THE JOURNAL OF BIOLOGICAL CHEMISTRY

I’nnted in 1J. S. A. Vol. 258, No. 24, Issue of December 25, pp. 14190-14796, 1983

Euglena gracilis Chloroplast Ribosomal RNA Transcription Units NUCLEOTIDE SEQUENCE POLYMORPHISM IN 5 S rRNA GENES AND 5 S rRNAs*

(Received for publication, July 6, 1983)

Gerald D. Karabin, Jonathon 0. Narita, Jesse R. DoddS, and Richard B. Hallickf From the Department of Chemistry, University of Colorado, Boulder, Colorado 80309

The three tandemly repeated ribosomal RNA operons from the chloroplast genome of Euglena gracilis Klebs, Pringsheim Strain 2 each contain a 5 S rRNA gene distal to the 23 S rRNA gene (Gray, P. W., and Hallick, R. B. (1979) Biochemistry 18, 1820-1825). We have cloned two distinct 5 S rRNA genes, and determined the DNA sequence of the genes, their 5‘- and 3”flank- ing sequences, and the 3’-end of the adjacent 23 S rRNA genes. The two genes exhibit sequence poly- morphism at five bases within the “procaryotic loop” coding region, as well as internal restriction endonu- clease site heterogeneity. These restriction endonucle- ase site polymorphisms are evident in chloroplast DNA, and not just the cloned examples of 5 S genes. Chloroplast 5 S rRNA was isolated, end labeled, and sequenced by partial enzymatic degradation. The same polymorphisms found in 5 S rDNA are present in 5 S rRNA. Therefore, both types of 5 S rRNA genes are transcribed and are present in chloroplast ribosomes.

The chloroplast of the unicellular flagellate Euglena gracilis contains a circular double-stranded DNA molecule of approx- imately 145,000 base pairs (1, 2), with a G + C content of 25 mol % (3). Encoded on this DNA are the genes for all of the plastid ribosomal RNAs (4-6), most if not all of the transfer RNA molecules (7-lo), and several chloroplast-specific pro- teins (11, 12).

The ribosomal RNA-coding loci of E. gracilis consist of three tandemly repeated units, each containing the genes for the 16 S, 23 S, and 5 S rRNA genes. The repeating unit is 6.2 kbp’ in length and has the contiguous gene arrangement 16 S rRNA-tRNA”‘-tRNAA’”-23 S rRNA-5 S rRNA (13, 14). This gene organization resembles the ribosomal RNA operons of Escherichia coli (15).

Fine structure analyses and comparisons of rRNA genes from the genomes of several organisms has recently been possible through the use of recombinant DNA technology and DNA sequence analysis. We were interested in analyzing the nucleotide sequence of the 5 S rRNA genes of Euglena to look for heterogeneity that may exist between genes on the three different repeats. In our analyses, we used restriction mapping

* This work was supported by Grant GM21351 from the National Institutes of Health. This is paper I11 in a series “Euglena gracilis Chloroplast Ribosomal RNA Transcription Units.” Paper I1 is Ref. 14. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ Present address, Stanford University Medical School, Palo Alto, CA 94305.

§ To whom correspondence should he addressed. * The abbreviations used are: kbp, kilobase pair; bp, base pair; rrn,

ribosomal RNA operon.

techniques, Southern blot hybridizations, and DNA sequence analysis on two different 5 S rRNA regions. In addition, RNA sequence analysis was performed on isolated Euglena chloro- plast 5 S RNA.

In this paper, we present evidence for the existence of at least two distinct 5 S rRNA genes on the Euglena chloroplast genome. It would appear that both of these genes are tran- scribed into stable RNAs that are both present in the chlo- roplasts.

EXPERIMENTAL PROCEDURES’

graclli. xlebs Strain as prevloualy described 1421. Chloroplast DNA IsolatlOn-ChlorOpla.Ilr DNA Was isolated frOp Euglena

cleared lysate pracedure (361 and further purified by isopycnic Centrlfuga- Plasmid CHA Isolation and Cloning-Plasmid DNA was isolated by the

t m n m an EtBr-CsC1 density qradient ( 3 7 1 . DIqeation of plasmid PPGll and pEZCl DNAs with restrlctron-enzymes was carried-out according to procedures provided by the suppliers 1Bethesda Research IdbOratOries, New Kngland Bio- labs). For D m restrlctlon fragment isolation, l o w gelllng temperature agarose was “sed, and DNA was recovered by DE-23 ion-exchange chrmatography

Out by the mxam-Gilbert procedure 1201. 1141. DNA strand separation and single strand DNA laolation yere carried

librarlea of EcDRI and Bind111 fragaenta, respectively. Of EU lena racilis The reedinant plasmids pPGll and PEZCl rere isolated from shotgun

%FORI restriction fra-t E-P and PUB9 118). Plasmid pEZCl is a recaobi- 2 chloroplast-A. The-asmid pPGll is a recombinant of t & r b N A

z t of the chloroplast D N A m d I I I restriction fragment e 2 3 or 24. and pBR322 1171. E. CDll EB-101781 was used as the host strain for the plasmid PPG11. E. colT L m 7 8 lhsd X-, hsd W , Su-2, gal 96, st1 R , ILV-6, Thi-1, Thr-I, p & v m by Dr. 1. soll, was used as the haat strain for the recaobi- nant plasmid pEZC1. Ligation and transformation procedures were prfonwd according to published procedures (391.

librarlea of EcDRI and Bind111 fragaenta, respectively. Of EU lena racilis The reedinant plasmids pPGll and PEZCl rere isolated from shotgun

%FORI restriction fra-t E-P and PUB9 118). Plasmid pEZCl is a recaobi- 2 chloroplast-A. The-asmid pPGll is a recombinant of t & r b N A

z t of the chloroplast D N A m d I I I restriction fragment e 2 3 or 24. and pBR322 1171. E. CDll EB-101781 was used as the host strain for the plasmid PPG11. E. colT L m 7 8 lhsd X-, hsd W , Su-2, gal 96, st1 R , ILV-6, Thi-1, Thr-I, p & v m by Dr. 1. soll, was used as the haat strain for the recaobi- nant plasmid pEZC1. Ligation and transformation procedures were prfonwd according to published procedures (391.

