MOLECULAR AND CELLULAR BIOLOGY, Nov. 1993, p. 7144-71520270-7306/93/117144-09$02.00/0Copyright X) 1993, American Society for Microbiology

The Murine ocB-Crystallin/Small Heat Shock ProteinEnhancer: Identification of oxBE-1, acBE-2, acBE-3,

and MRF Control Elements

Vol. 13, No. 11

RASHMI GOPAL-SRIVASTAVA AND JORAM PIATIGORSKY*Laboratory ofMolecular and Developmental Biology, National Eye Institute,

Bethesda, Maryland 20892

Received 22 April 1993/Returned for modification 7 July 1993/Accepted 18 August 1993

The murine aB-crystallin gene (a member of the small heat shock protein family) is expressed constitutivelyat high levels in the lens and at lower levels in many other tissues, including skeletal muscle. We have previouslyused the herpes simplex virus thymidine kinase promoter fused to the human growth hormone gene to identifyan acB-crystallin enhancer at positions -427 to -259 that has high activity in muscle and low activity in lenscell lines. In the study reported here, we performed DNase I footprinting, transfection, mutagenesis, andelectrophoretic mobility shift experiments using the murine C2C12 muscle and aeTN4-1 lens cell lines and therabbit N/N1003A lens cell line to identify sequences responsible for activity of this enhancer. Enhancer activityin both the muscle and lens cells was dependent on novel elements called afBE-1 (-407 to -397), oaBE-2 (-360to -327), and odBE-3 (-317 to -306). These elements were also weakly occupied by nuclear proteins in L929cells, which appear to express the cv.B-crystallin gene at a very low level (detectable only by the polymerasechain reaction). A fourth element containing a consensus muscle regulatory factor-binding site called MRF(-300 to -288) was occupied and used only by the C2C12 muscle cells. Cotransfection in NIH 3T3 cells andantibody-gel shift experiments using C2C12 nuclear extracts indicated that MyoD, myogenin, or a similarmember of this family can activate the cxB-crystallin enhancer by interaction with the MRF site. Takentogether, we conclude that the adBE-1, aBE-2, and aBE-3 elements are shared by both lens and muscle cells,but the MRF element is used only in muscle cells, providing the first example of a muscle-specific controlelement in a crystallin gene.

The optical properties of the transparent cellular eye lensdepend on a diverse group of globular proteins called crys-tallins. Crystallins comprise approximately 90% of the totalsoluble proteins of the vertebrate eye lens (3, 48). Theseinclude three dominant families of ubiquitously expressedcrystallins (a, 1B, and y) as well as a number of taxon-specificcrystallins found only in certain species (11, 38, 39). ot-Crys-tallin is composed of two single-copy gene products, aA-crystallin and oaB-crystallin. The two proteins share 55%sequence identity at the amino acid level (45) and aremembers of the small heat shock protein family (12, 22). TheaA-crystallin gene is expressed at very high levels in lens(15, 37, 46) and at much lower levels in rat spleen andthymus and is also detectable in other tissues and cell lines(26, 43). aB-crystallin is expressed abundantly in lens butalso occurs at significant levels in a variety of nonlenstissues, including heart, skeletal muscle, kidney, lung, brain,retina, and iris (1, 15, 23). aB-crystallin has been associatedwith a variety of pathological and experimental conditions,especially Alexander's disease (23), Lewy body disease (32),Creutzfeldt-Jakob disease (35), and Werner's syndrome (41)in humans and scrapie infection in hamsters (16). It has alsobeen demonstrated that aB-crystallin is induced by osmoticstress in cultured lens epithelial and glomerular endothelialcells (9) and by oncogene expression and heat shock in NIH3T3 cells (27-29). In addition, both aA- and oxB-crystallincan act as molecular chaperones (20).

Previous experiments demonstrated that a promoter frag-ment of the murine aoB-crystallin gene extending from posi-

* Corresponding author.

tions -661 to +44 linked to the bacterial chloramphenicolacetyltransferase gene shows preferential expression in lensand skeletal muscle in transgenic mice (14). Transfectionexperiments (14) revealed that a region between positions-426 and -257 is required for expression in the murineC2C12 (2) and G8 (7) cell lines, which differentiate intomyotubes upon cultivation. In association with a heterolo-gous promoter, the -427 to -259 sequence functions as astrong enhancer in C2C12 myotubes and less efficiently inthe N/N1003A (40) rabbit lens cell line (14).

In this study, we examined the murine aB-crystallin-427/-259 enhancer by DNase I footprinting, gel mobilityshift assays, site-directed mutagenesis, and transient trans-fection experiments. The results were compared by usingmurine muscle C2C12 cells, murine oxTN4-1 cells (which aresimian virus 40 T-antigen-transformed lens cells) (50),N/N1003A rabbit lens epithelial cells (40), and L929 fibro-blasts (17). The present data suggest the presence of aminimum of four cis-acting elements, at least one of whichcan be activated by binding MyoD and/or myogenin. Theseresults also indicate that activity of the aB-crystallin en-hancer in cultured cells from skeletal muscle and lensinvolves at least three of the same elements and one muscle-specific cis-acting element.

