bean. On the other hand production of yard long bean has been reducing in the last 3 years. In 2011 production of yard long bean is 458.307 ton, in 2012 decrease 455.615 ton, and in 2013 was decreased until 218.948 ton (BPS, 2013). The decreasing production of yard long been is caused by many factors, one of theme is diseases. Viruses is one of serious disease especially Mungbean Yellow Mosaic Virus (MYMV) with specific yellowing symptom. Mungbean Yellow Mosaic Virus (MYMV) make the losing production until 53,87%. Inoculums resources of virus basically come from the infected plants (host plant


PROCEEDING 2017 80

including weeds). In addition weeds are grow around the crop and have negative effect because make competition with the crop (Sastroutomo, 1990; Soerjani et al. 1996). To detect the viruses basically the farmer are using morphological symptom. However the morphological symptom is sometimes incorrectly because the morphological sometimes have similar symptom but different of virus species. MATERIALS AND METHODS

Experimental prosedure

The experiment was conducted in Mamabal Vilage Badung since October until Desember 2014. The first step of research is collecting the sample from morphological symptom. Collecting samples was analysis using Polymerase Chain

Reaction (PCR) in Laboratory of Virology, Department of Plant Protection IPB to detect of the virus. The five leaf of host plant with yellowing symptom were collected for molecular detection using PCR.

DNA extraction and PCR amplification

DNA extraction was conducted using general method CTAB method (Doyle & Doyle, 1990). Around 0.1 g of leaf was prepared using liquid Nitrogen, after dilution 500 μl CTAB Buffer was added (10% Cetyl-trimethyl-ammonium bromide, 0,1 M Tris-HCL pH 8, 0,05 M EDTA, 0,5 M NaCl, 1% β-mercepto-etanol). The product of DNA extraction was using for amplification to detect MYMV. Oligonucleotide primers of MYMV; MY1 F (Forward): (5’-TTACATGGTCCCTCGCAACC-3’) dan MY2 R (Reverse):(5’- ACAGCCTTCTCTACCCCGAT -3’) (Nurulita, 2014) were used in this study. On the other hand for reaction mix and steps of PCR was followed of Rojas Method Rojas et al., (1993). RESULTS

Morphological symptom of yard long bean and weeds

The weeds were identified base on the guide book of Weeds Of Rice In

Indonesia (Soerjani et al., 1987). Base on the morphological symptom the plants (yard long bean and weeds) have the Vein clearing, leaf malformation, and change color of leaf from green to yellow symptom. The symptom indicated the plants have been infected by virus and look like the Mungbean Yellow Mosaic Virus (MYMV) (Table 1 and Figure 1).

Table 1. Morphological symptom of Mungbean Yellow Mosaic Virus (MYMV) of

yard long bean and weeds No Host Plants Symptom

1 Vigna sinensis L. (yard long bean)

Vein clearing and leaf malformation, (Figure 1 B).

2 Ageratum conyzaides (weed) Vein clearing and leaf malformation, Figure 1 C). 3 Ludwigia hyssipofilia (weed) Vein clearing (Figure 1 D).

4 Amaranthus sp. (weed) Change color of leaf from green to yellow (Figure 1 E).

5 Morning glory Ipomea sp. (weed)

Change color of leaf from green to yellow (Figure 1 F)


PROCEEDING 2017 81

The health leaf of yard long bean can compare with the infected crop, show in figure 1 A and B respectively. In addition the clearly symptom of weeds were predicted infected by MYMV of Ageratum conyzoides (vein clearing), Ludwigia

hyssopifolia) (vein clearing), Amaranthus sp. (Change color of leaf from green to yellow), and Morning glory (Ipomea sp.) (Change color of leaf from green to yellow) show in Figure 1, C,D, E, F, respectively. Base on those symptoms the all plants were collected and prepared for DNA extraction for PCR process. The morphological symptom is necessary to use as basic data to molecular detection by PCR method using specific primers.

Figure 1. Morphological symptom of Mungbean Yellow Mosaic Virus (MYMV) of yard long bean and weeds. (A) Health leaf; (B) Virus symptom on yard long bean

(vein clearing); (C) weed Ageratum conyzoides (vein clearing); (D) weed Ludwigia

hyssopifolia (vein clearing ; (E) weed Amaranthus sp. (Change color of leaf from green to yellow); (F) weed Morning glory (Ipomea sp.) (Change color of leaf from

green to yellow).

Amplification of DNA target of Mungbean Yellow Mosaic Virus (MYMV) using

Polymerase Chain Reaction (PCR) method

The all plants sample; health of yard long been, infected yard long bean (vein

clearing), Ageratum conyzoides (vein clearing), Ludwigia hyssopifolia (vein

clearing, Amaranthus sp. (Change color of leaf from green to yellow), and Morning

glory (Ipomea sp.) (Change color of leaf from green to yellow) were prepared for DNA extraction. After DNA extraction and purification the all samples were

A B

D E F

A B C


PROCEEDING 2017 82

238 bp

M 1 2 43 5 6 7

100 bp

500 bp

1000 bp

amplified using the specific primer (Material and method). The result of PCR after running in gel electrophoresis showed the clearly band in some samples, with size 238 base pare (bp). The data indicated the samples were infected by MYMV. The samples are Amaranthus sp., morning glory (Ipomea sp.) and yard long bean, Figure 2, lane 5,6,7 respectively. In other hand sample of Ageratum conyzoides and Ludwigia hyssopifolia was not detected the band in gel electrophoresis, Figure 2, lane 3,4 respectively. The data incicated the weeds were not infected by MYMV.

Figure 2. Visualization of PCR product using specific primer of MYMV. (M) marker DNA 100bp; (1) positive control (MYMV lab. Stock); (2) negative control (buffer); (3) weed (Ageratum conyzoides); (4) weed (Ludwigia hyssopifolia); (5) weed (Amaranthus sp.); (6) weed morning glory (Ipomea sp.); (7) yard long bean.

DISCUSSIONS

The morphological symptom is not 100 % correctly to justify the plant infected by the species of virus. However the molecular detection more correctly to detect of species of virus. The data indicated the similar morphological symptom of weed Ageratum conyzoides, Ludwigia hyssopifolia, Amaranthus sp., and morning glory (Ipomea sp.) is not completely conclude the weeds infected by Mungbean Yellow

Mosaic Virus (MYMV). The phenomena was clearly describe after the all samples were amplified by

PCR, only Amaranthus sp. and morning glory (Ipomea sp.) were infected by MYMV base on band of PCR product. Some researcher reported the phenomena can occur cased by some factors. The 1st factor, possible the same symptom is not the same species of virus, 2nd factor, the specific of primer was not detect the DNA of different strain of same species of virus. Akin, (2006) reported the same symptom in the same plant can performed by deferent of virus. On the other hand the plant tissue also is one of importance factor. (Rojas et al,. 1993).


PROCEEDING 2017 83

CONCLUSIONS

Base on the morphological symptom and molecular detection the yard long bean and weeds (Amaranthus sp. and morning glory (Ipomea sp.) were infected by Mungbean Yellow Mosaic Virus (MYMV).

REFFERENCES

Akin, H. M. 2006. Virology Tumbuhan. Penerbit Kanisius. Jl Cempaka 9, Deresan. Yogyakarta.

Anto, A. 2013. Teknologi Budidaya Kacang Panjang. Penyuluh Pertanian BPTP Kalimantan Tengah Jalan G.Obos KM 5 Palangka Raya.

Badan Pusat Statistik . 2013. Produksi Sayuran dan Buah-Buahan Semusim di Indonesia 1997-2013. http://www.bps.go.id/tab_sub/view.php?kat=3&tabel=1&daftar=1&id_subyek=55&notab=70 diakses tanggal 6 Juli 2014.

Rojas, M. E., R. L. Gilbertson, D. R. Russel and D. P. Maxwell. 1993. Use of the

generate primers in the polymerase chain reaction to detect whitefly- Transmitted

Geminiviruses. Plant Dis 77: 340- 347.

Sastroutomo, S. S. 1990. Ekologi Gulma. Jakarta. PT. Gramedia Pustaka Utama.

Soerjani, M, A. J. G. H. Kostermans and G. Tjitrosoepomo. 1987. Weed of Rice in

Indonesia. Jakarta : Balai Pustaka.

Soerjani, M., M. Soendaru dan C. Anwar. 1996. Present Status of Weed Problems

and Their Control in Indonesia. Biotrop. Special Publication. No.24.


PROCEEDING 2017 84

EXPRESSION OF OsbZIP72 GENE IN BALI LOCAL RICE

UNDER DROUGHT STRESS

Made Pharmawati1*, Ni Nyoman Wirasiti1, IGA Sugi Wahyuni1,

and Luh Putu Wrasiati2

1Biology Department, Faculty of Mathematics and Natural Sciences, Udayana

University, Kampus Bukit Jimbaran, Badung, Bali Indonesia 2Department of Agricultural Industrial Technology, Faculty of Agricultural

Technology, Udayana University, Kampus Bukit Jimbaran, Badung, Bali Indonesia *Corresponding author: [email protected], [email protected]

Abstract

Drought is main environmental factor affects plant growth and development. To respond to drought stress, plants develop mechanism of adaptation through induction or repression of genes. OsbZIP72 gene is one of the drought responsive genes. This study aimed to evaluate expression of OsbZIP72 gene under different levels of drought treatments in bali local rice ‘Mansur’, ‘Putih Cempaka’ and ‘Merah Cendana’. Rice seedlings were grown in hydroponic system and treated for three days with 20% and 30% PEG (polyethylene glycol). RNA was extracted using RNeasy Plant Mini Kit (Qiagen). Synthesized of cDNA was done using Transcriptor First Strand cDNA kit (Roche). Semi quantitative RT-PCR was performed. Results showed that in ‘Putih Cempaka’ and ‘IR64’ the expression of OsbZIP72 decreased at high level of drought stress. There was no alteration of OsbZIP72 expression levels in ‘Mansur’, ‘Salah Bulu’ and ‘Merah Cendana’ due to drought treatments. Polymorphism among OsbZIP72 gene was detected. Keywords: drought, gene expression, OsbZIP72, rice

BACKGROUND

Rice (Oriza sativa L.) is a member of Poaceae Family and is a main food source in the world. Several factors affected rice productivity which are classified as biotic and abiotic factors. One of a biotic factor is drought (Sahoo et al., 2013). The condition of water deficit in plant tissue, will cause disturbance of plant metabolism and will affect plant growth (Lestari, 2005). Drought stress causes major changes in physiological and biochemical processes (Lawlor and Cornic, 2002) and reprograming of gene expression (Romo et al., 2001). There are several cultivars of rice in Bali that need to be tested for drought tolerance. Three of them are ‘Mansur’, ‘Putih Cempaka’ and ‘Merah Cendana’.

Local rice cultivars need to be screened for their characteristics. Evaluation of characteristics that contribute to adaptation to drought is important in rice breeding (Lonbani and Arzani, 2011). Genetics approach can be used to screen local rice cultivars. Certain genes will be induced if plant undergo drought stress. The products of the genes involved in cellular protection to damage by stress (Chen et al.,


PROCEEDING 2017 85

2012). One of gene that positively involved in resistancy to drought is OsbZIP72 (Lu et al, 2009). In drought stress, phytohormone ABA (absicic acid) will accumulated. The increase of ABA causes changes in plant growth and development. The pathway that depends on ABA regulates gene expression through transcription factor bZIP (basic leucine zipper proteins) (Lu et al., 2009). OsbZIP72 is one member of bZIP family (Lu et al., 2009). Transgenic rice that expressed OsbZIP72

showed hypersensitivity to ABA and an increase in resistancy to drought (Lu et al., 2009). This study aimed to analyse expression of OsbZIP72 gene under different levels of drought treatments using PEG in bali local rice ‘Mansur’, ‘Putih Cempaka’ and ‘Merah Cendana’. This study also characterize the OsbZIP72 sequence.


Plant Materials and Treatments

Seeds of rice cultivar rice ‘Mansur’, ‘Putih Cempaka’ and ‘Merah Cendana’ and ‘IR64’ were collected from local farmer in Tabanan, Bali, Indonesia. ‘IR64’ was included for comparison. Seeds were germinated in germination tray using rockwool as medium. One weeks old seedlings were transfer to hydroponic system supplemented with ¼ MS (Murashige and Skoog) medum. At one weeks after transfer, seedlings were treated with PEG (Polyetylenglicol) at 20% and 30%. Seedlings were harvested three days after treatment.

RNA Extraction, cDNA synthesis and Semi-qPCR

RNA was extracted using RNeasy Plant kit (Qiagen) from 0.1g leaf following instruction from manufacturer. RNA concentration was calculated using spectrophotometer at 260 nm and 280 nm. Absorbance of 260 nm = 1 means that the RNA concentration is 40 ug/ul. Synthesis of cDNA was done using Transcriptor First Strand cDNA kit (Roche). Semi Quantitative PCR was conducted with the following program: 1 x initial denaturation at 95°C for 5 min and 40 x of denaturation at 95°C for 1 min, annealing at 60°C for 1 min, and extension at 72oC for 1.5 min. Final elongation was done 1 x at 72oC for 10 min Primer pair used was 5' AATGAGGTAGAAGAAATGAT 3' and 5' GCACAGTCGCTGATGAAGG 3' (Lu et al, 2009).

Sequencing of OsbZIP72

PCR products OsbZIP72 using cDNA as template were sent to sequencing facility (1stBASE). As much as 20ng/ul PCR product and 10pmol/ul primer was used. Sequencing was done one direction using Applied Biosystems 3730xl. cDNA was used as template in PCR reaction. Rice samples were ‘Mansur’, ‘Merah Cendana’, ‘Putih Cempaka’ and ‘Salah Bulu’. The cDNA was synthesized from control seedling. Sequences were then aligned and compared using MEGA 6. Comparison was also done using BLAST (www.ncbi.nlm.nih.gov/BLAST/). RESULTS

Gene expression of OsbZIP72 under drought stress was observed at seeding stage. There was a decrease in expression of OsbZIP72 at ‘Putih Cempaka’, ‘Salah Bulu’ and ‘IR64’ (Figure 1).


PROCEEDING 2017 86

Sequencing of OsbZIP72 gene was done to analysed polymorphism in gene sequence. Sequencing resulted in 68 bp readable DNA. While the length of PCR product of OsbZIP72 using cDNA as detected using agarose gel electrophoresis was 120bp. Allignment of OsbZIP72 sequences from bali rice cultivars ‘Mansur A’, ‘Merah Cendana’, Putih Cempaka’, ‘Salah Bulu’ obtained using cDNA, was shown in Figure 2. There are 2 indels and one base substitution identified among the sequences. BLAST search of each sequence showed 94% similarity with Oryza

sativa Japonica Group bZIP transcription factor TRAB1-like (LOC4347257), mRNA.

Figure 1. Expression of OsbZIP 72 under drought stress in rice. (a) Mansur A, (b) Putih Cempaka, (c) Merah Cendana, (d) Salah Bulu, and (e) IR64. Numbers above

figure are PEG concentration.

.

Figure 2. Sequences of OsbZIP72 obtained from cDNA of bali rice cultivars

‘Mansur A’, ‘Merah Cendana’, Putih Cempaka’, ‘Salah Bulu’

DISCUSSIONS

Transcription factor bZIP, is kwon to act as important regulator for response to stress in plant (Nijhawan et al., 2008). There are more than 100 member of bZIP family in rice (Lu et al., 2009). One of them is OsbZIP72. The expression of OsbZIP72 in bali rice cultivars decreased in ‘Putih Cempaka’ at 30% PEG. The decrease in OsbZIP72 expression was also observed in ‘IR64’. ‘IR64’ is known as rice cultivar that is sensitive to drought (Lenka et al., 2011). The expressions of OsbZIP72 in ‘Salah Bulu’ slightly decreased at 20% and 30% PEG.

Previous study found that the expression of OsbZIP72 was up regulated in the 12 hours treatment of PEG in rice cultivar ‘Nipponbare’ (Lu et al., 2009). Transgenic rice overexpressing OsbZIP72 showed ability of drought adaptation (Lu et al., 2009). Our study found that there is no increase of OsbZIP72 gene expression under drought stress in all cultivars tested. Based on the expression levels, it is predicted that ‘Putih Cempaka’, ‘Merah Cendana’, ‘Salah Bulu’ and ‘IR64’ do not develop drought tolerance.

0 20 30 0 20 30 100bp 0 20 30 0 20 30 0 20 30 100bp

A B C D E


PROCEEDING 2017 87

‘Nipponbare’ is drouht-sensitive rice cultivar (Hoque and Kobata, 1998), similar to ‘IR64’. However, different results were obtained. The level of OsbZIP72

expression in ‘IR64’ does not change at moderate level of PEG (20%), while the expression decrease at high level of PEG (30%). This differences could be because different experiment set up. Lu et al. (2009) evaluate OsbZIP72 after 4 hours and 12 hours after PEG treatment.

Sequencing of OsbZIP72 obtained from cDNA as template resulted in 68bp readable sequence, while fragment size prediction using agarose gel electrophoresis was 120bp. The short sequence of OsbZIP72 could be because the sequencing method used was direct sequencing without cloning. It was reported that the length of bZIP domain is 60 to 80 amino acids (Nijhawan et al., 2008). This is approximately equal to 180 tp 240 bp mRNA sequence.

Polymorphism of OsbZIP72 sequence obtained from cDNA of bali rice cultivars ‘Mansur A’, ‘Merah Cendana’, Putih Cempaka’, ‘Salah Bulu’ cannot show ability to adapt to drought stress. According to Dey at al. (2016), study using OsbZIP23 in rice showed that overexpression of OsbZIP 23 was more important in adaptation to drought stress than polymorphism in coding sequence.

CONCLUSIONS

Expression levels OsbZIP72 gene in bali rice cultivar ‘Mansur’, ‘Salah Bulu’ and ‘Merah Cendana’ did not change due to drought treatments. OsbZIP72 gene expression in cultivar ‘Putih Cempaka’ and ‘IR64’ decrease at high concentration of PEG. Polymorphism among OsbZIP72 gene was detected. ACKNOWLEDGEMENT

The authors thank Ministry of Research Technology and Higher Education for providing research grant for this study.

REFERENCES

Chen, H., W. Chen, J. Zhou, H. He, L. Chen, H. Chen, X. W. Deng. 2012. Basic Leucine Zipper Transcription Factor OsbZIP16 Positively Regulates Drought Resistance in Rice. Plant Science 193: 8-17

Dey, A., M. K. Samanta, S. Gayen, S. K. Sen, M. K. Maiti. 2016. Enhanced Gene Expression Rather than Natural Polymorphism in Coding Sequence of the OsbZIP23 Determines Drought Tolerance and Yield Improvement in Rice Genotypes. PLoS

ONE 11(3): e0150763

Hoque, M. M., T. Kobata. 1998. Growth Responses of Drought Resistant Rice Cultivars to Soil Compaction under Irrigated and Succeeding Non-irrigated Conditions during the Vegetative Stage. Plant Production Science 1: 183-190

Lawlor, D. W., G. Cornic. 2002. Photosynthetic Carbon Assimilation and Associated Metabolism in Relation to Water Deficits in Higher Plants. Plant Cell and

Environment 25: 275-294.


PROCEEDING 2017 88

Lestari, E. G. 2005 Hubungan antara Kerapatan Stomata dengan Ketahanan Kekeringan pada Somaklon Padi Gajahmungkur, Towuti, dan IR 64. Biodiversitas 7: 44-48

Lenka, S. K., A. Katiyar, V. Chinnusamy, K. C. Bansal. 2011. Comparative Analysis of Drought-responsive Transcriptome in Indice Rice Genotypes with Contrasting Drought Tolerance. Plant Biotchnology Journal 9:315-327

Lonbani M, A. Arzani. Morpho-physiological Traits Associated with Terminal Drought Stress Tolerance in Triticale and Wheat. Agronomy Research 9: 315–329

Lu, G., C. Gao, X. Zheng, B. Han. 2009. Identification of OsbZIP72 as a Positive Regulator of ABA Response and Drought Tolerance in Rice. Planta 229:605–615.

Nijhawan, A., M. Jain, A. K. Tyagi, J. P. Khurana. 2008. Genomic Survey and Gene Expression Analysis of the Basic Leucine Zipper Transcription Factor Family in Rice. Plant Physiology 146:333-350

Romo, S. E., B. Labrador, Dopico. 2001. Water Stress-regulated Gene Expression in

Cicer arietinum Seedlings and Plants. Plant Physiology and Biochemistry 39: 1017-

1026

Sahoo, K. K., A. K. Tripathi, A. Pareek, S. L. Singla-Pareek. 2013. Taming Drought Stress in Rice through Genetic Engineering of Transcription Factor and Protein Kinase. Plant Stress 7:60-72


PROCEEDING 2017 89

HMG-CoA REDUCTASE INHIBITOR ACTIVITY OF

ANTHOCYANIN FROM PURPLE SWEET POTATO

(Ipomoea Batatas L.)

Ni Made Pitri Susanti *, Ni Kadek Warditiani, Ni Putu Linda Laksmiani, Ni

Kadek Ayu Sandra Dewi, Mitsue Oka, Wayan Eka Heltyani, I Gde Pande

Anindhita Putra Wicaksana, and I Made Agus Gelgel Wirasuta

Department of Pharmacy, Faculty of Mathematics and Natural Sciences, University of Udayana, Bukit Jimbaran, Badung, Indonesia, 80361


Abstract

Anthocyanins are compounds contained in the purple sweet potato (Ipomoea

batatas L.), which in some other plants are known to be used as antihiperlidpidemia. Hyperlipidemia treatment is done by lowering total cholesterol, LDL, triglycerides and increase HDL. Decrease the amount of cholesterol in the body can be done by inhibiting the HMG-CoA reductase enzyme. This study was conducted to determine the activity of acylated anthocyanins in purple sweet potato as antihiperlipidemia through molecular docking. Molecular docking is an in silico method that uses software to determine the molecular activity of acylated anthocyanins as antihiperlipidemia against a target protein, the HMG-CoA reductase enzyme. Software used is ArgusLab 4.0.1 and HyperChem 8. Data analysis was done by comparing the energy bond between acylated anthocyanins dan native ligand to the target protein. Molecular docking performed includes the preparation of 3D structures of proteins and anthocyanins, molecular docking method validation, optimization of the 3D structure and molecular docking to the HMG-CoA reductase enzyme with binding energy parameters. The lower the binding energy, the stronger and more stable the bond between the enzyme and anthocyanins. The results showed that anthocyanins form hydrogen bonds with the amino acid 1156LYS, 684SER, 590 ARG, 692LYS, 981 GLY and 982CYS of HMG-CoA reductase enzyme with a binding energy of -8.16 kcal/mol. It can be concluded that anthocyanins have antihiperlipidemia potency through interaction with enzyme HMG-CoA Reductase.

Keywords: Anthocyanins, HMG-CoA reductase, antihiperlipidemia, Molecular

docking

BACKGROUND

Hyperlipidemia is characterized by an increase in one or more components of fats (total cholesterol, LDL, trigleserida) or a decrease in HDL. Treatment of Hyperlipidemia is done by lowering levels of LDL, triglycerides, cholesterol and raising levels of HDL. The formation of cholesterol in the liver, beginning with the establishment of HMG-CoA from acetyl CoA by HMG-CoA reductase enzyme, then reduced to form mevalonate, which later developed into cholesterol (Mayes and Botham, 2003). Statins are the antihiperlipidemia drugs that works by inhibiting HMG-CoA Reductase and are the most commonly prescribed drugs, ie Rosuvastatin, Simvastatin, Lovastatin, Artovastatin and Fluvastatin.


PROCEEDING 2017 90

Purple sweet potato (Ipomoea batatas L.) is one commodity that relatively abundant in Indonesia with the productivity of 1.9 million tons per year (Koeswara, 2008). Sweet purple color comes from the anthocyanin pigments (Woolfe, 1992). Purple sweet potato has 10 kinds of anthocyanin which are the derivate of cyanidin and peonidin (Montilla et al, 2011). Peonidin have OCH3 group in ring B so called acetylated anthocyanins. Acetylated anthocyanins have good stability during processing and storage. Anthocyanins have many health benefits, such as reduce the risk of coronary heart disease, reduce the risk of stroke, anti-carcinogenic activity, anti-inflammatory effects, improve sharp eyesight, and improve cognitive behavior. Anthocyanins are also known as antihiperlipidemic, but the mechanisms not been known (Mason et al, 2008).

The mechanism of action of a compound can be detected through molecular docking via insilico simulation. Therefore, this study will be conducted molecular docking of acetylated anthocyanins from purple sweet potato to the target enzyme HMG-CoA reductase inhibitors to determine its mechanism as antiahiperlipidemic.


Materials

HMG-CoA Reduktase 3D structure which has been bonded to native ligand, obtained from Protein Data Bank(PDB) with ID 2Q6C and native ligand HR1, 3D structure of acetylated anthocyanins from purple sweet potato as a ligand, Computer with ArgusLab 4.0.1 and HyperChem 8 software.

Methods

Docking Molecular Method Validation

Validation of molecular docking method carried out by using Exhaustive Search (ArgusDock) method with 0.4 Å grid resolution. Validation was done by docking copy ligand to the binding site targeted protein using ArgusLab 4.0.1. The result of docking will show the conformation of compounds with the lowest binding energy and RMSD (Root Mean Square Deviation) value.

Optimization of Acetylated Anthocyanin 3D Structure

Acetylated anthocyanins 3D structure was optimized by using a semi-empirical method AM1 in the HyperChem 8 program, with a single point and geometry optimization calculations.

Docking Acetylated Anthocyanins to the HMG-CoA Reductase Enzyme

Optimized acetylated anthocyanins docked to HMG-CoA Reductase enzyme used ArgusLab 4.0.1. Molecular docking is done without removing the water molecules to get a condition similar to that in the body.

Data Analysis

Docking score used in the analysis of the binding energy. The lower the bond energy, the stronger and more stable bond is formed. The lower the bond energy between the acetylated anthocyanins with HMG-CoA Reductase, the stronger the interaction occurred, so acetylated anthocyanins have a potency as antihiperlipidemic.


PROCEEDING 2017 91

a b

RESULTS

Method Validation

RMSD result in docking validation of copy ligand and HMG-CoA reduktase was 1.74Å. Figure 1 shows the location of the copy ligand compared to the native ligand. Table 1 shows the result of native ligand docked with HMG-CoA reductase enzyme.

Figure 1. Comparison of layout of Copy Ligand (gray) with Native Ligand (yellow)

to the protein HMG-CoA Reductase.

Table 1. Results of Native Ligand Docking with HMG-CoA Reductase Conformation RMSD Binding Energy (kcal/mol) Hydrogen Bond

1 1.74 -11.06 692 LYS, 684

SER, 590 ARG 2 1.59 -11.05

3 1.92 -11.01 4 1.77 -11.01 5 4.85 -8.99 6 4.79 -8.48 7 4.95 -8.42 8 4.99 -8.34 9 4.99 -8.14 10 4.99 -8.11

Optimization of Acetylated Anthocyanin 3D Structure

3D structure optimization of acylated anthocyanins were performed using the HyperChem 8 with a single point calculations and geometry optimization. The results are shown in Figure 2. Single point calculation result the -3783.92 kkal/mol of energy and geometry optimization calculations result in lower energy ie -3920.47 kkal / mol.

Figure 2. 3D Structure of Acetylated Anthocyanin after Single Point Calculation (a) dan Geometry Optimization Calculation (b).


PROCEEDING 2017 92

Docking Acetylated Anthocyanin to Enzim HMG-CoA Reduktase Molecular docking of acetylated anthocyanin to HMG-CoA Reductase

enzyme was done using the same parameters that used in validation processing. Figure 3 shows the interaction of Acetylated Anthocyanin (a) with HMG-CoA Reductase enzyme (b) through hydrogen bond (red line). Molecular docking results shown in the table 2.

Figure 3. Interaction of Acetylated Anthocyanin and HMG-CoA Reduktase Enzyme

Table 2. Docking Result of Acetylated Anthocyanin to HMG-CoA Reductase

Enzyme

Conformation Boinding Energy

(kcal/mol) Hydrogen

Bond

1 -8.16

1156 LYS, 684 SER, 590 ARG, 692 LYS, 981 GLY, 982 CYS

2 -7.90

3 -7.64

4 -7.50

5 -7.48

6 -7.44

7 -7.43

8 -7.33

9 -7.27

10 -7.11

DISCUSSIONS

RMSD (Root Mean Square Deviation) is meansurement results of two pose, experimental structure with native ligand structure, by comparing the atomic spacing of that two structures (Agistia, 2013). Valid method will give RMSD value in the range of 1-3 Å (Azam, 2012). RMSD result in docking validation of copy ligand and HMG-CoA reduktase was 1.74Å, so this method can be used to the next step.

a

b


PROCEEDING 2017 93

Geometry optimization results less energy compared to a single point calculation. This indicates a more stable conformation of acylated anthocyanins, so that the conformation is used for the next stage. The lower energy show the stable structure (Fitriasari, 2008).

Binding energy between acetylated anthocyanin and HMG-CoA Reductase enzym is -8.16 kcal/mol with hydrogen bond at amino acid 1156 LYS, 684 SER, 590 ARG, 692 LYS, 981 GLY and 982 CYS. Bond energy between native ligand and HMG-CoA Reductase enzym is -11.06 kcal/mol with hydrogen bond at amino acid 692 LYS, 684 SER and 590 ARG. The bond energy of acetylated anthocyanin was higer than native ligand, that means the bond between native ligand and the enzyme is more stable than acetylated anthocyanin. Figure 4 shows the comparison of binding energy.

Figure 4. Comparison of the Bindingd Energy of Acetylated Anthocyanin (Blue) and Native ligand on the HMG-CoA Reductase Enzyme (Red).

To compare the acylated anthocyanins affinity to the enzyme HMG-CoA

Reductase, docking to drugs that act on the same receptor has been done. The drugs used are known as statins (rosuvastatin), which works by inhibiting the HMG-CoA reductase enzyme. Rosuvastatin is a statin drug that is most effective for lowering LDL, triglycerides, cholesterol and raise HDL (Bullano et al., 2006). Binding energy are formed from the docking Rosuvastatin is -8.93 kcal / mol. This energy is higher than the native ligand, which indicates the lower bond stability than the native ligand. Rosuvastatin has been shown to have activity as antihiperlipidemia, so the acylated anthocyanins which also has a lower stability than the native ligand also has potential as antihiperlipidemia.

CONCLUSIONS

Acylated anthocyanins from purple sweet potato has potential as HMG-CoA Reductase inhibitors in mechanism as antihiperlipidemia through hydrogen bonding at the 1156 LYS, SER 684, 590 ARG, LYS 692, 981 and 982 Gly CYS amino acids, with a binding energy of -8.16 kcal/mol.


PROCEEDING 2017 94

ACKNOWLEDGEMENT

This research was support by Ministry of Research, Technology and Higher Education of the Republic of Indonesia.

REFERENCES

Azam, F., A. M. Madi, H. I. Ali. 2012. Molecular Docking and Prediction of Pharmakokinetic Properties of Dual Mechanisme Drugs that Block MAO-B and Adenosine A2A Receptor for the Treatment of Parkinson’s Disease. Journal of Young

Pharmacist. 4(3): 184-192

Bullano, MF, Wertz DA, Yang GW, Kamat S, Borok GM, Gandhi S, McDonough KL, Willey VJ. 2006. Effect of Rosuvastatin Compared with Other Statins on Lipid Levels and National Cholesterol Education Program Goal Attainment for Low-Density Lipoprotein Cholesterol in a Usual Care Setting. Pharmacotherapy. 26(4): 469-478.

Dalimartha, S. 2006. Atlas Tumbuhan Obat Indonesia Jilid IV. Puspa Swara. Jakarta.

Koeswara S. 2008. Teknologi Pengolahan Umbi-umbian. Bagian 5: Pengolahan Ubi. Research and Community Service Institution. Agricultural Technology. Bogor.

Mason, W.F., Christine, J. 2008. Kolesterol Rendah Jantung Sehat. Associate

Professor The Medical School. PT Bhuana Ilmu Populer. Jakarta.

Mayes, P.A, Botham, K.M. 2003. Cholesterol Synthesis, Transport & Excretion. In : Murray,R.K, Granner,D.K, Mayes,P.A, Rodwell V.W. Editors. Harper’s. Illustrated

Biochemistry. Lange Medical Book. 26th ed. New York.

Montilla, Elyana Cuevas, S. Hillebrand, P. Winterhalter. 2011. Anthocyanins in Purple Sweet Potato (Ipomoea batatas L.) Varieties. Fruit, Vegetable and Cereal

Science and Biotechnology.

Pidrayanti, L. T. M. U. 2008. Artikel Penelitian Pengaruh Pemberian Ekstrak Daun

Salam (Eugeniapolyantha) Terhadap Kadar LdL Kolesterol Serum Tikus Jantan

Galur Wistar Hiperlipidemia. Fakultas Kedokteran Universitas Diponogoro. Semarang.

Woolfe J.A.1992. Sweet Potato An Untapped Food Resource. Cambridge University Press. Cambridge.


PROCEEDING 2017 95

GENE ACTION FOR AGRONOMY CHARACTERS IN

SEGREGATING GENERATION (M2) OF SOYBEAN

[Glycine max (L.)Merr.]