nmbrana Filter Aybrldilation-The chemically synthesized 32P-labeled tstr~aecadeoxynu=leotide 5 ’ - d ( T m A M T G m A ) was synthesized and purified by Jac Nickdoff 1391. Restriction endonuclease fragaentl Of e c a p , EcoL, and

chloroplast O N I S -e transferred by blotting frDl a g a r o s ~ e l s to nitrocellulose filters 1401. NitrKellulose bound DNA M. hybridized accord- ing to the procedure deacribd by Southern 1401. nybridiration of 32P-

Dents was carried Out at 37.C for 2 1 h in 6 X UET INET: 0.15 I4 NaC1, 0.1 I8 labeled t.tT.dBcadeOxynUcle0tide to plasmid and Chloroplast restriction fra9-

EDTA. 0.05 I4 Tris basal, 5 X Denhardt‘s SOlUtiom (41). 0 . 5 ) SDS, 101 dextran

tines in 5 X SSC ISSC: .6 I# NaC1, . 0 6 U sodium citzatel, 0.1\ SDS for 20 mi” sulfate, and 0.001% bovine se- albumin 1401. The filters were washed three

at roan temperature. They were blotted dry and autoradiographed at -70C using xodak XAR X-ray filn and a DuPOnt Cmnex lightning Plus A-G LntenaifY- in9 screen.

tian Iragmente rere estimated on the basis of their electmphorbtlc mobill- Sire Determination of Reatriotion Pragments-(IOlecular size. of restrxc-

ties in 1.0-1.58 agarose gels and 3.5-5.01 129:ll polyacrylamide gels. For fraqrent sire est-tion. Bind111 digested A DNA and e 1 1 1 digeated OX-174 DNA rere used as m o l e c u l ar~za standards.

ylls p e r f o d on isolated restriction fraswnts of EcoP. g L . pPG11, and pEZCl plasmid DNA-. RestriCtlOn fra-ts were isoGed. alkaline phospha-

bere elther cut as-trically or strand separated and fractionated by poly- rase treated, and 5‘-end labeled as described 1201. End labeled fraqments

acrylamide gel electrophoresis 1201. Sequence reactions G. G + A. C + T.

DNA Sequence halysis by Chemical Cleavagdhenical Sequence analysis

labeled end was detkined by resolition of the Cleavage product. on Ultra thin 6-88 138:21 polyacrylamide gels I38 x 21 -1 containing 8 I4 urea and I x T9” on a region of DNA sequence just upstream Of the BamnI reetriction site in nind23/24 1 P l g . l b l . The x&I/aindIII restrictionTagment (Pig. lt4 contain- = the 5 5 rRNA gene and p a r t 3 the 23 s TUNA gene was strand separated and purified by polyacrylamide gel electrophoresis as described 119). A chemi- cally synthesized tctradefadeoxynucleotide, complamentary to a 14 nucleotide sequence of the 5 s rFNA gene, was used as the primer for tbo didsoxy chain termination reactions. Polymerase I IXlenoWl was used to synthesize radio-

strand template and chain termination reactions -re uaed described 1201. labeled fragments frcm template DNA. Bybridiaatian of primer to single

Resolution of labeled fragments by polyacrylamide gel electrophoresis was

. .. . ” . Primed Dideory Sequence halysis-cndeoxy sequence analyais was performed

performed as described above

rose ?latation as previously reported a61. The nuclease inhibitor aurincri- carboxylic acid (ATAI was present in all buffers at a SOnCCntZation of 10 111.

5 S rRWA SeWancing-UNA was isolated from chloroplast. purified by SYC-

2 “ Experimental Procedures” are presented in miniprint as pre- pared by the authors. Miniprint is easily read with the aid of a

the Journal of Biological Chemistry, 9650 Rockville Pike, Bethesda, standard magnifying glass. Full size photocopies are available from

MD 20814. Request Document No. 83M-1912, cite the authors, and include a check or money order for $1.20 per set of photocopies. Full size photocopies are also included in the microfilm edition of the Journal that is available from Waverly Press.

14790

by guest on Novem

ber 29, 2018http://w

ww

.jbc.org/D

ownloaded from

Euglena Chloroplast 5 S rRNA Genes 14791

ATA was r-ved from the RNA. prior to end labeling reactions, using G50-150 Sephadex fractionatlon ( 4 3 ) .

the alkaline phosphatase and TI polynucleotide kinase methods described above for DNA. except a pH 8.0 buffer was used to minimize alkaline hydrolysis of tho RNA. The radioactively labeled ENAs were fractionated on 10% polyacryl- amide-8 I4 =rea gels as described above. The 5 5 rRNA was detected by auto- radiography and excised from the gel. Tho RNA wad placed in 0.1-0.3 m l Of elution buffer ( 0 . 3 I4 NaC1, 10 mM Tris-C1, pH 7.6, 1 ml4 EDTA1 and left for 12-21 h at 4.C. The supernatant wa. collected and the RNA was ethanol pre- cioitatad. washed twice with 8 0 1 ethanol, and dried. The pellet was resus-

The total RW population was radioactively labeled at the I'-ends using

RNA 12000-10.000 dpml ln 7 W urea. 20 m M Na-cltrate, 1 mn EDTA, 0.25 rnq/ml tRNA was treated at 50DC for15 m m Wlth elther I11 no added enzyme. (21 RNase U? whlch cleaves after adenoslnes, (31 RNase T1 whlch cleaves after quano- 61nes or, I41 RNase Phy M whlch cleaves after adenosines and urldlnes. A partla1 alkaline hydrolysls of the RNA was employed to generate a ladder representlnq all posslble base Cuts. ThlS latter reactlo" 1s done In d pH 9.0 carbonate buffer at 90°C for 15-30 mln. The reactlon products were separated by electrophoresis, and detected by auroradloqraphy as described a bow.