MATERIALS AND METHODS

Northern (RNA) analysis. Total RNA was isolated by usingRNAzol (Cinna/Biotecx) from C2C12 myotubes (2), aoTN4-1cells (50), and L929 fibroblasts (17), fractionated by electro-phoresis through a 1.5% agarose-formaldehyde gel, trans-ferred to nitrocellulose paper, and hybridized for 16 h in

7144

MURINE aB-CRYSTALLIN ENHANCER 7145

Nitrohybe (Digene, Silver Spring, Md.) to both a 230-bpmurine aB-crystallin exon 3-specific probe (14) and a 770-bp0-actin cDNA fragment (Oncor, Gaithersburg, Md.). Theintegrity of the RNA preparation was confirmed by ethidiumbromide staining and visualization of the rRNAs. The re-striction fragments were labeled to a specific activity of 5 x106 to 10 x 106 cpm with [ct-32P]dCTP by the randomoligonucleotide priming method (Bethesda Research Labo-ratories, Inc., Bethesda, Md.). The blot was hybridized with106 cpm of probe per ml, washed twice with 2x SSC (lxSSC is 0.15 M NaCl plus 0.015 M sodium citrate) at roomtemperature for 20 min, and exposed for autoradiography onKodak XAR5 film at -80°C with an intensifying screen for48 h.

Site-directed mutagenesis. A restriction fragment spanningpositions -427 to -259 of the murine aB-crystallin gene(with HindIlI linkers at both ends) was used as a source ofoaB-crystallin enhancer sequences. The restriction fragmentwas cloned into the HindIII site of bacteriophage M13mpl9.Mutations (MuA to MuT) were introduced into the enhancerby using the oligodeoxynucleotide-directed mutagenesismethod according to the protocol provided by the manufac-turer (site-directed mutagenesis kit, version 2; AmershamCorp., Arlington Heights, Ill.). Mutated restriction frag-ments were subcloned into plasmid pTKGH (Nichols Insti-tute, Capistrano, Calif.) at the unique HindIII site approxi-mately 15 bp upstream of the thymidine kinase (TK)promoter (pTKGH contains the human growth hormone[hGH] gene driven by the herpes simplex virus TK promot-er). All constructs were confirmed by sequencing the ligationjunctions and mutated regions, using Sequenase (U.S. Bio-chemical Corp., Cleveland, Ohio) and [a-35SJdATP (1,000Ci/mmol; Amersham).

Cell culture, transfection, and enzyme assays. RabbitN/N10003A (40) and mouse aTN4-1 lens cell lines werepropagated in Dulbecco's modified Eagle's medium(DMEM; GIBCO Laboratories, Grand Island, N.Y.) con-taining 10% fetal calf serum (regular medium) in 10% CO2.The murine muscle cell line C2C12 was maintained andtransfected as myoblasts by growth in DMEM plus 20% fetalbovine serum (proliferative medium) in 5% CO2. Myotubedifferentiation was induced with DMEM containing 5%horse serum (differentiating medium). All media contained50 ,ug of gentamicin per ml. The cells were propagated on60-mm-diameter plastic dishes. Four micrograms of the testplasmid and 2 ,ug of internal control plasmid pCMV,Bgal(containing the 0-galactosidase gene; Clontech, Palo Alto,Calif.) were cotransfected as calcium phosphate precipitates(14). Following DNA removal, lens cells were refed withregular medium and myoblasts were glycerol shocked for 1min in 15% glycerol-proliferative medium. After a recoveryperiod of 2 h in proliferative medium, myoblasts were refedwith differentiating medium. Approximately 53 h later, bothmyotubes and medium were collected separately. Lens cellsand medium were harvested 31 h after the transfection. Tocontrol for variations in transfection efficiencies, hGH levelswere normalized to ,B-galactosidase levels derived from thecontrol plasmid. hGH was measured in the medium by usinga commercially available radioimmunoassay kit (NicholsInstitute) as instructed by the manufacturer. 3-Galactosidaseactivities were determined as described previously (15).

Transactivation experiments were performed in NIH 3T3cells which were grown to 70% confluence before transfec-tion. Four micrograms of target plasmid containing theaB-crystallin enhancer (-427 to -259), driving hGH as areporter gene, and various amounts (2 to 10 ,ug) of pSVMD

or pSVMG (kindly provided by A. Buonanno, NationalInstitutes of Health, Bethesda, Md.) were cotransfected withpSVgal (containing the 3-galactosidase gene; Clontech) ascalcium phosphate precipitates as described by Dubin et al.(14). pSVMD was constructed by inserting 2.0 kbp of MyoDcDNA (10) at the EcoRI site of the expression vector pSVT7(33). Similarly, pSVMG was constructed by inserting 1.5 kbpof myogenin cDNA (49) at the EcoRI site of the expressionvector pSVT7. NIH 3T3 cells were propagated in regularmedium, with calf serum substituted for fetal calf serum.Following DNA removal, fibroblasts were glycerol shockedfor 1 min and refed with fresh regular medium containing calfserum. Cells and medium were collected 30 h after thetransfections. All transfection data represent the means ofthree experiments.