Diana Sofia Hanafiah*, Ratna R. Lahay, Irda Safni, Eva S. Bayu,

Isman Nuriadi, and Muhdi

Faculty of Agriculture, University of Sumatera Utara *Corresponding author: [email protected]

Abstract

Gamma ray irradiation is one of way to improve the plant genetic diversity. Seeds of Anjasmoro variety was treated with 100 Gy, 200 Gy and 300 Gy doses of Gamma-rays. The gene action for the agronomy characters in the mutated segregating generations was found out based on the frequency distribution of characters through measurement of skewness and kurtosis value. The frequency distribution for the agronomy characters viz., time of flowering, plant height, number of primary branches, seeds weight per plant and weight of 100 seeds were obtained. The skewness and kurtosis estimate were calculated to study the gene action. The number of primary branches recorded positive skewness value in all the three irradiated doses. The others characters have positive skewness value but different characters of each irradiated doses. This indicates the presence of complementary epistatic gene action for these traits and if selection will be made intensively in the segregating generations the gain will be faster of each characters in the three irradiated doses.

Keywords: gene action, generation M2, soybean

BACKGROUND

Soybean is not a native plant from Indonesia, but it is introduction plants that originated from China. Soybean is self-pollinated plants that are kleistogami and soybean genetic diversity in Indonesia is still low (Adie and Krisnawati 2007). To increase the genetic diversity of soybean plants can be done through mutation breeding to improve desired characters of plants. Mutation breeding is a way to obtain genetic diversity of characters quantitative and qualitative in plants (Manjaya and Nandawar 2007; Kavithamani et al. 2010).

Mutations with high dose irradiation, usually leads to genetic instability (Van Harten 1998). The micro mutations change the quantitative characters derived from seeds irradiated and more beneficial for breeders. Micro mutations caused little damage although these mutations were difficult to detect. Micro mutations can increase the diversity on yield, protein content, plant height, time of flowering, pod production, seed weight and other results related to the quantitative inherited characters (Sakin 2002; Tah 2006). The irradiation dose is different for each cultivar and soybean varieties. In general, the dose of gamma irradiation for legumes ranged from 100 Gy to 200 Gy (Bhatia et al. 2001). Superior varieties obtained through plant breeding to the improvement of yield and crop adaptation. The new varieties


PROCEEDING 2017 96

require a population base which has a high genetic diversity and gene action that influence it. M2 population is a segregation population after gamma-ray irradiation, in which each individual of the population have the possibility randomly mutated genes so that the genetic diversity in each character different from irradiation genotype population. The objective of this study is to identifying the gene action of agronomy characters in soybean by studying the segregating M2 population.


Irradiation treatment was performed at BATAN (National Atomic Energy Agency) and field research was conducted at the University of Sumatra Utara, Medan. Soybean seed varieties of Anjasmoro were treated with 100, 200, 300, 400, 500, 600, 700, 800, 900 and 1000 Gy of gamma irradiation derived from irradiator gamma chamber. The effect of irradiation on germination was observed. Based on the observations the LD50 value for germination to gamma rays was arrived at 425,416 Gy for seed soybean of Anjasmoro. Hence, the treatment doses viz., 100 Gy, 200 Gy and 300 Gy were chosen for conducting the field experiment. A total of 100 seeds (M1) planted with a spacing 40 x 20 cm2. For the M1 generation, in each plant at each treatment dose, 10 pods per plant then were harvested (restricted bulk) and grown as an M2 generation. Then 1500 seedlings of M2 seeds were planted for each dose treatment with spacing of 40 x 20 cm2, and the variability in agronomic characters viz., time of flowering, plant height, number of primary branches, seeds weight per plant and weight of 100 seeds were evaluated. treatment. Based on the observations the Skewness and Kurtosis estimates to study the gene action.

RESULTS

Table 1. Variance and heritability for agronomic characters in M2 generation of Anjasmoro soybean

Character Gamma Dosage Coefficient of variability Heritability G P

Time of flowering 100 Gy 1,33 2,13 1,00 200 Gy 7,24 7,51 93,00 300 Gy 8,32 6,33 95,00 Plant height 100 Gy 10,80 12,87 61,00 200 Gy 6,97 11,34 38,00 300 Gy 16,93 19,25 77,00 Number of primary branches

100 Gy 16,80 20,18 7,00

200 Gy 12,05 27,63 35,00 300 Gy 7,20 39,11 43,00 Seed weight per plant 100 Gy 18,98 25,43 27,00 200 Gy 16,00 42,30 46,00 300 Gy 51,84 62,66 21,00 Weight of 100 seeds 100 Gy 8,46 13,79 38,00 200 Gy 24,45 27,66 78,00 300 Gy 48,86 50,16 95,00

Genetic variation and heritability of Anjasmoro M2 soybean variety plants at

different irradiation doses can be seen in Table 1. M2 plants are expected to show


PROCEEDING 2017 97

segregation at the genetic locus that has mutation. Genetic variety can be observed in M2 generation. In this study observations focused on agronomic characters like time of flowering, plant height, and yield components. Based on data in Table 1, the character seed weight per plant and weight of 100 seeds having coefficient variation genetic that ranged from low to high, while for the other characters observed coefficient variation genetic ranged from low to medium. The range of heritability values ranged from 1.00 to 95.00 on all the characters are observed.

Table 2. Skewness and kurtosis value for agronomic characters in M2 generation of Anjasmoro soybean

Character Gamma Dosage Skewness Kurtosis Time of flowering 100 Gy 0,248 -1,041 200 Gy -0,325 6,092 300 Gy 0,688 -0,871 Plant height 100 Gy -0,087 -0,690 200 Gy -0,283 -0,102 300 Gy -0,309 -0,828 Number of primary branches

100 Gy 0,060 -0,381

200 Gy 1,675 5,419 300 Gy 0,391 -0,186 Seed weight per plant 100 Gy 0,069 0,728 200 Gy -0,212 0,146 300 Gy -0,192 -1,291 Weight of 100 seeds 100 Gy 0,230 0,362 200 Gy -0,967 2,636 300 Gy 1,633 8,428

Table 2 shows that the positive skewness value found in the parameter number of primary branches in three doses of irradiation in the population was observed. Positive kurtosis value found in weight of 100 seeds characters in three populations irradiation were observed. In other parameters, skewness and kurtosis varied, ranging from negative and positive value

DISCUSSIONS

The approach to estimating gene action for the quantitative traits in the mutated segregating generations was found out based on the frequency distribution of characters. Skewness describes the degree of departure of a distribution from symmetry or it shows the action of genes that control a character. Kurtosis characterizes the peakedness of a distribution or it estimates the number of genes (Roy 2000). The positive skewness indicated the influence of additive gene with the presence of complementary epistatic gene action for that character. The negative skewness indicated the influence of additive gene with the presence of duplicate epistatic gene action. (Roy 2000). Kurtosis will occur if either a few genes are contributing to the phenotypic distribution. Traits (characters) showing leptokurtic distribution are usually under the control of few segregating genes and traits showing a platykurtic distribution usually represent characters that are


PROCEEDING 2017 98

controlled by many genes. The positive values of kurtosis indicated leptokurtic curve and negative kurtosis indicated platykurtic curve.

Genetically, the diversity of agronomic characters in M2 populations of soybean irradiated by gamma rays due to the segregation of genes within loci that have mutations in the M1. The diversity that occurs as a result of segregation genes from affected population irradiation caused the diversity of quantitative characters on M2 generation (Van Harten 1998; Tah 2006; Manjaya and Nandawar 2007; Pavadai et al. 2010). Previous researchers have reported hereditary changes in the desirable characters in crop plant by using gamma rays as a physical mutagen, which has been used to develop 64 % of the radiation-induced mutant varieties (Ahloowalia et al. 2004). High expectation value of broad sense heritability was found in the observation variable such as time of flowering, plant height and weight of 100 seeds. Selection for improvement of these characters can be done to produce genotypes with the desired time of flowering, plant height and production. For other characters, the estimated expectation value of heritability range from low to moderate. Sakin (2002) who observed wheat found that heritability for some mutant population depends on the characters observed.

The characters number of primary branches had positive skewness values in all the three irradiated doses (Table 2). This indicates the presence of complementary epistatic gene action for this character and if selection will be made intensively in the segregating M2 generations for number of primary branches. Selection can be done in early generations, until it can be obtained the better of selection progress later. The kurtosis values estimate for the weight of 100 seeds had positive values in all the three treatments indicated that the character is controlled by few segregating genes only. Based on Jayaramachandran et al. (2010) the characters panicle length and 100 grain weight controlled by few segregating genes confirms that the genes actions are disturbed by irradiation.

CONCLUSIONS

The variability of agronomic characters of soybean after irradiation was due

to genetic factor. The highest heritability values menunjukkan adanya pewarisan genetik dan seleksi bisa dilakukan pada generasi awal dari karakter yang diinginkan. Skewness and kurtosis positive value indicates that the additive gene action and complementary epistatic gene plays a role determining the selection process and the progress of the selection that will be done later.

ACKNOWLEDGEMENT

The authors wish to thank Irwan Bonar Sibarani and Irfan Mustaqim, that

participated in this study.

REFERENCES

Adie M, Krisnawati A. 2007. Soybean plant biology. In: Sumarno, Suyamto, Widjono A, Hermanto, Kasim H (eds). Soybean: Production technique and development. Research centre and food plants development, Bogor. [Indonesia]


PROCEEDING 2017 99

Ahloowalia B, Maluszynski M, Nichterlein K. 2004. Global impact of mutation-derived varieties. Euphytica, 135: 187-204. Bhatia CR, Maluszynski M, Nichterlein K, Van Zanten L. 2001. Grain legume cultivars derived from induced mutations, and mutations affecting nodulation. Mutation Breeding Review 13: 1-44. Jayaramachandran M, Kumaravadivel N, Eapen S, Kandasamy G. 2010. Gene action for yield attributing characters in segregating generation (M2) of Sorghum (Sorghum

bicolor L.). Electronic Journal of Plant Breeding 1(4): 802-805. Kavithamani D, Kalamani A, Vanniarajan C, Uma D. 2010. Development of new vegetable soybean (Glycine max L. Merrill) mutants with high protein and less fibre content. Journal of Plant Breeding 1(4): 1060-1065. Manjaya JG, Nandanwar RS. 2007. Genetic improvement of soybean vanety JS 80-21 through induced mutations. Plant Mut Rep 1 (3): 36-40. Pavadai P, Girija M, Dhanavel. 2010. Effect of gamma rays on some yield parameters and protein content of soybean in M2, M3 and M4 generation. Journal of

Experimental Sciences, 1(6):8-11. Roy D. 2000. Plant Breeding Analysis and Exploitation of Variation. India: Narosa Publishing House. Sakin MA. 2002. The use of induced micro mutation for quantitative characters after EMS and gamma ray treatments in durum wheat breeding. Pakistan Journal of

Applied Sciences 2(12): 1102-1107. Tah, PR. 2006. Studies on gamma ray induced mutations in mungbean [Vigna

radiata (L.) Wilczek]. Asian J of Plant Sci 5 (1): 61-70. Van Harten AM. 1998. Mutation breeding, theory and practical application. University of Cambridge, Cambridge, UK.


PROCEEDING 2017 100

INFECTION AND DISTRIBUTION OF Anisakis spp. LARVAE ON

SWORD FISH (Trichiurus lepturus) IN KEDONGANAN WATERS

Nyoman Adi Suratma*, I Wayan Yustisia Semarariana, Ida Bagus Made Oka,

and Hapsari Mahatmi

Faculty of Veterinary Medicine, Udayana University, P.B. Sudirman Street

Denpasar, Bali, Phone: 0361-223791 * Corresponding author: [email protected]

Abstract

A research on the infection and distribution of Anisakis spp. larvae on Sword Fish (Trichiurus lepturus) was done.. There was an observational study by examining of 32 Sword Fish (Trichiurus lepturus) captured in Kedonganan Badung waters against infection of Anisakis spp larvae. The results showed that prevalence infections of Anisakis spp. larvae on Sword Fish in Kedonganan waters was 31.25%. and intensity of infection abaout 1-49 larvae per fish ( mean : 9.2 larvae) and it there is siginificant correlation (P <0.01) between the size of the fish and the intensity of Anisakis spp larvae infections. Distribution of Anisakis spp. larvae were occurs in the abdominal cavity (100%), itestines (50%), stomach (10%), and muscle (10%). Keywords: Infection, Anisakis spp., Sword Fish (Trichiurus lepturus).

BACKGROUND Sword Fish or Trichiurus lepturus (Nakamura and Parin, 1993), was a fish that is popular in Indonesia with high protein content, this fish is generally processed by frying, baking or eaten directly. But on fish is common occur infection of parasite that can be transmitted to humans (zoonoses). One of parasites in fish that are zoonotic is Anisakis spp. (Nabib and Pasaribu, 1989). Anisakis spp. was nematode worms in the digestive tract of marine mammals such as dolphins, whales and seals. Worm eggs are mixed with feces of infected definitive host so dispersed into the water and it will hatch into larvae II. Larvae II will be eaten by crustaceans and inside his body will develop into larvae III. Sword Fish (Trichiurus lepturus) will become infected when eating crustaceans or other fish containing the worm larvae III Anisakis spp. Infective larvae live in the digestive tract of fish, and after being cooked will migrate to various tissues and organs, and will form a cyst until Sword Fish (Trichiurus lepturus) ingested by host definitive, and often after fish was dead larvae will migrate into the muscle of fish (Grabda , 1981). Infections in humans are generally incidental, by eating fish that contain larvae III in a fresh fish or undercooked. Anisakis spp worm infection in humans known as Anisakiasis. Anisakiasis usually marked by symptoms of abdominal pain, cramps and vomiting (Pengendalian Penyakit & Penyehatan Lingkungan, 2005). Additionally, Anisakis spp. can also cause allergies in humans, although the fish was


PROCEEDING 2017 101

cooked well, but Anisakis spp. can release chemical compounds in meat fish that are allergens, causing people who eat them suffer from allergies (Palm et al., 2008).


This study was an observational study by conducting inspection of Sword fish (Trichiurus lepturus) to the presence of Anisakis spp. larvae. Samples were 32 Sword fish derived from Kedonganan waters, then grouped into two, short size (<100 cm) and long size (> 100 cm). So fish were necropsied and seen the infection, intensity and distribution of larva in the organs of Sword fish. Identification worm Anisakis spp. conducted by Williams and Jones (1993) and the data obtained are presented descriptively and analyzed by correlation analysis. RESULTS

The prevalence infections of Anisakis spp larvae on Sword Fish (Trichuirus

lepturus).

From 32 Sword fish (Trichiurus lepturus) in Kedonganan waters found that 10 fish. (31.25%) infected with Anisakis spp. larvae. Based on the size of the fish, that found 30 short size fish (52-71 cm) and 2 long fish (118 cm and 126 cm) . In short size fish, that 8 (26.67%) were infected with Anisakis spp.larvae while for long fish all (100%) were infected. Intensity of Infection Anisakis spp. larvae on Sword fish (Trichuirus lepturus).

After counted the larvae in 10 infected Sword fish, found that the intensity of infection about 1-49 larvae per fish (mean : 9.2 larvae) . Based on the difference in the size of the fish, found that intentity in short size fish about 1 -15 larvae per fish (mean :2.63) and intensity in long size fish were 22 and 49 larvae (mean: 35.5 larvae). There were significant correlation (P <0.01) between the size of the fish and intensity of Anisakis spp. larvae infection. Distribution of Anisakis spp. larvae Infectioni on Sword Fish (Trichuirus

lepturus).

After examination about the presence of larvae in fish body, looked larvae infections occur in the abdominal cavity (100%), the intestines (50%), stomach (10%) and in the muscles (10%). Distribution larvae infections was highest in the abdominal cavity (74 larvae), then in the intestines (16 larvae), stomach (1 larvae) and muscle (1 larvae). Based on the difference in the size of the fish, on the short size fish distribution in the abdominal cavity were 16 larvae, in intestines were 5 larvae and in stomach were 16 larvae. While on long size fish distribution is in the abdominal cavity as much as 58 larvae, as many as 11 larvae in the intestine, and in the stomach and muscles as much as 1 larva DISCUSSIONS

The prevalence of infections in these study were lower than studies conducted on Sword fish (Trichiurus lepturus) size > 70 - 114 cm in the sea waters in Central


PROCEEDING 2017 102

Java (97.1%) (Palm, et. al, 2008). Differences in the results obtained by Palm et al. (2008) because of the fish was examined is longer than the fish used in this study. According to Hadidjaja et al. (1978) that infection Anisakis spp larvae increases with increasing size of the fish. It’s the meaning age of fish was old, so the exposure with Anisakis spp larvae is also increases By categories based on prevalence of infection criteria (Williams & Williams Bunkley- 1996) in Hariyadi (2006), the prevalence of infections Anisakis spp larvae on Sword fish in Kedonganan waters were category frequently. This condition is related with presence of the definitive host Anisakis spp. such as dolphins and whales. which is also affected by the phenomenon of upwelling in the South Bali waters (Khan, 2005). The intensity of infections is influenced by the size of the fish examined, in accordance with the opinion of Noble & Noble (1989) which states that the number, size, the behavior of any parasites on the host are determined by age, body size of the host, climate, season and geographic location. Factors affecting these differences include fish diet, endurance fish and fish environmental conditions, especially water quality factors are the main factors that influence the immune response reaction of the fish, which ultimately affect the high-intensity worm larvae. According Williams and Jhones (1993) a parasitic microhabitat were environment whree a parasitic life support, environment shelter should be provided food, oxygen and other factors including competition between species. According Gidelli (2003,) distribution of infections Anisakis spp larvae in several organs, were to complete its life cycle. The presence of parasitic worms in the body cavity and the digestive tract because of the many sources of organic matter that is ready absorption by parasitic worms. Known as nematodes are parasites of food from blood, tissue cells and body fluids, because the parasitic nematodes can not change the organic material that has not been simplified. CONCLUSIONS

From these results it can be concluded: 1. Prevalence of infection Anisakis spp larvae. In Sword fish (Trichiurus lepturus)

in Kedonganan waters was 31.25%. 2. The intensity of infection Anisakis spp larvae infections on Sword fish

(Trichiurus lepturus) in Kedonganan waters about 1-49 larvae per fish (mean : 9.2 larvae) and there is a significant correlation between the size of the fish and the intensity of Anisakis spp larvae infections.

3. 3.Distribution of Anisakis spp. larvae infections on Sword fish (Trichiurus

lepturus) were occur in the abdominal cavity (100%), intestines (50%), stomach (10%) and muscle (10%).

REFERENCES

Ditjen Pengendalian Penyakit & Penyehatan Lingkungan - Departemen Kesehatan R.I. 2005. Grabda, J. 1981. Marine Fish Parasitology. New York: An outline. Polish Scientifitic Publisher.


PROCEEDING 2017 103

Hadidjaja P, H.D. Ilahude , H. Mahfudin, Burhanuddin, and M. Hutomo. (1978). Larvae of Anisakidae in Marine Fish of Coastal Waters Near Jakarta, Indonesia [abstract]. Am J Trop Med Hyg 27 (1):51-54.

Hariyadi, A.R. 2006. Pemetaan Infestasi Cacing Parasitik dan Resiko Zoonosis pada Ikan Laut di Perairan laut Indonesia Bagian Selatan. [Tesis]. Bogor: Fakultas Kedokteran Hewan. Institut Pertanian Bogor. Khan, B. 2005. Indonesia Oceanic Cetacean Program Activity Report : January – February 2005.Apex Environmental. Bali. Nabib, R dan F.H. Pasaribu. 1989. Patalogi dan Penyakit Ikan. Lembaga Sumberdaya Informasi : Bogor. Noble ER and Noble GA. 1989. Parasitology : The Biology Of Animal Parasites. Edisi ke-5. Alih Bahasa; Wardiarto. Yogyakarta: Gadjah Mada University Press. Palm H.W., I.M. Damriyasa, Linda, and I.B.M. Oka. 2008. Molecular genotyping of Anisakis Dujardin, 1845 (Nematoda: Ascaridoidea: Anisakidae) larvae from marine fish of Balinese and Javanese waters, Indonesia. Udayana University. Badung Williams and Jones .1993. Parasitic Worm Of Fish, Taylor & Fish.


PROCEEDING 2017 104

ANTIBACTERIAL ACTIVITY AGAINST Staphylococcus aureus

FROM METHANOL EXTRACT OF MANGOSTEEN RIND

(Garcinia mangostana L.)

Ketut Widyani Astuti* and Ni Putu Ayu Dewi Wijayanti

Pharmacy Department, Faculty of Mathematics and Natural Sciences, Udayana

University * Corresponding author: [email protected]

Abstract

Staphylococcus aureus is one of bacteria that could cause acne. Xanthone in mangosteen rind extract known had antibacterial activity. In this study, the antibacterial activity of methanol extract of mangosteen rind (Garcinia mangostana

L.) against Staphylococcus aureus was determined. This study will be the basis for development of pharmaceutical preparation for acne with extract of mangosteen rind (Garcinia mangostana L.) as active ingridients. In this research, the extraction is done by maceration method using methanol in dried mangosteen rind. Extract was freeze dried in order to get dry powder. Antibacterial activity against Staphylococcus

aureus is tested with disc diffusion method (Kirby & Bauer test). Results showed the value of Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) of the methanol extract of mangosteen rind against Staphylococcus aureus was 0.2 % (g /ml) and 0.6 % (g/ml)

Keywords: methanol extract of mangosteen rind, Staphylococcus aureus, MIC, MBC

BACKGROUND

Mangosteen (Garcinia mangostana L.) is a functional plant known for its

benefit in health. According to Tambunan (1988), Subroto (2008), Masniari (2010) one of the benefits of the mangosteen rind is antibacterial activity. Linuma, et al. (1996) and Palakawong, et al (2010) reported that α-mangostin, a xantone compound, isolated from the mangosteen rind has antimicrobial activity against Staphylococcus aureus. Staphylococcus aureus is one of the bacteria that cause acne. Thus the mangosteen rind extract has the potential to be developed as an active ingredient in antiacne preparation. Health products developed today are using mangosteen rind crude extract. Extracts will be more stable and easier to use in pharmaceutical preparation in the form of dry extract. In this study, dry extract was obatained with freeze dry method. Methanol solvent used in extraction process was easy to evaporated. Based on this it is necessary to study the antibacterial activity of methanol extract of mangosteen rind against Staphylococcus aureus.


Materials used in this study i.e. mangosteen rind (Garcinia mangostana L.), methanol, n-hexane, Muller Hilton Agar Media (Lab), Nutrient Broth (NB), NaCl


PROCEEDING 2017 105

0,9%, whatman paper no. 41, clindamysin, and Sthaphylococcus aureus isolate. Ripe and blackish purple mangosteen was obtained from Luwus Village, Baturiti District, Tabanan, Bali. Determination plants conducted in UPT Gardens Plant Conservation Eka Karya Bedugul, Tabanan, Bali.

Collected mangosteen rind was washed, grated then dried in room temperature. Dried mangosteen rind was sieved with mesh no. 20 into powder. Mangosteen rind powder was defatted with n-hexane and then extracted with methanol. Obtained filtrate was concentrated by rotary evaporator at 50 ° C (Sukatta et al., 2009). Extract was freeze dried to gain dried extract.

Antibacterial activity against Staphylococcus aureus was tested with disc diffusion method (Kirby & Bauer test) in media Muller Hilton Agar (MHA). A total of 100 µL of S. aureus bacterial suspension was spread into a petri dish contains media MHA. Whatman paper disc was filled with methanol extract of mangosteen rind concentration 10%, 1%, 0.1%, 0.01% w/v (g/ml), negative controls (methanol) a positive control (clindamycin 1%), and control media. The disc was placed into the MHA media contained S. aureus and incubated at 370C for 24 hours aerobically. Observations were made of the inhibition zone is formed.

Determination of MIC and MBC of the mangosteen rind methanol extract was was tested with disc diffusion method (Kirby & Bauer test) in media Muller Hilton Agar (MHA). A total of 100 µL of S. aureus bacterial suspension was spread into a petri dish contains media MHA.

Whatman paper disc was filled with methanol extract of mangosteen rind concentration 1%, 0.8%, 0.6%, 0.4%, 0.2% w/v (g/ml), negative controls a positive control (clindamycin 1%), and control media. The disc was placed into the MHA media contained S. aureus and incubated at 370C for 24 hours (aerob). Observations were made of the inhibition zone formed and whether there is a clear zone.

RESULTS

Table 1. Antibacterial activity of methanol extract of mangosteen rind (Garcinia

mangostana L.) against Staphylococcus aureus

No. Concentration Inhibition zone (mm) Inhibition zone

average (mm) 1 2 3

1 Media control 0 0 0 0

2 Negative control 0 0 0 0

3 Positive control 36 36 35 35.67

4 Extract 0.01% 0 0 0 0

5 Extract 0.1% 0 0 0 0

6 Extract 1% 7.5 8 7.5 7.67

7 Extract 10% 9.5 9 9 9.17


PROCEEDING 2017 106

Table 2. Determination of Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) methanol extract of mangosteen rind

(Garcinia mangostana L.)

No. Concentration Inhibition zone (mm) Inhibition

zone average (mm)

Clear Zone 1 2 3

1 Media control 0 0 0 0 -

2 Negative control 0 0 0 0 -

3 Positive control 27 24 24 25 +

4 Extract 0.2% 6.5 6.5 6.5 6.5 -

5 Extract 0.4% 7 6.5 6 6.5 -

6 Extract 0.6% 6.5 6.5 7 6.67 +

7 Extract 0.8% 7.5 7 7.5 7.33 +

8 Extract 1% 10 8 8.5 8.83 +

DISCUSSIONS

Results showed that methanol extract of mangosteen rind had lower activity than positive control (clindamycin). Nevertheless, test results in Table 1 showed that methanol extract of mangosteen rind (Garcinia mangostana L.) had antibacterial activity of against Staphylococcus aureus at concentration 1%. The study was followed with determination of Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) methanol extract of mangosteen rind (Garcinia mangostana L.). Test results in table 1 showed that MIC and MBC of the methanol extract of mangosteen rind against Staphylococcus aureus was 0.2 % (g /ml) and 0.6 % (g/ml).

CONCLUSIONS

The value of Minimum Inhibitory Concentration (MIC) and Minimum

Bactericidal Concentration (MBC) of the methanol extract of mangosteen rind against Staphylococcus aureus was 0.2 % (g /ml) and 0.6 % (g/ml) ACKNOWLEDGEMENT

Kemristekdikti on funding this research through Hibah Bersaing Grant, as

well as colleagues of Pharmacy Department, Faculty of Mathematics and Natural Sciences, Udayana University.

REFERENCES

Clinical and Laboratory Standards Institute, (2004) : Methods for Antimicobial

Susceptibility Testing of Anaerobic Bacteria. Approved Standard M11-A6, Clinical and Laboratory Standards Institute, Wayne, PA.


PROCEEDING 2017 107

Leelapornpisid, P., S. Chansakao, T. Ittiwittayawat, and S. Pruksakorn. 2005. Antimicrobial Activity of Herbal Extracts on Staphylococcus aureus and Propionibacterium acnes. Thailand: Faculty of Pharmacy Chiang Mai University. Linuma M, Tosa H, Tanaka T, Asai F, Kobayashi Y, Shimano R, Miyauchi K. (1996). Antibacterial Activity of Xantones From Guttiferaeous Plants Against

Methicilin-Resistant Staphylococcus aureus. J. Pharm. Pharmacol. 48(8): 861-865. Masniari P. (2010). Uji Aktivitas Antibakteri Ekstrak Kulit Buah Manggis (Garcinia

mangostana Linn.).Pusat Penelitian Botani-LIPI. Bogor, Bandung. Palakawong, C., Sophanodora, P., Pisuchpen, S. and Phongpaichit, S. (2010). Antioxidant and antimicrobial activities of crude extracts from mangosteen (Garcinia

mangostana L.) parts and some essential oils. International Food Research Journal:

Vol 17. P 583-589. Subroto, M.A. (2008). Real Food True Health. Agromedia Pustaka. Jakarta Tambunan, R. M. (1998). Telaah Kandungan Kimia dan Aktivitas Antimikroba Kulit

Buah Manggis. Tesis. Institut Teknologi Bandung, Bandung.


PROCEEDING 2017 108

THE POTENTIAL HONEYCOMB FROM WILD BEE

Mochammad Junus

The Faculty of Animal Husbandry Brawijaya University, Malang-Indonesia Corresponding author: [email protected]

Abstract

The study was enacted in Sungai Pagar Village, Kiri Hilir Riau regency,

Riau Province in July 2014 in co-operation with the area wild bee honey Co-operative Society. The aim of this study was obstain an accurate estimate of the economic potential at local wild bee honey (Apis dorsata) and its products of the above area. In order to draw was appropriate laws and regulations for its sustainable exploitation. A survey method was employed, which found that there were two types honey of wild honey bees, one black ini colour and the other yellow , and that of the total number of hives 1320 colony were of the black variety. Regarding honey production and harvesting, it was found that black bee hives produced 3 - 8 kgs of honeycom and could be harvested from between 8 and 10 times a year. The local of method of harvesting, namely the taking of only 25 % - 30 % if any one hive was unlikely to cause the bees to abandon the hive, and is thus fully sustainable. Keywords: economic, co-operative, harvest.

BACKGROUND

Forest sustainable utilization and its capacity to support human life are the benchmark of a nation development. The nation capacity to manage its forest governance indicates that country development can be measured perfectly. Forest, farming and agriculture are the lifeblood that comes from non-living things become living things (fodder and food). The non-living things’ ability to be living things like tomato, coconut and sialang tree are concrete example that can be perfectly applied to fulfill life necessities. One of life necessities that its production needs to be improved is honey. Honey comes from honeybee that absorb plants and animal sugar-rich liquid, and pollen. Some plantations that produce sugar-rich liquid and pollen can be used by giant honey bee (A dorsata) to supply their needs, but other results that can be obtained are new products such as honey, royal jelly, pollen, beeswax, bee colony and queen bee. Those products can be used by humans not only for food but also for medicine and cultivation.

Therefore, forest potential towards giant honey bees products in general, honeycomb, honey and beeswax are needed to observe further in the beginning segment of products. The aim of this research was to know the ability of forest resources to produce honeycomb, and honey. Therefore, the benefit of this research was to determine the policy in developing bees activity in forest area to produce honeycomb, and honey.


PROCEEDING 2017 109


This research was done once on every tree when honey harvesting with survey. The beginning of this research determining the location and sample used. Then, location and sample used were set out as research objects. The location was in community cooperative (KOPMAS) of Sialang honey in Riau Province. Tree used as sample was determined randomly. The ingredients needed in this research were: sialang tree, black giant honeybee product, and some giant honeybee colonies. Then, the equipments used were: stationery, camera, rope, protective clothing, frames, honey strainer, scales and honey dehydrator. The research was held using survey, the researcher went to giant honeybee cultivation area which was determined randomly. Then, the researcher observed scattering of tree, prepared the climbing equipments and harvesting honey from black giant honeybee colony. There was one group observed with 16 trees, while the number of colony that was measured its honey production was 100% from the total colony on each tree. Product observed was the hive comb that would be cut out and dropped down. The variables measured were: 1. The number of black giant honeybee colony on the sample tree 2. The types of giant honeybee colony according to beekeeper The amount of honey produced by each sample colony was grouped into 5: group a,b,c,d and e with each honey production in the range of 7.3-8.2 kg, 6.3-7.2 kg, 5.3-6.2 kg, 4.3-5.2 kg and 3.3-4.2 kg. RESULTS AND DISCUSSIONS

The amount of black giant honeybee colony on sample sialang tree

Referring to the observation on giant honeybee colony, there were two colors found, yellow and black. Yellow giant honeybees were easy to migrate, while the black giant honeybees were rarely to migrate. Those giant honeybees would be observed in this research. Salmah (2000) said that there are three types of giant honeybees in Indonesia, A. dorsata, A cerana, and A. andreniformis. Furthermore, yellow giant honeybee identification should be done. The number of black giant honeybee colony on the sample tree were varied. The observation showed that the number of honeybee colonies on each tree were in the range of 28-132 colonies. Overall, there were 1320 giant honeybees on 16 trees occupied. Furthermore, the result from statistic analysis showed the average of giant honeybee colony on each tree could be seen in Table 1.

Table 1. Total and groups of giant honeybee in Kopmas Sungai Hilir Kiri Kampar

Tree Number of Giant Honey bee Colony Group (Colony) Total a b c d e

Total 152 240 328 320 280 1320

Average 9.5 + 7.98 15,0 +10.88 20.5 +15.86 20.0 +12.65 17.5 +8.37 82.5 + 36.77

Based on the result in Table 1, black giant honeybees colonies produced different honey with very big variety. The total of black giant honeybee colony in group a,b,c,d and e which produced honey in the range of 7.3 - 8.2 kg, 6.3 – 7.2 kg,


PROCEEDING 2017 110

5.3 - 6.2 kg, 4.3 – 5.2 kg and 3.3 – 4.2 for each group was 9.5 + 7.98 colony, 15,0 +10.88 colony, 20.5 +15.86 colony, 20.0 +12.65 colony, 17.5 +8.37 colony, 82.5 + 36 colony. The differences in number of colony commonly happened because black giant honeybee was without queen bee recovery. There was also a probability that the queen bee was homozygote and heterozygote. As the result, there would be different recombinant gene in their progeny. According to Adam (1985), bee progeny has strong influence towards the appearance of colony. That recombinant gene made difference in honey production within the group of bee colony. Sasongko (2014) explained that the difference is because permanent ways which have obstacles. Therefore, the harvesting process had some variations. The figure of total of giant honeybee colony which produced honey could be seen in Figure 1.