RNA sequencing was performed uSlnq the procedure of DOnls-Keller 1331.

dlmethylsulfoxide were Obtalned from Eastman Xodak Co. Acrylamlde Was pur- chased from fzrher Sclentlflc co. Agaro~e. aurinrricarboxyllc acld, and

Chmlcals and Enzymes- Dlmethylsulfate, plperrdlne, hydrazine, and

bacterial alkallne phosphatase were obtained from Siqma Chemlcal Co. [?-32PlATP, Io-32PldATP. TI polynucleatlde klnase, and TI DNA 11qase were purchased from New England Nuclear. ReStrlction enzymes were Obtalned from Bethesda Research IdbOratOrleS IBRLI and New England Bialabs. Pol1 1KlenOwl and dldeoxy NTPs were purchased from BRL. RNase T and RNase U2 were Obtained from Calblochem. RNase Phy M was a qener&us q1ft from Norman Pace.

RESULTS

Isolation and DNA Sequence Analysis of Two Different Euglena Chloroplast 5 S rRNA Genes-The E. gracilis chlo- roplast ribosomal RNA operons have been previously shown to encode 5 S rRNA genes distal to the 23 S rRNA genes (16). The rRNA operons, which have a gene arrangement of 16 S rRNA-tRNA'l'-tRNAAla-23 S rRNA-5 S rRNA, are repeated three times in tandem in E. gracilis strain 2 (14) chloroplast DNA. We will designate these transcription units as rrnA, B, and C. The 5 S rRNA genes of rrnA and B are located on 2.5- kbp EcoRI fragments (EcoL1 and LJ, and also on 2.5-kbp HindIII fragments (Hind23 and 24). The third 5 S rRNA gene of rrnC is encoded on a 7.8-kbp EcoRI fragment (EcoF). The gene arrangement and restriction map of the Euglena chloroplast rDNA is shown in Fig. la. In order to compare the 5 S genes and flanking sequences of different rRNA operons, two distinct 5 S rRNA genes were isolated and amplified as recombinant plasmid DNAs. HindIII fragment 23 or 24 (Fig. la) was cloned as a recombinant plasmid designated pEZC1. It was selected from a shotgun library of Euglena chloroplast DNA HindIII fragments ligated at the HindIII site of pBR322 DNA (17). The 5 S rRNA gene of pEZCl derives from either rrnA or rrnB. At present there is no known difference between these two transcription units, or a means to resolve these genes on different restriction fragments. This fragment will be designated Hind23124, and its locus as the operon rrnA/B. The 5 S rRNA gene of rrnC was isolated on an EcoF-containing plasmid designated pPG11. pPG11 was selected from a collection of EcoRI frag- ments of Euglena chloroplast DNA cloned in EcoRI-digested pMB9 (2, 18).

Restriction endonuclease cleavage maps for Hind23/24 and EcoF are presented in Fig. 1, b and c, respectively. These maps were determined as previously described for other Eu- glena chloroplast rDNA-derived plasmid DNAs (13, 14, 16). It has been shown previously that the unique BamHI cleavage sites in rrnA, B, and C are most likely internal sequences of the 5 S rRNA genes (16). Therefore, initial DNA sequence analysis was by chemical cleavage (19) of DNA 5'-32P-labeled at the BamHI cleavage sites (Fig. 1, b and c). Sequence analysis of the 5 S genes and flanking sequences was com- pleted by chemical cleavage of 5'-end-labeled HindIII frag- ments (Fig. l b ) or by primed dideoxy chain termination analysis (20) (Fig. IC). The primer was the synthetic deoxy- oligonucleotide 5'-d(TTCGAAATGTTTTA)-OH. This tetra- decamer could be designed and synthesized as a primer within the 5 S rRNA gene adjacent to the BamHI cleavage site after the initial DNA sequence data were obtained. Thus, the DNA sequences of two different 5 S rRNA genes, their distal

spacers, the 23 S rRNA-5 S rRNA intergenic spacers, and the 3'-end of the 23 S rRNA genes of rrnA or B, and rrnC were determined. The DNA sequence of 400 bp from HindIII23/24 and 300 bp from EcoF is given in Fig. 2.

The 3'-End of the 23 S rRNA Gene-In order to locate the 3'-end of the Euglena chloroplast 23 S rRNA gene, the se- quence data shown in Fig. 2 were aligned with the correspond- ing region of the E. coli 23 S rRNA gene (21), and chloroplast 4.5 S rRNA and rDNA sequences of tobacco (221, duckweed (23), wheat (24), and maize (25). It has previously been noted that higher plant chloroplast 4.5 S rRNA, which is encoded between 23 S and 5 S rRNA genes (26), has primary sequence (27) and secondary structure (28) homology to the 3'-end of E. coli 23 S rDNA. In maize and tobacco chloroplasts, the 4.5 S rRNA genes are separated from the 23 S rRNA genes by 78- and 101-bp spacers, respectively (22, 25).

A 95-bp region of the Euglena rDNA sequence shown in Fig. 2 (positions 36-130) has 44% primary sequence homology to the 3'-end of the E. coli 23 S rDNA, and 64% homology to the 4.5 S rRNAs or rDNAs of wheat, maize, and tobacco chloroplasts. As shown in Fig. 3, this sequence can also assume the proposed, conserved secondary structure shared by pro- caryotic 23 S rRNA 3'4erminal regions and chloroplast 4.5 S rRNAs (29). We conclude that this is the 3"terminal sequence of the 23 S rRNA gene. Unlike the higher plant chloroplast rDNAs, there is no spacer in Euglena chloroplast rDNA separating these 3'-terminal sequences from the remainder of the 23 S rRNA gene, and no 4.5 S rRNA species is found in Euglena chloroplast ribosomes. The homology in primary and secondary structure between Euglena chloroplast and procar- yotic 23 S rDNA continues 5'-proximal to the 95-bp terminal region into the remainder of the large rRNA gene (Fig. 3). There is at least one possible base-pairing interaction between sequences at or near the 5'- and 3'-ends of the 23 S rRNA (Fig. 3). We would therefore conclude that the 3'-terminal portion of the Euglena chloroplast 23 S rRNA must have a functional and structural homology to the 4.5 S rRNA of higher plant chloroplast ribosomes, and the 3'-end of procar- yotic 23 S rRNAs.