Nuclear extracts, gel mobility shift assays, and DNase Ifootprinting assays. Nuclear extracts were prepared fromC2C12 myotubes and myoblasts, aTN4-1 lens cells, andL929 cells as described by Dignam et al. (13) except that theammonium sulfate precipitation step was omitted. Comple-mentary oligonucleotides were synthesized (model 380Asynthesizer; Applied Biosystems) and annealed at a 1:1molar ratio as described previously (14). Double-strandedoligodeoxynucleotides were labeled on one strand, and gelmobility shift assays were performed as described previ-ously (14).DNase I footprinting analyses were performed by using a

KpnI-BamHI restriction fragment of plasmid pE92 (14),spanning positions -427 to -259 of the aB-crystallin en-hancer. pE92 was digested with BamHI, and the sensestrand was end labeled with [-y-32P]dATP (Amersham), usingT4 polynucleotide kinase. The radiolabeled DNA was di-gested with YpnI, electrophoresed on a 5% polyacrylamidegel, eluted overnight at 37°C into elution buffer (0.5 Mammonium acetate, 2 mM EDTA, 10% methanol), passedthrough a Centrex column (Schleicher & Schuell), extractedonce with phenol-chloroform, ethanol precipitated, and dis-solved in water. pE92 was digested with KpnI, and theantisense strand was end labeled with [.y-32P]ATP. DNase Ifootprinting reactions were conducted in a total volume of 25Ll, using 10,000 dpm of 32P-labeled DNA. Nuclear proteinswere incubated with the probe as described previously (15).The samples were incubated for 20 min at room temperatureto allow nuclear factors to bind, and the mixture wasdigested with appropriately diluted DNase I in water for 90 sat room temperature. DNase I digestions were terminated byaddition of an equal volume of buffer containing 0.3 Msodium chloride, 10 mM EDTA, and 50 ,ug of yeast tRNA.The DNA was extracted once with phenol-chloroform andtwice with chloroform, precipitated with ethanol, and ana-lyzed on 6% polyacrylamide-8 M urea sequencing gelsalongside the Maxam-Gilbert G+A reaction. The gels weredried and autoradiographed on Kodak XAR5 film at -80°C,using intensifying screens.

RESULTS

Northern blot hybridization of aB-crystallin mRNA. Priorto DNase I footprinting and transfection studies, C2C12,xTN4-1, and L929 cells were examined for the ability toaccumulate endogenous atB-crystallin RNA. The level ofxB-crystallin RNA varied with each cell type (Fig. 1).Northern blot hybridization showed that both lens (otTN4-1)and skeletal muscle (C2C12) cell lines derived from miceaccumulate aB-crystallin RNA (Fig. 1, lanes 1 to 4). Incontrast, the L929 mouse fibroblast cell line (Fig. 1, lanes 5

VOL. 13, 1993

7146 GOPAL-SRIVASTAVA AND PIATIGORSKY

0Z H- o

0 -j

Actin _ ... -.... *

(4B-Crystallin j ;3

1 2 3 4 5 6FIG. 1. Northern analysis of total RNA from C2C12, aTN4-1,

and L929 cells. Lanes: 1 and 2, 10 p,g of total RNA from C2C12myotubes; 3 and 4, 10 jig of total RNA from aTN4-1 cells; 5 and 6,10 jig of total RNA from L929 cells. aB-crystallin mRNA wasdetected by using a murine aB-crystallin exon 3-specific probe;1-actin was monitored by simultaneously hybridizing with a 770-bprandom-primed human 0-actin cDNA fragment.

and 6) did not have detectable amounts of aB-crystallinmRNA by Northern blot analysis, although low levels of aBmRNA were detected in these cells by polymerase chainreaction analysis (data not shown). The presence of actinhybridization in the Northern blots verified that the L929cells contained intact mRNA (Fig. 1). Hybridizations per-formed with individual probes in previous studies (14) haveconfirmed the identities of individual bands. The intermedi-ate band in the C2C12 myotubes hybridized exclusively withthe actin probe.DNase I footprint analysis of ctB-crystallin enhancer.

DNase I footprinting was used to identify putative cis-actingregulatory elements within the otB-crystallin enhancer (14).Figure 2A shows the DNase I-protected regions obtained byusing crude C2C12 (myotubes) and aTN4-1 nuclear extracts.Both extracts protected three distinct regions (called aBE-1,aBE-2, and aBE-3) of the aB-crystallin enhancer (open barsin Fig. 2; boxed regions in Fig. 3). The regions from -300 to-288 on the upper (sense) strand and -296 to -280 on thelower (antisense) strand, indicated by arrows in Fig. 2, wereprotected only by the C2C12 nuclear extract. This regioncontains an E box (8, 18) within the MRF-binding sitesequence (5, 6, 31, 36) (see Fig. 3).

Figure 2B compares DNase I footprints produced bycrude nuclear extracts derived from C2C12 (myotubes) andL929 cells. The footprints of aBE-1, aBE-2, and (xBE-3obtained with the extracts from the three cell lines weresimilar, although a much weaker footprint was obtained for6BE-2 and axBE-3 with the L929 extract. In addition, thedata indicate that only C2C12 cells contain one or morenuclear factors which specifically recognize the -300 to-288 region (MRF site) of the aoB-crystallin enhancer. Theresults of the footprinting data are summarized in the se-quence shown in Fig. 3. A consensus heat shock sequence(44) and AP-2-like sequence (21) present in the aB-crystallinenhancer are also indicated in Fig. 3.