Figure 1. The Average of Colony in Honey Producers Groups

Based on Figure 1, the number of colony which produced honey was not the same in group. Meanwhile, colony producers could be said as productive because the groups of honey producers still high and the lowest was 9.5 colony on each tree. While the colony reality in a tree could be explained in Figure 2.

Figure 2. Sialang tree occupied by Black Giant Honeybee Therefore, engineering towards product improvement using genetic

technologies was not necessary in black giant honeybee colony. Meanwhile, cultivation technology is important to prevent the bees migrate easily (Junus,2006). That way was very important to improve the interest of people around the forest in maintaining giant honeybee to conserve the forest and environment.


PROCEEDING 2017 111

Production of black giant honeybee honeycomb per colony Honeycomb was honey inside the hive comb which just cut by the giant

honeybee keeper from the colony on sialang tree. Then, honey inside the hive comb was put in a plastic container before it was put down from the top of tree using rope. The container should covered with plastic sack before it is put down to prevent the bees go inside it (Sasongko, 2014). There is a beekeeper below the tree who takes the honey (Ramli,2014). Those process could be seen in Figure 3.

Figure 3. Getting Down the Honeycomb (Sasongko, 2014).

After that, the honeycomb was measured and given to the community cooperative to be chopped and drained. The process of chopping and draining could be seen in Figure 4. After honeycomb chopping, all honey inside the hive came out and then it was put in vessel. That process was the same with taking honey out of the hive but it takes longer time (Junus, Setiawan, Minarti, Basori, 2016). Thus, giant honeybee did not need extractor for giant honeybee breeder. In contrast, if there was huge amount of honeycomb or time limitation, extractor was totally needed.

a.Harvested honeycomb b. Chopped Honeycomb

Figure 4. Harvested Honeycomb (a) chopped honeycomb (b) drained honeycomb

b a


PROCEEDING 2017 112

The result of weighed honeycomb from black giant honeybee breeders in KOPMAS that statistically analyzed indicated the sum and average of honeycomb in various group, it could be seen in Table 2.

Table 2. Honeycomb Production Group of Giant Honeybee Colony in Kopmas Sungai Hilir Kiri Kampar

Honeycomb Production Group (kg) Total (kg) a B C d e

Total 1149.12 1555.2 1771.2 1382.4 907.2 6765.12

Average 76.6+ 59.24 97.2 + 70.51 110.7 + 85.63 86.4 + 54.64 56.7 + 27.13 422.8 + 196.50

As seen in Table 2, honeycomb production in group b,c,d was still dominant.

Percentage for group a,b,c,d, and e was 18.11 %, 22.98 %, 26.18 %, 20.44 % dan 13.41 %. Therefore, giant honeybee population without engineering still produced honey production at least 31.52% up to 68.48%. The honeycomb production could be seen in Figure 5.

Figure 5. Honeycomb of Giantbee in Various Group

Figure 5. Honeycomb of Giantbee in Various Group

It could be seen that low or high honey production in many groups was because of the different age of queen bee in each colony. The colony which had young queen bee (under 3 months) had less member. Likewise the hive with old queen bee. The existence of those colonies still produced honey optimally even without the queen bee help. That fact revealed that even though the population was not controlled , they still produced honey optimally. Tropical climate environment also supported honey production to be optimal. Phillips (20013) said, optimal temperature to breed the eggs is 35.9o C, means that the temperature is easy to reach in tropical area. As the result, life necessity was low and the production was high. The amount of black honey production from giant honeybee per colony

Honey inside the chopped hive comb was directly drained and it did not take too much time. The result of draining process was put into container as seen in Figure 6. Honey obtained was in good quality because it did not contain carcass or larva. Honey which contains larva fraction is easily contaminated, even the honey becomes aqueous (Morse and Hooper, 1985).Therefore, honey without larva fraction


PROCEEDING 2017 113

lasted longer than squeezed honey. Junus et al (2006) explained that honey which is extracted using extractor does not contain larva, so it is better than squeezed hone. Furthermore, honey which was extracted and evaporated using cool temperature would improve its quality without spoiled the honey component. Honey of giant honeybee was from various plantation nectar (sugar-rich liquid) so that it produced various components. As mentioned by Horn (1998), that kind of honey will have better benefits.

a. Result from honey draining b. Honey filtering Figure 6. Drained honey filtered in certain container

This process did not use honey extractor because the hole in the hive comb

was big enough and it let the honey came out easily from the hive. The groups of giant honeybee breeders or KOPMAS did not have honey extractor. Therefore, filtered honey was directly put in honey tube container, then it was flowed into bottles or trays which were ready to use for packaging or draining. Honey filtering machine and trays could be seen in Figure 7.

a.Pure honey b. Honey filtering Figure 7. Honey filtering process and pure honey tube

a b

a b


PROCEEDING 2017 114

The result of honey weighing in many honey production groups after filtering (before packaged) by KOPMAS and the total and average after it was statistically analyzed could be seen in Table 3.

Table 3. Honey Production Groups of Giant Honeybee Koloni in Kopmas Sungai Hilir Kiri Kampar

Honey Production Group (kg) A B c D e

Total 1149.12 1555.2 156.5 1451.52 842.4 Average 88.4 + 54.46 135.9 +63.84 1879.2 + 84.31 166.7 + 55.91 162.2+ 27.99

Referring to Table 3, honey production of group C was still dominant. Thus, figure of the most dominant honey production from group C could be explained in Figure 8.

Figure 8. Honeycomb Production Group of Giant Honeybee

Based on Figure 8, whether it was low or high giant honeybee colony produced honey was caused by existence of colony member, queen bee age and feed stock around the location. A colony which had many colony members indirectly would produce more feed. The young queen bee under 1 year could produce more eggs, thus it produced more colony members. Likewise, if there is much feed around the location, the honey would be more than others (Wiston, 1987). CONCLUSION AND SUGGESTION

Conclusion

1. Black giant honeybee could not be breed modernly, but it could be controlled by its natural supporting factors.

2. Production potential of black giant honeybee in producing colony, honeycomb, and honey was very big and that might be used as a job for people in forest area.

Suggestion

Pertaining to the research result, it is suggested that good coordination from each professional competence should be improved and applied in giant honey bee care.


PROCEEDING 2017 115

ACKNOWLEDGEMENTS

The researcher would express his profound sense of reverence to the Head of LPPM University of Brawijaya and the Dean of Faculty of Animal Husbandry for entrusting the researcher to do a research and seminar. His gratitude also goes to the head of Koperasi Masyarakat (Kopmas) Madu Sialang in KPHP KAMPAR KIRI for helping the researcher doing his research.

REFERENCES

Adam, B. 1985. Breeding the honeybee. A contribution to the science of breeding. Northern bee books. Mytholmroyd: Hebden Bridge. Horn, H. 1998. Beekeeping and Honey Quality Control. Fakultas Peternakan – Hohenheim University dan DAAD Germany. Penerbit Jurusan Produksi Ternak Fakultas Peternakan Universitas Brawijaya. Malang. Junus, 2006. Peranan umur ratu, jumlah sisiran eram dan pemakaian penyekat ratu pada awal musim bunga dalam meningkatkan produktivitas koloni lebah Apis

mellifera. Disertasi. Fakultas Pertanian Universitas Brawijaya. Unpublished.

Junus, M. Setiawan, Radiati, Minarti, 2006. Produktivitas madu fungsional dan tablet polen melalui freeze evaporator dan mesin pentabletan otomatis di Unit Perlebahan Koperasi Unit Desa Batu, Kemenristek (KRT). Proyek Riset Unggulan Kemitraan-LPPM Universitas Brawijaya. Malang. Unpublished. Morse, R. A and T. Hooper. 1985. The Illustrated Encyclopedia of beekeeping. Blandford Press Poole Dorset. Phillips. K, 2003. Climate control, bee style. J. Exp. Biol 206 (23): 4181-4183.

Ramli, 2014. Sejarah Kompmas dan proses pengambilan madu sialang. KPHP Model Unit XVIII Kampar Kiri Provinsi Riau. Unpublished Sasongko, D.D. and Junus, M. 2014. Management of Harvesting Honey bee Apis

dorsata at hutan Harapan PT. Reki Jambi. PKL. Fakultas Peternakan Universitas Brawijaya. Unpublished. Sasongko, D.D. dan Junus, M. 2014. Pengaruh jumlah sarang lebah ratu buatan terhadap calon lebah ratu pada akhir fase larva koloni lebah Apis dorsata Di kawasan PT Reki Jambi. Skripsi. Fakultas Peternakan Universitas Brawijaya. Unpublished. Nurrohman, Junus, M. 2013. Study of vegetation feed producing Apis dorsata bees in PT Reki Jambi. Praktek Kerja Lapang. Fakultas Peternakan Universitas Brawijaya. Unpublished.

Salmah, S. 2000. Kebijakan Pengembangan Perlebahan di Indonesia. Dirjen RLPS Dephutbun, Perum Perhutani dan Api Indonesia. Hal 1-11. Unpublished.


PROCEEDING 2017 116

CHARACTERIZATION OF LACTIC ACID BACTERIA

ISOLATED FROM KIMCHI WITH AVIEW FOR

DEVELOPMENT OF PROBIOTIC POTENTIAL

Swastini, D.A.1*, Agestiawan, I.G.A.M.1 and Ramona, Y.2,3

1School of pharmacy Faculty of mathematics and Sciences, Udayana University 2Integrated Laboratory for Biosciences and Biotechnology. Udayana University 3School of Biology, Faculty of Mathematics and Sciences, Udayana University


Abstract

A new paradigm in the therapy of pathogenic bacterial infection is the use of probiotics isolated from various fermented foods, such as kimchi. Kimchi is a Korean fermented vegetable in which lactic acid bacteria (LABs) are involved in its making processes. In our previous study, LABs isolated from this product was found to be resistant against low pH conditions (pH 4, 3 and 2). In this study, those LABs were further characterized for resistance on high levels of NaDC, its ability to convert colic acid into deoxycolic acid, and its ability to inhibit pathogenic bacterial growth (Escherichia coli and Staphylococcus aureus). The results showed that 15 out of 66 isolates showed resistant properties against high levels of NaDC, although its growth response decreased as the level of NaDC was increased. None of those isolates converted colic acid into deoxycolic acid, indicating that they are safe for human use. In dual culture assays in vitro, all LAB isolates inhibited the growth of E. coli and S.

aureus. These results confirmed that they have potential to be developed as human probiotic candidates, although further tests need to be conducted. Keywords: Probiotis, Lactic Acid Bacteria, Deoxycolic acid, Biotransformation of

colic acid, E. coli, S. aureus

BACKGROUND

Treatment of bacterial infections with antibiotic therapy will suppress the normal flora in the human digestive system, causing an imbalance of the normal flora resulting in an increase in colonization and infection of pathogenic microbes, increasing the risk of bacterial resistance to antibiotics, and occurring the resistance factor to be transmitted potentially among pathogenic microorganisms (Stephen et al., 2007). A new paradigm in the therapy of pathogenic bacterial infection is the use of probiotics (Hickson, 2011). Intensive researches have been done to isolate the lactic acid bacteria (LAB) from food, which is then tested its activity and competence as probiotics (Schingllier dan Lucke ,1989; Moulay et al.,2006; Tamang et al., 2008). Kimchi is a Korean traditional food which was made from mustard greens, radishes and cucumbers fermented by lactic acid bacteria. Various lactic acid bacteria can grow in the process of making kimchi (Lee et al., 2002). Some important species that have been known to participate in kimchi fermentation process is a group of bacteria Leuconostoc such as Leuconostoc mesenteroides, pseudomesenteroides


PROCEEDING 2017 117

L. and L. lactis and Lactobacillus groups such as Lactobacillus brevis and L. plantarum (Lee et al., 2002). The total of lactic acid bacteria in kimchi is reaching 108 cells/ gram (Song et al., 2009), which is greater than the yogurt drink (61 x 106 cells/ ml), which were investigated by Zakaria et al. (2010). Moreover, lactic acid bacteria contained in kimchi showed potential antitumor, antimutagenic, boost immunity, lower atopy, lowering the amount of the avian influenza virus, as well as lowering the production of gamma-aminobutyric acid (GABA) (Park and Kim, 2010). In our previous study, LABs isolated from this product was found to be resistant against low pH conditions (pH 4, 3 and 2) (Agestiawan et al, 2014). In this study, those LABs were further characterized for resistance on high levels of NaDC, its ability to convert colic acid into deoxycolic acid, and its ability to inhibit pathogenic bacterial growth (Escherichia coli and Staphylococcus aureus). MATERIALS AND METHODS

In this study, among the 66 isolates from Kimchi, 15 of them were chosen because they were homofermentative, negative catalase, gram-positive cell, trunk shaped, and resistant to low pH environment (pH 4, 3, and 2). Fifteen isolates were subsequently being tested. LAB Isolates’ Resistance of Natrium Deoxycholic test (NaDC)

A total of 50 μL of the bacterial suspension was put into four tubes which had contained 5 mL MRS broth media with various concentration of NaDC (0, 0,2 Mm; 0,4 mM;dan 0,6 mM), incubated for 24 hours at 37oC (Nocianitri et al., 2011). LAB isolates resilience demonstrated by the increasing of turbidity as measured by Optical Density (OD) at a wavelength of 660 nm. When the score of OD less than 0,1, the bacterial strain is categorized as not resistant to derivatives of cholic acid, and when the OD is 0,1 or greater than 0,1, the LAB strain is categorized as resistant to cholic acid derivatives. (Nocianitri et al., 2011; Hyronimus et al., 2000) Biotransformation of Cholic Acid into Deoxycholic Acid Activity Test

Fifty μL of bacterial suspension was inoculated into 5 mL MRS broth (pH 7) and added cholic acid until the concentration was 25mM, incubated for 24 hours at 37oC. One mL bacterial suspension was centrifuged at 5000 rpm for 5 minutes, then 0.1 ml of the supernatant was put in a eppendorf, added 20 mL of 3N HCl and 0.5 mL of ethyl acetate, being in the vortex for 1 minute and then centrifuged again with the speed of 5000 rpm for 5 minutes, the supernatant was subsequently being evaporated, while 500 mL of ethyl acetate was added into the sediment, centrifuged at 5000 rpm for 5 minutes, and the part of the supernatant was evaporated for 48 hours at room temperature (Sujaya et al., 2008a). Analyzed with TLC (Thin Layer Chromatography), the mobile phase a mixture of cyclohexane, ethyl acetate acetic acid (10:15:14). Biotransformation occurred was detected with molibdophosporic acid, and when the spot is black coloured after being heated in the oven for 1 to 2 minutes (Sujaya et al., 2008a). The ability of inhibit microbial pathogen test

Pathogen bacteria suspension Escherichia coli and Staphylococcus aureus were taken 0.1 mL, put into the sterile petri dish, added 15 mL of 55oC sterile NA,


PROCEEDING 2017 118

and being homogenized. After the suspension became frozen, a 4 mm diameter well were made in the agar. In a total of 50 μL culture from the stock culture were inoculated in a 5 mL MRS broth, incubated for 24 hours, centrifuged at 3000 rpm for 15 minutes, and the supernatant-free cells obtained were collected in the micro tube. 10 μL of supernatant-free LAB cells were added into the well, settled for 20 minutes and then incubated for 24 hours at 37oC. Inhibition of isolates was characterized by the formation of clear zones around colonies of pathogenic bacteria (Sujaya et al., 2008b; Schillinger and Lucke, 1989). LAB isolates inhibitory activity against pathogenic bacteria were measured by the diameter of clear zone on the media. The activity is expressed “High” if the diameter of inhibitory zone reached more than 25 mm, “Medium zone” if the diameter of inhibitory ranged from 13-25 mm, and “Low” if the diameter of inhibitory zone ranges from 0-12 mm (Hutt et al., 2006).

RESULTS

Resistance test of LAB isolated from Kimchi against Sodium Deoxy Cholic

(NaDC).

In this study, all the LAB isolates showed a resistance against NaDC at the concentration of 0.2 mM with the total of cells is approaching the total of control cells. When the concentration was increased (0.4mM), most of the isolates (11 isolates) had a total of cells as many as the total of control cells. A decreasing in OD readings occurred significantly when the concentration was 0.6mM and only 6 isolates that have categorized as resistance to bile salt.

Figure 1. Result of LAB Isolate’s Resistance of Natrium Deoxycholic test in Various

Concentration. 4 isolate that have strongest resistance against 0.6 mM DCA.

Biotransformation of Cholic Acid into Deoxycholic Acid Activity Test

It was done with 4 LAB isolates (kim 19,21,23, and 26) which were isolated from Kimchi with the strongest resistance against 0.6 mM DCA. The result showed that all of the isolates tested did not perform a biotransformation activity of cholic acid into deoxycholic acid, so that isolates may be developed potentially as a new probiotic.


PROCEEDING 2017 119

Figure 2. Result of Biotransformation of Cholic Acid into Deoxycholic Acid Activity Test with TLC Method. (a) MRS broth media (b) MRS broth media with

cholic acid (c) cholic acid (d) Deoxycholic acid (e) Kim 19 isolate (f) Kim 21 isolate (g) Kim 21 isolate (h) Kim 26 isolate

The ability of inhibit in vitro E. coli and S. aureus test

Figure 3. Inhibitory zone of microbial pathogen (A) E. coli (B) S. aureus by

supernatant-free LAB cells isolated from Kimchi in NA media. Table 1. The ability of free-supernatant cells of BAL to inhibit pathogenic bacterial

growth (Escherichia coli and Staphylococcus

No Isolate Code

LAB cell supernatant inhibition against microbial pathogen E. coli S. aureus

1 Kim 7 Low Medium 2 Kim 9 Low Low 3 Kim 18 Low Low 4 Kim 19 Low Medium 5 Kim 20 Low Low 6 Kim 21 Low Low 7 Kim 23 Low Low 8 Kim 26 Low Low 9 Kim 36 Low Low 10 Kim 41 Low Low 11 Kim 45 Low Low 12 Kim 48 Low Low 13 Kim 55 Low Medium 14 Kim 59 Low Low 15 Kim 64 Low Low

Note : - : No inhibitory zone; Low : Inhibitory zone’s diameter is 0-12 mm; Medium : Inhibitory zone’s diameter is 13-25 mm; High : Inhibitory zone’s diameter > 25 mm

(Hutt et al., 2006).


PROCEEDING 2017 120

DISCUSSIONS

The ability of bacteria to survive in an environment containing NaDC was very closely related to the ability of the isolates to produce the bile salt hydrolase (BSH) enzyme (Corzo and Gilliland, 1999). Some trunk shaped lactic acid bacteria such as Lactobacillus and Bifidobacterium have been widely reported able to produce BSH enzymes that play a role in the process of hydrolysis of the amide bond that occurs bile salts conjugated. This will result in inactivated bile salts (Begley et al, 2004). The resistance of LAB isolated from kimchi may be caused by this mechanism, although it still needs to be elucidated further.

Another ability that should be met by a bacterium before it was developed into a new probiotic is not doing biotransformation the cholic acid into deoxycholic acid (Iryana, 2008). This relates to the safety reasons for humans who consume the probiotics. According to Brady et al. (2000), Pato (2003) and Liong (2008), the incidence of colon cancer is closely related to the high concentration acid deoxy cholic in the digestive tract. In addition, the quantities of bile acids and their derivatives can be cytotoxic to abnormal mucosal cells (Stamps and Jenkins, 2008). Therefore, although a strain of bacteria has superior characteristics as probiotics, further development will not be done if these strains do the biotransformation of CA into DCA.

Probiotics are often used in the field of health, especially as a supportive therapy or support in handling cases of diarrhea. This is done because some probiotics could inhibit the development of pathogenic bacteria and the metabolic activity in the gastrointestinal tract (Vrese and Marteau, 2007). The data obtained in this study (Table 1) shows the inhibition of two species of enteric pathogen with low to medium inhibitory because only the free-supernatant cells of bacteria are involved and need to be elucidated further on the ability of the cells of the bacteria.

Data in Table 1 shows that E. coli is relatively more resistant than S. aureus. This phenomenon is closely related to differences in the composition of the cell wall of the pathogen. Gram-positive bacteria have no outer membrane, so that the antimicrobial compound can easily get into the cells of gram-positive bacteria (Raftari et al, 2009). Therefore, gram-positive bacteria is indicated more sensitive to toxic compounds in the environment.

Inhibition of bacterial pathogens by LAB can occur through a variety of mechanisms, such as the production of lactic acid to lower the pH of the environment (Salminen and Wright, 2004; Gotcheva et al, 2002), the production of antibiotics (De Muynck et al, 2004), the production of nisin (Rattanachaikunsopon and Phumkhachorn, 2010) or the production of bacteriocins (Zacharof and Lovin, 2012.). In addition, LAB is able to accumulate hydrogen peroxide with a sizeable amount because of the unproduced catalase enzyme (Santoso et al., 2013). A decrease in the pH of the environment caused by lactic acid, acetic acid and hydrogen peroxide cause a disturbance in the function of the cell membrane of pathogenic bacteria, causing the death of cell (Pelczar et al, 1993). CONCLUSIONS

The results showed that 15 out of 66 isolates showed resistant properties against high levels of NaDC, although its growth response decreased as the level of


PROCEEDING 2017 121

NaDC was increased. None of those isolates converted colic acid into deoxycolic acid, indicating that they are safe for human use. In dual culture assays in vitro, all LAB isolates inhibited the growth of E. coli and S. aureus. These results confirmed that they have potential to be developed as human probiotic candidates, although further tests need to be conducted

REFERENCES

Begley, M., Cormac, G. M., Gahan, dan Colin, H. 2004. The Interaction Between Bacteria and Bile. FEMS Microbiology Reviews. 29: 625-651 Brady, L. J., Gallaher, D., dan Busta, F. F. 2000. The Role of Probiotic Culture in Tolerance Isolates from Strains of Lactobacillus acidophilus. Journal Dairy Sci. 62: 23-31 Corzo, G. dan Gilliland, S.E. 1999. Bile Salt Hydrolase Activity of Three Strains of Lactobacillus acidophilus. J. Dairy Sci. 82: 472 – 480. De. Muynck, C., Annelies, I. J. L., Sofie, D. M., Filip, A., Wim, S., dan Erick, J. V. 2004. Potential of Selected Lactic Acid Bacteria to Produce Food Compatible Antifungal Metabolites. Microbiological Research 15: 339—346 Gotcheva, V., Eli, G., Tsonka, H., Mingruo, G., Zlatka, R., dan Angel, A. 2002. Assessment of Potential Probiotic Properties of Lactic Acid Bacteria and Yeast Strains. Food Biotechnology. (16) : 211-225 Hickson, M. 2011. Probiotics in the Prevention of Antibiotic-Associated Diarrhea and Clostridium difficile Infection. Ther Adv Gastroenterol 4(3): 185- 197 Hutt, P., Shchepetova, J., Loivukene, K., Kullisaar, T. dan Mikelsaar. 2006. Antagonistic Activity of Probiotic Lactobacilli and Bifidobacteria Against Entero- and Uropathogens. Journal of Applied Microbiology. P: 1324-1332 42 Hyronimus, B., Mareec, L. C., Sassi, A. H., dan Deschamps, A. 2000. Acid and Bile Tolerance of Spore-forming Lactic Acid Bacteria. J. Food. Microbiol, 6(2): 193-197. Iryana, S. 2008. Preclinical Testing in the Development of Probiotics: a Regulatory Perspective with Bacillus Strains as an Example. Clinical Infectious Disease. 46: 92-95 Lee, J. S., Lee K. C., Ahn, J. S., Mheen, T. I., Pyun Y. R., dan Park, Y. H. 2002. Weissella koreensis Sp. Nov., Isolated From Kimchi. Korea Research Institute Of Bioscience And Biotechnology. 52(4):1257-61 44. Liong, M. T. 2008. Role of Probiotics and Prebiotics in Colon Cancer Prevention: Postuled Mechanism and In-vivo Evidence. Journal Mol Sci. 9(5): 854-863


PROCEEDING 2017 122

Moulay, M., Aggad, H., Bemmechernene, Z. Guessas, B., Henni, D. E. dan Kihal, M. 2006. Cultivable Lactic Acid Bacteria Isolated from Algerian Raw Goat’s Milk and Their Proteolytic Activity. World Journal Of Dairy & Food Sciences. (1): 12-18 Nocianitri, K. A., Permana, I. D. G. M., dan Sujaya, I. N. 2011. Skrining Lactobacillus Spp. untuk Pengembangan Probiotik Berbasiskan Susu Kedelai. The Exellence Research 8: 113-120 Park, K. Y. dan Kim, B. K. 2010. Kimchi Lactic Acid Bacteria and Health Benefits. Korea: Pusan National University. Pato, U. 2003. Potensi Bakteri Asam Laktat Yang Diisolasi dari Dadih untuk Menurunkan Resiko Penyakit Jantung. J. Natur Indonesia. 5(2): 162- 166. Rattanachaikunsopon, P dan Phumkhachorn, P. 2010. Lactic Acid Bacteria: Their Antimicrobial Compounds and Their Uses in Food Production. Annals of Biological Research. (4) : 218-228. Salminen S, dan Wright A. V. 2004. Lactic Acid Bacteria. Microbiology and Functional Aspects. 2nd Ed. New York NY (USA): Marcell Dekker, Inc. Santoso, B., Maunatin, A., Hariadi, B. T., dan Abubakar, H. 2013. Isolasi dan Identifikasi Bakteri Asam Laktat Asal Rumput Raja (Pennisetum purpureophoides) sebagai Kandidat Probiotik pada Ternak. JITV. 18(2): 131-137. Schingllier, U. dan Lucke, F. K. 1989. Antibacterial Activity of Lactobacillus sake Isolated from Meat. Appl. Environ. Microbiol. 55(8): 1901–1906 Song, B. S., Park, J. G., Park, J. N., Han, I. J., Kim, J. H., Choi, J. I., Byun, M. W., Lee, J. W. 2009. Korean Space Food Development: Ready-To-Eat Kimchi, A Traditional Korean Fermented Vegetable, Sterilized with High-Dose Gamma Irradiation. Life Sciences in Space. 44(2): 162-169 Stephen, O., Meiss, D., dan Ralston, J. 2007. Probiotics and Antibiotic-Associated Diarrhea. ProThera 4:775-785 Stamp, D dan Jenkins, G. 2008. An Overview of Bile Acid Synthesis, Chemistry and Function. Royal Society of Chemistry pp 5-8 Sujaya, N., Dwipayanti, N. M. U., Suariani, N. P., Widarini, N. P., Nocianitri, K. A., dan Nursini, N. W. 2008a. Potensi Lactobacillus spp. Isolat Susu Kuda Sumbawa Sebagai Probiotik. J. Veteriner, 9(1): 33-40. Sujaya, N., Ramona, Y., Widarini, N. P., Suariani, N. P., Dwipayanti, N. M. U, Nocianitri, K. A., dan Nursini, N. W. 2008b. Isolasi dan Karakterisasi Bakteri Asam Laktat dari Susu Kuda Sumbawa. Jurnal Veteriner. 9(2): 52-59 Tamang, B., Schilinger, U., Franz, C. A. M. P., Gores, M., dan Holzapfel, W.H. 2008. Phenotytpic And Genotypic Identification Of Lactic Acid Bacteria Isolated


PROCEEDING 2017 123

From Ethnic Bamboo Tender Shoots Of North East India. Int. J. Food Microbiol. 121 (1): 35-40 Vrese, D. M. dan Marteau, P. R. 2007. Probiotics and Prebiotics: Effect on Diarrhea. J Nutr 137(3): 3-11 Zacharof, M. P. dan Lovin, R. W. 2012. Bacteriocins Produced by Lactic Acid Bacteria : A Review Article. APCBEE Procedia (2): 50-56 Zakaria, Y., Novita, C. I., dan Delima, M. 2010. Keamanan Susu Fermentasi yang Beredar di Banda Aceh Berdasarkan Nilai Gizi dan Jumlah Bakteri.


PROCEEDING 2017 124

DETECTION OF ANTIBACTERIAL COMPOUND OF Piper betle

L. PURIFIED EXTRACT AGAINTS Propionibacterium acnes

BY BIOAUTOGRAPHY

Ni Luh Putu Vidya Paramita*, Ni Wayan Budiningrum, Anak Agung Gede Rai

Yadnya Putra, Putu Sanna Yustiantara and I Made Agus Gelgel Wirasuta

Department of Pharmacy, Faculty of Mathematic & Science

University of Udayana, Jimbaran-Bali, 82121 *Corresponding author: [email protected]

Abstract

Propionibacterium acnes are one of bacterial in skin surface which triggering an inflammation in acne. Purified extract of Piper betle Leaf has been reported for antibacterial activity against Propionibacterium acnes. The aim of this study was to detection of antibacterial compound of P. betle L. purified extract against P. acnes by bioautography method. Purified extract was obtained by partitioning the crude extract with immiscible solvent to obtain n-hexane, and aqueous fraction. The Aqueous fraction known as purified extract. Antibacterial test method used is kirby-bauer disk diffusion test to find out effective inhibition concentration against P. acnes. The average diameter of the inhibition zones were analyzed using inhibition response category from Clinical and Laboratory Satandart Institute (CLSI). Detection of antibacterial compound was evaluated using TLC contact-bioautography. The inhibition zones were observed on the agar surface in the places where the spots of antimicrobials are stuck in the agar. Screening phytochemical of the inhibition zone was observed using reagents phytochemical such as ammonia (flavonoid), sitroborat (flavonoid), AlCl3 (flavonoid), FeCl3 (phenol), folin-ciocalteau (phenol), Liebermann burchard (triterpenoid and steroid), annisaldehyde-H2SO4 (terpenoid), dragendrof (alkaloid). Antibacterial compound which inhibit the growth of P. acnes was showed in HRf 37 on agar surface. Phenol or derivates phenol and terpenoids in Piper betle were responsible for the antibacterial activity of P. betle against P. acnes. The flavonoid compound in Purified extract of P. betle are not active to inhibit the growth of P. acnes. Phenol or derivates phenol in P. betle is known like eugenol, hydroxychavicol, and chavibetoL, etc., P. betle also reported contain a Sesquiterpens. Investigation of active compound using GC-MS are needed. Conclusion: Altough purified extract of P.

betle consist the highest amount of flavonoid, but the antibacterial compound for inhibition the P. acnes colonies were phenol or derivates phenol and terpenoids.

Keywords: Piper betle, Phenol, Derivates phenol, Contact-Bioautography, TLC

BACKGROUND

Acne is a skin disease characterized by the appearance of spots freckle face area, chest and back, the appearance of blackheads papules, pustules, cysts, nodules, and scars (Pothitirat, et al, 2010; Batubara et al, 2010). The development of acne are influenced by the increased production of sebum, bacterial colonization of


PROCEEDING 2017 125

Propionibacterium acnes in the ducts and inflammation pilosebaseus (Jappe, 2003). Treatment of acne requires a compound that can inhibit P. acnes population and inhibit the lipase activity of P. acnes so as to decrease pro-inflammatory lipids in sebum and reduce the possibility of formation of the wound after the onset of acne . Compounds that have antioxidant activity beneficial to reduce the formation of hypertrophic and keloid scars on the skin. So in other words, compounds capable of controlling acne must possess antibacterial activity, antilipase, anti-inflammatory, and antioxidant (Batubara et al, 2010). Piper betle Leaf have been reported to have antioxidant and anti-inflammatory activity (Alam, 2012; Putri, et al, 2013). The screening method for the detection of antimicrobial activity are diffusion, dilution, and bioautography. Diffusion and bioautography are qualitative method, because its only give the absence or presence of antimicrobial substances. Dilution is quantitative techniques to determine the minimal inhibitory concentration.

The Screening method for detection antibacterial activity of Piper betle Leaf against Propionibacterium acnes have been proven using diffusion techniques. That research showed that purified extract are more effective for the antibacterial activity against Propionibacterium acnes than crude extract. Purified extract of Piper betle

are considered to have sufficiently potent activity for use as an antiacne agent and this extract yielded the highest amount of flavonoid (Widyaningtias, 2014). Research on the antibacterial compounds which are responsible for inhibiting the growth of bacteria Propionibacterium acnes has not been proved. Bioautography method is a simple method for the detection of antimicrobial compound, which hyphenated with Planar Chromatography system. This method is effective and inexpensive technique for phytochemical analysis of plant extract. There are three method for antimicrobial bioautography, such as, i) contact bioautography, ii) direct bioautography, and iii) agar overlay bioautography. In this research, we used contact or agar diffusion bioautography method for detection antimicrobial compounds. It offer a rapid and easy identification of bioactive compound in complex matrices of plant extracts (Dewanjee, et al, 2014; Choma and Grzelak, 2014). This research aimed to detect antibacterial substances from Piper betle Leaf purified extract which responsible inhibit the growth of Propionibacterium acnes by contact bioautography method.