Microheterogeneity in the 23 S rRNA-5 S rRNA Intergenic Spacer-The 23 S rRNA genes and 5 S rRNA genes of Euglena chloroplast rrnA/B and rrnC are separated by an AT-rich spacer of approximately 73 bp. The exact terminus of the 23 S rRNA gene, and therefore the spacer size, is not known. The two Euglena chloroplast spacer sequences are identical except for a single C/T polymorphism (Fig. 2, posi- tion 134). The two intergenic spacers have an 81-82% A + T base content. The spacer length of 73 bp is comparable in size to the 92-bp E. coli rrnB spacer (30), but considerably shorter than the 256-bp tobacco chloroplast 4.5 S rRNA-5 S rRNA intergenic spacer.

Polymorphism in the 5 S rRNA Genes of rrnAIB and rrnC- The 5 S rRNA genes are located distal to the 23 S rRNA genes in rrnA/B and rrnC. They have the same polarity as the other genes in these operons. The 5 S rRNA genes could be identified by the following criteria: 1) primary sequence homology to other known chloroplast and procaryote 5 S rRNAs and rDNAs (31); 2) conservation of secondary struc- tural features proposed for other 5 S rRNAs (32); 3) the presence of internal BamHI recognition sequences (5'- GGATCC) previously mapped within these genes (16); 4) the presence of marker residues that are present, with few excep- tions, in all 5 S rRNAs (31, 32); and 5) co-linearity with Euglena chloroplast 5 S rRNAs (described below).

The primary sequences of the rrnA/B and rrnC 5 S rRNA genes are shown in Fig. 2, positions 207-322. A primary

by guest on Novem

ber 29, 2018http://w

ww

.jbc.org/D

ownloaded from

14792 Euglena Chloroplast 5 S rRNA Genes

a) r r n c r r n B r r n A I V ,

tRNA”

5 s 23s 16s SS 235 tRNAAIaJ lbs s16S

partial tRNATr d/ part ia l tRN2rDY part ia l pseudo tRN$lc pseudotRNA” pseudo tRNA1IC

BarnHl c I E2 I E l I D I B

E C O R I F 1 P3 1 L 2 I P2 I L l I P1 1 B Hind 111 I 361861152 I 29 I 2 4 I IM I 2 8 I 2 1 I 1501 27 1 1 1

70 60 e6

FIG. 1. Restriction maps of 6 S rDNA loci. a, the organization of E. gracilis chloroplast DNA ribosomal RNA operons. The chloroplast ribosomal RNA genes are organized as a triple tan- dem repeat. Each repeated unit, labeled r r d , r r B , rrnC, is 6.2 kbp in size. Re- striction maps for EcoRI, BamHI, and Hind111 are illustrated. The direction of transcription is from right to left. Studies on this region have been reviewed else- where (2) . b, restriction endonuclease site map for E. gracilis chloroplast DNA fragment Hind23124. The upper line is a restriction map for enzymes that cleave Hind23/24 once. The second and third lines are maps of fragments produced by Hoe111 and HpaII cleavages, respec- tively. Restriction fragment sizes in base pairs were determined as described un- der “Experimental Procedures.” Below the maps is a schematic representation of the 5 S and 23 S rRNA genes and sequence analysis strategy. The small solid square, below the 5 S rRNA gene, indicates the primer hybridization locus. DNA nucleotide sequences were read from sequencing gels in the 5’ to 3’ direction as indicated by the arrows. c, restriction endonuclease site map for E. gracilis chloroplast DNA fragment EcoF. The top five lines are restriction maps for the 7.8-kbp restriction fragment EcoF. Restriction fragment sizes were determined as described under “Experi- mental Procedures.” Bottom, a sche- matic representation of the 5 S and 23 S rRNA genes and sequence analysis strat- egy. DNA nucleotide sequences were read from sequencing gels in the 5‘ to 3’ direction as indicated by the arrows.

HaeIII I 227 I

MIDI 1720 1 400 1 330 J

..

1175 I 870 75 1 1

3’ f I S r R N A 8’ 3’ 23SrRNA

4

p r k r r I b

FIG. 2. The nucleotide sequence from Euglena chloroplast Hind23/ 24 (rrnA/B) and EcoF (rrnC) DNAs. The DNA strands are written left to right in the 5’ to 3’ direction. The RNA-like strand of the rRNA genes is written in italics. The upper strand is the DNA sequence from Hind23124 The lower strand is the DNA sequence from EcoF. Asterisks indicate base difference be- tween the two DNA strands.

r r n A 1 0

r r n A 1 8

r r n C

r r n A 1 0

r r n C

r r n A l 0

r r n C

1 20 ?O 2 3 S r R U - 6’ 80 100

CATATAGTAGAGTCCACCTAACCATAGTACTCTTCATAGGTCACOCTAAGACGAACCGTTTGATAGGTATTAGGTGTACAATTGCTAACAATTTTAGCCC

r r n C TATTAGGTGTACAATTGGTAACAATTTTACCCC

1 fO I40 160 180 200

A G A T A T A C T A A C C G A C C G A A A A T T T ~ T T C C T A T A ~ G A A A A C A A A A C A ~ ~ ~ A ~ ~ ~ ~ T A C ~ ~ G ~ C A C T ~ T ~ ~ T A A G A ~ ~ ~ A A A A G ~ ~ ~ C T ~ G A A ~ G A A C T ~ T