Electrophoretic mobility shift assay with anti-MyoD and

antimyogenin monoclonal antibodies. Our footprinting exper-iments demonstrated that myotube nuclear extract preparedfrom C2C12 cells contained one or more factors that interactwith the otB-crystallin enhancer at the MRF site (-288 to-300). To determine whether these factors might be anti-genically related to MyoD or myogenin, which are bothexpressed in C2C12 cells, a 32P-labeled 24-bp oligomer(-307 to -282) containing the MRF site was incubated withC2C12 myotube nuclear extract plus an anti-mouse MyoD(gift of P. Houghton, St. Jude Children Research Hospital,Memphis, Tenn.) or anti-rat myogenin (gift of W. E. Wright,Southwestern Medical Center, Dallas, Tex.) monoclonalantibody. The monoclonal antibodies used in these studieswere generated against amino acids 180 to 190 of MyoD and144 to 158 of myogenin. Incubation of the myotube extractwith the oligomer gave two distinct complexes designated U(for upper) and L (for lower) (Fig. 4A, lane 2). Incubation ofthe anti-MyoD or anti-myogenin antibody with probe in theabsence of myotube nuclear extract did not produce aprotein-DNA complex (Fig. 4A, lanes 3 and 5). Preincuba-tion of the myotube nuclear extract with the anti-MyoDantibody resulted in the disappearance of the lower complex(Fig. 4A, lane 4), and preincubation of the antimyogeninantibody with the nuclear extract resulted in the formation ofa more slowly migrating supershifted complex (indicated byan arrow), with the concomitant disappearance of the uppercomplex (Fig. 4A, lane 6). Thus, the complexes detected inthe C2C12 nuclear extract appear antigenically related toMyoD and myogenin. In addition, a muscle creatine kinase(MCK) E-box oligodeoxynucleotide (5'CCAACACCTGCTGC3') (30) also competed for complex formation (Fig. 4B,lanes 3 and 4). Incubation of the oligonucleotide with C2C12myoblast nuclear extract also exhibited binding to the MRFsite (Fig. 4B, lane 2), although the complex formed migratedwith slightly different mobility which needs further investi-gation. Interestingly, the MCK E-box oligodeoxynucleotidecompeted for complex formation when incubated with thelabeled probe and myoblast nuclear extract (Fig. 4B, lane 1),consistent with the idea that the complex formed with theoligodeoxynucleotide containing the MRF site consists ofMyoD or related proteins.

Site-specific mutations of the aB-crystallin enhancer. Ourprevious analyses (14) coupled with the DNase I footprintsdescribed above have identified potential cis-acting regula-tory elements of the aB-crystallin enhancer. To correlatefootprints with the functional significance of these se-quences, we tested some site-specific and deletion mutationswithin the -427/-259 enhancer by transfection experiments.Mutations covering the axBE-1, aLBE-2, aBE-3, and MRFregions were introduced (Fig. 5). The mutated enhancerswere placed upstream of the herpes simplex virus TKpromoter and hGH gene and compared with the wild-typeenhancer for ability to direct expression of the reporter hGHgene in transfected C2C12 myoblasts, N/N1003A cells, andaTN4-1 cells. N/N1003A cells are derived from rabbit lensepithelial cells (40) and, unlike the murine aTN4-1 lens cells(50), are not transformed.The results in Fig. 6 are shown as secreted hGH levels in

the media of cells transfected with the test plasmid relativeto those obtained in cells transfected with the enhancerlessvector (pTKGH). The data were normalized with respect totransfection efficiency (see Materials and Methods). Thewild-type enhancer construct, pH64 (containing positions-427 to -259), directed approximately 20-times-higher hGHlevels in muscle C2C12 cells and about 7-times-higher hGHlevels in lens oaTN4-1 and N/N1003A cells than did the

MOL. CELL. BIOL.

MURINE aB-CRYSTALLIN ENHANCER 7147

7 C\

0a) Z N

G+A 5 6 7 85'

-420

- 395

_ - 360

-329

-319

B N

LLDZ~cm

+ nAi2 O4G+A 1 2 3 4

aiBE-1

aBE-2

coBE-3

3,

-288-300'n 306c0B E-3-317

-327

ceBE-2

T - 360

N@ z Cw Nlu.t0 -J 0

G+A 5 6 7 85,

-420aBE-1

-395

- 360

aBE-2

-329

-319

aBE-3

"usa: ~~-296 e 3-0£43S -37 j- -*j_3* * -296

xV aBE-1 t 397

maCe £^ _ 4-407 , - JBE-1-280z|*2 * l-280 * ^ * R * _407

Lii. * . ! i |:£80.a e .~~~~~~~~~~~~~~~~~~~~~~~~~~~~*~8..a I.,y; late a

UPPER STRAND LOWER STRANDUPPER STRAND 5 LOWER STRAND 3'

FIG. 2. In vitro DNase I footprinting of the murine axB-crystallin enhancer. Footprinting was performed with crude nuclear proteins fromC2C12 myotubes, L929 fibroblasts, and aTN4-1 lens cells. Upper-strand and lower-strand 5'-end-labeled probes (-427 to -259) wereincubated with nuclear proteins (12 ig) for 20 min and digested with DNase I. G+A lanes are Maxam-Gilbert G+A reactions. In panel A,lanes 1, 2, 5, and 6 contain free DNAs and lanes 3 and 7 contain DNAs incubated with aTN4-1 nuclear proteins; lanes 4 and 8 of panels Aand B contain DNAs incubated with C2C12 nuclear proteins; in panel B, lanes 1, 2, 5, and 6 contain free DNAs and lanes 3 and 7 containL929 nuclear proteins. Regions found protected from DNase I digestion are diagrammed, with their corresponding positions boxed andnumbered. The shaded box with arrow represents the DNase I-protected region unique to C2C12 cells.