Piper betle L Leaf, which has been tested determination before use in Botanical Garden “Eka Karya” Bali - Lembaga Ilmu Pengetahuan Indonesia (LIPI), Ethanol (Technical, brataco). Bacterial isolates of Propionibacterium acnes obtained from the Laboratory Microbiology, School of Pharmacy, Institute Technology Bandung (ITB), which has been tested confirmation before use in UPT Balai Laboratorium Kesehatan Provinsi Bali. Mueller Hinton Agar (MHA) (Oxoid®), Doxycycline disc (Oxoid®), suspending agent (CMC-Na 0,5% b/v), standart 0.5 Mc. Farland, TLC Aluminium Silica Gel 60 GF 254, n-hexane (p.a, Merck), ethyl acetat (p.a, Merck), aquadest, reagents, such as, Folin-Ciocalteu, FeCl3 5% b/v, ammonia, sitroborat, AlCl3, Liebermann burchard, annisaldehyde-H2SO4, dragendrof.

Extraction

Purified extract was obtained by partitioning the crude extract with immiscible solvent to obtain n-hexane, and aqueous fraction. Piper betle Leaf


PROCEEDING 2017 126

powders were extracted by using a maceration method with 96 % ethanol solution to find out the crude extract. Then, The crude extracts were partitioned respectively by using the immiscible solvents i.e. n-hexane, ethanol and Aquades to obtain n-hexane fraction, and aqueous fraction. The aqueous fraction known as purified extract.

Antibacterial assay

The antibacterial test was conducted by using kirby-bauer disk diffusion method (Wanger, 2009); the medium used was MHA. the bacterial suspension of 0.5 Mc. Farland was swab on the surface of the agar medium by using cotton swabs. After the solid paper disk containing the test compound was placed on the medium, and then it was incubated during 18-24 hours at the temperature of 370C. A paper disk sized 6 mm in diameter was used in the test. The concentrations of fractions tested were 40 mg/mL, 80 mg/mL, 160 mg/mL, 320 mg/mL, and 640 mg/mL. Doxycycline disc as positive control was 30 µg. The clear zone around the paper disk indicated the test sample that could inhibit the bacterial growth. The value of the inhibition zone was obtained by calculating the average diameter of the clear zone. The average diameter of the inhibition zones were analyzed using inhibition response category from Clinical and Laboratory Satandart Institute (CLSI) that is Susceptible (the inhibition zone ≥ 20 mm), Intermediate (the inhibition zone 15 – 19 mm), Resistant (the inhibition zone ≤ 14) (Cockerill, et al.,2012).

Bioautography assay

The method for detection antimicrobial compounds was contact or agar diffusion bioautography. TLC plate aluminium silica Gel 60 GF 254 was eluted with n-hexane: ethyl acetat (7.2:2.9) v/v. The chromatogram is placed face down onto the inoculated agar layer for one hour to enable diffusion. Then the chromatogram is removed and the agar layer is incubated during 18-24 hours at the temperature of 370C. The zones of inhibition on the agar surface, corresponding to the spots in chromatographic plates, are indicative of the antimicrobial substances. The Identification of antimicrobial substances were used any reagents, such as ammonia (flavonoid), sitroborat (flavonoid), AlCl3 (flavonoid), FeCl3 (phenol), folin-ciocalteau (phenol), Liebermann burchard (triterpenoid and steroid), annisaldehyde-H2SO4 (terpenoid), dragendrof (alkaloid).

RESULTS

Based on the results of the diffusion test (table 1), it can be seen that the increasing concentration of the sample are linier to the inhibition zone diameters. Seen at the concentrations of 640 mg/mL showed intermediete activity against P.

acnes with diameter of inhibition zone at 18.44 ± 0.05 mm. Bioautography test results indicate the presence of inhibition zones shown in

Figure 1 with Rf value (Rf 3.7). The phytochemical screening of purified extract of P. betle Leaf revealed the presecence of secondary metabolites such as flavonoid, phenols and terpenoid. The secondary metabolite which responsible to antibacterial activity against P. acnes were phenols because the spott shown black colour with FeCl3 and blue colour with Folin- Ciocalteau. The spott also have a positive results with annisaldehyde-H2SO4 which shown a purple to red colour.


PROCEEDING 2017 127

Table 1. Diameters of inhibiton zones of Purified Extracts of Piper betle L. and Doxycycline

Sample Diameters of inhibition

zones (mm) Inhibition rensponse category by CLSIa

Purified Extract (mg/mL) 40 10.62 ± 0.13 resistant 80 12.05 ± 1.26 resistant 160 13.52 ± 0.39 resistant 320 16.44 ± 0.4 intermediate 640 18.44 ± 0.05 intermediate

Doxycycline Disc (30 µg) 24.55 ± 0.05 susceptible a = Cockerill et al.,2012

Figure 1. Antibacterial activity of Purified extract (P2) of Piper betle L. against Propionibacterium acnes using TLC Al Silica Gel 60 GF 254 as stationary phase and

with n-hexane: ethyl acetat (7.2:2.9) v/v as a mobile phase.

Figure 1. Phytochemical Screening of Chromatograms of Piper betle L. Purified extract (P2) using TLC Al Silica Gel 60 GF 254 as stationary phase and with n-

hexane: ethyl acetat (7.2:2.9) v/v as a mobile phase: a) White lamp, b) UV 366, c) UV 254, d) Ammonia, e) Sitoborat, f) AlCl3 g) FeCl3 h) Folin - ciocaltecu, i)

Liebermann Burchad, j) Anysaldehide, k) Dragendroff

a b c d e f g h i j k


PROCEEDING 2017 128

DISCUSSIONS

Propionibacterium acnes is intermediate with 640 mg/mL of purified extract of P. betle Leaf. It response rates are lower than doxycycline which shown susceptible response. Intermediate response means that 640 mg/mL of purified extract of P. betle Leaf attainable to blood and tissue level while the dosage of doxycycline can treat the site of infection (Cockerill et al.,2012). Each microorganisms could have different response with the same antimicrobial agent. Piper betle Leaf are known empirical to treat fungal infection. It’s antifungal activity to Candida albicans show susceptible response (Ali, et al, 2010; Wirasuta IMAG, et al, 2016). The secondary metabolit which responsible for antifungal activity have closer chemical structure with eugenol (Wirasuta IMAG, et al, 2016). The isolate hydroxychavicol of P. betle is proof as antifungal activity against Candida albicans

(Ali, et al, 2010). Based on their chemical structure, eugenol and hydroxychavicol categorized

as phenol or derivates phenol. Bioautography assay reported that Purified extract of P. betle Leaf contains a flavonoid but it is not the metabolite which inhibited the growth of P.acnes. The Inhibition zones on Rf value (Rf 3.7) shown that phenol or derivates phenol and terpenoids are responsible to antibacterial activity against P.

acnes. The DART mass spectra show peaks corresponding to phenol or derivates phenol such as chavicol, allylpyrocatechol, chavibetol, chavicol acetate, allylpyrocatechol acetate, chavibetol acetate, allylpyrocatechol diacetate, and also corresponding to sesquiterpens. It’s means that P. betle are consists of phenol or derivates phenol and terpenoids compounds. The phenol or derivates phenol and terpenoids are secondary metabolites of betel oil (Essential oil of Piper betle). The flavour of betel oil are characteristic by the betel phenol. Bioautography methods hyphenated with planar chromatography can used as a screening methods to find an antimicrobial compound (Dewanjee, et al, 2014; Choma and Grzelak, 2014). Because of the antibacterial compound are phenol or derivates phenol and terpenoids compound are composer of betel oil we need to continue this research with another methods such as GC-MS which known have a better separation and identification.

CONCLUSION

Altough purified extract of P. betle consist the highest amount of flavonoid, but the antibacterial compound for inhibition the P. acnes colonies were phenol or derivates phenol and terpenoids.

ACKNOWLEDGEMENT

This research was founded by Faculty of Mathematic & Science, Universitas

Udayana, No: 2721//UN14.1.28/LT/2016.

REFERENCES

Alam, B., F. Akter, N. Parvin, R.S. Pia, S. Akter, J. Chowdhury, K.S. Jahan, and E. Haque. 2013. Antioxidant, analgesic and anti-inflammatory activities of the


PROCEEDING 2017 129

methanolic extract of Piper betleleaves, Avicenna Journal of Phytomedicine, 3(2); 112-125 Ali, I., F.G. Khan, K. A Suri, B. D. Gupta, N. K. Satti, P. Dutt, F. Afrin, G. N. Qazi, I. A. Khan. 2010. In vitro antifungal activity of hydroxychavicol isolated from Piper betle L., Annals of Clinical Microbiology and Antimicrobials, 9(7): 1-9 Choma, I.M. and E.M. Grzelak. 2011. Bioautography detection in thin-layer chromatography, Journal of Chromatography A, 1218(19) : 2684-2691 Cockerill, F.R., Matthew A. W., Jeff A., Michael N. D., George M. E., Mary J. F. 2012., Performance Standards for Antimicrobial Disk Susceptibility Tests; Approved Standard—Eleventh Edition. CLSI document M02-A11. Wayne, PA: Clinical and Laboratory Standards Institute., p. 1-4 Dewanjee, S., M. Gangopadhyay, N. Bhattacharya, R. Khanra, and T. K. Dua, 2015, Bioautography and its scope in the field of natural product chemistry, Journal of

Pharmaceutical Analysis, 5(1): 75-84 Pothitirat, W., M.T. Chomnawang, W. Gritsanapan, 2010, Anti-Acne-Inducing Bacterial Activity of Mangosteen Fruit Rind Extracts, Medical principles and practice, 19:281–286 Batubara, I., H. Kuspradini, and T. Mitsunaga, 2010, Anti-acne and Tyrosinase Inhibition Properties of Taxifolin and Some Flavanonol Rhamnosides from Kempas (Koompassia malaccensis), Wood Research Journal, 1(1); 45-49 Jappe, U., 2003, Pathological Mechanisms of Acne with Special Emphasis on Propionibacterium acnes and Related Therapy, Acta Derm Venereol, 83; 241-248 Wirasuta, IMAG, I G.A.M. Srinadi, I. B.G. Dwidasmara, N.L.P.P. Ardiyanti, I G.A.A. Trisnadewi, N.L.P.V. Paramita, 2016, Authentication ofPiper betle L. folium and quantification of their antifungal-activity, Journal of Traditional and

Complementary Medicine, 1-8 Wanger, A., 2009, Antibiotic susceptibility Testing, in: Goldman, E., dan Green, L.H., Practical Handbook of Microbiology, 2nd Ed., New York, CRC Press, p. 149 – 154 Widyaningtias, N.M.S.R., Yustiantara, P.S., and Paramita. N.L.P.V., 2014. Uji Aktivitas Antibakteri Ekstrak Terpurifikasi Daun Sirih Hijau (Piper betle L.,) Terhadap Bakteri Propionibacterium acnes. Jurnal Farmasi Udayana, Vol 3 (1) pp 1-4


PROCEEDING 2017 130

ROLE OF NATIVE MYCORRHIZAE Gigaspora, Acaulospora

AND Glomus sp ON THE GROWTH OF CASHEW NUT

(Anacardium occidentale L.) SEEDLINGS

Meitini W. Proborini

Departement of Biology, Basic Science Faculty University of Udayana Email address: [email protected] / [email protected]

Abstract

Endomycorrhiza can strategically be applied as an effort to overcome the

problem of agriculture at arid region such as at north-east and north-west of Bali. Many plant studies at marginal area reported the significant role of endomycorrhiza on boosting the growth rate, productivity and its resistance to plant diseases. Only few research concern on application of Endomycorrhiza in Bali. Therefore it is strategic to conduct a research for indigenous Bali endomycorrhiza. The aim of this study was to formulate combining number of Glomus, Gigaspora and Acaulospora spores (0, 45, 60, 75 and 90) for cashew nut nursery (Anacardium occidentale) with three replication. The experiment was conducted at green house of Biology Department Basic Science Faculty Udayana University. The results showed there were positivally on the growth response of A. occidentale seedling (number of leaves and height of plant) by 75 number of spores. Therefore there was no significant effect on the response of A. occidentale seedling by 90 number of mycorrhizal spores. This finding indicate that the optimum number of spore was 75 spores take a positive role on the growth of cashew nut seedlings. Keywords: Endomycorrhza, spores, Indigenous Bali, Cashew seedlings

BACKGROUND

Vesicular Arbuscular Mycorrhizal (VAM) fungi are beneficial microorga-nisms that form symbiotic association with the fine roots of vascular plants (Al-Zalzaleh et al., 2009) and can be utilized as bio-fertilizers supporting the plant growth because the mycorrhizal fungi play an important role in improving plant growth, nutrient uptake especially phosphorous (Brundrett et al., 2008) and provide stress tolerance and disease resistance to plants (Smith et al., 2010).

The use of endomycorrhizal fungi as bio-fertilizer may improve longer branching of plant roots and the hyphae grow from the root to soil enabling the plant roots to contact with wider area of soil surface, hence increasing the absorbing area for water and nutrients absorption of the plant root system (Smith et al., 2010). Efforts are being made to improve the quality of seedlings under nursery conditions through inoculation of suitable endomycorrhiza only or combined with other organic and an-organic fertilizer may improve the growth of seedlings (Gill et al. 2002).

Plantation of Cashew-nut (A. occidentale L) in arid region of North-East of Bali plays an important role in the economic prosperity for farmers and industry. However, the yields of cashew nut remain few and low quality due to a loss of soil fertility, pest and disease damages. The dependence of endomycorrhizal Fungi


PROCEEDING 2017 131

associated with Cashew nut is not known therefore endomyccorhizal symbiosis could be a way of resolving these constraints, indeed its usage requires the knowledge of the fungal symbionts. This study aimed on the usage of mixed spores of Glomus,

Gigaspora, Acaulospora (i.e. 0, 45, 60, 75 and 90) on the growth of cashew (A.

occidentale L.) seedlings at the green house of Agriculture faculty University of Udayana Bali for 6o days.


The spores of endomycorrhizal fungi Glomus, Gigaspora, Acaulosporap were isolated from the rhizosphere of Anacardium occidentale L plants and mass produced on maize (Zea mays) for three months. Seedlings of Anacardium occidentale L were procured from Divisional Forest Nursery of Bali Province.

One seedling of Anacardium occidentale L was grown in polybags containing mixture of zeolit and soil (2000 g). The number of mycorrhizal spores ( i.e. 0, 45, 60, 75 and 90) were added along with roots. Observations were recorded 60 days on seedlings shoot length (increase in height), shoot weight and root weight. Percentage of mycorrhizal root colonization, number of mycorrhizal (VAM) spore and phosphorous content of seedlings were analized and three replicates of each treatment were taken.

Percentage mycorrhizal root colonization was studied according to Brundrett at al. (2008). The VAM spore quantification was also determined according to Gerdemann and Nicolson (1963). Phosphorous content was determined by vanadomolybdate phosphoric yellow colour method RESULTS AND DISCUSSIONS

Result of the research on then 60 days’ growth, the seedling of A occidentale

responded to spores inoculation of endomycorrhizal spores showed better growth than in the control (Table 1).

Table 1. Growth of cashew seedlings inoculated with endomychorrhizal spores on 60 days

Treatment A B C D E F Control 15.0±2.82 7.0±0.70 6.95±0.31 6.05±0.45 5,0±0.53 0.35 30 spores 27.5±2.75 15.5±0.35 10.91±0.81 6.40±0.14 46.6±2.07 0.36 60 spores 28.5±3.01 21.0±2.82 10.81±1.22 6.85±0.17 69.6±1.34 0.42 75 spores 31.3±2.22 22.0±2.02 13.82±0.22 7.45±0.23 85.6±1.34 0.55 90 spores 30.3± 2.01 21.0±4.25 7.62±0.87 6.65±0.45 86.65±2.6 0.52

# Mean of five replicates each, ± Standard error. A. Height of seedlings (cm), B. Length of root (cm). C. Shoot dry weight (g),

D. Root dry weight (g), E. Colonization ( % ), F. P content

The research showed that endomyccorhizal inoculation of 75 spores have the highest responses in all treatments of cashew seedlings (table 1). This is indicated that the inoculation of endomycorrhizal spores on the cashew seedlings has beneficial function the growth of seedlings, i.e. it can increase the shoot and root development and also it able to elongate the root system of cashsew seedlings.


PROCEEDING 2017 132

According to Bhattacharya et al. (2000), seedling response to phosphate addition and inoculation with arbuscular mycorrhizas and after 12 weeks, the biomass and P uptake were greater than those of the non-mycorrhizal plants across all P treatments. Satter et al (2005) who studied on the influence of arbuscular mycorrhiza and phosphate rock on uptake of major nutrients by Acacia mangium seedlings on degraded soil. They found that use of nutrient absorbed by seedling was more efficient in the endomycorrhiza-inoculated seedlings compared than that in uninoculated seedlings. A relative low growth as observed in Vitex negundo may be due to host specificity or the root exudates which produces phyto-toxic substances. Differences among hosts were observed in the amount of hyphae, arbuscules, and vesicles produced by the fungi, which could be attributed to growth and development characteristics among hosts and VAM fungi (Kramnik et al, 2007).

There is an interesting trend on the root length, dry shoot and roots in which the 75 and 90 number of spores were highest among treatment and control. The seedlings inoculated with all VAM fungi had increased phosphorous content of shoot and root over that in the control. The increased rate of P uptake and inflow in roots is regarded as the major contribution of VAM infection (Gautam Shrestha, 2009 ; Kumar et al., 2002). The VAM colonization increased initially up to 45 days but decreased thereafter. The positive mycorrhizal response at early seedling stage, may be due to the increase in root development.

Bhattacharya et al. (2000), working on the arbuscular mycorrhizal dependence of Eucalyptus tereticornis, found both negative and positive response of VAM fungi inoculation and concluded that E. tereticornis may not be an arbuscular mycorrhizadependent plant at early developmental stage, although it is infected by arbuscular mycorrhizal fungi freely, improving its phosphorus acquisition efficiency in low phosphorus soil. Influence of VAM fungi (Glomus invermaium) and sheathing (ECM) ectomycorrhiza (Descolea maculata) on early growth of Eucalyptus globulus

have been reported by De Olieviera et al. (1999a,b). Earlier studies by Kumar et al. (2002) and Hazarika et al. (1999) also found

Glomus mosseae inoculation to have maximum effect on the growth of chickpea plants. Rajeshwari et al. (2001) also reported that seedling growth and vigour of casuarinas plant (Casuarina equisetifolia) in polybags was greater after inoculating nursery soil mixture with cultures of Glomus fasciculatum, Glomus mosseae and Glomus etunicatum,and that Glomus fasciculatum was more efficient.

The production of large number of VAM fungi in soil-based inoculum, could be attributed to rapid sprouting from extracellular and intracellular hyphae in the soil and root inoculum. The root colonization by mycorrhiza was directly related to nutrient uptake by plants. The plants with highest mycorrhizal root colonization had larger number of mycorrhizal spores in soil. Dodd and Thompson (1994) also observed the similar results while using the soil-based VAM inoculum. Shoot length and fresh weight were more in 75 spores of Glomus sp-treated A. occidentale

seedlings. According to Rani et al. (1999) greater height and fresh weight in plant species treated with Glomus sp and Gigaspora sp it is likely that those species produces growth hormones which result in better growth of the shoots (Rani et al. 1999). Thus, VAM fungi of Glomus sp have a potential for utilisation to produce high quality seedlings of A. occidentale ensuring better survival and improved growth in the nurseries.


PROCEEDING 2017 133

CONCLUSIONS

1. The usage of native endomycorrhizal spores (Glomus, Gigaspora,

Acaulospora) have significant role to the growth of Cashew nut (A.occidentale L.) seedlings cultivated in Green house.

2. The significant result on the 60 days of cashew seedlings was inoculated 75 spores of endomycorrhizal fungi

ACKNOWLEDGEMENTS

Thanks to Directorate General of Higher Education, Ministry of Education and Culture of Republic Indonesia and University of Udayana Bali (grant of Hibah Bersaing) for providing financial support and extending essential facilities to carry out this research work.

REFERENCES

Al-Zalzaleh, Hani, A. Majid, Anu Ray Mathew, 2009. VAM Inoculation for Selected Ornamental Plants in Bioremediated and Agricultural Soils. European Journal of Scientific Research.25(4).559-566 Bhattacharya, P.M., Misra, D., Saha, J. and Chaudhari, S. 2000. Arbuscular mycorrhizal dependency of Eucalyptus tereticornis Sm.: How real is it? Mycorrhiza News 12(3): 11-15. Brundrett, M., N. Bougher, B. Dell,. T. Grove, & N. Malajczuk. 2008. working with Mycorrhizas in Forestry and Agriculture. ACIAR Monograph 32. Australian Centre for International Agricultural Research, Canberra. Chalimah, S., Muhadiono, L. Aznam, S. Haran, N., Toruan-Mathius. 2007. Propagation of Gigaspora sp and Acaulospora by pot culture in green house. Biodiversitas. 7/4/12-19. De Olieviera, V.L., Thomson, B.D. and Last, F.T. 1998-1999a. Eucalypt seedlings and their mycorrhizas: components of growth and some aspects of root efficiency. Kavaka 26 & 27: 71-80. De Olieviera, V.L., Thomson, B.D. and Last, F.T. 1998-1999b. Eucalypt seedlings and their mycorrhizas: the early stages of development after substrate inoculations with arbuscular and/or sheathing (ectomycorrhizal) fungi. Kavaka 26 & 27: 81-89. Dodd, J.C. and Thompson, B.D. 1994. The screening and selection of inoculant arbuscular mycorrhizal and ectomycorrhizal fungi. pages 149-158, In: Robson, A.D., Abott, L.K. and Malajczuk, N. (Editors) Gill, T.S., Singh, R.S. and Kaur, J. 2002. Comparison of four arbuscular mycorrhizal fungi for root colonization, spore population and plant growth response in chickpea. Indian Phytopathology 55(2):210-213.


PROCEEDING 2017 134

Gerdemann JW, T.H. Nicolson, 1963. Spores of mycorrhizal endogone spesies extracted from soil by wet sieving and decanting. Trans British Mycological Society. 46:235-244 Kumar, R., Jalali, B.L.& Chand, H. 2002. Influence of vesicular arbuscular mycorrhizal fungi on growth and nutrient uptake in chickpea. Journal of Mycology and Plant Pathology 32 (1): 11-15. Lapeyrie, F.F. and Chilvers, G.A. 1985. An endomycorrhiza-ectomycorrhiza succession associated with enhanced growth by Eucalyptus dumosa seedlings planted in calcareous soils. The New Phytologist. 100(1): 93-104. Rajeshwari, E., Latha, T.K.S., Vanangamudi, K., Selvan, K.A. and Narayanan, R. 2001. Effect of arbuscular mycorrhizal and phosphorus on seedling growth of Casuarina equisetifolia. Indian Phytopathalogy 54(1): 85-87. Rani, P., Aggarwal, A. and Mehrotra, R.S. 1999. Growth responses in Acacia

nilotica inoculated with VAM fungi (Glomus mosseae), Rhizobium species and Trichoderma harzianum. Indian Phytopathology 52(2): 151-153.


PROCEEDING 2017 135

MICROBIAL CONTAMINATION IN TRADITIONAL FOOD

PROCESSING PEDETAN

Ni Made Ayu Suardani Singapurwa*, A.A. Made Semariyani,

and I Putu Candra

Department of Food Science and Technology, Warmadewa University

Terompong 24th Road, Tanjung Bungkak Denpasar 80235, Bali *Corresponding author: [email protected]

Abstract

This study aims to determine the microbial contamination in the processing of

the traditional food sardine fish (Sardinella longiceps) pedetan in Jembrana Bali. The sampling was conducted on the three groups of the producer of pedetan. The analysis of the Total Plate Count and the Escherichia coli were carried out by the swab at the washing place, the process of seasoning and drying and the sampling of water used for manufacturing the products. The analysis of the Salmonella, the Vibrio cholerae and the Staphylococcus aureus were performed on the fresh fish and the dried fish. The laboratory analysis showed that the average Total Plate Count was 1.56 x 107 (cfu/ml), Escherichia coli was 0 (cfu/ml), Salmonella was negative (per 25 g), Vibrio cholerae was negative (per 25 g), Staphylococcus aureus was negative (colony/g). The results showed that the sanitation and hygiene in the processing of traditional food pedetan are good enough and for the microbial contamination in the dried fish products is in good agreement with the requirements of the SNI 2721:1: 2009, except for the TPC that was not in accordance with the SNI requirements which is 1.0 x 105 (cfu/ml) Keywords: Microbial Contamination, Traditional Food, Pedetan.

BACKGROUND

A traditional fish processing have a better prospects and development opportunities. A traditional fish processing is very complex and much more based on an inherited conception. One of the traditional processed fish products is Sardine Pedetan. Pedetan is a food product similar to a traditional Balinese marinated dried fish processed by the people in the area of Jembrana, Bali province. Pedetan is made of Sardine fish (Sardinella longiceps) found in the coastal areas of Jembrana.

In the processing stage of traditional fish, the type and the quality of the raw materials and also the other ingredients are vary greatly, environmental conditions are difficult to be controlled, as well as the end point of a process that is uncertain. The technology for fishery traditional products is characterized by an image that is not good, where the traditional products are processed at low level of sanitation and hygiene, using raw materials with low level of quality or freshness, the food safety that is not assured, the technology that has been used for generations, and the company that is managed by families with inadequate levels of management capability (Singapurwa et al., 2014)


PROCEEDING 2017 136

This contamination may play a significant role in the transmission of potentially harmful microorganisms which causes different diseases such as cholera, diarrhea and skin infections. It is therefore expedient that great care is taken during handling and the preparation of our fish products to avoid or reduce the level of microbial load and contamination. Thorough cooking processes and good hygiene practices could help reduce the microbial load to harmless level (Agyei and Maalekuu, 2014).

The reliable supply of safe food that is free from harmful contaminants is important for the people‘s general health and daily life, economic development and social stability and the government and countries image. One way to protect a population from all the detrimental impacts of food microbiological contamination is to spread information and knowledge about the sources and routes of transmission of pathogens into food (Ulum et al., 2016). Therefore determine the microbial contamination in the processing of the traditional food sardine fish pedetan.


The study was conducted in Jembrana Regency, Bali Province on January 2016 to June 2016. The samples were taken in three villages of coastal areas that used to make pedetan who sell to traditional markets. Microbiological analysis will be conducted at the Food Analysis Laboratory of the Faculty of Agricultural Technology Universitas Udayana and Laboratory Fish Inspection and Quality Control Provincial Marine and Fisheries Affairs of Bali.

Laboratory analysis is based on determination of Total Plate Count by SNI 01-2332.3-2006, Determination of Escherichia coli by SNI 01-2332.1-2006, determination of Salmonella by SNI -01-2332.2-2006, determination Vibrio cholerae by SNI 011-2332.4- 2006 and determination of Staphylococcus aureus by SNI 2332.9-2011.

RESULTS

The Research result was average of Total Plate Count in each processing traditional food sardinella fish pedetan collected with swab at the washing place was 1.07 106 cfu/ml, the process of seasoning was 3.90 x 107 cfu/ml, drying was 6.67 x101 cfu/ml, and the sampling of water used for manufacturing the products was 3.33 x 101 cfu/ml. Average of Total Plate Count in processing pedetan was 1.56 x 107

cfu/ml (Table 1). Microbial contamination in processing pedetan with swab at the washing place, the process of seasoning, drying, and the sampling of water used for manufacturing the products were 0 cfu/ml (Table 2).

Table 1. Total Plate Count (cfu/ml) in processing pedetan Processing Producer 1st Producer 2nd Producer 3th Average The washing place The process of seasoning

0 1.17 x 108

2.0 x103

0 3.2 x106

6.6 x 107 1.07 x 106 3.90 x 107

The drying place 1.0 x 102 0 1.0 x102 6.67 x 101

The sampling of water 0 1.0 x 102 0 3.33 x 101

Average 1.56xx 107


PROCEEDING 2017 137

Table 2. Escherichia coli (cfu/ml) in processing pedetan Processing Producer 1st Producer 2nd Producer 3th The washing place The process of seasoning

0 0

0 0

0

0 The drying place 0 0 0 The sampling of water 0 0 0

Microbial contamination in processing pedetan for before process in wet fish

and after processed in dry fish for Vibrio cholera was negative (per 25 g), Salmonella sp. was negative (per 25 g), Staphylococcus aureus was negative (colony/g) (Table 3).

Table 3. Microbial contamination in processing pedetan

Microbial contamination Wet fish

(before processed) Dry fish

(after processed) Vibrio cholera (per 25 g)

Producer 1st Producer 2nd Producer 3th

Negative Negative Negative


Salmonella sp.(per 25 g) Producer 1st Producer 2nd Producer 3th



Staphylococcus aureus (colony/g) Producer 1st Producer 2nd Producer 3th



DISCUSSIONS

Some microbes play important roles in the food industry because they confer

important properties to the edible products. However, other ones reduce food quality mainly by contamination with toxins harmful for human health and generate great economic losses per year (Vaquero et al., 2015). The Research resulted by Agyei and Maalekuu (2014) was presence of indicator organism including E. coli and Salmonella that the presence of these organisms in food makes food unhealthy for consumption. The exposure of fish products to unhygienic practices from the point of production to retail level increases the level of microbial contamination in the produce. Microbial contamination in processing pedetan in this research for Vibrio

cholera, Salmonella sp., and Staphylococcus aureus were negative. The microbes and pathogens were totally absent in solar dryer dried samples. The samples dried using solar dryer have comparatively good nutritional value and hygienic status followed by fish rack dried sardine. Solar drying and its improved processes minimize or stop some of the limitations of open sun drying. Drying in solar dryer is different from open sun drying because the solar dryer is an enclosed structure that traps heat inside the drier and make effective use of the heat (Immaculate et al., 2012).

E. coli, which was rarely found on the inside surfaces, originated mainly from such highly contaminated surface sites. The fact that the inside surfaces remained


PROCEEDING 2017 138

damp after sanitation, we could rule out the selective loss of viability of E. coli cells due to drying. The main purpose of hygiene in the food production is to ensure the safety of the food Products. It is known that heat treatment, which eliminates the other species of micro flora (Schlegelová et al., 2010). Thirty six (30%) samples were positive to Escherichia coli and no Salmonella was detected in any samples of food. It was concluded that health conditions of production for product is low and it needs to promote the hygiene and safety in the production line of product (Asidi et

al., 2015). Illness-causing bacteria may survive on various surfaces around the kitchen, including hands, utensils and cutting boards. For utensils and cutting boards to be sufficiently sanitized, hot water with detergent and a sanitizing (bleach) solution should be used (Nhlapo et al., 2014).

The results have studied by Dib et al., (2014) constitute an indicator of bacteriological contamination and showed that samples markets were contaminated with potential pathogenic microorganisms. No strain of Staphylococcus aureus and Vibrio were detected. The observation points to the absence of a practice that isolates these surfaces from one another so as to prevent or hinder cross-contamination. Other factors which may lead to the contamination of surfaces include the use of contaminated water and shortcomings in surface sanitation methods, such as an incorrect detergent to water dilution ratio or an inadequate contact time (Nhlapo et al., 2014).

Surface contamination decreased, corrective measures still must be enforced and the employees must be oriented regarding the importance of hygiene. It is crucial that all food production be organized and that the hygiene procedures, often left to second thought, be carried out effectively and uninterruptedly. The repetitive nature of the tasks and the lack of incentive favor a gradual reduction in quality, which increase the risk of pathogenic microorganism contamination. Therefore, it is important that those responsible for food producers acknowledge the value of this activity to obtain quality products from the hygienic sanitary standpoint (Sousa et al., 2014). The surfaces may not have been sources of contamination, opportunity for cross contamination among surfaces may exist because of a lack of surface isolation and shortcomings in cleaning regimes. To prevent cross-contamination, all equipment and working surfaces must be thoroughly washed with hot water and detergent after being used to prepare raw foods. In this regard, sanitation program have proved to be cost effective and simple to implement and to significantly reduce microbial contamination (Nhlapo et al., 2014). Therefore, it is recommended to establish a local investment and safeguard mechanism to develop local microbiological surveillance, especially for local characteristic foods (Pei et al., 2015). Surveillance of potential contaminant bacteria in harvested seafood is crucial for sustenance of public health (Dib et al., 2014).

The total plate count for the sampling of water in this research used for manufacturing the products average was 3.33 x 101 cfu/ml because two producers used water supply with chlorine and one of them used water supply not available chlorine. The microorganism concentration was 103-106 cfu/ml, and the concentration of available chlorine was 0 mg/l. At the concentration of available chlorine was 0.4 mg/l and there was no bacterial contamination at that point (Yorioka et al., 2016). The Higher microbial counts in some samples may be attributable to handling during harvest or processing. The total bacteria count on fish rarely indicate the quality of the fish but it gives an indication of the risk of spoilage


PROCEEDING 2017 139

induced since each of these organisms had different ways of effecting health conditions of consumers of such contamination fish. The seafood products from markets are generally unsafe for the consumers, the presence of contaminating bacteria could be attributed to cross contamination from environment, source and handling by the sellers. Safety of this kind of seafood can be guaranteed mainly by preventive measures and application of appropriates procedures of hygiene (Dib et

al., 2014). The food safety depends on understanding the need to prevent food

contamination (through the mirror of food contamination/pathogen impacts) as well as the food contamination pathways or mechanisms, well enough to prevent them. The exclusion and control of the well estimated risk factors through the above named practices can help to develop safe food all over the world and reduce the socioeconomic burden of foodborne diseases. Surprisingly, recent records show that microbiological contamination and pathogen contaminated foods still represent important causes of unintentional injury, diseases and death. Besides diseases and death, the consumption of pathogen-contaminated foods has also created economic, social and psychological impacts that were quiet devastating on the consumers, nations and food dealers and companies (Ulum et al., 2016).