A ~ A T A T A C T A A C C G A C C G A A A A T T T T T T C C T A T A ~ G A A A A C A A A A C A ~ ~ ~ A ~ T ~ ~ ~ A C ~ ~ ~ ~ C A C ~ ~ ~ ~ T T A A G A ~ ~ ~ A A A A ~ T ~ ~ C T T G A ~ T ~ ~ ~ C T T T

5 5 rRNA * ‘to h HI 260 280 3?0

TATTTTAGG0TGCTCTTGTCTTTAT~ACTTAAAACATTTCGAACTTGCAAGTTAAACATAAAGGGTAAATCCATACTTG~*ADCTT~CTTTC~CC

TATTTTACGGTGCTCTTGTCTTTAT~ACTTAAAACATTTCGAACTTGCAAGTTAAACATAAAGGGTAAATAGATACTTGAAACCTTACTTTCCCC

320 340 360 360 4 0 0 GAAAAGATT~TAcTGCCCT~ATGGGAAGlilA~lllAlliAATlGTClCilAGl6AGTliAlllAllAAiAllAAClCGAllllCGAGTAA~~~~~A~~A

C A A A A G C T T T T A C T C C C C T T A T ~ G ~ G ~ 6 l l l A ~ l l ~ ~ l ~ ~ ~ A l l G ~ ~ T ~ T ~ ~ ~ l ~ ~ G ~ l T ~ ~ T l ~ l l A ~ ~ ~ ~ T ~ ~ ~ ” ”

sequence comparison to other chloroplast 5 S rRNAs is given region near the 3’-end of the gene. This type of gene poly- in Fig. 4. We estimate the Euglena genes to be 115 nucleotides morphism has not previously been observed in repeated rRNA in length. The base contents are 36-38 mol % GC. The most or tRNA genes of chloroplast genomes, but is not without unexpected feature is that the two genes have five differences precedent among 5 S rRNA genes from other sources (31). in nucleotide sequence. All five changes occur within a 32-bp A model for the secondary structure of the Euglena chlo-

by guest on Novem

ber 29, 2018http://w

ww

.jbc.org/D

ownloaded from

Euglena Chloroplast 5 S rRNA Genes 14793

roplast 5 S rRNAs is shown in Fig. 5. The primary structure can be represented in a secondary structure which contains two hairpin loops, two interior loops, and a multibranched loop, with base pairing separating these loops, and joining the 5'- and 3'-ends of the molecule. Several of the base differences in the two 5 S rRNA genes might alter base-pairing interac- tions.

There are two prominent features of the DNA sequences 3"distal to the rrnA/B and rrnC 5 S rRNA genes. First, the DNA is 78-80 mol % A T base pairs. Second, the sequences from the two different operons are completely divergent. It is apparent that the boundary between the tandemly repeated rDNA and the single copy DNA is immediately adjacent to the 3'-end of the 5 S rRNA gene of rrnC.

Restriction Endonuclease Cleavage Site Polymorphism in the Euglena Chloroplast 5 S rRNA Genes-Two of the base differences between 5 S rRNA genes result in restriction enzyme site polymorphism within the coding loci. The 5'- AAGCTT HindIII site at positions 304-309 in rrnC has the sequence 5"AAGATT in rrnA/B. The 5'-CCGG MspI site at positions 297-300 in rrnA/B is the 5'-CTGG in rrnC. In addition, the rrnC gene is immediately followed by a 5'-CGCG ThaI site, rather than the 5'-GGGA of rrnA/B. Each of these restriction site variations was evident in the restriction en- donuclease maps of the cloned genes used for DNA sequence analysis (Fig. 1, b and c ) . In order to demonstrate that the

A G G A C

A A U . A G.C

V A " G A A U C C A AUCAUAUA

A

A B - A A G C A U

C G A A A A U U U U U U C C . . . 3 ' z ..........

U U U U G G A A A A f = l . . . 5 ' L 2 3 S r R N A f

FIG. 3. Euglena chloroplast 3'-terminal 23 S rRNA se- quence. The 23 S rRNA sequence is deduced from the DNA sequence and is represented in the secondary structure proposed for the 3'-end of E. coli 23 S rRNA (28). A hypothetical base-pairing interaction with sequence at or near the 5'-end of the Euglena chloroplast 23 S rRNA (14) is drawn.

FIG. 4. A comparison of the se- quence homology of the E. gracilis 5 S rRNA gene sequence to 5 S rRNA genes from Dryopteris acu- minata, tobacco, spinach, duck- weed, broad bean, and Anacystis ni- dulans. The E. gracilis 5 S rRNA gene sequence from Hind23124 is shown as the top sequence with nucleotide differ- ences from the EcoF 5 S rRNA gene shown directly below. Sequences were taken from this report and from Ref. 31. ct, chloroplast.

E . g m c i z i a ( c t )

D. aclrmimtu (Ct) Tobacco (c t )

Spinach kt)

Duckweed ( c t ) Broad bean ( c t )

A . nimCLma

D. aclrmimtu ( c t ) Tobacco ( c t )

Spinach ( c t ) Duckweed ( c t ) Broad bean ( c t ) A. niduLma

restriction site polymorphism, and thus the 5 S rRNA gene sequence polymorphism, was a property of most or all of the population of genes within chloroplast DNA, and not merely the consequence of cloning an unusual gene, a membrane filter hybridization was performed. Euglena chloroplast DNA was digested individually with HaeIII, EcoRI, T h I (TacI), MspI, and HindIII. The products were separated by agarose gel electrophoresis, blotted onto nitrocellulose filters, and hybridized with the synthetic 5 S rRNA gene-specific probe [~'-c~-~'P]~TTCGAAATGTTTTA. The gel photo and corre- sponding autoradiogram are shown in Fig. 6. In each case, two 5 S rRNA gene hybridization signals were obtained, and the fragments were of the size expected from the cloned genes of rrnA/B and rrnC. In control experiments (not shown), the fragment mobility and Southern hybridization signals from parallel digests of pEZCl and pPGll were the same as with the chloroplast DNA restriction fragments. We therefore conclude that the nucleotide sequence polymorphism of Eu- glena chloroplast 5 S rRNA genes, especially at positions 298 and 307 (Fig. 2), is a property of most or all genes. We cannot rule out the possibility that additional polymorphisms might exist, either between rrnA and B, or among other members of the chloroplast 5 S rRNA gene family.