control plasmid lacking an enhancer. The largest decrease inenhancer activity in the cell lines tested was caused by themutations of the sequences within the aBE-1, aBE-2, andotBE-3 regions. Most of these mutations targeted the Gresidues affected by methylation interference analysis (14).The mutations introduced produced similar although quan-titatively nonidentical effects in all cell lines that were tested.By contrast, mutations in the MRF consensus sequence(mutants MuN to MuQ) resulted in decreased hGH expres-sion only in the C2C12 cell line. Moreover, it is important tonote that mutations at the border of ctBE-2 (MuA and MuB),between otBE-2 and aoBE-3 (Mul and MuJ), at the 3' borderof aBE-3 (MuL), and between aBE-3 and MRF (MuM) hadlittle or no effect on enhancer activity. Thus, the sequencebetween -414 to -312 contributes to aB-crystallin tran-scription in both lens-derived and skeletal muscle-derivedcells, while the putative MRF site is important for aoB-crystallin transcription only in muscle-derived cells. Theseresults are consistent with the DNase I footprinting resultsand indicate that the MRF sequence is a distinct cis-actingregulatory element for skeletal muscle.MyoD and myogenin transactivation of the cvB-crystallin

aBE-1-427 - 407 - 397

CTAGGACTCCACAAAGAGTT]AATGTCCCTG-G GCTAAGCCTAGGAAGATTCCAGTCCCTGGATCCTG|AGGTGTTTCTCAATTACAGGGA_CCCCAGGGAC

-420 Heat Shock

aBE-2 caBE-3-360 - 327 -317

CCCAGGC|CCAAGATAGTTGCTGGCTCAATTCCCCTGGCATGICGAGACTGGAGGAGGAGGGGTCCGKGGTTCTATCAACGACCGAGTTAAGGGGACCGTIACGCTCTGAPCTCTCCTCCTC

AP-2 like - 330 -319

MRF-306 - 300 -288

G-aG3CCCAXYSO :;aRg&i¢GGATTCCAGGCTCCATCCTAGCTCCAGACCCGG TGGTC CGAGGTAGGATCGAGGTCT

-303 -296 -270

FIG. 3. Summary of in vitro DNase I footprinting. Regionsprotected from DNase I digestion are boxed. Footprints for C2C12,aTN4-1, and L929 nuclear proteins are shown in the open boxes forboth strands. The shaded box represents the unique region pro-tected by C2C12 nuclear proteins. Underlined regions show the heatshock, AP-2-like, and MRF sequences.

owii"4'ti

a . Aa A

VOL. 13, 1993

7148 GOPAL-SRIVASTAVA AND PIATIGORSKY

A.

AntibodyC2C12 Extract

U -m

LL

FIG. 4. Autoraiments indicatingtically related to Nnents of the bindirof labeled MRF I-307 to -282 ofthbinding reactionsi4, and 6) or no exti4), antimyogeninmobilities of freeF(U and L [upper ar(arrow) with antircated. (B) The binand 2) or myotubeE-box oligodeoxyrpetitor (lanes 1, 3,3) or a 50-fold excoxynucleotide ove

enhancer. We nenin can stimulaunder the contrcmyogenin are k

B. DNA motif CANNTG (4, 10, 42, 51). NIH 3T3 cells werea) a) Competitor used for these transactivation experiments (Fig. 7). As

cja 0O MCK E-Box expected, theaB-crystallin enhancer(plasmid pH64) was

,,', O @ 0 inactive in the transfected NIH 3T3 cells. Cotransfection ofD MyoD and myogenin expression constructs pSVMD and

t - C2C12 ExtractE Ei i - pSVMG activated transcription from the hGH reporter genein NIH 3T3 cells (Fig. 7). By contrast, the enhancerlessplasmid pTKGH was not transactivated by cotransfection

pwrs with the MyoD or myogenin expression plasmid (not

J IF V x ~ shown). The extent of transactivation of the aB-crystallinenhancer by MyoD and myogenin (five- and threefold,respectively, relative to the pTKGH control) was five- tosevenfold lower than the activity of this enhancer in C2C12cells (Fig. 6). This finding suggests that other factors inC2C12 cells are also utilized for full activation of theotB-crystallin enhancer.

2 3 456 1 2 3 456 Todetermine whethertheEbox(CAGCTGsequence [5,diograms of electrophoretic mobility shift exper- 6, 8, 17, 31, 36]) present in theaB-crystallin enhancer is