CONCLUSIONS The results showed that microbial contamination in traditional food pedetan

based on requirements for quality and food safety salty dry fish SNI 2721: 1: 2009, the value of Total Plate Count with an average of 1.56 x 107 cfu / ml exceeds the limit required, which is 1.0 x 105 (cfu / ml). While the value of microbial contamination of E. coli, Salmonella, V. cholerae, and Staphylococcus aureus as required.

ACKNOWLEDGEMENT

Much obliged for DP2M DIKTI which have funded Decentralization

Research Competitive Grant in 2016. Thanks also goes to all those who have helped this research.

REFERENCES

Agyei, P.A. and B.K. Maalekuu. 2014. Determination of microbial contamination in meat and fish products sold in the Kumasi metropolis (A Case Study of Kumasi central market and the Bantama market). Merit Research Journal of Agricultural

Science and Soil Sciences. 2(3): 038-046.

Alum, E. Akanele, Urom, S. M. O. Chukwu, Ben, C. M. Ahudie. 2016. Microbiological Contamination of Food: The Mechanisms, Impacts And Prevention. International journal of scientific & technology research. 5(3):65-78.

Dib, A.D., N. Lakhdara, E. E. Rodriguez, R. Kabouia, E. M. Roldán, M. E. García, H. Koutchoukali, L. Guerraichi, O. Bouaziz. 2014. Prevalence of microbial contamination of fresh seafood product sold in Constantine, Algeria. Environmental

Skeptics and Critics. 3(4): 83-87.


PROCEEDING 2017 140

Immaculate, J., P. Sinduja, P. Jamila. 2012. Biochemical and microbial qualities of Sardinella fimbriata sun dried in different method. International Food Research

Journal. 19(4): 1699-1703.

National Standardization Agency (BSN), 2006. SNI 01.2332.3.2006. Microbiology Test Method-Part 3: Determination of Total Plate Count (TPC) in Fishery Products.

National Standardization Agency (BSN), 2006. SNI 01.2332.4.2006. Microbiology Test Method-Part 4: Determination Vibrio cholera in Fishery Products.

National Standardization Agency (BSN). 2009. SNI 2721.1: 2009, Salted Fish-Part 1: Specification.

National Standardization Agency (BSN), 2011. SNI 01.2332.2.2006. Microbiology Test Method-Part 2: Determination of Salmonella in Fishery Products.

National Standardization Agency (BSN), 2011. SNI 01.2332.9.2011. Microbiology Test Method-Part 9: Determination of Staphylococcus aureus in Fishery Products.

Nhlapo, N., R. J.F. Lues. W. H. Groenewald. 2014. Microbial counts of food contact surfaces at schools depending on a feeding scheme. South African Journal of

Science. 110 (11/12):1-5.

Pei, X., N. Li, Y. Guo, X. Liu, L. Yan, Y. Li, S. Yang, J. Hu, J. Zhu and D. Yang. 2015. Microbiological Food Safety Surveillance in China. Int. J. Environ. Res.

Public Health. 12: 10662-10670.

Schlegelová1, J., V. Babák, M. Holasová, L. K. Tantinová, L. Necidová, F. Šišák , H.Vlková, P. Roubal and Z. Jaglic. 2010. Microbial Contamination after Sanitation of Food Contact Surfaces in Dairy and Meat Processing Plants. Czech J. Food Sci.

28(5): 450-461.

Singapurwa, N.M.A.S., N. M. Darmadi, A.A.M. Semariyani. 2014. Characteristics of Traditional Food Pedetan in Jembrana Regency. International Journal of Advanced

Science Engineering Information Technology. 4(2):68-74.

Sonia Asadi, S., Z. Re. Maram, F.Kooshk. 2015. Evaluation of microbial contamination of pastry cream in Arak city of Iran. Journal of Food Safety and

Hygiene. 1(1): 26-29.

Sousa, C.L., J.A. Freitas, L.F.H. Lourenço, E. A. F. Araujo, M. R. S. P. Joele. 2014. Microbiological contamination of surfaces in fish industry. African Journal of

Microbiology Research. 8(5):425-431.

Yorioka, K., S. Oie, K. Hayashi, H. Kimoto, H. Furukawa. 2016. Microbial Contamination of Ice Machines Is Mediated by Activated Charcoal Filtration Systems in a City Hospital. Advancement of the Science. 78(10):32-35.

Vaquero, M.J.R., C. V. Vallejo, F. M. Saguir and D. A. Sampiet. 2015. Preservative and Antitoxigenic Activities of Phenolic Compounds: Usefulness in Prevention of Microbial Spoilage and Toxin Contamination of Food Products. Chemical Physics

Research Journal. 7(2):148-166.


PROCEEDING 2017 141

COPPER HAIR LEVEL ON CHILDREN WITH HIV/AIDS

Niruri R1*, Wati K.D.K2, Oktavianti K.A.D1, and Cahyani M.R1

1Department of Pharmacy, Faculty of Mathematic and Science, Udayana University, Bali, Indonesia

2Pediatric Department, Sanglah Hospital, Bali, Indonesia * Corresponding author: [email protected]

Abstract

Copper, a component of antioxidant enzymes, has a role in immune system against HIV. This study aimed to identify Copper (Cu) hair level on children (0-12 years old) with HIV/AIDS. The data was collected from medical record on the period of December 2014 – May 2015. Value of Cu normal hair level is 9,29 - 13,89 µg/g. Data of forty patients were collected, which hair concentration of Cu on 34 subjects were excess, and on two children were lower than the normal value. Therefore, further clinical evaluation need to be conducted. Keywords: Copper Hair Level, HIV/AIDS, Children

BACKGROUND

Bali was reported as the fourth province with the highest incidence of HIV /

AIDS in Indonesia (Kemenkes, 2014). In the period of January 2007 to November 2011, 103 children were diagnosed with HIV positive in Sanglah Hospital, Denpasar, Bali. (Saputri, 2013). Oxygen free-radicals, which are resulted during oxidative stress, could give a protection against viral attack, but during the protection process it causes tissue destruction by inducing inflammation. Depletion of antioxidant, such as glutathione, may be occurred in the viral infection. A balance between oxidant and antioxidant for viral activation and deactivation, is needed. Therefore, having harmful pro-oxidant and antioxidant component equally are important. Antioxidant deficiency may cause to T cell apoptosis and stimulate HIV-replication. Micronutrients, such as copper (Cu), Zinc (Zn), Selenium (Se), Manganese (Mn) , are cofactors of antioxidants enzymes to give body protection from oxygen free radicals. Cu can initiate reaction of the free radicals and also plays the role as a cofactor of a free- radicals scavenging enzyme Cu/Zn- superoxide dismutase (Chaturvedi, 2004; Duggal,2012,).

Cu is found in food (such as in beans, clams, seeds, and liver), water, and the atmosphere (Trojawnoski, , 2009; WHO, 2004) . Most Cu dietary are excreted through liver. Intracellular Cu should be tightly managed. If Cu accumulate in liver, it leads to the organ damage (Robert, 2008). Highest concentrations in normal condition of Cu are found in hair, nail, brain, liver, kidney, and heart (WHO, 2004). Cu hair sample is preferred because it is easy to get and to store, and not an invasive method (Trojawnoski, 2009). This study aimed to identify Copper (Cu) hair level on children (0-12 years old) with HIV/AIDS in Sanglah Hospital, Denpasar, Bali, Indonesia. Therefore, it can provide the data of Cu status, which will be used to


PROCEEDING 2017 142

evaluate the disease progression and to determine the therapy in order to optimize the patients’ outcome.


This observational retrospective study was conducted in Sanglah Hospital and approved by the local ethic committee. Samples criteria were children (0-12 years old (y.o) with HIV/ AIDS who had Cu hair levels data. The data was collected from medical record on the period of December 2014 – May 2015. Value of Cu normal hair level is 9,29 - 13,89 µg/g (Gurgoze, 2006). Descriptive analysis was applied to evaluate the data.

RESULTS

Total patients who fit to the sample criteria (Table 1) were 40, which were

20 girls and 20 boys. The subjects were 3-12 years of age. Children with copper deficency were 2 children, copper excess were 34 patients, and normal copper were 4 subjects (Table 2 and 3). The majority of children had high CD4 count /percentage and received triple drugs of first line or second line antiretroviral therapy (ART) based on WHO-Indonesian Health Department recommendation (Kementerian Kesehatan Republik Indonesia. 2014). Most of the patients had normal liver function (based on SGOT, SGPT, and total bilirubin).

Tabel 1. Characteristic Patients (N total = 40)

n (%)

Sex

• Female 20 (50.0%) • Male 20 (50.0%) Age

• 3 – 4 y.o 7 (17.5%) • ≥5 y.o 33 (82.5%) Clinical Status (based on HIV stadium (*))

• Stadium I 36 (90.0%) • Stadium II 3 (7.5%) • Stadium III 1 (2.5%) Immunological status (based on CD4) • Immunodeficiency 11 (27.5%) • Not immunodeficiency 29 (72.5%) Liver Function • SGOT

Low - Normal 30 (75.0%) High 9 (22.5%) Unknown 1 (2.5%)


PROCEEDING 2017 143

• SGPT Low 1 (2.5%) Normal 32 (80.0%) High 6 (15%) Unknown 1 (2.5%) • Bilirubin Total

Low 4 (10%) Normal 31 (77.5) High - Unknown 5 (12.5%)

(y.o): years old (*) : HIV stadium was based on physicians’ diagnosis, no data of patients with HIV

stadium IV were collected. (**): Immunological status were classified into not immunodeficiency (if the patients

fit to CD4 criteria based on age category of not in immunodeficiency condition, which was CD4 count > 500 cell /mm3 (>5 y.o) or CD4 percentage >25% (36 – 59 months old)) and immunodeficiency (if CD4 count / percentage did not fit to the CD4 criteria of not in HIV immunodeficiency) – Kementerian Kesehatan Republik Indonesia, 2014 with adaptation.

Table 2. Cu status and HIV Clinical – Immunological Status

Stadium (N total 40) Immunodeficiency status (N total 40)

I II III Not Immunodeficiency Immunodef

iciency

Low Copper (n=2) 1 1 - 2 -

Normal Copper (n=4) 2 1 1 3 1 Excess Copper (n=34) 33 1 - 24 10

Table 3. Cu Status and Liver Function (N Total = 40)

Low Cu (n=2)

Normal Cu r (n=4) Excess Cu (n=34)

SGOT

Low - - - Normal 1 2 27 High (<2 x higher than UNL*) 1 1 6 High (≥ 2 x higher than UNL *) - 1 - Unknown - - 1 SGPT Low - - 1 Normal 1 3 28 High (<2x higher than UNL*) 1 - 3 High (≥ 2 x higher than UNL *) - 1 1 Unknown - - 1


PROCEEDING 2017 144

Total Bilirubin Low - 1 3 Normal 2 2 27 High - - - Unknown - 1 4 (*) UNL = upper normal limit Normal SGOT levels : 10-40 U/mL (Gallagher., 2013) Normal SGPT levels : 5-35 U/mL (Gallagher, 2013) Normal Total Bilirubin Levels : 0.2-1.5 mg/dL (Johnson., 2003)

DISCUSSIONS

In result of this study, the majority of children had Cu Excess, HIV stadium I, high CD4 count / percentage, and ART for HIV management. Asbjorndottir (2015) showed that ART was used for CD4 recovery and viral suppression. The result was varying. Age, pre ART CD8 T-Cell, and pre ART viral load determined the immune recovery (Asbjorndottir, 2015). In meta-analysis study, ART in children with HIV could minimize the risk of opportunistic infection (B-lajoie, 2016). Micronutrients, such as Se, Zn, Cu, Iron, and vitamin E, were also contributed to immune function (Chaturved, 2004, WHO, 2005).

Those nutrients had role on progression of HIV (WHO, 2005). Comparing to healthy subjects, HIV patients tended to have higher Cu and lower levels of Zn, and iron in blood and hair samples (Afridi, 2011, Malviya 2008, WHO 2005). There was an inverse correlation with Cu and Zn. As Cu concentration was increase, Zn level would be decrease. However, this correlation was not sustained, such as in advanced HIV disease (Malviya 2008). In HIV, low concentration of Zn and Iron can be indicators to predict for secondary infection (Afridi, 2011). Cu / Zn ratio in plasma may predict disease progression and survival in patients with HIV (Malviya2008 ).

In a mean of 2,5-year follow up study on homosexual male patients with HIV, higher Cu and lower zinc levels were found in the first group who developed to AIDS compared with the second group who did not progress (WHO, 2005). Mortality was increased if Cu / Zn ratio>1 (Malviya, 2008; 15). Due to the possible effect on advancing HIV infection, both Cu and Zn levels should be measured and evaluated periodically in these HIV subjects.

In animal model (a study in rats), excess Cu may increase oxidant damage to DNA liver tissues and membrane lipids (Turnlund, 2004). In a study on 1365 healthy subjects (adults), who received 0.01, 2, 4, or 5 mg Cu per liter water (for drinking or preparation of food) for over a two month-period, no significant different of liver function (SGOT, SGPT) between groups (Araya, 2003, WHO, 2004).

A case (a man (26 y.o) with kayser – Fleischer rings, liver failure ,and cirrhosis) was reported after having a two-years-period of self-medication of 30 mg Cu supplements per day and a poorly defined period of up to one year of 60 mg Cu per day. A liver transplant was required on this patient (WHO, 2004, O’Donohue, 1993). Changes in histopathology of liver were dose related. Having a high Cu dietary (3-6 times the recommended upper limit intake) for prolonged daily consumption may cause liver damage (WHO, 2004). On this study, most of the patients had Cu Excess, but majority of them showed normal liver functions.


PROCEEDING 2017 145

Considering effect on liver of high dose and long term use, Cu level intake (from food, water, and supplements) should be determined and liver function should be monitored periodically. Two patients with lower Cu hair lever than the normal value were found on this study.

Low Cu levels may cause iron deficiency anemia, through impairing the mineral absorption, decreasing heme synthesis, and increasing iron levels in storage-tissues. Furthermore, the iron accumulation in the joints associated with low Cu levels, may contribute to arthritis (Watts, 1989). Further evaluation for anemia and arthritis condition for these children should be conducted.

CONCLUSIONS

From forty subjects, hair concentration of Cu on 34 patients were excess, on two children were lower than the normal value, and on the rest were normal. Therefore, further clinical evaluation need to be conducted

REFERENCES

Afridi HI , Kazi TG, Kazi N, Kandhro GA, Baig JA, Shah AQ, Khan S, Kolachi NF, Wadhwa SK, Shah F. 2011. Evaluation of zinc, copper and iron in biological samples (scalp hair, blood and urine) of tuberculosis and diarrhea male human immunodeficiency virus patients. Clin Lab. Vol. 57 (9-10). pp. 677-688. Araya M , Olivares M, Pizarro F, González M, Speisky H, and Uauyl R. 2003. Gastrointestinal symptoms and blood indicators of copper load in apparently healthy adults undergoing controlled copper exposure. American Journal of Clinical

Nutrition, 77:646– 650. Asbjornsdottir, K.H. 2015. Pediatric HIV: Immunologic and Virologic Response to Antiretroviral Therapy. Thesis. University of Washington. B-Lajoie, M R., Drouin, O, Bartlett, G, Nguyen, Q, Low, A, Gavriilidis, G, Easterbrook,P, and Muhe L.. 2016. Incidence and Prevalence of Opportunistic and Other Infections and the Impact of Antiretroviral Therapy Among HIV-Infected Children in Low- and Middle- income Countries: A Systematic Review and Meta-analysis. Clinical Infectious Disease. Vol. 62. pp. 1586-1594. Chaturvedi, U.C., R. Shrisvastava, and R.K. Upreti. 2004. Viral Infections and Trace Elements: A Complex Interaction. CURRENT SCIENCE. Vol. 87 (11). pp. 1536-1554. Duggal, S., T.D. Chugh., and A. K. Duggal. 2011. Review Article: HIV and Malnutrition: Effects on Immune System. Clinical and Development Immunology. Vol. 2012. pp. 1-8. Gallagher, C.J. 2013. Pure and Simple: Anesthesia Writtens Review IV. Raleigh: Lulu Publishing Services. Page 90.


PROCEEDING 2017 146

Gurgoze, M.K., A. Olcucu, A. D. Aygun, E. Taskin, and M. Kilic. 2006. Serum and Hair Levels of Zinc, Selenium, Iron, and Copper in Children with Iron-Deficiency Anemia. Biological Trace Element Research. Vol. 111. pp. 23-29. Johnson, C.W., D.L. Timmons, and P.E. Hall. 2003. Essential Laboratory

Mathematics. Second Edition. Canada: Delmar Learning. Page 144. Kemenkes RI. 2014. Situasi dan Analisis HIV AIDS. Jakarta: Pusat Data dan Informasi Kementerian Kesehatan RI. Hal. 5. Kementerian Kesehatan Republik Indonesia. 2014. Pedoman Penerapan Terapi Hiv Pada Anak. Kementerian Kesehatan Republik Indonesia. Jakarta. Hal. 11, 15-82 Malviya, A., H. Hasan, And A. Hussain. 2008. Original Article: Correlation Of Cd4+ T Cell Count With Serum Zinc, Copper, And Selenium In Hiv Positive Individuals. The Internet Journal of Epidemiology. Vol. 6 (2). pp. 1-10. O’Donohue JW, Reid MA, Varghese A, Portmann B, Williams R (1993). Micronodular cirrhosis and acute liver failure due to chronic self-intoxication. Eur J Gastroenterol Hepatol 5: 561-562. Saputri, L.O. 2013. Penggunaan Antiretroviral (ARV) Perinatal, Cara Persalinan, dan Pemberian Nutrisi pada Anak yang Lahir Dari Ibu Penderita HIV/AIDS Di RSUP Sanglah Denpasar. Skripsi. Universitas Udayana, Denpasar. Trojanowski, P., J. Trojanowski, M. Bokiniec, and J. Antonowicz. 2009. Copper in Human Hair of Middle Pomeranian Population. Baltic Coastal Zone. No. 13. pp. 163-186. Turnlund, J.R., Jacob,RA, Keen, CL, Strain, JJ, Kelley, D S,, Domek JM, , Keyes WR., Ensunsa, JL, Lykkesfeldt, J, and Coulter J. 2004. Long-term High Copper Intake: Effects on Indexes of Copper Status, Antioxidant Status, and Immune Function in Young Men. Am J Clin Nutr. Vol. 79. pp. 1037-1044. Watts, D.L. 1989. The Nutritional Relationship of Copper. Journal of

Orthomolecular Medicine. Vol. 4 (2). pp. 99-108. WHO. 2004. Copper in Drinking Water. Switzerland: World Health Organization. pp. 1-23. WHO. 2005. Micronutrients and HIV infection: a revies of current evidence. Switzerland: World Health Organization. Page 1-48.


PROCEEDING 2017 147

MECHANISMS OF ANTIBIOTIC FILTRATE

Streptomyces thermocarboxydus AGAINST Fusarium oxysporum

F020 ULTRASRUCTURE THROUGH SCANNING ELECTRON

MICROSCOPE AND TRANSMISSION ELECTRON

MICROSCOPE

Retno Kawuri

Laboratorium Microbiology, Biology Department FMIPA, Udayana University Corresponding author: [email protected]

Abstract

Fusarium oxysporum F020 is the leaf rot fungus on Aloe vera (Aloe

barbadensis Mill) in Bali (Kawuri et al 2012). To control the pathogen Kawuri (2013) found the bacterium Streptomyces thermocarboxydus able to inhibit the growth of F.oxysporum both in vitro and in vivo .This research was to examine S.

thermocarboxydus ability to produce antibiotics and mechanisms to inhibit the growth F.oxysporum Fo2010 using Scanning Electrone microscop ( SEM ) and Transmission Electrone microscop (TEM). The study was conducted at the College of Agriculture Ibaraki University Japan. The concentration of the filtrate S.thermocarboxydus antibiotic that is used to test the inhibition of 100%, 75%, 50% and 25% in the untreated control filtrate. S.thermocarboxydus and F.oxysporum Fo2010 colonies grown on YMA media and PDA for 5 days at 25 ° C. Colony was cut with a size of 1-3 mm and then fixed with a solution of 2% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.2) at 4 0C for 4 hours and then allowed to stand at room temperature (25°C) for 1 hour. Samples that have been fixed washed with sodium cacodylate buffer (pH 7.2) and continued fixation with 1% osmium tetroxide in 0.1 M cacodylate buffer and allowed to stand at room temperature for 5 hours. Furthermore, the dehydration process by using ethyl alcohol serially (40%, 60%, 80%, 99.5% and 100%). Samples were cut using a cutting device freeze (TF-2, Eiko, Japan) and treated with a solution of t-butylalcohol, and placed in the vacuum freeze-drying apparatus (ID-2, Eiko, Japan). Samples were dried and placed in a special place coated with osmium tetroxide (OPC 60A, Filgen, Japan) and platinum (JUC-5000, JEOL, Japan). The coated samples were observed for SEM by using JSM-6701F, JEOL, Japan with 5 kV acceleration voltage and TEM (JEM-2100, JEOL, Japan) (Hall, 1978; Hayat, 1981). In this study by using antibiotics filtrate S.thermocarboxydus with different levels of the percentage of 100%, 75% and 50% can lead to cell death macrokonidia, microconidia, chlamydospores and changes in the morphology of hyphae of F.oxysporum. Using TEM is known that filtrate S.thermocarboxydus mechanism is capable of damaging the cell membrane both the outer membrane and the inner membrane of the cell, so the cell becomes lysis, release of organelles and resulted in the death of cells F.oxysporum Keywords: Filtrate antibiotic, S.thermocarboxydus, F.oxysporum Fo2010,

ultrastructure cell


PROCEEDING 2017 148

BACKGROUND

Aloe vera (Aloe barbadensis Mill.) is a herb type of plant and belongs to the Liliaceae family. Among approximately 400 Aloe species exixted, A. barbadensis is cultivated the most and has high quality. Leaf of Aloe vera plant contains gel which is the most important component of the plants, as it contains amino acid, antraquinon, enzyme, lignin, mineral, mono and polysaccharide, salisilic acid, saponin, sterol and various vitamins beneficial for health (Barcroft and Myskja, 2009).

Disease that have destroyed Aloe vera plant is leaf rot, with the symptom of rotten leaf. The infected leaf becomes rotten and dry with brown color crescent type. The disease was found for the first time in Aloe plantation in a few regions in Bali in 2010. Infection, with diameter reaches 1- 4 cm, starts from leaf edge causing leaf to dry, rot with brown color, shrink and finally damage, broken with dry and rotten leaf tip. The cause has been identified, using molecular identification assessment, as Fusarium oxysporum F020 (Kawuri et al 2012).

Synthetic fungicides are currently utilized as disease control agent for diseases caused by pathogenic fungi, that can cause a number of problems such as decreases in soil pH, environmental pollution and health problems. Moreover, synthetic fungicide can cause pathogen resistance and decrease in non target organism population (Brimer and Boland, 2003).To overcome problems of synthetic fungicide used, an alternative safe way to control disease on plants must be found. Microorganism can be used as biocontrol for plant pathogen due to more environmental friendly and also affable to non target microorganism.

Prapagdee et al. (2008) reported that many genus Streptomyces have been used as antifungi agents to control several pathogenic fungi on plants. The capcapability of Streptomyces in inhibiting growth of pathogenic fungi is due to its capability to produce both antifungal agent and extracellular hydrolytic enzyme those are able to degrade fungi’s cell wall. To control the pathogen Kawuri (2012) found the bacterium Streptomyces

thermocarboxydus able to inhibit the growth of F.oxysporum both in vitro and in vivo .This research was to examine S. thermocarboxydus ability to produce antibiotics and mechanisms to inhibit the growth F.oxysporum Fo2010 using Scanning Electrone microscop ( SEM ) and Transmission Electrone microscop (TEM).


The study was conducted at the College of Agriculture Ibaraki University Japan. The concentration of the filtrate S.thermocarboxydus antibiotic that is used to test the inhibition of 100, 75, 50 and 25% in the untreated control filtrate. S.thermocarboxydus and F.oxysporum Fo2010 colonies grown on YMA media and PDA for 5 days at 25°C. Colony was cut with a size of 1-3 mm and then fixed with a solution of 2% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.2) at 4 0C for 4 hours and then allowed to stand at room temperature (25°C) for 1 hour. Samples that have been fixed washed with sodium cacodylate buffer (pH 7.2) and continued fixation with 1% osmium tetroxide in 0.1 M cacodylate buffer and allowed to stand at room temperature for 5 hours. Furthermore, the dehydration


PROCEEDING 2017 149

process by using ethyl alcohol serially (40, 60, 80, 99.5 and 100%). Samples were cut using a cutting device freeze (TF-2, Eiko, Japan) and treated with a solution of t-butylalcohol, and placed in the vacuum freeze-drying apparatus (ID-2, Eiko, Japan). Samples were dried and placed in a special place coated with osmium tetroxide (OPC 60A, Filgen, Japan) and platinum (JUC-5000, JEOL, Japan). The coated samples were observed for SEM by using JSM-6701F, JEOL, Japan with 5 kV acceleration voltage and TEM (JEM-2100, JEOL, Japan) (Hall, 1978; Hayat, 1981). RESULTS AND DISCUSSIONS

Observation using Scanning Electron Microscope (SEM) showed that Fusarium oxysporum Fo2010 had curve shape of macroconidia of 4 septa with foot cell, 31 µm length with smooth surface. Microconidia had rough surface, 4.6 µm length (Picture 1). Hypha morphology had not curvy with 13 µm in diameter and chlamydospora intercalar had wavy surface and 37 µm length. Research by Torres et

al. (2003) shows that hypha of Fusarium verticillioides has smooth surface, while Alberthini et al. (2003) reported that hypha of F. culmorum has rough surface.

Figure 1. Scanning Electrone Microskop (SEM) Fusarium oxysporum Fo2010. A.macroconidia bar 10 µm; B. microconidia bar 1 µm; C. Chlamidospora bar 10 µm

D, Hypha bar 10 µm

Colony F.oxysporum treated with antibiotic filtrate of S thermocarboxydus (100%, 75%,50%) showed the diameter colony was different with the control (untreated colony), however colony of F.oxysporum treated with 25% antibiotic filtrate was same as control. Observation on macroconidia showed the mechanism based on SEM and TEM was the capability of filtrate to damage cell wall and plasma membrane of the macroconidia (Picture 2). It can be seen through SEM, that hypha’s surface of F. oxysporum on control, was not curvy (Picture 1D).

Treatment with S. thermocarboxydus antibiotic filtrate, under SEM showed broken hypha, hypha surface seemed to be curvy as seen on Picture 3.ABC. SEM data was supported by TEM analyses, through where it showed perforated cell wall and plasma membrane, organelle under pressure and wider vacoule causing cell became lysis and died (Picture 3.AA, BB, CC).

Under Scanning electrone microscope, Clamydospore interalar treated with 100% and 75% filtrate antibiotic can cause morfology damage, however in this reasearch clamydospore treated with 50% filtrate antibiotic was not found.

A C A

B D


PROCEEDING 2017 150

Figure 2. SEM and TEM macroconidia (A) and microconidia (B) of F oxysporum

treated with 100 % antibiotic filtrate (arrow, broken plasma membran)

Figure 3. SEM and TEM hypha of F oxysporum treated with 100 % A, 75% (B), 50%(C) antibiotic filtrate (arrow, broken plasma membran)

Figure 4. SEM Clamidospore intercalar of F.oxysporum treated by 75% (A) and 50% (B) antibiotic filtrate.

Study on fungi with the same genus of Fusarium was done by Liyong et al. (2009) who found that chitosan treatment of 0.5% concentration over Fusarium

sulphureum causing dry rot on potato roots. It was seen through SEM, that

A

A

B

A B

C

B

A AA

BB

AA BB

CC


PROCEEDING 2017 151

morphology of hypha was changed and become tangled, swollen and branching. TEM results showed the cytoplasm distribution was not normal, thickened hypha membrane, formation of new septa was also on broken hypha, but microconidia and macroconidia were not damaged. Significant damage also occurred in intercalary chlamydospores which occurred for all treatments (Figure 4). There are similarities results of research conducted by Dominguez et al. (2011) which is damage to the cell membrane of hyphae and destruction makrokonidia thoroughly, but targets different fungi. Goh et

al. (2009) reported the formation of chlamydospores is an indicator that the yeast cells experience stress. Yuan et al. (2011) reported research with the antibiotic ciprofloxacin concentration of ≥40 g / ml was able to induce the formation of chlamydospores in F. graminearum and F. avenaceum.

CONCLUSIONS

In this study by using antibiotics filtrate S.thermocarboxydus with different levels of the percentage of 100%, 75% and 50% can lead to cell death macroconidia, microconidia, chlamydospores and changes in the morphology of hyphae of F.oxysporum. Using TEM is known that filtrate S.thermocarboxydus mechanism is capable of damaging the cell membrane both the outer membrane and the inner membrane of the cell, so the cell becomes lysis, release of organelles and resulted in the death of cells F.oxysporum.

REFERENCES

Albertini, M. C., A.B. Accorsi, S. Citterio, M.P. Burattini, Piacentin, F. Uguccioni, and E. Piatti. 2003. Morphological and biochemical modifications induced by a static magnetic field on Fusarium culmorum. Biochimie 85:983-970. [Cited on 5 Nov.2011]. Available from: www.sciencedirect.com Barcroft, A., and Myskja. 2009. Aloe vera Nature’s Silent Healer. BAAM Publishing Ltd. London. P.28-42. Brimer , T. A., and G.J. Boland. 2003. A Review of the non target effects of fungi used to biologically control plant diseases. Agric. Ecosystem. Environment. 100:3-16. Domínguez S.D. M.Y. Ríos b, P. Castillo-Ocampo c, G. Zavala-Padilla d, M. Ramos-García .2011.Cytological and biochemical changes induced by chitosan in the pathosystem Alternaria alternata–tomato. Pesticide Biochemistry and Physiology 99 250–25. Journal homepage: www.elsevier.com/locate/pest Goh, Y.K., Daida, P., Vujanovic, V., 2009. Effects of abiotic factors and biocontrol agents on chlamydospore formation in Fusarium graminearum and Fusarium

sporotrichioides. Biocontrol. Sci. Tech. 19, 151–167. Hall, J. L. 1978. Electron Microscopy and cytochemistry of plant cells. Elsevier North-Holland Biomedical Press. New York.


PROCEEDING 2017 152

Hayat, M. A. 1981. Fixation for Electron Microscopy. Academic Press. New York. Yuan X, Y. Goh, N. Low, V. Vujanovic.2010. Rapid detection of ciprofloxacin effects on Fusarium graminearum and F. avenaceum cells in modulating

environmental pH using a reactive, non-toxic food-dye indicator.Micron. Micron2010journal homepage: www.elsevier.com/locate/micron LiYong, C., S. Juan, B. Yang, G. Hong, and W. Yi. 2009. Antifungal Activity of Chitosan on Fusarium sulphureum in Relation to Dry Rot of Potato Tuber. Agricultural Sciences in China 8(5): 597-604. [Cited on 10 Nov. 2011]. Available from www.sciencedirect.com. Prapagdee, B., C. Kuekulvong, and S. Mongkolsuk. 2008.Antifungal potential of Extracellular Metabolites produced by Streptomyces hygroscopycus against Phytophatogenic fungi. International Juornal of Biological Sciences 4:330-337. Kawuri, R., D.N. Suprapta. 2011. Main Diseases of Aloe barbadensis Miller in Bali. J. ISSAAS.17(1):265. Kawuri, R., D.N. Suprapta. Y.Nitta, H.Homma. 2012. Destructive leaf Rot Disease caused by Fusarium oxysporum on Aloe barbadensis Miller in Bali Agriculture

Science Research Journal..2(6):296-301 Torres, M. R., A.J. Ramos, J. Soler, V. Sanchis, and S. Marına. 2003. SEM study of water activity and temperature effects on the initial growth of Aspergillus ochraceus,

Alternaria alternata and Fusarium verticillioides on maize grain. International

Journal of Food Microbiology 81:185– 193. [Cited on 25 Nov. 2011]. Available from: www. elsevier.com.