Polymorphisms in the Euglena Chloroplast 5 S rRNA Se- quence Are Consistent with Expression of Both the rrnA/B

A A G

A A * U A

FIG. 5. 5 S rRNA sequence and secondary structural model. The RNA sequence is deduced from the Hind23124 DNA gene se- quence. The nucleotides drawn around the secondary structure denote changes found in the EcoF 5 S rRNA gene.

10 20 30 40 50 60 "" AGGGUGCUC-UUGUCUUUAUGGAUCCACUUAAAA--CAUUUCGAACUUGCAAGUUAAA

UAUUCUGGUG-UCCCAG6CGUAGAGGAACCACACCGAU-CCAUCUC4AACUU4GU9GUUAAA UAUUCUGGUG-UCCUAGGCGUAGAGGAACCACACC~U-CCAUCCCGAACUUGGUGGUUAAA UAUUCUGGUG-UCCUAGGCGUAGAGGAACCACACCAAU-CCAUtCCCGAACUUGGUGGUUAAA UAUUCUGGUG-UCCUAGGCGUAGAGAGGAACCACACC~U-CCAUCCCfiAACUUGGUGGUUAAA UAUUCUGGUGCUCCUACGEGUAGAGAGGAACCAAACCAAU-CCAUCCCGAACUUGGUGGUUAAA --UUCUGGUG-UCUAUGGCGGUAUGGAACCAA~CU~CCCCAUCCCGAACUCAGUG6UUAAA

70 80 1 0 0 11.0 120 90 - CAUAAA-G-GGUAAAUAGAUACUUGAAAGGUUACUUU-CC~f i~AAAA6AUUUUA~U~CCCUUA--

G G G U C

- C U C U G C C G C G G U A A C C A A - ~ - C ~ G G G G 6 G ~ C C U - G C G G A ~ U A G C U C G A _ U G C C A G G A U A - CUCUACU~CGGUGACG-A-UAtUGUAGGGGAGGUCCU-GCGGAAAAIUA6CUCGACGCCAGfiAU- - CUCUACUGCGGUf i~CG-A- t lACUGUAGGGGAGGUCCU-GCGGAAAAAUAGCUCGAC~AGGAUG - C U C U A C U q C C S V G A C G - A - ~ G U A G G G G A G G U C C U - G C G G A A A A I U A G C U A G C G A C ~ A G A ~ U - - CACUACUGCGGUGACA-A-UACUGUAr.G~AGGUCCU-GCGI;AAAAAUAGCUCGGCGtCAGAAU- CAUACCUGCGGC~CG-A-UACUCUCGGGUAGCCGGCCGCU- -AAAAUAGCUCGACGttAGGUC-

by guest on Novem

ber 29, 2018http://w

ww

.jbc.org/D

ownloaded from

Euglena Chloroplast 5 S rRNA Genes

1234512345

- 78OO(Eco-F)

- 5500

_ 2400

- 2300

-1280

- 870

- 730

- 400

FK. 6. Hybridization of a chemically synthesized aligo- deoxynucleotide 5 S rRNA gene probe to restriction endonu- clease fragments of Euglena chloroplast DNA. Chloroplast DNA was digested with the following enzymes: Lane 1, HaeIII; Lane 2, EcoKI; Lone 3, 7’hoI; Lane 4, MspI; Lone 5, HindIII. DNA restric- tion fragments were electrophoresed on a 1.0% agarose gel, trans- ferred to nitroceilulose paper by the method of Southern (4O), and then hybridized with [5’-n-“*P]dTTCCIAAATCTTTTA. The sizes of the restriction fragments are marked on the right s&de of the autora- diogram. See text for an explanation of the results.

Fit;. 7. Autoradiograms of 5 S rRNA-sequencing gels. Pans illus- trate partial ribonuclease cleavage of 5’- ‘“P-end-labeled 5 S rRNA. Cleavage products were resolved by electrophore- sis on 6, 8, 12, and 20% polyacrylamide gek (b/t to right) containing 7 M urea. The various lanes are RNase UI, (A), RNase TI (G), RNAse Phy M (A + U), and alkaline hydrolysis (Ah) (nonspe- cific). The 5 S rRNA sequence is shown to the right of each autoradiogram. The lines indicate sites of overlap between adjacent autoradiograms and + denotes base polymorphism in the RNA se- quence.

and rrnC Genes-To determine if both 5 S rRNA sequences were present in the Euglena chloroplast RNA population, we sequenced the RNA. Total chloroplast RNA was isolated and 5’-end labeled with [r-““P]ATP in a polynucleotide kinase reaction. The 5 S rRNAs were purified by polyacrylamide gel electrophoresis, and eluted from the gel.

The base-specific RNases, T,, UL, and Phy M, were then used to generate sequence-specific, partial digestion ladders from which the RNA sequence could be derived (33). RNase T, cleaves RNA 3’ to G; RNase U, cuts after A, and Phy M cleaves 3’ to both A and U. A limited alkaline hydrolysis ladder was used in parallel to mark each base. Thus, a position on the alkaline ladder not represented in any of the RNase ladders must be a C.

Examples of sequencing gels generated from these types of reactions are shown in Fig. 7. The 5 S sequence is determined from the 5’-end, an A, to within 4 or 5 bases of the 3’-end. Of the I.09 nucleotides that can be read from the oligonucleo- tide sequence ladder, beginning at the 5’-end of the 5 S rRNA, there are 102 positions where a single nucleotide is present, and seven sites of nucleotide polymorphism. The 102 unam- biguous positions are co-linear with the 5 S rRNA genes of both rrnA/B and rrnC. The five sites of nucleotide poly- morphism in the 5 S rRNA genes are also represented as nucleotide polymorphisms in the 5 S rRNA sequence. These are at positions 70 (A + G), 79 (A + G), 86 (A + G), 92 (“C” f U), and 101 (A + “C”).