thatC2C12myotube nuclearproteins are antigen- responsible for the MyoD and myogenin transactivationlyoD, myogenin, and related proteins. Compo- results, we tested enhancer mutations MuN to MuQ (Fig. 5ig reactions are indicated above the lanes; 0.1 ng and 7). These mutations essentially eliminated transactiva-tinding site oligonucleotide containing positions an byThe tansfetediMy min plasmiva-ie otB-crystallin gene (all lanes) was used. (A) The tion by the transfected MyoD and myogenin plasmids inncluded C2C12 myotube nuclear extracts (lanes 2, NIH 3T3 cells (Fig. 7, columns 13 to 18), consistent withract (lanes 3 and 5) plus anti-MyoD antibody (lane their strong negative effects on the activity of the otB-antibody (lane 6), or no antibody (lane 2). The crystallin enhancer in transfected C2C12 cells (Fig. 6).)robe (F), probe complexed with nuclear proteins Taken together, the footprinting, transfection, and transac-nd lower]), and probe in the supershifted complex tivation experiments indicate that MyoD and myogenin bindmyogenin (lane 6) and nuclear protein areindi- the E box at the MRF site and enhance transcription of theding reactions included C2C12 myoblast (lanes 1 reportgenhenuclear extract (lanes 3, 4, and 5) plus an MCK reporter gene.nucleotide (5'CCAACACCTGCTGC3') as a com- Gel mobility shift experiments. Gel mobility shift competi-and 4). There was a 100-fold excess (lanes 1 and tion assays were conducted to test whether the reductions in-ess (lane 4) of the unlabeled competitor oligode- functional activity of the enhancer by the site-specific muta-rlabeled oligodeoxynucleotide. tions could be correlated with a corresponding loss in ability

to bind nuclear factors from C2C12 cells. Double-strandedoligodeoxynucleotides composed of the aB-crystallin en-

axt investigated whether MyoD and myoge- hancer sequences between positions -426 and -371 (oli-te transcription of an hGH reporter gene godeoxynucleotide El containing the aBE-1 region), be-1 of theaB-crystallin enhancer. MyoD and tween positions -370 and -315 (oligodeoxynucleotide E2nown to activate enhancers containing the containing theaBE-2 region), and between positions -314

aBE-1-407 -397

-420 -397

El - 370

caBE-2- 360 - 327

1

-360 - 329

E2AP-2 Like

caBE-3-317 -3061 3

319 -303

-314

MRF-300 -288

-296 -280

E3MRF

MG GG

immrif

MuKl

FIG. 5. Site-directed mutagenesis of the aB-crystallin enhancer. Point and deletion (shown by A) mutations are indicated below thesequence. Regions found protected from DNase I digestion are represented with open boxes above the sequence. El, E2, and E3 refer to theregions used for the electrophoretic mobility shift experiments in Fig. 8. Solid and open circles indicate guanosines whose methylationinterfered with complex formation with one or more C2C12 myotube nuclear factors (14).

MOL. CELL. BIOL.

MURINE otB-CRYSTALLIN ENHANCER 7149

257

,, 20

I 15-

a 10-IDlo0ca:rc

co

0,-J

0)

a1)cc

03)-J

ImC!,a,

10 rC2C12

I I i il

8

-5

ICD

.5

[ pH 64 +

I increasing MyoD

6 _

2 _

Ei'i

8- aTN4-17n6-5-4-3-

2- k~L

0

Target

1. pH64 )wt)2. pH64 )wt)3. pH64 )wt)4. pH64 (wt)

5. pH64 )wt)6. pH64 )wt)7. pH64 )wt)8. pH64 )wt)9. pH64 )wt)

10. pH64 )wt)11. pH64 )wt)12. pH64 )wt)13. Mu N

14. Mu O

15. Mu P

16. Mu Q

17. Mu P

18. Mu Q

aBE-1 aBE-2 aBE-3 MRF

FIG. 6. Transfection studies of the aB-crystallin enhancer inC2C12 myoblasts and in aTN4-1 and N/N1003A lens cells. hGHlevels (± standard deviations) are presented relative to the levelsproduced by the parental plasmid, pTKGH. ND, not done.

and -258 (oligodeoxynucleotide E3 containing part ofaBE-3 and the MRF regions) (Fig. 5) produced retardedbands with different mobilities when incubated with theC2C12 myotube nuclear extract (Fig. 8A). Complex forma-tion by oligonucleotides El, E2, and E3 was severelyreduced by self-competition (Fig. 8A, lanes 3, 9, and 25).Mutated El, E2, and E3 sequences that decreased or abol-ished aB-crystallin enhancer activity in the transfectionexperiments (Fig. 6) did not compete for complex formationwith the corresponding wild-type oligodeoxynucleotide (Fig.8A, lanes 4 to 6, 10 to 18, and 21 to 24); by contrast, mutationMuL, which did not alter enhancer activity, competedefficiently (Fig. 8A, lane 20). These results provide a positivecorrelation between protein-DNA complex formation andenhancer activity for the aBE-1, aBE-2, aBE-3, and MRF

-1-

x 's +CDhexCLCL

[I

.-

pH64 +increasingMyogenin +

0

0 h~~~E3-Mutants +MyoD Myogenin

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

Driver

MyoD (2 jAg)

MyoD 13 jAg)

MyoD 14 jAg)

MyoD (5 jAg)

MyoD (8 jAg)MyoD 110 jAg)

Myogenin (2 jig)Myogenin 13 jig)Myogenin 14 jAg)Myogenin (5 jg)MyoD + Myogenin (2 jg)MyoD 110jg)MyoD (10jig)MyoD (10 jg)MyoD (10 jig)Myogenin 110 jig)Myogenin 110 ig)

Mutation in E Box(CAGCTG)

TGGCTGCAGCCATGGCCAACAGCTG

TGGCCAACAGCTG

Relative hGHLevel

1.16 ± 0.20

2.79 _ 0.20

3.66 ± 0.28

4.30 i 0.10

5.43 ± 0.64

5.61 ± 0.25

5.93 ± 0.52

3.30 i 0.31

2.50 ± 0.57

3.16 i 0.28

3.10 i 0.99

5.13 i 0.72

1.50 ± 0.461.35 ± 0.561.59 ± 0.50

1.47 ± 0.281.52 i 0.64

1.7 i 0.84

FIG. 7. Transactivation of the aB-crystallin enhancer in NIH3T3 cells cotransfected with plasmids encoding MyoD and myoge-nin. hGH levels (± standard deviations) are presented relative to thelevels produced by the parental plasmid, pTKGH. Numbers underthe bars correspond to the numbers in the table. wt, wild type.