PROCEEDING 2017 153

THE INFLUENCE OF DOSES APPLICATION BIOKOMPOS

AND BIOCHAR RESULT OF FERMENTATION FUNGI

Trichoderma spp.and FUMIGATION ON THE GROWTH OF AND

FROM THE SALE OF SOYBEAN IN THE LAND OF ENTISOL

LOMBOK BARAT

Sardian 1*, I Made Sudantha2 and Suwardji2

1 Student of PM-PSLK Unram, 2 Lecturers of PM-PSLK Unram


Abstract

The soybean plant (Glycine (B.) Merr.) are mostly food third major after rice

and corn and a one of commodities which are prioritized in the program revitalization soybean national in the past five years continues to decrease, one of cause is the low level of soil fertility.One way to improve land and reduce the use of fertilizer is by using biokompos and biochar as a the ground.The purpose of this research is: 1) to know the influence of application biokompos result of fermentation fungi trichoderma spp. Can increase growth and from the sale of soybean in the land of entisol; 2) to know the influence of application biochar result of fermentation fungi trichoderma spp. Can increase growth and from the sale of soybean in the land of entisol; 3) to know the influence of treatment fumigation to growth and from the sale of soybean in the land of entisol; 4) to know the influence of influence interaction between factors biokompos and biochar result of fermentation fungi trichoderma spp and but fumigation in improve the result the soybean plant in the land of entisol.The research was done in the village bagek polak labuapi lombok regency west in april up to july 2016.This experiment use design random a group (a shelf) to the treatment divided (split a plot design with three a factor. As tenement the public works is fumigation (f) with 2 cedar: formula one = without fumigation f2 = with fumigating, children tenement (ap is biokompos with two cedar: k0 = without biokompos, k1 = with biokompos ( doses 5 tons / ha, and children tenement ( aap is doses application biochar to 4 cedar: b0 = without biochar (0 ton / ha, b1 = biochar doses 5 tons / ha, b2 = biochar doses 10 tons / ha, b3 = biochar doses 15 ton / ha). The research results showed that: 1) application fumigation able to increase growth vegetative the soybean plant, 2) the application of biokompos with doses 5 tons / ha able to increase growth vegetative the soybean plant, 3) the influence interaction between factors fumigating, biokompos and with biochar showed the influence of an insignificant.

Keywords: soybeans fumigating, biokompos, biochar, Trichoderma spp.

BACKGROUND

The soybean plant (Glycine ( L. ) Merr.) are mostly food third major after rice

and corn and a one of commodities which are prioritized in the program


PROCEEDING 2017 154

revitalization agriculture.Besides containing protein vegetable high needed to improve nutrition the community, soybean also safe to be consumed, and the price tending to affordable all these levels of society (Arsyad and indeed 1998, the directorate nuts and tubers, 2004) and own a lot of these functions and soybean stock must always be available in the number of totally.But that becomes obstacle is the low production in urban farmers and soybean stock domestic often experienced a lack of.Soybean needs national recorded at 2.5 million tons a year while production soybean in indonesia is 800,000 tons so that indonesia lack soybean 1.7 million tons every year. Due to the low tingat soybean production in the land so in fulfilling their needs.


The Place and Time Research

The research was done in the village bagek polak kecamatan labuapi lombok regency west in april up to july 2016. Tools and Materials

The tools will be used in this research, among others : autoclave, Balance Analytical, Stove, Glassware Chemistry, Erlenmeyer, Tweezers, Rod Stirrer, Petri dishes, glasses Watches, Spatula, laminar air flow, hoes, buckets, handsprayer, oven, bottle weigh , shake the bottle, a measuring cup, flask, pumpkin destruction, beaker, test tubes, pipette volume, a measuring pipette, funnel, filter paper (Whatman 42), pH - meter, meter, spectrophotometers and stationery. The materials will be used in these experiments is the potato, agar, sugar dextrose, distilled water, soil, seeds of soybean varieties Anjasmoro, manure, Urea, TSP, KCl, water, plastic clip, label paper, tissue paper, a buffer solution, HCl, NH4F, HNO3 (65 %), concentrated HClO4 (60 %), Amoniummolibdat, Stanoklorida and KH2PO4. Experimental design

The method used in this research is the method of experimental field trials. In this experiment we used the design of a randomized block design (RAK) with a treatment plan plots divided (Split-Split Plot Design) with three factors. As the Main Grid (PU) is Fumigation, Children Petak (AP) is Biokompos, and Children Petak (AAP) is dose Biochar application. Main plots (PU): Fumigation (F) with two levels, namely: f1 = Without fumigation; f2 = By fumigation. Kids Petak (AP): Biokompos (K) with two levels, namely: k0 = Without biokompos; k1 = With biokompos (dose of 5 tonnes / ha). Children - Children Petak (AAP): Biochar Application Dose (B) with four levels of treatment are: b0 = without biochar (0 ton / ha); b1 = biochar dose of 5 t / ha; b2 = biochar dose of 10 ton / ha; b3 = biochar dose of 15 ton / ha. The treatment is a combination of Fumigation (F), Biokompos (K), and Biochar (B) so there are 16 combinations of treatment each - each repeated three times so that there are 48 experimental units.

Implementation Trial

Preparation fungus Trichoderma spp Provision cultures. Provision cultured fungus T. harzianum isolates Sapro - 07 and T - 02 ENDO koningii isolates and


PROCEEDING 2017 155

isolates to be used is derived from the collection of Prof. Sudantha in the Laboratory of Crop Production Faculty of Agriculture, University Mataram.Isolat fungus T. harzianum isolates Sapro - 07 and T - 02 koningii isolates ENDO first be purified in PDA + streptomycin medium in a petri dish , after the pure bred on the PDA without the use of streptomycin .

Making preparations Biokompos

Before the manufacture biokompos done first solution made Biotricon made by T. koningii culture isolates of endophytic fungi ( Endo - 04 ) and the fungus T. harzianum (isolates Sapro - 07) which had been grown in PDA ( aged two weeks ) was dissolved in 1 liter water , then added 2.5 grams of granulated sugar. Biokompos to be used is compost derived from rice straw prepared by hay dried and cut into pieces with a size of 3-5 cm , mixed with cow dung and sawdust solid wood , created plated to a height of about 1 meter and then sprayed with a solution biotrichon. Compost evenly watered while compost material is stirred until the water content reaches 30-40 % . The next ingredient in the compost pile with a tarpaulin cover tightly and do the reversal of two weeks. The composting process from the beginning until ready for use takes 4 weeks .

Preparation Making Biochar

Biochar comes from the remnants of coconut shell charcoal manufacture of Small Industry Making charcoal in the village of Gunung Sari Bengkaung District of West Lombok regency. The technique of making biochar in small industries are as follows: Source biochar (coconut shell) that had been prepared inserted into the drum, then heated using the furnace which has a length of 120 cm, width 70 cm, and 40 cm high fuel coconut fibers and powders saw. Temperature measurement is performed every hour until towards the end of the heating process. Heating the material is done until all the ingredients transformed into black charcoal. Production of biochar then cooled and put into sacks. Biochar is then pulverized (grinding) such sieved with a 1.0 mm sieve eye strain. Furthermore, biochar in put into fermentation tanks, arranged pile of biochar as deep as 30 cm and then sprayed with a solution biotrichon (containing the fungus T. harzianum isolates Sapro-07 and T-02 koningii isolates ENDO) evenly while biochar stirring until the water content reaches 30 - 40%. Furthermore, biochar sealed with a tarp and left for 1 week

Provision of Land

Land to be used are cropping land in the village of the District Labuapi Bageq Polak - West Lombok. Before planting tillage conducted prior to stages as follows: a. The area of the land is cleared of weeds or other plant debris. b. Tillage manner dug as deep as 15-20 cm and burying weeds that had rotted, the

next chunk of land cultivation results are dried for 5-7 days. c. Furthermore dibibuat plot-plot experiments for the planting of soybeans with a

plot size of 2 x 2.5 meters. Between plots with each other created a trench with a width of 30 cm and depth of 30 cm. Inter block made trench with a width of 60 cm and depth of 60 cm. All around the land made moat 40 cm with a depth of 30 cm.


PROCEEDING 2017 156

d. Applications Fumigation done a week before planting in order to avoid the possibility of killing the microorganisms that exist in biokompos and biochar.

e. The second hoeing parallel activities tilling the soil followed by application of biochar in the plot biokompos and treatment.

f. Applications biokompos and biochar made on solum thickness of topsoil (to a depth of ½ x 10 cm of raised bed plots treated).

g. After land preparation is complete and then later do penananman. Plant Maintenance

Maintenance of the plant include replanting, weeding, pest control (OPT) and fertilization. Stitching is done one week after planting (1 wap) on the seed grow. Weeding is done once a week to clear weeds to reduce the impact of competition. If there are pests and diseases in the crop should be controlled by mechanical means and the use of pesticides according to the type of pests and diseases that attack. Fertilization is done by using half the recommended dose. Watering is done by flushing until the planting medium, when moist (not wet) from the time of planting to a maximum of pod filling .

Observations Variables

The parameters to be observed in this study is the growth of plants. observation of plant growth will be done systematically with a diagonal pattern (5%) on each block, so that in each plot five plant samples. Observations made during the life of the plants 3 weeks after planting until the generative growth phase is done every week. Plant height is measured from the base of the stem to the highest end of the soybean crop.

Data Analysis

The data were analyzed using analysis of diversity at the 5% significance level. Further treatment showed significant difference was tested further by Honestly Significant Difference test on the real level of the same. RESULTS AND DISCUSSIONS

Plant Height (Cm)

The observation and analysis of the results of the high diversity of soybean plants were treated with biochar biokompos and fermented fungus Trichoderma spp . and fumigation aged 3 , 4 , and 5 weeks after planting ( wap ) have a significant influence on plant height. High soybean plants wap age 3 showed that the fumigation treatment and biokompos factors showed a significant effect on the increase in soybean plant height . While biochar factors and the interaction effect between biokompos , biochar and fumigation showed no significant effect . The average height of soybean plants as a result of the influence of fumigation treatment and tested further by a significant difference of 5% is presented in Tables 1 and 2 below .

In Table 1 shows that the fumigation treatment factors have a significant influence on the soybean plant height age of 3 weeks after planting. High soybean crop in fumigation higher compared with those not in fumigation. The average height of soybean plants were fumigated 3 wap is 19.43 cm while not fumigated 17.49 cm. The average height of soybean plants are in fumigation higher than soybean plants


PROCEEDING 2017 157

that are not in the fumigation caused by soybean plants were fumigated better growth and development. This is because of plant pests (OPT) in plants that have been fumigated already cleaned before planting. While on soybean plants that do not tend to be fumigated in the pest population is high. Prayudyaningsih (2012), stating that the land Fumigation is done before the seeds or seedlings are planted to effectively reduce pathogenic fungi, insects, nematodes, and some kind of weed seeds.

Table 1. The average height of soybean plants as a result of the influence of factors

fumigation at the age of 3 weeks after planting ( 3 WAP) .

Treatment Plant height (cm) Without Fumigation 17,49 a *) With Fumigation 19,43 b BNJ 5 % 1,09

*) The numbers in each row followed by the same lowercase letters are not significantly different at the level of 5 % HSD test.

On the results of a further test calculation factors influence biokompos application to high soybean crop showed wap age 3 showed a significant effect. He continued in the present test results in Table 2 below.

Table 2. The average height of soybean plants as a result of the influence of factors biokompos at the age of 3 weeks after planting (3 WAP).

Treatment Plant height (cm) Without Fumigation 17,41 a With Fumigation 19,50 b BNJ 5 % 1,09

*) The numbers in each row followed by the same lowercase letters are not significantly different at the level of 5 % HSD test .

Based on Table 2 above it can be seen that the application biokompos a significant influence on the plant height of soybean aged 3 wap. Treatment without biokompos lower than the treatments applied biokompos (dose of 5 tonnes / ha). The average height of soybean plants without biokompos which is 17.41 cm, while the average height of soybean plants were applied bikompos is 19,50 cm. If you see a further test results in Table 2 it is shown that the application of compost fermented and saprofit endophytic fungi Trichoderma sp. causing higher when compared with no application biokompos. This shows fermented compost and saprofit endophytic fungi Trichoderma sp. able to stimulate vegetative growth of soybean plants. This is consistent with the statement Sudantha (2008) that the use of biokompos containing the active ingredient endophytic fungi T. polysporum, saprofit T. harzianum induced in addition to improving resistance to fusarium wilt also able to improve plant health, stimulate vegetative growth and flowering plants, and increased yield.


PROCEEDING 2017 158

Height observation of soybean plants aged 4 wap shows that fumigation and treatment biokompos factors have a significant influence on the high plant height increasing. While the biochar treatment factors and the influence of interaction between factors fumigation treatment, and biochar bioompos influence signifikanterhadapa showed high increase in soybean plants. The average height of soybean plants as a result of the influence of fumigation treatment and biokompos tested further with a significant difference of 5% is presented in Tables 3 and 4 below. Table 3. The average height of soybean plants as a result of the influence of factors

fumigation at the age of 4 weeks after planting (4 WAP).

Treatment Plant height Without Fumigation 35,59 a With Fumigation 38,32 b BNJ 5 % 1,72

* ) The numbers in each row followed by the same lowercase letters are not significantly different at the level of 5 % HSD test .

Based on Table 3 shows that the fumigation treatment give real effect to the increase in soybean plant height . The average soybean crop is in fumigation before planting is 38, 32 cm, while the average height of soybean plants that are not in the fumigation is 35.59 cm. This can happen because the fumigation caused the ground to avoid nuisance pest and weed growth, so growth soybean crop would be optimal (Prayudyaningsih, 2012). Biokompos treatment effect on soybean plant height observation age 4 wap showed a significant effect . The average height of soybean plants as a result of the effect of treatment factors biokompos tested further with a significant difference of 5% is presented in Table 4 below.

Table 4. Average height of soybean plants as a result of the influence of factors biokompos at the age of 4 weeks after planting ( 4 WAP ) .

Treatment Plant height Without Biokompos 35,47 a With Biokompos 38,44 b BNJ 5 % 1,72

* ) The numbers in each row followed by the same lowercase letters are not significantly different at the level of 5 % HSD test .

Based on Table 4 shows that there is a difference in the average height of soybean plants between treatment that is applied biokompos with perakuan who applied biokompos. The average height of soybean plants were applied biokompos is 38.44 cm, while the average high soybean crop is not applied biokompos is 35.47 cm. An increase in plant growth in soybean plants that applied biokompos due biokompos containing Trichoderma spp. providing nutrients and nutrients needed for


PROCEEDING 2017 159

plant growth. According to Cook and Baker (1989), Trichoderma spp. can improve plant growth caused by Trichoderma spp. has the ability to stimulate plants to increase growth hormone. Further Khaerati (2011) reported that the application biokompos fermented mushroom trichoderma spp. has the ability to increase the speed of plant growth and development, especially its ability to cause the production of healthy roots and increase the depth of deeper roots below the ground surface, deeper roots can cause the plants more resistant to drought. In observation of high soybean crop wap age 5 show the influence of interaction between factors fumigation and bikompos showed significant effects. While the fumigation treatment factors, biokompos and biochar does not have a significant influence on the increase in soybean plant height. Neither the influence of interaction between factors fumigation with biochar, and the interaction between the factors fumigation with biokompos and biochar showed no significant effect. The average height of soybean plants as a result of interactions between factors fumigation and biokompos tested further by a significant difference of 5% is presented in Table 5 below. Based on Table 5 shows that the effect of interaction between factors biokompos fumigation treatment and a significant influence on the increase in soybean plant height at age 5 wap. The average height of soybean plants in the control treatment (without fumigation and without biokompos) tend to be lower when compared with the treatment applied by fumigation and biokompos. The average height of soybean plants from highest to lowest are respectively; interaction between treatment without fumigation and with biokompos that is 50.26 cm, with fumigation and without biokompos that is 50.06 cm, with fumigation and with biokompos namely 48.4, and without fumigation and without biokompos which is 46.36 cm. Based on Table 5, it appears that the application of fumigation and biokompos capable improved its growth and development of soybean plants.

Table 5. The average height of soybean plants as a result of interactions between factors fumigation and biokompos at the age of 5 weeks after planting (5 WAP).

Treatment Plant height (cm)

Without fumigation and without biokompos 46,36 a Without fumigation and with biokompos 50,26 b Fumigation with and without biokompos 50,06 b With Fumigation and with biokompos 48,4 ab BNJ 5 % 2,93

* ) The numbers in each row followed by the same lowercase letters are not significantly different at the level of 5 % HSD test.

The average height of soybean plants were higher in the treatment fumigated and applied biokompos. This is because with fumgasi providing a more healthy growth for the soybean crop due to avoid the attack of pest and weed pest. This is consistent with the statement of Pinkerton (2000), that the treatment with soil solarization, solaraisasi soil and ground cover plants and fumigation with metam sodium resulted in a decrease in population density cinnamoni Phytophthora and


PROCEEDING 2017 160

Verticillium dahliae to within 5 and 10 cm soil. P. penetraans population density decreased at a depth of 30 cm of the soil surface with solarization. Applications biokompos able to improve soil fertility, improve the structure and characteristics of the soil, increasing the capacity of absorption of water by the soil, improve soil microbial activity, improve the quality of the crop (taste, nutritional value, and the amount of harvest), provides hormones and vitamins for plants, Suppress growth / attack plant diseases, increase retention / availability of nutrients in the soil (Sudaryana, 2012). Meanwhile, according to (Gaur, 1980) the role of organic matter to the soil physical properties of which stimulate granulation, improve soil aeration, and increases the ability to retain water; biological properties of the soil which increases the activity of microorganisms that play a role in nitrogen fixation and transfer of certain nutrients like N, P, and S; Soil chemical properties is increasing the cation exchange capacity that affect nutrient uptake by plants. Further Santoso (2007) stated that with the addition of compost in the soil will spur the growth of microorganisms in the soil, CO2 gas produced soil microorganisms will be used for the photosynthesis of plants and produce hormones that can stimulate plant growth and development. Sudantha (2013), reported that biokompos fermented juamur endophytic and saprophytic Trichoderma spp. able to stimulate plant growth and development compounds that contain growth promoters. According to Cook and Baker (1989), Trichoderma spp. can improve plant growth caused by Trichoderma spp. has the ability to stimulate plants to increase growth hormone. Endophytic fungus is spread vertically from the generative parts of the plant to the offspring and grow systemically through the leaves and stems (Clay and Schardi, 2002 in Arnold et al., 2003). CONCLUSIONS

Based on the results of the above description may be taken some conclusions: 1. Applications Fumigation able to increase vegetative growth of soybean plants . 2. Application biokompos a dose of 5 tones / ha were able to increase vegetative

growth of soybean plants 3. Effect of the interaction between factors fumigation with biokompos increase

vegetative growth of soybean plants . REFERENCES

Arsyad dan Syam, 1998. Kedelai Sumber Pertumbuhan Produksi dan Teknik Budidaya Pusat Penelitian dan Pengembangan Tanaman Pangan. Badan Penelitian dan Pengembangan Pertanian. Departemen Pertanian 30 hal. Cook, R. J. and K. F. Baker, 1989. The Nature on Practice of Biological Control of Plant Pathogens. ABS press, The American Phytopathological Society, St. Paul, Minesota 539 p. Direktorat Kacang-kacangan dan Umbi-umbian 2004. Program Bangkit Kedelai Tahun 2004. Dirjen Bina Produksi Tanaman Pangan. Direktorat Kacang-kacangan dan Umbi-umbian. Jakarta. 27 hal.


PROCEEDING 2017 161

Gaur, D. C., 1980. Present Status of Composting and Agricultural Aspect, in: Hesse, P. R. (ed). Improvig Soil Fertility Through Organic Recycling, Compost Technology. FAO of United Nation. New Delhi. Akses: 7 September 2013. Glick. RB.1995. The enhancement of plant growth promotion by free living bacteria. Can. J Microbial 41 : 109-117 Isroi, 2008. KOMPOS. Makalah. Balai Penelitian Bioteknologi Perkebunan Indonesia, Bogor.Kompos Limbah Padat Organik. Akses: 16 Pebruari 2013. Khaerati, 2011. Potensi Trichoderma sp. Sebagai Biofungisida. Majalah Semi Populer Tanaman Rempah dan Industri. Vol. 2. Nomor 6, Juni 2011. Balai Penelitian Tanaman Rempah dan Aneka Tanaman Industri. Mas’ad, 2012.Peranan Biokompos (Hasil Fermentasi Jamur Trichoderma spp.)

Untuk meningkatkan Kesehatan, Pertumbuhan, Pembungaan dan Hasil Tanaman

Kedelai di Lahan Kering.Tesis.Universitas Mataram. Mataram.

Muhtajali; I. W. Wangiyana dan I. M. Sudantha, 2009. Efektivitas Jamur Saprofit Trichoderma harzianum dan Fungi Mikoriza Abskular (FMA) dalam Menekan Serangan Jamur Sclerotium rolfsii dan Peningkatan Pertumbuhan Tanaman Kedelai. Artikel Publikasi Ilmiah Program Magister Pengelolaan Sumberdaya Lahan Kering Program Pascasarjana Universitas Mataram. Pinkerton, J.N. 2000. Effect of Solarization and cover crops on population of selected soilborne plant pathogens in Western Oregon. Plant Disease 84:952-960. Prayudyaningsih, R. 2012. Mikoriza dalam Pengelolaan Hama-Penyakit Terpadu di Persemaian. Info Teknis EBONI Vol.9 No.1, Oktober 2012 : 55-75 Sudantha, I. M., 1997. Pemanfaatan Kompos Limbah Organik dan Jamur Trichoderma spp. Sebagai Pengendali Penyakit Tanaman Tomat dan Pengaruhnya Terhadap Pertumbuhan Hasil. Fakultas Pertanian Universitas Mataram. Sudantha, I. M., 2007. Karakterisasi dan Potensi Jamur Endofit dan Saprofit Antagonistik Sebagai Agens Pengendali Hayati Jamur Fusarium oxysporum f. sp. vanillae Pada Tanaman Vanili di Nusa Tenggara Barat. Disertasi Program Pascasarjana Universitas Brawijaya, Malang. 337 hal. Sudantha, I. M., 2008. Aplikasi Jamur Trichoderma spp. (Isolat ENDO-02 dan 04 serta SAPRO-07 dan 09) sebagai Biofungisida, Dekomposer dan Bioaktivator Pertumbuhan dan Pembungaan Tanaman Vanili dan Pengembangannya pada Tanaman Hortikultura dan Pangan Lainnya di NTB. Laporan Penelitian Hibah Kompetensi DP2M - Fakultas Pertanian Universitas Mataram, Mataram. 117 hal. Sudantha, I. M., 2010a. Pengendalian Hayati Patagen Tanaman. Mataram University Press. Mataram.


PROCEEDING 2017 162

Sudantha, I. M., 2010b. Buku Teknologi Tepat Guna: Penerapan Biofungisida dan Biokompos pada Pertanian Organik. Fakultas Pertanian Universitas Mataram, Mataram. Sudantha, I. M., 2010c. Pengujian beberapa jenis jamur endofit dan saprofit Trichoderma spp. terhadap penyakit layu Fusarium pada tanaman kedelai. Jurnal Ilmu Pertanian Agroteksos, Fakultas Pertanian Universitas Mataram, Mataram. Vol. 20 No. 2. Sudantha. 2013. Potensi Jamur Endofit Dan Saprofit Trichoderma spp. Untuk

Pembuatan Biofungisida, Bioaktivator, Biodekomposer Dan Biochar Dan

Peranannya Dalam Meningkatkan Kesehatan Dan Ketahanan Pangan. Fakultas Pertanian Universitas Mataram. Sudantha, I. M., 2011a. Uji aplikasi beberapa jenis biokompos (hasil fermentasi jamur T. koningii isolat Endo-02 dan T. harzianum isolat Sapro-07) pada dua varietas kedelai terhadap penyakit layu fusarium dan hasil kedelai. Jurnal Ilmu Pertanian AGROTEKSOS, Fakultas Pertanian Universitas Mataram, Mataram. Vol. 21 No. 1 April 2011. Sudaryana, A., 2012. Kompos Mengembalikan Unsur Hara Tanah. Website: http://www.tataruangindonesia.com/fullpost/headline/1333795847/%2%80%9Ckompos%E2%80%9D-mengembalikan-unsur-haratanah.html. Suherman, M., 2013. Ini Penyebab Produksi Kedelai Merosot dalam 5 Tahun

Terakhir. Kompas.Jakarta.http://bisniskeuangan.kompas.com/read/2013/10/07/1900570/Ini.Penyebab.Produksi.Kedelai.Merosot.dalam.5.Tahun.Terakhir. Wiryawan, G., 2013. Kedelai Kurang, Pemerintah Terpaksa Impor. Kompas. Jakarta Selatan http://regional.kompas.com/read/2013/08/23/1816286/Gita.Kedelai.Kurang.Pemerintah.Terpaksa.Impor.


PROCEEDING 2017 163

DETERMINING AN OPTIMAL ISOLATION METHOD OF

CARRAGEENAN FROM SEAWEED Kappaphycus alvarezii Doty

THAT MEETS FAO STANDARDS

Ni Putu Ayu Dewi Wijayanti *, I Gusti Ngurah Agung Dewantara Putra,

Ni Putu Linda Laksmiani and Ketut Widyani Astuti

Department of Pharmacy, Faculty of Mathematics and Natural Sciences,

Udayana University * Corresponding author: [email protected]

Abstract

Seaweed Kappaphycus alvarezii Doty is a marine product of high economic values as it can produce carrageenan. Carrageenan can be used in pharmaceutical formulations, cosmetics and food. Therefore, it is necessary to do isolation of the carrageenan from seaweed using an optimum method. This study aims to investigate an optimal carrageenan isolation method that meets the characteristics determined by the Food Agriculture Organization (FAO). Seaweed samples were collected from Nusa Lembongan of Klungkung Regency, Bali Province. In order to determine the optimal carrageenan isolation method, this study used varied concentration of KOH (5% and 10%), varied extraction time (0.5 hour and 2 hours) and varied precipitation time (0.5 hour and 1 hour) with a factorial experimental design using Design-Expert version 7.0.0 program. The chemical and physical properties of the carrageenan were then evaluated using FAO standards and analyzed using a one-way ANOVA. Results of the one-way ANOVA analysis showed that KOH concentration, extraction time and precipitation time have a significant effect on the yield, viscosity, sulfate content and ash content. In this study it can be concluded that extracting seaweed using aqueous solution of KOH of 5.39% during the extraction time of 0.85 hour and the precipitation of 0.85 hour could produce carrageenan with the yield of 27.05%, viscosity of 6 cPs, sulfate content of 17.70 % and ash content of 18.22% that meets FAO standards.

Keywords: Isolation Method, Carrageenan, Kappaphycus alvarezii Doty, FAO

BACKGROUND

Seaweed Kappaphycus alvarezii Doty is a type of seaweed that is widely cultivated and developed in Indonesia. This seaweed has high economic value since it can be processed to produce carrageenan (Prasetyowati et al., 2008). Carrageenan is a linear polysaccharide and constitutes a large molecule composed of more than 1,000 galactose residues consisting of potassium, sodium and potassium sulfate esters of galactose and 3,6-anhydrogalactose copolymers (Chapman, 1980). Approximately 80% of carrageenan products are used in food industry and the other 20% are used in non-food industry, pharmaceuticals and cosmetics (Distantina et al., 2012). However, producing carrageenan with good quality requires a carrageenan


PROCEEDING 2017 164

isolation method that is quite complicated and relatively expensive. This is a constraint in the development of carrageenan industry in Indonesia.

Research on the isolation of the carrageenan has been done by Distantina, et al. (2012) using KOH (Potassium Hydroxide) as the solvent at a concentration of 0.5 N for 30 minutes and the precipitation using 90% ethanol for 30 minutes. Meanwhile, in the research conducted by Bono et al. (2014), extraction was conducted using 10% KOH during 30 minutes and without any precipitation stage. Different methods of isolation of the carrageenan have different effects on the quality of the resulting carrageenan (Mtolera et al., 2004 and Pelegrin, 2006). The use of KOH as an alkaline solvent can produce better extraction of polysaccharides from seaweed Kappaphycus

alvarezii Doty which results in better yields of carrageenan (Distantina et al., 2012). Therefore, in order to obtain carrageenan products with the quality that meets

the standards set by FAO, optimization of the isolation method of carrageenan from seaweed Kappaphycus alvarezii Doty was done by optimizing the concentration of the KOH solvent (5% and 10%), extraction time (0.5 hour and 2 hours) and the precipitation time (0.5 hour and 1 hour) using a factorial experimental design program namely Design Expert version 7.0.0. program. The physical and chemical properties of the carrageenan which include the yields, viscosity, sulfate content and ash content were then evaluated using one-way ANOVA, and the factors that significantly influence the physical and chemical properties of the carrageenan were observed. The optimum isolation method was determined by looking at the value of desirability that is closest to 1 on the Design Expert version 7.0.0 program. MATERIALS AND METHODS

Materials

The research materials used were seaweed Kappaphycus alvarezii from Lembongan Village of Nusa Penida, KOH (Bratachem), 90% Ethanol (Bratachem) and distilled water of technical grade, Hydrochloric Acid (Merck), and Barium Chloride (Merck) of p.a. degree.

Methods

Optimization of Carrageenan Isolation Method

Optimization of carrageenan isolation method was conducted by varying the concentrations of KOH, extraction time and precipitation time at the highest level and the lowest level and the data were processed using a factorial experimental design program namely Design Expert version 7.0.0. program.

Table 1. Optimization of the Method using Factorial Experimental Design.

Formula Factor 1:

KOH concentration (%) Factor 2:

Extraction time (hour) Factor 3:

Precipitation time (hour) 1 5 0.5 0.5 2 10 0.5 0.5 3 5 2 0.5 4 10 2 0.5 5 5 0.5 1 6 10 0.5 1 7 5 2 1 8 10 2 1


PROCEEDING 2017 165

Extraction of Carrageenan

Dried Kappaphycus alvarezii Doty seaweed was cut into small pieces (± 1 cm), and then weighed as much as 50 grams. The seaweed was then soaked in distilled water for 30 minutes. Then, it was extracted using KOH solution with varying concentrations of 5 % and 10%. The extraction was done on a hot plate at a temperature of 90°C during a predetermined time. The ratio of dried seaweed and the solvent was 1:30 (g/mL). The extraction time variations were 0.5 hour and 2 hours. Finally the extract was filtered using gauze cloth in a hot condition. Precipitation

After the extraction, precipitation was conducted by adding 90% ethanol to the filtrate to form hydrocolloid fibers (carrageenan fibers). The ratio between the filtrate volume and the ethanol volume is 1: 3 (v/v). The variations of precipitation time were 0.5 hour and 1 hour. Carrageenan fibers formed were then filtered and washed with distilled water until the washing water reached a neutral pH, and then they were dried in an oven at 60°C for 48 hours or until they reached a constant weight and dried carrageenan was obtained. Next, the carrageenan was made into powder until it was smooth (Distantina 2009, modified).

Evaluation of Physical and Chemical Properties of Carrageenan

a. Yields The carrageenan yield was calculated based on the ratio between the

weight of carrageenan produced and the weight of dried seaweed used (Andriani, 2006).

b. Viscosity The carrageenan solution at a concentration of 1.5% was heated in a glass beaker at a temperature of 90°C. The temperature was lowered while the solution was stirred regularly until the temperature reached 76oC -77oC. The viscosity was measured using a Brookfield Viscometer at a speed of 100 rpm. Reading was taken after one minute full (Andriani, 2006).

c. Sulfate Content Analysis of sulfate content in the carrageenan was done using the hydrolysis method followed by sulfate precipitation as barium sulfate. The 0.5 g sample (W1) was hydrolyzed using 50 mL of 0.1 N HCl for 15 minutes at a boiling temperature. About 10 mL of BaCL2 of 0.25 M was added little by little while boiling for 5 minutes. After being allowed to stand for 5 hours, the precipitate was filtered using Whatman filter paper (no. 42 ashless) and subsequently burned in a furnace at 700°C for 1 hour. The weight of white ash is the weight of barium sulfate (W2). The sulfate content was calculated using the formula of ((W2 x 0.4116)/W1) x 100% (Distantina et al., 2010).

d. Ash Content A porcelain crucible was heated in an oven for one hour at a temperature of 105oC, and then cooled in a desiccator and weighed until a constant weight (A) was obtained. The carrageenan powder was then weighed as much as 2 g (B), and then put into the crucible and heated on a fire. After that, it was put into an electric furnace at a temperature of 650oC for ± 12 hours. Next, it was cooled in a desiccator, and then weighed until a constant weight (C) was obtained. The


PROCEEDING 2017 166

ash content was calculated using the formula of ((A+B)-C)/B x 100% (AOAC 1995).

Data Analysis

Data on the yields, viscosity, sulfate content and ash content were analyzed using one-way Analysis of Variance (ANOVA) at a 95% confidence level. The optimum carrageenan isolation method was determined using Design Expert version 7.0.0 program based on the desirability closest to 1.

RESULTS

Table 1. Results of Evaluation of Physical and Chemical Properties of the Carrageenan

Formula Results of Evaluation (x ± SD)

Yield (%) viscosity (cPs) Sulfate content (%) Ash content (%) F1 22.01±3.26 8.4±0 17.22±0.95 17.57±01.35 F2 29±2.43 4±0 19.30±1.09 22.79±0.56 F3 27.3±1.61 4.4±0 18.64±0.92 16.77±5.06 F4 29.26±3.10 3.47±0.23 19.83±0.48 15.86±0.85 F5 27.90±1.04 5.33±0.23 17.35±0.86 20.38±1.76 F6 30.92±3.33 3.6±0 20.17±0.77 21.11±0.19 F7 35.92±0.40 5.2±0.46 17.78±0.62 12.16±1.02 F8 39.99±1.10 3.07±0.23 18.37±0.77 17.38±1.88

DISCUSSIONS

a. Yields

Yields serve as an important parameter in assessing the effectiveness of the process of making carrageenan powder. The minimum yield according to the standards set by the Department of Trade (1989) was 25%. The results of the analysis using one-way Analysis of Variance (ANOVA) showed that KOH concentration, extraction time and precipitation time have a significant effect on the yield of carrageenan (p<0.05). The yield of the carrageenan resulting by using 10% KOH is greater than that using 5% KOH. This is because higher KOH concentration produces greater KOH solvent capabilities in extracting carrageenan. Alkaline treatment helps improve the extraction of polysaccharides and accelerate the formation of 3,6-anhydrogalactose (Yasita and Rachmawati, 2010).