The changes at sites 70,79, and 86 are all A -+ G polymorph- isms. In each case, the G signal is much less intense than the surrounding G bands. The rrnA/B genes that are present in two copies on the Eu&vta genome have As at these sites. The rrnC gene, a single copy gene, has a G at each of these sites. The base at position 92 gives a very weak U signal. The rrnA/ B genes have a C at this position and thus would not be expected to give any band. The rrnC gene has a T at this site, and is therefore the source of this U signal. Similarly, the band at position IO1 gives a strong A signal that corresponds to the A found in the rrnA/B gene. The rrnC sequence has a C at this position and would not be expected to give an RNase

by guest on Novem

ber 29, 2018http://w

ww

.jbc.org/D

ownloaded from

Euglena Chloroplast 5 S rRNA Genes 14795

product. Thus, we find evidence for at least two different 5 s rRNAs from at least two different genes from a single RNA- sequencing gel.

Two additional sites of possible RNA sequence polymorph- ism are found at positions 12 (G + U) and 20 (G + U) (Fig. 4). These ambiguities are not reflected in the DNA sequence, since both of the 5 S genes have G at these positions. The G signal is much stronger at both sites. These nucleotides are both in unpaired regions in the proposed 5 S secondary structure and may be a consequence of overdigestion or nu- clease contamination. Alternatively, there may be additional polymorphism in the 5 S rRNA gene population not evident from two gene sequences we have determined.

From the above results, we conclude that 5 S rRNA se- quences from both rrnA/B and rrnC are expressed in Euglena chloroplasts. The gels would appear to be consistent with the notion that rrnA/B transcripts are present in more copies in the total RNA population than the rrnC 5 S rRNA. This is only a qualitative observation and has not been quantitatively determined.

DISCUSSION

On the Origin and Expression of the Euglena Chloroplast rRNA Operons-The distal portion of the Euglena chloroplast rRNA operons more closely resembles procaryotic than higher plant chloroplast rRNA operons by several criteria. The 3‘- domain of the 23 S rRNA is an integral portion of the large ribosomal RNA, rather than split off as a 4.5 S rRNA gene. Interestingly, the 3’-end of Chlamydomonas chloroplast 23 S rRNA, a split gene, is like Euglena chloroplast and procaryotic 23 S rRNAs, but the 5’-functional domains are split off as 7 S and 3 S rRNA genes (34). In addition, the 23 S-5 S rDNA intergenic spacer is relatively short compared to that in higher plants. This 5 S rRNA gene may therefore be co-transcribed with the 16 S and 23 S rRNAs, although this has not been established. Higher plant chloroplast 5 S rRNAs are reported to be independently transcribed (22,25). A potential promoter has been identified for tobacco chloroplast 5 S rRNA genes based on homology to procaryotic transcription signals (22).

We have examined the 23 S-5 S rDNA intergenic spacer for any possible clues to 5 S rRNA processing. A possible hairpin-loop secondary structure for a transcribed 5 S rRNA precursor, involving 8 bp and a 9-nucleotide loop, is located at positions -28 to -4 with respect to the 5’-end of the 5 S rRNA gene. Such a structure, with a calculated AG‘ upon folding of -6 kcal/mol, might have a role in 5 S rRNA maturation. There are no obvious clues to the rRNA operon transcription terminators in the DNA sequence 3”distal to the two 5 S rRNA genes.

Polymorphism in Euglena Chloroplast 5 S rRNA Genes- The major unexpected finding of this study was the discovery of significant polymorphism in the 5 S rRNA genes and 5 S rRNAs of two different Euglena chloroplast rRNA operons. To the best of our knowledge, there is no precedence for polymorphism in repeated chloroplast genes from other sources. The functional significance of different 5 S rRNAs, if any, is unknown. Repeated tRNA genes of higher plant chloroplast DNAs have previously been compared. However, both copies of the tRNAAs” of tobacco chloroplast DNA, and the tRNAIle of the spinach chloroplast genome, respectively, are found to be identical. Since chloroplast genomes are highly repeated within cells, in addition to polymorphism between repeated genes on the same chloroplast genome, one could also imagine polymorphism between genes on different ge- nomes in the same cell. Based on a Southern hybridization approach, no additional polymorphism could be detected in

the population of chloroplast DNA molecules not detected in the two sequenced 5 S rRNA genes. However, the sensitivity of this experiment was such that minor gene variants might not have been detected. At present, the only known variation within the population of chloroplast DNAs in E. gracilis 2 is in the “Z” band region, where length heterogeneity is found (35).

5 S rRNA gene polymorphism has previously been described for E. coli, Lactobacillus uiridescens, and Thermus thermophi- lus among procaryotes, and in the cytoplasm of Euglena, Neurospora, and Chlamydomonas among eucaryotes. It would be of interest to know if there is any evolutionary significance of such polymorphism, and whether variant 5 S rRNA genes are present in other organelle genomes.

Acknowledgments-We thank Jac Nickoloff for providing us with the oligonucleotide primer and Pat Gray for the cloning of pPGll and pPG2O. We also would like to thank Art Zaug and Kyle Tanner for their advice and assistance with the RNA sequencing and Norm Pace for suggesting the secondary structure depicted in Fig. 5, and to give special thanks to Margaret Hollingsworth for providing us with the Euglena RNA.