elements. For oligodeoxynucleotide E3, both MRF (-300 to-288) and aBE-3 (-319 to -303) wild-type oligodeoxynu-cleotides competed for complex formation (Fig. 8B, lanes 1and 2) when incubated with C2C12 myotube nuclear extract.As mentioned above, competitions using oligodeoxynucle-otides containing mutations in either the aBE-3 or MRF sitedid not alter the gel shift pattern of oligodeoxynucleotide E3.These competition experiments suggest that oligodeoxynu-cleotide E3 forms a complex with C2C12 nuclear proteinsconsisting of at least two interacting components.

DISCUSSION

Results of the DNase I footprinting experiments describedabove are consistent with the existence of at least fourregulatory sites (called here aBE-1, aBE-2, aBE-3, andMRF) within the previously identified enhancer of the aB-crystallin gene (14). aBE-2 is similar to the C2C12 nuclearprotein-binding sequence detected earlier by methylationinterference footprinting (14). As with the murine aA-crys-tallin gene (25), the putative regulatory sequences are alsooccupied, at least weakly, by nuclear proteins from L929cells, which showed no aB-crystallin mRNA by Northernblot hybridization. Polymerase chain reaction experiments,

I II tt.L.L

VOL. 13, 1993

I

4 _

_-

I-

7150 GOPAL-SRIVASTAVA AND PIATIGORSKY

A.C2C12 Extract -- + + + + +

Competitor

Probe

C-

n uz :3El 2 2 2

El~~~~~~~~~~~~~~~~~~~~~~~~~~~I

< 0 0 L 5C I--_Z) = 3 M n3

E2 2 2 2 2 2 2

E2

-J Z 0 CL O2 2 2 2 2 2 E3 -- --

E3

B.C2C12 Extract -±+ -

Cp1trCompetitor 2 - - -

Probe E3

0

C-_ . _

_C- d

1 2 3 4 5 6 F--a sA

7 8 9 10 11 12 13 14 15 16 17 18

F---19 20 21 22 23 24 25 26 27

FIG. 8. Gel shift and competition analyses of protein-DNA interactions between nuclear extracts of C2C12 myotubes and oligodeoxy-nucleotides El, E2, and E3. (A) The labeled oligodeoxynucleotides El (-426 to -371; lanes 1 to 6), E2 (-370 to -315; lanes 7 to 18), andE3 (-314 to -258; lanes 19 to 27) were incubated in the presence of C2C12 myotube nuclear extract. Gel shift assays with oligodeoxynu-cleotides El, E2, and E3 (lanes 1 to 6, 7 to 18, and 19 to 27, respectively) were performed on different gels and do not reflect equal mobilityof the complexes. There was a 100-fold excess of the unlabeled competitor oligodeoxynucleotide over labeled El, E2, or E3. Free (F) andprotein-complexed (C) species were resolved by 5% polyacrylamide gel electrophoresis, and competitions were performed with unlabeleddouble-stranded oligodeoxynucleotide (El in lane 3, E2 in lane 9, and E3 in lane 25) or mutated versions of oligodeoxynucleotide El (lanes4 to 6), E2 (lanes 10 to 18), and E3 (lanes 19 to 24). Mutants (MuA to MuT) are shown in Fig. 5. (B) The labeled oligodeoxynucleotide E3(-314 to -258) was incubated in the presence of C2C12 myotube nuclear extract. There was a 100-fold excess of the unlabeled competitoroligodeoxynucleotide over labeled E3. Competitions were performed with wild-type unlabeled double-stranded oligodeoxynucleotide (MRF[-300 to -288] in lane 1 and aBE-3 [-319 to -303] in lane 2).

however, indicated that low levels of aB-crystallin mRNAsequences are present in L929 cells, providing a possiblerationale for the presence of the putative transcription fac-tors binding these sequences. We cannot determine from thepresent data whether the proteins (or their cofactors) occu-pying the aBE-1, aBE-2, and aBE-3 sites are the same inC2C12, aTN4-1, and L929 cells.The atB-crystallin enhancer studied in this investigation

uses the aBE-1, otBE-2, and otBE-3 elements for activity inthe C2C12, aTN4-1, and N/N1003A cell lines, consistentwith this enhancer having the ability to function in bothcultured muscle and lens cells (14). Although the function ofthese regulatory sequences in the aTN4-1 murine lens epi-thelial cells could be attributed to the fact that these cells aretransformed with simian virus 40 T antigen (50), this is notthe case with their function in N/N1003A rabbit lens epithe-lial cells, which are not transformed (40). In contrast to theaBE-1, atBE-2, and aBE-3 sequences, the MRF site of theoaB-crystallin enhancer is used only in the muscle cells andprobably accounts for the greater efficiency of the enhancerin transfected C2C12 myotubes than in transfected aTN4-1or N/N1003A lens cells (14). The present site-specific muta-tions identifying functional elements in the otB-crystallinenhancer correlate well with the loss of the ability of theseputative regulatory elements to bind nuclear proteins in thegel mobility shift assays, consistent with the bound factorsbeing positive transcription factors (34).The experiments presented above show that both MyoD