Suryaningrum et al. (2002) stated that the K+ ions help in the formation of double helix and inter-helical aggregates that form a three-dimensional network in the forming of gel. Kappa carrageenan gel is formed in the presence of K+ ions, especially at the sol-gel transition phase that depends on the temperature and the amount of K+ ions (Rochas and Rinaudo, 1980 in Herliany et al., 2013). The yield produced through the extraction of carrageenan for 2 hours is greater than that for 0.5 hour. This is because the longer the contact time of the seaweed with heat or with an extraction solvent, the more carrageenan that can be extracted from the seaweed cell walls. In addition, hot alkaline solution can cause increased permeability of cell walls and increase the rate of diffusion of substances passing through the cell walls, which finally produces higher yields of carrageenan (Yasita and Rachmawati, 2010).


PROCEEDING 2017 167

b. Viscosity

Viscosity is used as a measure and control to determine the quality of a final product (Lestari, 2004). The viscosity of carrageenan based on the quality specification set by FAO is a minimum of 5 cPs (FAO, 1990). The results of the analysis using one-way Analysis of Variance (ANOVA) showed that the concentration of KOH has a significant effect on the viscosity of the carrageenan (p<0.05), while the extraction time and precipitation time do not have a significant effect on the viscosity of Doty (p>0.05).

The viscosity of the carrageenan using a formula with 5% KOH concentration is higher than that with 10% KOH. This decrease may be due to K+ ions dissolved in the carrageenan, which can decrease the carrageenan net charge along the polymer chain. K+ ions come from the KOH that is used as an extraction solvent. According to Towle (1973), a decrease in net charge of carrageenan causes less repulsion between sulfate groups, which causes the hydrophilic nature of the polymers to become weaker and the viscosity to become lower.

c. Sulfate Content

Seaweeds that produce agar or carrageenan are composed of sulfate groups which serve as one of the determinants of the quality of seaweed products (Basmal et al., 2009). The results of the analysis using one-way Analysis of Variance (ANOVA) showed that the concentration of KOH has a significant effect on the level of sulfate content in the carrageenan (p <0.05). In this study, the level of sulfate in the carrageenan extracted using 10% KOH is greater than that using 5% KOH.

The content of sulfates in the carrageenan is closely related to the amount of 3,6-anhydrogalactose and the strength of the resulting gel. However, the excessive concentration of extraction solvent will cause a high level of sulfates in carrageenan and reduce the gel strength. This is because the saturation concentration of K+ ions causes a balance between ions to become more difficult to achieve (Imeson, 2000). High sulfate content causes more repulsion between negatively charged sulfate groups, which results in rigidity and straightening of polymer chains which then increase the viscosity.

d. Ash Content

The ash content indicates the amount of mineral contents in seaweeds that are not burnt during the ashing process (Bidwel, 1974 in Syamsuari, 2006). Macro minerals such as Na, Ca, K, Cl, Mg, P, S, and trace elements such as I, Mn, Cu, Fe are commonly found in seaweeds (Santoso et al., 2006 in Wenno, 2012). The result of the analysis using the one-way Analysis of Variance (ANOVA) showed that the KOH concentration and extraction time have a significant effect on the ash content of the carrageenan (p<0.05).

According to Winarno (1996), a potassium ion is an unburned mineral element (ash). The higher the concentration of KOH used in the extraction process, the higher the ash content of the resulting carrageenan will be. Therefore, the ash content in the extraction of carrageenan using 10% KOH is greater than that using 5% KOH. The percentage of ash content of the resulting carrageenan in this study has met the requirements set forth by FAO, namely 15-40%.


PROCEEDING 2017 168

Determination of an Optimal Carrageenan Isolation Method

The optimum formula was determined using the Design Expert version 7.0.0 program by looking at the desirability value of the formula which is close to 1. The results revealed that the optimal carrageenan isolation method could be applied by extracting the seaweeds using 5.39% KOH solution for 0.85 hour and during 0.85 hour of precipitation time, and the resulting carrageenan will have the properties of 27.05% yield, 6 cPs viscosity, 17.70% of sulfate content and 18.22% of ash content that meet the FAO standards.

CONCLUSIONS

Seaweed extraction using 5.39% KOH solution for 0.85 hour and 0.85 hour of precipitation will produce carrageenan with the properties that meet FAO standards.

ACKNOWLEDGEMENT

We would like to express our deepest gratitude to the Institute of Research

and Community Service of Udayana University for its support, and Laboratory of Formulation and Technology of Non-Sterile Dosage Forms of Department of Pharmacy, Faculty of Mathematics and Natural Sciences of Udayana University for its laboratory equipment.

REFERENCES

Andriani D. 2006. Pengolahan rumput laut (Eucheuma cottonii) menjadi tepung ATC (Alkali Treated Cottonii) dengan jenis dan konsentrasi larutan alkali yang berbeda. Undergraduate thesis. Makassar: Faculty of Agriculture and Forestry, Universitas Hasanudin.

AOAC. 1995. Official Methods of Analysis of the Association of Official Analytical

Chemist. Inc. Washington DC. Pp. 185-189.

Basmal, J., B.S. Bandol Utomo and B.B. Sedayu. 2009. Mutu Semi Refined Carrageenan (SRC) yang Diproses Menggunakan Air Limbah Pengolahan SRC yang Didaur Ulang. Jurnal Pascapanen dan Bioteknologi Kelautan dan Perikanan Vol. 4 No. 1, Jakarta, Pp. 7

Bono, W., S. Anisuzzaman, O. Wan. 2014. Effect of process conditions on the gel viscosity and gel strength of semi-refined carrageenan (SRC) produced from seaweed (Kappaphycus alvarezii). Journal of King Saud University. Engineering

Sciences. 26, 3–9.

Chapman, V.J., and Chapman, D.J., 1980. Seaweeds and Their Uses. 3rd ed., Chapman and Hall, New York

Distantina, S., Fadhilah, Rochmadi, Wiratni, M. Fahrurozi. 2010. Proses Ekstraksi Karagenan dari Eucheuma cottonii. Seminar Rekayasa Kimia dan Proses.


PROCEEDING 2017 169

Department of Chemical Engineering, Faculty of Engineering of Universitas Diponegoro, Semarang.

Distantina, S., Fadhilah, Y.C Danarto, Wiratni, M. Fahrurozi. 2009. Efek Bahan Kimia Pada Tahap Presipitasi Terhadap Rendemen dan Sifat Karagenan dari Rumput Laut Eucheuma cattonii. Ekuilibrium Vol. 8. No.2 pp.47-53

Distantina, S., Rohmadi, Qiratni, M. Fahrurozi. 2012. The Mechanism of Carrageenan Extraction from Eucheuma cottonii Using Alkaline Solvent. AGRITECH, Vol. 32, No. 4. pp 397-402.

FAO. 1990. Training Manual on Gracilaria Culture and Seaweed Processing in

China. Rome. p 37-42

Herliany, N.E., J. Santoso, E. Salamah. 2013. Karakteristik Biofilm Berbahan Dasar Karaginan. Jurnal Akuatika Vol. IV No. 1 pp. 10-21.

Imeson A. 2000. Carrageenan. in: Phililps GO, Williams PA (editors). Handbook of

Hydrocolloids. Wood head Publishing. England. p 87 – 102.

Lestari, H. 2004. Pengaruh Penambahan Alkali dan Natrium Disulfit Terhadap Mutu

Karagenan dari Eucheuma cottonii. Faculty of Mathematics and Natural Sciences. Institut Pertanian Bogor (Bogor Agricultural Institute). Bogor

Mtolera, M.S., and Buriyo, A.S., 2004, Studies on Tanzanian Hypneaceae: Seasonal Variation in Content and Quality of Kappa-Carageenan from Hynea musciformis, Western Indian Ocean J. Mar. Sci., 3, pp. 43-49

Pelegrin, Y.F., Robledo, D., and Azamar, J.A.,2006, Carraggeenan of Eucheuma

isiforme (Solieriaceae, Rhodophyta) from Yucatanm Mexico. I. Effect of Extraction Conditions, Botanica Marina, 49, pp. 65-71.

Prasetyowati, C. Jasmine, D. Agustiawan. 2008. Pembuatan Tepung Karaginan dari Rumput Laut (Eucheuma cattonii) Berdasarkan Perbedaan Metode Pengendapan. Jurnal Teknik Kimia. No.2. Vol 15. Pp.27-33

Suryaningrum, T.D. and Utomo, B.S.B. 2002. Petunjuk Analisis Rumput Laut dan

Hasil Olahannya. Pusat Riset Pengolahan Produk dan Sosial Ekonomi Perikanan dan Kelautan (Centre for Product Processing Research and Socio-economic Affairs of Fisheries and Maritime), Jakarta.

Syamsuar, 2006. Karakteristik karaginan Rumput laut Eucheuma cottonii Pada Berbagai Umur panen, Konsentrasi KOH dan Lama Ekstraksi. Master thesis. IPB.

Towle, G.A. 1973. Carrageenan. In: Whistler RL (editor). Industrial Gums. 2nd ed., Academic Press New York, 83 – 114 p.

Wenno, M.R., J.L.Thenu, C.G.Cristina. 2012. Characteristics of Kappa Carrageenan from Kappaphycus alvarezii at Different Harvesting Times. JPB Perikanan 7(1): 61-

68


PROCEEDING 2017 170

Winarno, F.G. 1996. Teknologi Pengolahan Rumput Laut. Pustaka Sinar Harapan. Jakarta

Yasita, D. and Rachmawati, I.D., 2010. Optimasi Proses Ekstruksi pada Pembuatan

Karaginan dari Rumput Laut Eucheuma cottonii Untuk Mencapai Food Grade. Department of Chemical Engineering, Faculty of Engineering of Universitas Diponegoro. Semarang.


PROCEEDING 2017 171

LESS FREQUENTLY CONSUMED FAUNA IN RECENT

BALINESE GENERATION’S DIET

Anak Agung Gde Raka Dalem

Head of Ecotourism and Sustainable Development Study Group

Faculty of Natural Sciences and Mathematics, Udayana University, Bali-Indonesia Corresponding author: [email protected], Telephone +62 811395360

Abstract

The study was undertaken in Bali, Indonesia between April and July, 2016. The objective of this study was to investigate whether there was a change in fauna consumed as a diet in the different Balinese generations. Two generations, consists of the Balinese younger generation aged 7-18 years old and the older Balinese generation aged 60 years old or over was interviewed. Result of this study showed that there is a different in fauna consumed in their diet across generations. As the time pass by, the Balinese younger generation have never or rarely consumed some species of fauna in their diet. Some of those, such as Kakul (Pila ampullacea), Lindung/Belut (Monopterus albus), Susul (Bellamya javanica), Capung Kombir (Orthetrum sp.), Capung Gantung (Pantala sp.), Capung Kuning (Sympetrum sp.), Capung Merah (Neurothemis sp.), Capung Re/Capung Sere (Potamarcha sp.), and klipes recently have never been consumed or rarely consumed by the younger Bali generation, but the older one during their younger ages. This may in part related to the fact that those fauna are less available on their local environment now, scared of consuming polluted food, and more choices available in Balinese daily menu recently.

Keywords: fauna, change in diet, pollution, Bali, younger generation, older

generation

BACKGROUND

Fauna has been providing a wide range of benefits for human beings. In Bali,

a province of Indonesia, they have been used for many purposes, such as for food, medecine, tourist attractions (eg Dalem et al., 2003; Dalem et al., 2014), trasportation tools, and an important component of offerings. They are kept as domesticated animals, or living free as wildlifes in their natural environments or habitats.

The change of environments including shrinked habitats and pollution may cause they go toward extinction or less available in their natural habitats and then less available for human uses such as for daily consumption, offerings, or human diets (eg. Suartini et al., 2010). In other case, if they are still available abundant in their natural habitat, but because of their habitat being polluted this may cause them to be unhealthy to be consumed, this may make them also less frequently consumed


PROCEEDING 2017 172

recently by those who have got a better awareness on healthy food. It is interesting to see what kinds of fauna available in Balinese diets. If compared between in the past and recently, across generation, and this will give the data what happends to the fauna in different era.


The study was undertaken in Bali, Indonesia between Mid April and Mid July, 2016. The objective of this study was to investigate whether there was a change in fauna consumed as their diet in the different Balinese generations. Two generations, consists of the Balinese younger generation aged 7-18 years old and the older Balinese generation aged at least 60 years old were interviewed. A total of 50 persons, twenty five (25) for each generation were interviewed. Informants was accidentally chosen from up around the maountain areas down to coastal areas. Interview was undertaken by following an interview guide that have been prepared. Data acquired were then tabulated in a Tabel. Data for younger (curent) and older generation (past) were compared. Description of data for two different groups were provided (eg. based on Carwardine, 1995; Dharma, 1988; Lilies S, 1991; Strange, 2012). Finally, conclusion was drown from the result of the analysis.

RESULTS

Result of this study showed that they are sixty four (64) kinds of items of fauna identified on the Balinese diets. They came from a wide group of wildlife and domesticated animals, including mammals, reptiles, ampbibians, pisces (fish), molluscs, and arthropods. The detail is shown in Table 1.

Tabel 1. Frequently and rarely consumed fauna on the Balinese older and younger generation’s diet, in different time frame (past and recent)

No Fauna in Balinese

Diet

Often consumed, Older Gen,

Past time (%)

Rarely+Never Consumed, Older Gen,

Past time (%)

Often consumed,

Younger Gen, Recent time

(%)

Rarely+Never consumed,

Younger Gen, Recent time

(%) 1 Beef Cattle (Sapi) 8 92 4 96 2 Pig (Babi) 48 52 56 44 3 Buffalow (Kerbau) 4 96 16 84 4 Goat (Kambing) 12 88 20 80 5 Flying Fox

(Kalong/bukal) 0 100 0 100

6 Deer (Kijang) 0 100 0 100 7 Squirel (Semal) 8 92 4 96 8 Mongoose (Luwak or

Lubak) 0 100 0 100

9 Bat (Kelelawar) 16 84 4 96 10 Dog (Anjing) 0 100 0 100 11 Mouse (Bikul) 0 100 0 100 12 Ant Eater (Klesih) 8 92 0 100 13 Ecidna (Landak) 8 92 0 100


PROCEEDING 2017 173

14 Horse (Jaran / kuda) 4 96 0 100 15 Bird (Cetrung ) 0 100 4 96 16 Bird, Munia (Perit) 4 96 4 96 17 Dove (Dara) 0 100 8 92 18 Dove, Turtle dove

(Kukur) 16 84 4 96

19 Muscovy (Entog, Kuir)

20 80 8 92

20 Duck (Bebek) 28 72 0 100 21 Geese (Angsa) 0 100 0 100 22 Bird (Gelatik) 4 96 0 100 23 Bird, Egrets

(Kokokan) 0 100 8 92

24 Chicken (Ayam kampung)

44 56 28 72

25 Chicken (Ayam broiler)

32 68 72 28

26 Freshwater Turtle (Bulus / Labi-Labi)

0 100 0 100

27 Turtle (Kekua) 0 100 0 100 28 Bird (Owl, Clepuk) 4 96 0 100 29 Reptile, Varanus

salvator (Alu) 4 96 0 100

30 Mollusc (Bekicot, Acatina sp.)

0 100 0 100

31 Snake (Lelipi) 0 100 0 100 32 Skink (Lelasan) 0 100 4 96 33 Mollusc (Kakul) 60 40 0 100 34 Mollusc (Susul) 52 48 0 100 35 Mollusc (Buit-buit) 12 88 0 100 36 Mollusc (Pici-pici) 12 88 0 100 37 Frogs (Katak) 8 92 0 100 38 Dragonfly (Capung) 52 48 0 100 39 Insect (Klipes) 28 72 0 100 40 Insect (Tabuan , anak

tabuan) 16 84 8 92

41 Grass hoopper (Belalang)

16 84 4 96

42 “Dedalu / laron” 0 100 0 100 43 Bee (Nyawan) 48 52 0 100 44 Insect (Bluang) 0 100 0 100 45 Insect (Cicada,

Tembreret, Sawan ai) 0 100 0 100

46 Insect larvae (Subatah)

44 56 0 100

47 Caterpillar (Uled daun pisang – uled don biu)

12 88 0 100

48 Insect larvae (Ancruk)

8 92 8 92

49 Insect (Blauk, larva of dragonfly )

20 80 0 100


PROCEEDING 2017 174

50 “Jubel” 20 80 0 100 51 Cricket (Jangkrik) 32 68 8 92 52 Shrimp (Udang) 48 52 44 56 53 Crab (Yuyu,

Kepiting) 32 68 4 96

54 Catfish (Lele) 20 80 60 40 55 Eel (Belut, Lindung) 64 36 0 100 56 Angila (Julit/ ikan

sidat) 4 96 4 96

57 Marine turtle (Penyu) 8 92 0 100 58 Shark (Kakia) 0 100 0 100 59 Manta (Be pai) 0 100 4 96 60 Whale (Ulam agung) 0 100 0 100 61 Dolphin (Lumba-

lumba) 0 100 0 100

62 Lobster 8 92 12 88 63 Clams (Kerang laut) 0 100 12 88 64 Other marine fish

(Ikan laut lainnya) 40 60 28 72

Result of this study showed that there is a different in fauna consumed in their diet across generations. As the time pass by, the Balinese younger generation have never or rarely consumed some species of fauna in their diet. Some of those, such as Kakul (Pila ampullacea), Lindung/Belut (Monopterus albus), Susul (Bellamya javanica), Capung Kombir (Orthetrum sp.), Capung Gantung (Pantala sp.), Capung Kuning (Sympetrum sp.), Capung Merah (Neurothemis sp.), Capung Re/Capung Sere (Potamarcha sp.), and klipes, recently have never or rarely consumed by the younger Bali generation, but the older one during their younger ages (Tabel 1). This may in part related to the fact that those fauna are less available on their local environment now, scared to consume of polluted food, or because of more choices available in Balinese daily menu recently. For mollusc, less frequently consumed mollusc in Balinese recent diet includes kakul, susul, buit-buit and pici-

pici. For some Balinese younger generation, eating buit-buit and pici-pici are strange for them.

The diversity of arthropods/insects selected for diet for the new generation has decreased. Some younger Balinese generation may not be experienced eating subatah, jubel, etc. For the dragonfly that is known locally as capung, some species those are known to be ever consumed, such as: Capung Kombir (Orthetrum sp.), Capung Gantung (Pantala sp.), Capung Kuning (Sympetrum sp.), Capung Merah (Neurothemis sp.), and Capung Re/Capung Sere (Potamarcha sp.). They are generally less frequently consumed recently.

Despite a wide range of less frequently consumed fauna, some on facts are consumed more frequently, including meat of pigs (pork), buffalow, goat, catfish, and clams. This may be related to some rasons. For example, more breeded chicken ‘ayam broiler’ meet available in a cheaper price recently than in the past, so its consumption increased in recent generations. Catfish are more commonly sold along the food stalls along the streets especially in the urban areas. This may give a better access for it. A similar situation may also happens to lamb. Recent generation may


PROCEEDING 2017 175

get a better access to clams, “sate kambing” (goat or lamb satay), etc, and may be they have a better income to by them. DISCUSSIONS

As the time pass by, the Balinese younger generation have never or rarely consumed some species of fauna in their diet. Some of those, such as Pila

ampullacea, Monopterus albus, Bellamya javanica, Orthetrum sp., Pantala sp., Sympetrum sp., Neurothemis sp., Potamarcha sp., and klipes recently have never or rarely consumed by the Balinese younger generation, but the older one during their younger ages. This may in part related to the fact that those fauna are less available on their local environment now, scared of consuming because of suspeciusly categorized as polluted food, or because of more choices available in Balinese daily menu recently.

Blauk (dragonfly larvae), jubel, klipes have certainly less available on the Balines environment recently. They may have been killed because of the inappropriate use of pesticide or because of the shrinked of their habitats. Capung has also rarely or never consumed anymore. On one of interview with a farmer, in one location it was mentioned that even though the “kakul” (mollusc) were a lot available, they were still afraid or relactant to consume them, because of scared of their toxic meat incidently caused by a side impact of farmers spraying pesticides for controlling pests or weeds.

Certainly the technology development in Bali or world wide gives a better opportunity to access to food. As a consequence, more fauna caught from along distance or far away available to buy close by to their hoses. On our observation it shows that many kinds of marine fish are sold in supermarket right now. Thus, it gives more selections to fulfil human needs. CONCLUSSIONS AND RECOMMENDATIONS

Conclussion

There is a different in fauna consumed in the diet of the Balinese across generations. As the time pass by, the Balinese younger generation have never or rarely consumed some species of fauna in their diet. Some of those, such as Kakul (Pila ampullacea), Lindung/Belut (Monopterus albus), Susul (Bellamya javanica), Capung Kombir (Orthetrum sp.), Capung Gantung (Pantala sp.), Capung Kuning (Sympetrum sp.), Capung Merah (Neurothemis sp.), Capung Re/Capung Sere (Potamarcha sp.), and klipes, recently have never been consumed or rarely consumed by the younger Bali generation, but the older one during their younger ages. This may in part related to the fact that those fauna are less available on their local environment now, scared of consuming polluted food, or because of more choices available in Balinese daily menu recently.

Recomendation

This data has open a wide range of questions to answer, and should be followed by a wide range and a comprehensive research to find out more infromation about the role of fauna di the Balinese’s diet. Data on this study sould be taken coustiosly since being collected though interviewing 50 people only. A more


PROCEEDING 2017 176

intensive data collection with more informants should be undertaken for a more acurate results.

ACKNOWLEDGEMENT

I would like to thank Wayan Suryana who helpped me to conduct some of the interview.

REFERENCES

Carwardine, M. 1995. Whales, Dolphins and Porpoises. London, New York, Munich, Merlbourne, Delhi: Dorling Kindersley Book. 256 pp.

Dalem, A.A.G.R., I.K. Muksin, S.K. Sudirga, dan I.B.M. Suaskara. 2003. Burung sebagai atraksi ekowisata di kawasan pariwisata Nusa Dua, Bali. Jurnal Lingkungan Hidup Bumi Lestari 3 (2): 12-33.

Dalem, A.A.G.R., I N. Widana, dan I.A. Trisna Eka Putri. 2014. Burung sebagai atraksi ekowisata di Kawasan Pariwisata Ubud, Bali. Jurnal Lingkungan Hidup Bumi Lestari 14 (2): 125-132.

Dharma, B. 1988. Siput dan Kerang Indonesia (Indonesian Shell). PT. Sarana Graha: Jakarta.

Lilies S., C. 1991. Kunci determinasi serangga. Yogyakarta: Kanisius. 223 pp.

Strange, M. 2012. A photographic guide to the birds of Indonesia. 2nd ed. Tokyo, Rutland, Vermont, Singapore: Tuttle. 544 pp.

Suartini, N. M., N. W. Sudatri, M. Pharmawati and A. A. G. Raka Dalem. 2010. Identifikasi Makrozoobenthos di Tukad Bausan, Desa Pererenan, Kabupaten Badung, Bali. Ecotrophic 5(1): 41-44.


PROCEEDING 2017 177

INNOVATION OF MODEL PROCESSING OF THE LOCAL

FOOD SAGO PALM (Metroxylon sagu Rottb.) FROM PAPUA

Linus Yhani Chrystomo*, I Made Budi, and Aditya Krishar Karim

Department of Biology, Faculty of Mathematics and Natural Sciences, Cenderawasih University, Jayapura, Papua

* Coressponding author: [email protected]

Abstract

The true sago palm Metroxylon sagu Rottb. has been described as

humankind’s oldest foodplant, its similarly traditional local food for Papuan. The trunk of this plant contains starch, used by the plant as a reserve food for flowering and fruiting. This starch has long been a staple food for humans in Papua. In general local people by sago starch traditional processing has produced wet starch. Papuan traditional food was made of wet starch has been called Papeda. People in Papua eat wet starch in the form of sago porridge mention. The object to this research was made innovation of model sago starch processing. Sago starch by innovation of mechanically technology can produced better quality flour and noodle, with the result can improved storage long time of local food for Papuan. The result of this research can be concluded that Papuan local food could be processed become to dried starch and noodle. Keywords: Papuan local food, Metroxylon sagu Rottb., dried starch, noodle.

BACKGROUND

Metroxylon sagu Rottb. is a sago palm tree, without leaf sheaths; boles have a diameter of 35-60 cm and reach a height of 6-16 m. Starch is stored in the central parenchyma of the bole. Under prolonged flooding conditions, it forms pneumatophores. The true sago palm is a pinnate-leaved tree. Healthy palms carry about 24 leaves or fronds. Each month a new frond appears out of the growing point, and the oldest dies. Occurring in the hot humid tropics of Southeast Asia and Papua, sago palm dominates mainly in permanent or seasonal lowland freshwater swamps, preferably on mineral soils with a pH higher than 4.5. Ideally, groundwater should be within 50 cm of the soil surface. Mixed with upland trees, it can also be found on dry soils, where it grows even taller. Altitude: 0-700 m, Mean annual temperature: 17-35 oC, mean annual rainfall : over 2000 mm. Soil type, clay soils with a high organic-matter content give best results. The sago tree (Metroxylon sagu Rottb.) grows in the swampy wilderness near their homes (Flach, 1997, Orwa et al., 2009).

Sago is a major staple food for the people of Papua and other parts of Indonesia as Maluku, and North Maluku provinces. The palms are cut down when they are about 15 years old. Carbohydrate from sago pith can be harvested when the tree is at least fithteen years old. All family members participate in harvesting sago


PROCEEDING 2017 178

and in many areas if this not one they cannot buy it from traders. A family can obtain 150 to 300 kilograms of sago flour from one sago tree to supply staple food for two weeks to one month. A type of flour, called sago flour, is made from sago. The powder is kneaded in water over a cloth or sieve. It passes into a trough where it settles. After a few washings, the flour is ready to be used in cooking.

People in Papua and Maluku eat sago flour in the form of sago porridge called papeda. It is made by ‘cooking’ sago flour in hot water and stirring it constantly until it coagulates. It has a glue-like consistency and texture. Papeda has a bland taste and has little nutritive value, therefore it is usually eaten with yellow soup of tuna, Mubara (Trachinotus carolinus) or any locally available fish spiced with turmeric, leaves of Ocimum citriodorum (Kemangi) and lime. The traditional sago palm processing can be summarized by the pith is rasped by means of a chopper or small hoe made from bamboo, followed by the addition of water to the rasped mixture of fiber and pith which either kneaded by hand or trampled by foot and collection of the wet starch (Karim et aI., 2008).


Materials which was used stem of sago palm be harvested when the tree is at least fithteen years old. In this method, use mechanically method of 2 major stages.

1. Sago starch processing method followed as below:

Stage 1. Cutting of sago stem using chain saw become blocks

Stage 2. Extraction of blocks of sago palm stem by extractor machine

Stage 3. Washing of extract with flow water

Stage 4. Filtering of ectract with 80 mesh


PROCEEDING 2017 179

2. Sago noodle making method

Stage 5. Producing wet starch

Stage 6. Pressing wet starch in filtered sheet by hydraulic machine with 1,5 ton to decrease water content

Stage 7. Starch sun dried or be oven

Packaging sago dried starch powder

Stage 1. 1 kg sago starch was added 30% water (300 ml) then was mixed, after that was steamed (glutinized process)

Stage 2. Noodle formation by screwed machine


PROCEEDING 2017 180


According to Mc Clatchey et al. (1997) that M. sagu is considerably more productive for starch production compared with other Metroxylon species. Although the starch yield other species have not been measured, the starch from each species is similar in taste and consistency to that M. sagu. It seems likely that because traditional selection in species other than M. sagu has probably not only focused on starch, so that starch production has not been maximized and therefore will be of lower quality and quantity.

Karim et al. (2008) stated that traditional extraction of sago suffer low productivity rates (25% -41 %). Therefore, many research studies have been done to improve the quality of sago flour which aid the transformation of sago flour processing from traditional technology to modern technology. The different methods of starch extraction gave rise to various quality of sago starch. Ellen (2006) reported that the ethnography, ethnobotany and dispersal of palm wet starch was extracted by traditional technology.

In this research the sago starch processing by mechanically method used with modern technology which has been modified (Budi et al., 2015). Evident of the sago flour processing by modern technology is faster one sago stem only need 30 minutes processing and quality of sago starch is better with zero glutein, likewise noodle product from sago starch also with zero glutein. The benefit in dried starch powder or noodle form its can stored long time

CONCLUSIONS

Based on results and discussions in this research can be make conclusions that the sago starch processing by mechanically technology modified can produced flour is faster, effective with better quality also zero glutein and can be produced in form noodle which can stored long time.

ACKNOWLEDGEMENT

The author is most grateful for the sago palm cultivator of Skow Mambo Papua Local People and also greatly appreciates the support and criticism received, especially from Director of CV. Budi Mulya Asih. Thanks are also extended to Dr.

Product of sago noodle with zero glutein (packaging)


PROCEEDING 2017 181

Dirk Y.P. Runtuboi, M.Kes. the Head of the Department of Biology, Faculty of Mathematics and Natural Sciences, University of Cenderawasih, Papua.

REFERENCES

Budi, I. M.; L.Y. Chrystomo; P. Sujarta & A.K. Karim. 2015. Lecture of Development of Local Food Processing to The Group of The Micro Small and Intermediate Entrepreneur at CV. Budi Mulya Asih Jayapura. Report of the Community Service has not been published (Penyuluhan Model Pengembangan Pengolahan Pangan Lokal (MP3L) Bagi Kelompok UMKM di CV Budi Mulya Asih Jayapura. Laporan Pengabdian Kepada Masyarakat yang tidak dipbublikasikan). 22p.

Ellen, R. 2006. Local Knowledge And Management Of Sago Palm (Metroxylon sagu Rottboell) Diversity In South Central Seram, Maluku, Eastern Indonesia. Journal of

Ethnobiology 26(2) : 258–298.

Flach, M. 1997. Sago palm. Metroxylon sagu Rottb. Promoting the conservation and use of underutilized and neglected crops. 13. Institute of Plant Genetics and Crop Plant Research, Gatersleben/International Plant Genetic Resources Institute, Rome, Italy. 76 p.

Karim,A.A.; A. Pei-Lang Tie; D.M.A. Manan & I.S.M. Zaidul. 2008. Starch from the Sago (Metroxylon sagu) Palm Tree—Properties, Prospects, and Challenges as a New Industrial Source for Food and Other Uses. Comprehensive Reviews in Food

Science and Food Safety.Vol.7 : 215-228.

Mc Clatchey, W.; H.I. Manner & C.R. Elevitch. 2006. Metroxylon amicarum, M.

paulcoxii, M. sagu, M. salomonense, M. vitiense, M. warburgii (sago palm), Arecaceae (palm family), Species profile for Pacific Island Agroforestry www.traditionaltree.org. 23 p.

Orwa, C.; A. Mutua; R. Kindt; R. Jamnadass. & S. Anthony. 2009. Agroforestree Database: a Tree Reference and Selection Guide Version 4.0., World Agroforestry Centre, Kenya. Pp. 1-5.


PROCEEDING 2017 182

DETERMINATION OF PELLETING TECHNIQUE AND

PELLET FORMULATION OF RICE SEED

Anak Agung Keswari Krisnandika1*, Eny Widajati2, and Wawan Hermawan3

1Landscape Architecture Study Program, Faculty of Agriculture, Udayana University

2Laboratory of Seed Science and Technology, Department of Agronomic and Horticulture, Faculty of Agriculture, Bogor Agricultural University

3Department of Mechanical and Bio-system Engineering, Faculty of Agricultural Engineering and Technology, Bogor Agricultural University *Corresponding author: [email protected]

Abstract

Seed pellets were used in order to get a uniform seeds shapethat suitable and fit with the seed planting machine. Pelleting also reduce the risk of drifting seeds and oxidation so that rice seeds can be sown directly in the field without going through the nursery. Direct seeding avoidsstress due to transplanting seedlings and minimizesof disease infection root through wounds. The research was conducted in two experiment, i.e.: 1) Determination of pelleting technique, 2) Determination of pellet formulation. In the first experiment three technique of seed pelleting were used and in the second experiment, two pellet formulas were used, all were arrange in randomized completely design. Result of this study showed that putting the seed in to machine first then followed by pellet formula step by step was the best technique. The result for the best formulas was CMC + Talc + Tapioca (1:1:0.02), however all of formulas does not reduce the pelleted rice seed quality as indicated by germination percentage either in the field or in the laboratory and vigor index.