REFERENCES 1. Manning, J. E., Wolstenholme, D. R., Ryan, R. S., Hunter, J. A.,

and Richards, 0. C. (1971) Proc. Natl. Acad. Sci. U. S. A. 6 8 ,

2. Hallick, R. B. (1983) in The Biology of Euglena (Buetow, D., ed)

3. Gray, P. W., and Hallick, R. B. (1979) Biochim. Biophys. Acta

4. Rawson, J. R. Y., Kushner, S. R., Vapnek, D., Alton, N. K., and

5. Gray, P. W., and Hallick, R. B. (1978) Biochemistry 17,284-289 6. Kopecka, H., Crouse, E. J., and Stutz, E. (1977) Eur. J. Biochem.

7. Schwartzbach, S. D., Hecker, L. I., and Barnett, W. E. (1976)

8. McCrea, J. M., and Hershberger, C. L. (1976) Nucleic Acids Res.

9. Gruol, D. J., and Haselkorn, R. (1976) Biochim. Biophys. Acta

10. Orozco, E. M., Jr., and Hallick, R. B. (1982) J. Biol. Chem. 257 ,

11. Chelm, B. K., Gray, P. W., and Hallick, R. B. (1978) Biochemistry

12. Rawson, J. R. Y., Boerma, C. L., Andrews, W. H., and Wilkerson,

13. Orozco, E. M., Jr., Gray, P. W., and Hallick, R. B. (1980) J. Biol.

14. Orozco, E. M., Jr., Rushlow, K. E., Dodd, J. R., and Hallick, R.

15. Nomura, M., and Morgan, E. A. (1977) Annu. Reu. Genet. 11,

16. Gray, P. W., and Hallick, R. B. (1979) Biochemistry 18 , 1820-

17. Stiegler, G. L., Matthews, H. M., Bingham, S. E., and Hallick, R.

18. Gray, P. W. (1978) Ph.D. thesis, University of Colorado, Boulder 19. Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 6 5 ,

20. Sanger, F., Nicklen, S., and Coulsen, R. A. (1977) Proc. Natl.

21. Brosius, J., Dull, T. J., and Noller, H. F. (1980) Proc. Natl. Acad.

22. Takaiwa, F., and Sugiura, M. (1980) Mol. Gen. Genet. 1 8 0 , l - 4 23. Bowman, C. M., and Dyer, T. A. (1979) Biochem. J. 183, 605-

24. Wildeman, A. G., and Nazar, R. N. (1980) J. Biol. Chem. 255,

25. Edwards, K., Bedbrook, J., Dyer, T. A., and Kossel, H. (1981)

26. Whitfeld, P. R., Leaver, C. J., Bottomley, W., and Atchison, B.

1169-1173

Vol. 4, Academic Press, New York, in press

561,53-58

Boerma, C. L. (1978) Gene 3, 191-209

72,525-535

Proc. Natl. Acad. Sci. U. S. A. 73, 1984-1988

3,2005-2018

447,82-95

3258-3264

17,4239-4244

C. G. (1982) Biochemistry 20 , 2639-2644

Chem. 255,10991-10996

B. (1980) J. Biol. Chem. 255,10997-11003

297-347

1825

B. (1982) Nucleic Acids Res. 10, 3427-3444

499-560

Acad. Sci. U. S. A. 74, 5463-5467

Sci. U. S. A. 77,201-204

613

11896-11900

Biochem. Znt. 2,533-538

A. (1978) Biochem. J. 175, 1103-1112

by guest on Novem

ber 29, 2018http://w

ww

.jbc.org/D

ownloaded from

14796 Euglena Chloroplast 5 S rRNA Genes 27. MacKay, R. M. (1981) FEBS Lett. 123, 17-18 28. Machatt, M. A,, Ebel, J., and Branlant, C. (1981) Nucleic Acids

29. Glotz, C., Zwieb, C., Brimacombe, R., Edwards, K., and Kossel,

30. Noller, H. F., and Garrett, R. A. (1979) J. Mol. Biol. 132, 621-

31. Erdman, V. A., Huysmans, E., Vandenberghe, A., and De Wach-

32. Delihas, N., and Andersen, J. (1982) Nucleic Acids Res. 10,7324-

33. Donis-Keller, H., Maxam, A. M., and Gilbert, W. (1977) Nucleic

34. Rochaix, J.-D., and Darlix, J.-L. (1982) J. Mol. Biol. 159, 383-

35. Jenni, B., Fasnacht, M., and Stutz, E. (1981) FEBS Lett. 125,

Res. 9, 1533-1549

H. (1981) Nucleic Acids Res. 9,3287-3306

636

ter, R. (1983) Nucleic Acids Res. 11, r105-rl33

7345

Acids Res. 4, 2527-2538

395

175-179

36. Guerry, P., LeBlanc, D. J., and Falkow, S. (1973) J. Bacteriol.

37. Cohen, S. N., and Miller, C. A. (1970) J. Mol. Biol. 50,671-687 38. Dagert, M., and Ehrlich, S. D. (1979) Gene 9,23-28 39. Nickoloff, J. A., and Hallick, R. B. (1983) Nucleic Acids Res. 10,

40. Southern, E. M. (1975) J. Mol. Biol. 98, 503-517 41. Denhardt, D. T. (1966) Biochem. Biophys. Res. Commun. 23,

42. Hallick, R. B., Richards, 0. C., and Gray, P. W. (1982) in Methods in Chloroplast Molecular Biology (Edelman, M., Hallick, R. B., and Chua, N.-H., eds) pp. 281-293, Elsevier Biomedical Press, New York

43. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Labora- tory, NY

116,1064-1066

8191-8210

641-646

by guest on Novem

ber 29, 2018http://w

ww

.jbc.org/D

ownloaded from

G D Karabin, J O Narita, J R Dodd and R B Hallicksequence polymorphism in 5 S rRNA genes and 5 S rRNAs.

Euglena gracilis chloroplast ribosomal RNA transcription units. Nucleotide

1983, 258:14790-14796.J. Biol. Chem. 

  http://www.jbc.org/content/258/24/14790Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/258/24/14790.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on Novem

ber 29, 2018http://w

ww

.jbc.org/D

ownloaded from