Keywords: Oryza sativa, rice field, seed treatment, germination

BACKGROUND

The risk of seed drifting and oxidation in submerged land rice through direct seeding can be overcome by the seed pelleting. Pellet is more or less spherical units developed for precision sowing, usually incorporating a single seed with the size and shape of the seed no longer readily evident (ISTA 2007). The main objective is to change the form of pellets, the weight and size of the seeds to facilitate the planting seed machine and to increase seed germination (Copeland and McDonald 2001). Seed planting machine will save the seeds for sowing purposes as planting distance and the right amount. While pelleted seed aims to homogenize the size of the seed thereby increasing the efficiency of the use of planting machine, as well to avoid the seed drifting and to protect the seeds from the extreme environmental conditions of planting. Additionally, pelleted seed does not need to be planting in the nurse area, so that disease infection through the wound during transplanting will be minimized. Pelleting technique and pellet formula very depending on types of seed, the equipment and purpose of seed pelleting. The objective of this study was to


PROCEEDING 2017 183

determination seed pelleting technique and pellet formulas which is suitable to the machine that have been design previously.


Experiment 1. Ciherang rice seed produced by PT. Sang Hyang Seri were pelleting by three pellet technique namely: a) Seed and pellet formulas were input into the machine at once in time, b) Seed was input to the machine first, then Followed by pellet formula step by step, c) Seed was dipped in CMC (Carboxymethyl Cellulose) before pellets generate. Those formulas were examined for quality of seed pellet on field condition and laboratory. Experiment 2. Formula consists of Talc + CMC, talc Talc + Alginate and without the addition of an adhesive. Observations were made on the quality of seed pellet on field conditions (zeolite media) and laboratorium conditions (paper media).

The quality of rice seed pellet were evaluated byrice seed germination benchmark: 1. % moisture content: (weight of fresh seed-weight of dry seed) : weight of fresh

seeds x 100%. 2. % Germination: Number of Normal seedling during 7 days after sowing :

Number of sowing seeds on the tray x 100% 3. Vigor index: Number of normal seedling during 5 days after sowing : Number of

sowing seeds on the tray x 100%

RESULTS

Used Comparison between seed: pellet material were 1: 2, the technique B

were the best one which resulted in regular shape and smooth surfaces of pelleted seeds. Pelleting did not reduce vigor and germination index (Tab. 1). Table 1. Profile of seed weight before and after become pellet and evaluation result

of seed quality

Method Seed weight (g) Pelleting

time (min.) Seed quality

Before After % VI (%) G (%) Control - - - - 26.67 82.67 A 12.5 26.58 112.64 20 18.67 88 B 12.5 28.18 125.44 20 33.33 85.33 C 20 30.61 53.05 18 38.67 82.67

CMC were a better binder than Alginate (Tab. 2) in the form of pellets and embedding pellets material.

Table 2.

Treatment Seed weight (g) Waste

material

Pelleting time

(min.)

Single seed in pellet (%)

Irregular seed pellet

(%) Before After Round Ellipse CMC 20 90.88 3.3 30 6 75.5 18.5 Alginate 20 86.23 9.5 30 3.75 75 21.25 Control 20 - - - - - -


PROCEEDING 2017 184

Based on Viability test on pelleted seed, the utilization of CMC showed that pelleting did not reduce rice seed quality too (Tab. 3).

Table 3. Quality of pelleted seed

Treatment Moisture content

(%)

Zeolit Between paper test

G (%) VI (%) G (%) VI (%) CMC 21.99a 63 31 88 88 Alginate 22.22a 54 23 88 84 Control 9.74b 63 31 90 87

DISCUSSIONS

The most preferable pellet seed is round with diameter around 1 cm (Fig.4). Physical criterias of the pellet describe by Glatt (2014) are round shape,bestspread,smooth surface, low abration, good dissolving in low higroscopic solvent. Based on those criteria, the pellet formula which consist of talc,tapioca and CMC were the best one.

The composition resulted in regular shape and smooth surface as well as solid and strong structure of pelleted seed. CMC was a better binder than Alginate (Tab.2) due to its solubility and can reach viscosity stage without passing through gel formation (Paoluchi et al.,2012). Another advantage of CMC is also can carry various bioactive molecules, both for hydrophobic and hydrophylic molecules(Davidson et al.,2013). Viability test on pelleted seed showed that pelleting did not reduce seed quality (Tab. 3;Fig.6 and 7).Although not significantly different, rice seeds coated with adhesive alginate likely to show a reduction in seed viability (Table 7), according to Palupi et al.(2012), which experienced a drying alginate has a chance to experience hardening thus hampers the emergence of the radicle at the seeds. In his research, Palupi et al. (2012) also reached the conclusion that the most appropriate formula for rice seed coating is CMC 1.5% + 1% talc and gypsum CMC 1.5% + 1%. CONCLUSIONS

The best pelleting technique is B (seed was input to the machine first, then followed by pellet formula step by step). Material with formulation that consist of Talc, Tapioca and CMC (1:1:0.02). The ratio of rice seed:pellet material = 1:6. REFERENCES

Davidson D.W., M. S. Verma and F. X. Gu. 2013. Controlled Root Targeted Delivery of Fertilizer using an Ionically Crosslinked Carboxymethyl Cellulose Hydrogel Matrix. SpringerPlus. 2(318):1-9.

Glatt. 2014. Innovative Technologies for Granules and Pellets. Glat [internet]. [Download: 2014 Nov 25]. Available at: http://www.google.com/url?sa=t&rct=&q


PROCEEDING 2017 185

=&esrc=s&source=web&cd=1&ved=0CCsQFjAA&url=http%3A%2F%2Fwww.glatt.com%2Ffileadmin%2Fuser_upload%2Fcontent%2Fpdf_downloads%2FAB_innovative_technologies_en_111017.pdf&ei=vwy4VMH0N4aE8QWJuoLQAg&usg=AFQjCNHyRj4iWvG5ig9ljcdExChZY8Ullg&sig2=lW73KNYHzU2fWgZfdD_AEA&bvm=bv.83640239,d.dGc&cad=rja.

[ISTA] The International Seed Testing Association. 2007. International Rules for Seed Testing. Bassersdorf (CH): ISTA.

Paolucci M, A. Fabbrocini, M. G. Volpe, E. Varricchio and E. Coccia. 2012. Development of Biopolymers as Binders for Feed for Farmed Aquatic Organisms. In Aquaculture, Edited by Z. Muchlisin. Intechopen.

Available from:http://www. intechopen.com/books/aquaculture/development-of-biopolymers-as-binders-for-feed-for-farmedaquatic-organisms[Internet]. [download: 2014 Nov 25]. Available at: http://www.intechopen.com/download/pdf/27101.

Palupi T, S. Ilyas, M. Machmud dan E. Widajati. 2012. Pengaruh Formula Coating

terhadap Viabilitas dan Vigor serta Daya Simpan Benih Padi (Oryza sativa L.). J

Agron Indonesia 40(1):21 – 28.


PROCEEDING 2017 186

THE APPLICATION OF BENZYL ADENINE (BA) AND INDOLE

BUTYRIC ACID (IBA) COMBINATIONS ON STRAWBERRIES

(Fragaria x ananassa Var. Earlybrite) MICROPROPAGATION

Tia Setiawati*, Linda Anggraini, and Ruly Budiono

Department of Biology, Faculty of Mathematics and Natural Sciences, Padjadjaran -

University. Jl. Bandung-Sumedang Km 21 Jatinangor, Sumedang, West Java, Indonesia. Tel./Fax. +62-22-77964124

*Corresponding Author : [email protected]

Abstract

Micropropagation is one of the alternative technique that can use in propagation of strawberry seedlings in a large quantity, uniform growth and relatively in a short period. The research of strawberry micropropagation was conducted. The goal of this research was to know the best combination of BA and IBA concentration for strawberry micropropagation. The research was using completely randomized design with nine combinations of BA and IBA concentration. The concentrations of BA used were 1 mg/L, 1.75 mg/L and 2.5 mg/L, while IBA concentrations were 0.25 mg/L, 0.75 mg/L and 1.25 mg/L. The parameters of observation were number of shoots, shoot length, number of roots, and root length. The results showed that the combination of 1 mg/L BA + 1.25 mg/L IBA produces the highest average number of shoots was 16 and the combination of 1.75 mg/L BA + 0.75 mg/L IBA produces the highest average length shoot was 1.7 cm. The highest average number of roots was 2.0 obtained on the combinations of 1 mg/L BA + 0.25 mg/L IBA, 1 mg/L BA + 1.25 mg/L IBA and 2.5 mg/L BA + 0.25 mg/L IBA and the highest average length of root was 0.53 cm obtained on combination of 2.5 mg/L BA + 0.25 mg/L IBA. Keywords : Micropropagation, Fragaria ananassa, BA, IBA

BACKGROUND

Strawberry is one of the popular fruit that is included in the Rosaceae family, and has been cultivated commercially in many countries (Moradi et al., 2011; Biswas et al., 2007). Strawberry (Fragaria x ananassa Duch.) is a natural hybrid of Fragaria chiloensis L. P. Mill. and Fragaria virginiana Duch (Sakila et al., 2007). Strawberries have traditionally been a popular delicious fruit for its flavour, taste, fresh use, freezing and processing (Sakila et al., 2007). Strawberry fruit has a high nutritional value because it is rich in vitamin C, B1, B2, protein, calcium, potassium, copper, iron, folate, fiber, flavonoids, autocianidin, antioxidans are beneficial for human health (Moradi, 2011; Emad, 2009) and relatively high quantities of ellagic acid (Sakila et al., 2007).

Conventionally, strawberry is propagated vegetativelly by rooted runners (Sakila et al., 2007; Ara et al., 2013), but this method is not proved suitable due to


PROCEEDING 2017 187

incidence of many diseases infection and environmental hazards and resulting in the gradual degeneration of cultivers performance (Ara et al., 2013). Beside conventional propagation of strawberry is very labour intensive, time consuming and results in the transmission of viral diseases (Gautam et al., 2001). So needed an alternative method to produce disease-free strawberries plants in large quantities and a relatively short time. Tissue culture considered as an in vitro aseptic culture of cells, tissue, organs or whole exact nutritional and ecological circumtances (Thorpe, 2007). Mass multiplication in vitro through tissue culture results high yield in disease free plant material (Mohan et al., 2005). Some characters such as crown size, number of runners, flowering time and yield of berries on strawberry plants propagated in vitro relatively better than conventionally propagated by runner (Karhu and Hakala, 2002). Several studies have been successfully conducted in strawberry propagation through in vitro culture using various concentrations of growth regulator substance (Haruga et al., 2014; Ara et al., 2013; Moradi et al., 2011; Litwińczuk et al., 2009;

Sakila et al., 2007). MATERIALS AND METHODS Explant materials used ware shoots derived from strawberry (Fragaria x

ananassa var. Earlybrite) plantlets in sterile culture bottles. This research used experimental method with a completely randomized design (CRD) consisting of nine combination of BA and IBA concentrations. The concentrations of BA used were 1 mg/L, 1.75 mg/L, 2.5 mg/L, and IBA concentrations used were 0.25 mg/L, 0.75 mg/L, 1.25 mg/L. The explants were cultured on MS basal medium supplemented with growth regulators i.e. BA and IBA, adding 20 g/L sucrose and 0.7% agar. The pH of the medium was adjusted to 5.8 before autoclaving at 121°C, 14.5 psi for 90 min. The cultures were incubated in growth chamber at 18-20oC. Observation on the number of shoots, shoot length, number of roots and root length performed after 5 weeks of culture initiation. RESULTS

Table 1. Effect of different concentrations of BA with IBA on shoot of Strawberry (Fragaria x ananassa var. Earlybrite) after 5 weeks of culture

Combinations of BA + IBA (mg/L) Average number of shoots

Average length of shoots (cm)

1 mg/L BA + 0.25 mg/L IBA 8.67 1.2 1 mg/L BA + 0.75 mg/L IBA 6.33 0.53 1 mg/L BA + 1.25 mg/L IBA 5.33 1.70 1.75 mg/L BA + 0.25 mg/L IBA 16.00 0.73 1.75 mg/L BA + 0.75 mg/L IBA 10.33 1.00 1.75 mg/L BA + 1.25 mg/L IBA 6.67 0.83 2.5 mg/L BA + 0.25 mg/L IBA 3.67 1.00 2.5 mg/L BA + 0.75 mg/L IBA 5.33 0.53 2.5 mg/L BA + 1.25 mg/L IBA 5.00 1.00


PROCEEDING 2017 188

Table 1 showed that the combinations of BA with IBA were effective for shoot formation of Strawberry (Fragaria x ananassa var. Earlybrite. The highest number of shoots in the combination of 1.75 mg/L BA + 0.25 mg/L IBA was 16. Zaer and Mapes (1982) reported that BA is growth regulator substance that is most widely used for multiplication of shoots because it has a strong activity as compared to other types of cytokinin. The study conducted by Hasan et al. (2010) showed that combined concentration of 1 mg/L BA and 0.1 mg/L NAA produced the highest number of shoot on strawberry (13.4). Another study conducted by Sitepu (2007) showed that the highest number of shoots (4.7) obtained on a combination of 2 mg /L BAP with 1 mg/L NAA. The optimum concentration differences can be due to differences in the strawberry cultivar used so that different genetic compositions will cause different physiological response to growth regulators that is added to the medium. Besides the differences in endogenous hormone content of the tissue explants were used. The content of endogenous cytokinin in explants work synergistically with exogenous cytokinin (BA) in stimulating the proliferation of shoots. The addition of growth regulator substances both exogenous auxin and cytokinin will improved biosynthesis of natural hormones (George and Sherrington, 1984). The lowest number of shoots obtained in the combination of 2.5 mg/L BA + 0.75 mg /L IBA was 3.67. In this combination, BA concentration is too high so that it will inhibit the proliferation of shoots. Naik et al. (1999) stated that increasing cytokinin concentration exceeding the optimum needs, will cause a decrease in the multiplication of shoots and buds elongation inhibition. The highest length of shoot obtained on the combination of 1 mg/L BA + 1,25 mg/L IBA was 1,70 cm. BA has a function in the process of cell differentiation in strawberry shoots. Simultaneously, IBA as auxin also play a role in supporting the elongation of shoots through the extension of the strawberry plant cells. Extension of the cells due to the role of auxin resulted in many primary cell wall material is generated and transferred at both ends of the cell, then the cell structure is stretched so that the cell wall will be formed more. Therefore, on the shoot tip occurred the cells elongation (Mulyono, 2010). The combination of 1 mg/L BA + 0.75 mg/L IBA and 2.5 mg/L BA + 0.75 mg/L IBA showed the lowest shoot length were 0.53 cm. This condition can be caused by IBA at a concentration of 0.75 mg/L was not able to support the growth of shoots length. Although naturally explants produce endogenous auxin, but in these conditions may still not sufficient for elongation of the cells forming shoots, thus need the addition of exogenous auxin at a concentration higher than 0.75 mg/L. Table 2 showed that root formation does not occur in all combinations. In this study, the combinations of BA and IBA were not effective for stimulating the in vitro rooting of strawberries shoots. The highest root length of 0.53 cm obtained in a combination of 2.5 mg/L BA + 0.75 mg/L IBA and the lowest was 0.26 cm on a combination of 1 mg/L BA + 0.25 mg/L IBA and 2.5 mg/L BA + 1.25 mg/L IBA. This may be due to the presence of BA can inhibit root formation. Kaabi dan Hassan (2008) reported that the addition of high concentrations of cytokinin in cultures of Phoenix dactylifera L. can lead to decrease in the percentage of root formation. Prakash (2004) stated that ratio of auxin and cytokinin interactions in culture medium to determine the direction of morphogenesis in the formation of shoots and roots. Wattimena (1992) stated that the plant growth regulator is usually used in


PROCEEDING 2017 189

combination and morphogenesis of explants always depends on the interaction of cytokinin and auxin balance. The effect of the combination of auxin and cytokinin in various proportions will produce different growth response. If the ratio of cytokinin concentrations greater than auxin, it will stimulate the growth of shoots. Conversely, if the concentration is lower than auxin cytokinin, these conditions will encourage root growth (Hartmann et al., 1990; Maheshwari and Kumar, 2006). In this case, it seems that root induction will be more effective if the shoots are transferred in a specific rooting medium containing only auxin.

Table 2. Effect of different concentrations of BA with IBA on rooting of Strawberry (Fragaria x ananassa var. Earlybrite) after 5 weeks of culture

Combinations of BA + IBA

(mg/L) Average number of roots

Average length of roots (cm)

1 mg/L BA + 0.25 mg/L IBA 2.0 0.26 1 mg/L BA + 0.75 mg/L IBA 0.0 0.0 1 mg/L BA + 1.25 mg/L IBA 2.0 0.32 1.75 mg/L BA + 0.25 mg/L IBA 0.0 0.0 1.75 mg/L BA + 0.75 mg/L IBA 0.0 0.0 1.75 mg/L BA + 1.25 mg/L IBA 0.0 0.0 2.5 mg/L BA + 0.25 mg/L IBA 2.0 0.53 2.5 mg/L BA + 0.75 mg/L IBA 0.0 0.0 2.5 mg/L BA + 1.25 mg/L IBA 1.0 0.26

Ara et al. (2013) have successfully induce adventitious roots on microshoots of strawberry by transferring to the rooting medium containing IBA and IAA.The results show that both the IBA and IAA effectively induce rooting ranged from 78-95 % and between the two auxins IBA showed better performance for root induction than IAA. Sakila et al. (2007) tested different concentrations of IBA (0.1-1.5 mg/L) and IAA (0.1-1.5 mg/L) to induce rooting of strawberry. The results showed that 1.0 mg/L IBA was the most suitable for root induction. Other researchers have successfully used the single auxin IBA to induce in vitro rooting on strawberry (Ashrafuzzaman et al., 2013; Mahmood et al., 1994, Harugade et al., 2014 ) while Hassan et al. (2010 ) using IBA, IAA and combination of both. CONCLUSIONS

The combination of 1 mg/L BA + 1.25 mg/L IBA produces the highest average number of shoots was 16 and the combination of 1.75 mg/L BA + 0.75 mg/L IBA produces the highest average length shoot was 1.7 cm. The highest average number of roots was 2.0 obtained on the combinations of 1 mg/L BA + 0.25 mg/L IBA, 1 mg/L BA + 1.25 mg/L IBA and 2.5 mg/L BA + 0.25 mg/L IBA and the highest average length of root was 0.53 cm obtained on combination of 2.5 mg/L BA + 0.25 mg/L IBA


PROCEEDING 2017 190

REFERENCES

Ara, T., M. Rezaul Karim, M. Abdul Aziz, Rezaul Karim, Rafiul Islam and Monzur Hossain. 2013. Micropropagation and field evaluation of seven strawberry genotypes suitable for agro-climatic condition of Bangladesh. African Journal of Agricultural

Research. 8(13): 1194-1199. Ashrafuzzaman, M., S. M. Faisal, D. Yadav ,D. Khanam and F. Raihan. 2013. Micropropagation of strawberry (Fragaria ananassa) through runner culture. Bangladesh J. Agril. Res. 38(3): 467-472. Emad, Y.Y. 2009. In Vitro, Propagation of Strawberry (Fragaria × annanasa Duch.) Through Organogenesis via Runner Tips. Thesis. The Islamic University – Gaza. Faculty of Science. Master of Biological Sciences Gautam H., R. Kaur, D.R. Sharma, and N. Thakur. 2001. A comparative study on in

vitro and ex vitro rooting of micropropagated shoots of strawberry (Fragaria ×

ananassa). Plant Cell Biotechnol. Mol. Biol. 2:149-152.

George, E. F. and P. D. Sherrington. 1984. Plant Propagation by Tissue Culture. Exegetics Ltd. Eversley. Basingstoke: England. 709 p.

Hartmann, H.T., D.E. Kester, and F.T. Davies. 1990. Plant Propagation and

Principles Practices. Prentice-Hall Inc. New Jersey.

Harugade, S., R.H.Tabe and Sushama Chaphalkar. 2014. Micropropagation of Strawberry (Fragaria X ananassa Duch.). Int.J.Curr.Microbiol.App.Sci. 3(3): 344-347

Hasan, M.N., S. Nigar, M.A.K. Rabbi, S.B. Mizan

and M.S. Rahman. 2010. Micropropagation Of Strawberry (Fragaria x ananassa Duch.).

Int. J. Sustain. Crop

Prod. 5(4):36-41

Kaabi and Hassan I.J. 2008. Morpho-regulatory role of thidiazuron : Substitution of auxin and cytokinin requirement for the induction of somatic embryogenesis in geranium hypocotyls culture. Plant Physiol. 99:1704– 1707.

Karhu, S. and K. Hakala, 2002. Micropropagated strawberries on the field. ISHS

Acta Horticulture, 2: 182

Litwińczuk, W., E, Okołotkiewicz, and I. Matyaszek. 2009. Development of in vitro

shoot cultures of strawberry (Fragaria × ananassa Duch.) ‘Senga Sengana’ and ‘Elsanta’ under the influence of high doses of gibberellic acid. Folia Horticulturae

Ann. 21(2) : 43-52

Mahmood, S., H. Rashid, A. Quraishi, N. Iqbal, S.S. Arjumand and M.N. Malik. 1994. Clonal propagation of strawberry through tissue culture. Pakistan J. Agric.

Res. 15(1): 54-59


PROCEEDING 2017 191

Maheshwari P, and A. Kumar. 2006. Organogenesis, Shoot Regeneration, and Flowering Response of Vernonia Cinerea to different Auxin/Cytokinin combinations, In Vitro Cellular and Developmental Biology-Plant 42(6):589-595.

Moradi, K., M. Otroshy, and M.R. Azimi. 2011. Micropropagation of strawberry by multiple shoots regeneration tissue cultures. Journal of Agricultural Technology. 7(6): 1755-1763

Mulyono, Daru. 2010. Pengatur Zar Pengatur Tumbuh Auksin : Indole Butric Acid (IBA) dan Sitokini : Benzil Amino Purine (BAP) dan Kinetin Dalam Elongasi Pertunasan Gaharu (Aquilaria beccariana). BPPT. Jakarta

Naik, S.K., Pattnaik, S., Chand, P.K. 1999. In vitro propagation of pomegranate (Punica granatum L. cv Ganesh) through axillary shoot proliferation from nodal segments of mature trees. Sci. Hort. 79:175–183.

Prakash, S., M.I. Hoque, dan T. Brinks. 2004. Culture Media and Containers. Proceedings of a Technical Meeting organized by the Hoint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture and held in Vienna. 26—30 August 2002. 106: 29—40.

Sakila, S., M.B. Ahmed, U.K. Roy, M.K. Biswas, R. Karim, M.A. Razvy, M. Hossain, R. Islam and A. Hoque. 2007. Micropropagation of Strawberry (Fragaria X ananassa Duch.) A Newly

Introduced Crop in Bangladesh.American-Eurasian Journal of Scientific Research 2 (2): 151-154.

Thorpe, T. 2007. History of plant tissue culture. J. Mol. Microbial Biotechnol. 37: 169-180.

Wattimena GA. 1988. Zat Pengatur Tumbuh Tanaman. Bogor : Pusat Antar Universitas, Institut Pertanian Bogor.


PROCEEDING 2017 192

POTATO FARMING SYSTEM AT BEDUGUL REGION,

BALI, INDONESIA

Ida Ayu Astarini 1*, Deborah Margareth1, Wina Andriani1, Made Ria Defiani1,

and I Gede Rai Maya Temaja2

1 Master Degree Program in Biology, Postgraduate Program,

Udayana University, Bali 2 Master Degree Program in Biotechnology, Postgraduate Program,

Udayana University, Bali * Corresponding author: [email protected]

Abstract

Potato (Solanum tuberosum L., family Solanaceae) is one of important vegetable crop in Indonesia, including Bali. Potatoes are highly nutritious, and are the fourth major source of carbohydrate around the world. In Bali, potatoes are mainly grown in highland. Central production areas are Bedugul region, at 1.200 m above sea level. This study aimed to describe potato farming system at Bedugul region, Bali. Method use was field observation and interview with farmers on all aspects of potato production. ‘Granola’ and ‘Granola Kembang’ are the main cultivars with average production of 18 ton/ha. Main problem on potato production was provision of certified early generation seed potatoes and infestation of diseases such as Phytophthora sp and Fusarium sp. Farmers do not aware on virus diseases as yet. Harvested potatoes are marketed fresh at nearby traditional markets such as Bedugul Market and Pancasari Market, as well as central market at Baturiti Village and Badung Market at Denpasar City. There is no potato processing industry found in the area.

Keywords: Granola, seed potato, Bali potato

BACKGROUND

Potato (Solanum tuberosum L.) is one of important tuberous vegetable that is highly nutritious. It contains carbohydrate, protein, fat, minerals (potassium, phosphorus, and iron), vitamin C and vitamin B6, and free of fat, cholesterol and sodium (Potatoes USA, 2015). In Indonesia, potato is consumed as additional food such as for soup, patties and chips. Potato in particular, has a high potency as a carbohydrate source to support food diversification. Central potato production in Indonesia is mainly in Java, such as Pengalengan, Lembang (West Java), Wonosobo (Central Java) and Batu-Malang (East Java). In Bali, potato are grown at Bedugul highland, Tabanan and Buleleng Regency.

Potato production in Bali was declining both in total growing areas as well as productivity. There is not yet report on potato farming system in Bali, and what causing the declining number of potato growers and potato productivity. This study


PROCEEDING 2017 193

aimed to find out potato farming system in Bedugul region, and to find out problems in growing potato in Bali, including pest and disease infestation.


Field observation was conducted on four potato farmers in Bedugul region, Bali. Field observation and interview was done March - June 2016. Activities observed include planting, weeding, pest and disease control, harvesting, storage and marketing. Intensive interview were conducted to the four farmers and 10 employees, chosen randomly.


Bedugul region lies at 1.200 m above sea level. It has a cool temperature,

ranging from 5oC early morning to 20oC during the day. Average precipitation is 2000 - 2500 mm per year with average of 195 rain day per year. Bedugul region has Andosol and Regosol soil type which is highly porous, and pH ranging 6.0 – 7.0 (Setiyo et al., 2011). Bedugul region consists of four villages, Pancasari, (Buleleng Regency), Candikuning, Kembang Merta and Batusesa Village (Tabanan Regency).

Bedugul region is central vegetable production for Bali. Main vegetable produced were spring onion, tomato, carrot, and broccoli, cauliflowers, cabbage, Chinese cabbage, snap beans and potato. Fresh produced is brought to Pancasari and Candikuning local market, as well as wholesale market at Baturiti Village (15 minutes drive from Bedugul) or to Badung Market at Denpasar City (an hour drive from Bedugul) every night.

Potato grown twice a year, April – June and September – December. Potato growers depended on two varieties only, i.e ‘Granola’ and ‘Granola Kembang’, with productivity reaching 15 - 20 ton/ha, depend mainly on seed quality. Other cultivar has been trialed such as ‘Atlantic’, but yield was below 10 ton/ha and it needs bigger planting space, due to long stolon characteristics. ‘Atlantic’ is also very susceptible to diseases (Wardana, Pers.comm, 2016).

Average potato fields of each farmers is very small, ranging from 0.2 ha – 0.5 ha. Potato production is managed by family, in which all family members involved in every stage from planting to harvesting.

Early generation seed potatoes (G0) were bought from Temanggung (Central Java) and Pengalengan (West Java) at Rp 1500–2000/seed. Third generation seed potatoes are also expensive, at Rp 50.000 per kilograms, usually bought from Malang (East Java). Due to high price of good quality seed potatoes, a number of farmers obtain cheaper seed potatoes at Rp 18.000 per kg, which was not guarantee early generation. Some other farmers set aside part of their harvest as seeds (Fig 1), but usually about 50% was damaged or deteriorate after 2-3 months storage (Astarini et

al., 2013). This causes low productivity due to disease infestation in seed (seed borne disease).

Chicken manure and rice husk were incorporated at planting to improve soil porosity and to allow maximum tuber growth. According to Soepardi (1983), chicken manure has higher dry matter compared to cow and pig manure. Chicken manure contains high nitrogen (65.8 kg N/ton manure) and phosphorous (13.7 kg P/ton). Manure also help in providing organic compound for the plants.


PROCEEDING 2017 194

Besides organic fertilizers, potato growers also applies Urea during planting day at about 100 kg/ha. Plants are watered every morning except during rainy season. Weeding was done twice only, before planting and when plants are about 25 – 30 days (about 10 cm plant height).

During growing season (Fig. 2), pesticide was sprayed twice a week; started when plants age 25 – 30 days, and also depend on the severity of diseases infection. Common diseases are leaf rot caused by Phytophthora infestans and dry rot caused

by Fusarium oxysporum fungi. Those diseases infect plants in particular when rainy season. Common practice by farmers is when it was raining a day before; farmers immediately sprayed their potato plants to prevent disease infection.

Common pest were orong - orong (Gryllotalpa sp) and kuwuk (Holotrica

javana) which damaged the mature tuber in the field, causing secondary rot (Fig 5). Green peach aphid (Myzus persicae) was also spotted on a few potato leaves in the field. This aphid can cause brittle leaves. This aphid usually occurs during dry seasons and is vectors for a number of viruses, particularly leaf roll (Duriat, 1984).

During field observation, symptom of virus infection was occurred on all famers field observed. Symptom includes leaf rolled, stunted plant growth, yellow mosaic leaf, abnormal leaf shape, dwarf plants and rosette plants. All potato growers do not aware on virus diseases as yet. Further study on virus detection and elimination method will be done.

Potato growers in Bedugul region admitted that they do not always practice crop rotation. Very often famers planted potato in the same field, a couple months following harvest, in order to obtain two harvesting seasons in a year. This is causing high disease infection, since infestation in the field has occurred in the previous plantation. Two - four days before harvesting date, upper parts of the plants were cut down and tubers were left underground in the field. This method was commonly practiced by potato growers to fasten maturing tuber, and to allow suberization (tuber skin become thicker), and prevents tuber mechanical injury during harvest and transportation.

Tuber harvest was done early morning, around 6 am, to reduce transpiration rate. G1 were harvested at 70 days, while G2-G4 at 90-100 days. When potato plants were severely infected by Fusarium sp. or Phytophthora sp., farmers usually harvest the tuber before maximum age. This is to prevent disease infection on tubers. Early harvest, together with used of uncertified seed potatoes are the main cause of low productivity, which is only less than half compared to potato productivity in the US (40 ton/ha) (ref).

Figure 1. Seed potatoes


PROCEEDING 2017 195

Harvested tubers were placed on big baskets. Sorting and grading was done at storage house. Grade A (3-5 tubers/kg) were sold at Rp 10.000 – Rp 13.000 to the middle man. This price was much lower than consumer price, which is Rp 20.000 per kg, due to long chain of marketing from growers to consumers.

Figure 2. Potato field at Bedugul region

Figure 3. Fusarium sp causing wilt on potato plants

Figure 4. Phytophthora sp. infection on potato field


PROCEEDING 2017 196

Figure 5. Potato tubers infected by Gryllotalpa sp and Holotrica javana pest and

secondary infection.

Figure 6. Harvesting time

Figure 7. Sortation and Grading of harvested tubers

To date, there are two farmers aware about the important of using high quality seed potatoes, after supervision from Udayana University team. The two farmers continuously bought early generation (G0), produced G1 and G2 seed potatoes and used G2 to produce potato for consumer. Those farmers have able to produce up to 20 ton/ha. Harvested seed potatoes from field were sort and grade and the store properly in basket for storage (Fig 7 and 8).

Farmers who wish to use part of their harvest as seed potatoes, should do selection in the field. Plants that are performed very well shoud be tagged and harvested tubers should be separated from other harvested tubers, and those can be used as a good source of seed potatoes. This was practiced by potato growers in Dieng Pleauteu, Wonosobo, Central Java (Pers. observation).


PROCEEDING 2017 197

Figure 8. Harvested potato at storage

CONCLUSIONS

Potato is one of main vegetable crop in Bedugul region. Potato productivity is declining, mainly due to unavailability of good quality seed potatoes and agronomic management. Potato growers needs supervision from government and academics to get access to certified seed potatoes and to increase awareness on pest and disease management. ACKNOWLEDGEMENT

Thank you to Pak Wardana, Pak Wayan Ada, Pak Wayan Sumerta and Pak Ngenteg for valuable information. This research was funded by Ministry of Research and Higher Education 2016.

REFERENCES

Potato Nutrition Handbook. 2015. Potatoes USA. Astarini, I.A., M. R. Defiani, N. K. Raleni, I.A. Suryanti. 2013. Studi Produksi Benih kentang Generasi 1 (G1) Varietas Granola Kembang untuk Penyediaan Benih Kentang Bermutu di Bali. Karya Unud Untuk Anak Bangsa. Pp 89 – 94. Duriat, A.T. 1984. Peranan myzus persicae Sulzer dalam penyebaran virus daun menggulung (potato leafroll virus) di lapangan. Prosiding Seminar Hama dan Penyakit Sayuran Cipanas, 29-30 Mei 1984, Badan Penelitian dan Pengembangan Pertanian, Jawa Barat. Setiyo, Y., I.B.W.Gunam, , I.B.P., Gunadnya, I. W. Tika. 2011. Bioremediasi In-Situ

Lahan Tercemar Pestisida Oleh Mikroba yang Ada Pada Kompos. The Excellent research. Universitas Udayana.

Date post:	22-Jan-2021
Category:	Documents
Upload:	others
View:	0 times
Download:	0 times

The International Conference on Biosciences€¦ · Nyoman Adi Suratma, I Wayan Yustisia...

Documents