and myogenin can transcriptionally activate the TK pro-moter fused to the aB-crystallin enhancer in cotransfectedNIH 3T3 cells. Our mutagenesis experiments show that thisactivation is dependent upon the E-box sequence (5, 6, 8, 18,31, 36) within the MRF site. It has been demonstrated intransfection experiments that at least two MyoD bindingsites (MRF sites, minimally defined as CANNTG) must bepresent to activate a promoter/reporter gene construct inC3H/10T1/2 cells (47). The fact that a single copy of the MRFsite in the oB-crystallin enhancer was effective in our

transfection experiments suggests that it is interacting withone or more of the other regulatory elements within theconstruct, possibly those within the oB-crystallin enhanceritself. Further experiments are necessary to characterize themyogenic C2C12 nuclear factors which complex with theacB-crystallin MRF sequence. In addition, it will be interest-ing to determine whether use of the MRF sequence isconfined to skeletal muscle cells or extends to any other celltypes which express the oxB-crystallin gene (1, 15, 23, 24).We have provided evidence that three (aBE-1, a-BE-2, and

aBE-3) cis-acting elements are shared for strong muscle andweak lens activity of the aB-crystallin enhancer in trans-fected C2C12 muscle and aTN4-1 or N/N1003A lens celllines and that one cis element (MRF site) is essential for theactivity of the enhancer in the muscle cells. Furthermore,the cotransfection, footprinting, mutagenesis, and antibodyexperiments indicate that MyoD, myogenin, or other mem-bers of this family of transcription factors are critical for theactivity of the aoB-crystallin enhancer in muscle. Finally,footprinting and transgenic mouse experiments indicate thatother sequences (-147 to -118) downstream of the -426/-257 enhancer are critical for the lens-specific expression ofthe aB-crystallin gene (reference 19 and unpublished data),consistent with the idea that regulation of the aLB-crystallingene in lens and muscle involves both shared and tissue-specific control elements.

ACKNOWLEDGMENTS

We thank A. Buonanno for providing the expression vectorspSVMD and pSVMG and A. Cvekl for providing L929 nuclearextract. Mouse monoclonal antibody to MyoD and anti-rat myoge-nin monoclonal antibody were kind gifts from P. Houghton (St. JudeChildren Research Hospital) and W. E. Wright (SouthwesternMedical Center, Dallas), respectively. We are grateful to C. M. Sax,M. Kantorow, and A. Cvekl for helpful suggestions and to J. Bradyand C. M. Sax for critically reading the manuscript.This work was done while R. Gopal-Srivastava held a National

Research Council (LMDB/NEI) Research Associateship.

iIA

MOL. CELL. BIOL.

MURINE aB-CRYSTALLIN ENHANCER 7151

REFERENCES

1. Bhat, S. P., and C. N. Nagineni. 1989. Alpha B subunit oflens-specific protein a-crystallin is present in other ocular andnon-ocular tissues. Biochem. Biophys. Res. Commun. 158:319-325.

2. Blau, H. M., C. Choy-Ink, and C. Webster. 1983. Cytoplasmicactivation of human nuclear genes in stable heterocaryons. Cell32:1171-1180.

3. Bloemendal, H., and W. W. de Jong. 1991. Lens proteins andtheir genes. Prog. Nucleic Acid Res. Mol. Biol. 41:259-281.

4. Brennan, T. J., D. G. Edmondson, and E. N. Olson. 1990.Aberrant regulation of MyoD contributes to the partially defec-tive myogenic phenotype of BC3H1 cells. J. Cell Biol. 110:929-937.

5. Brennan, T. J., and E. N. Olson. 1991. Myogenin resides in thenucleus and acquires high affinity for a conserved enhancer ofheterodimerization. Genes Dev. 4:582-595.

6. Buskin, J. N., and S. D. Hauschka. 1989. Identification of a

myocyte nuclear factor which binds to a muscle specific en-

hancer of the mouse muscle creatine kinase gene. EMBO J.8:701-709.

7. Christian, C. N., P. G. Nelson, J. Peacock, and M. Nirenberg.1977. Synapse formation between two clonal cell lines. Science196:995-998.

8. Church, G. M., A. Ephrussi, W. Gilbert, and S. Tonegawa. 1985.Cell type specific contacts to immunoglobulin enhancers innuclei. Nature (London) 313:798-801.

9. Dasgupta, S., T. C. Hohman, and D. Carper. 1992. Hypertonicstress induces aB-crystallin expression. Exp. Eye Res. 54:461-470.

10. Davis, R. L., P. F. Cheng, A. B. Lassar, and H. Weintraub. 1990.The MyoD binding domain contains a recognition code formuscle-specific gene activation. Cell 60:733-746.

11. de Jong, W. W., W. Hendriks, W. M. Mulders, and H. Bloemen-dal. 1989. Evolution of eye lens crystallins: the stress connec-

tion. Trends. Biochem. Sci. 14:365-368.12. de Jong, W. W., J. A. M. Leuninsen, and C. E. M. Voorter.

1993. Evolution of the a-crystallin/small heat shock proteinfamily. Mol. Biol. Evol. 10:103-126.

13. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983.Accurate transcription initiation by RNA polymerase II in a

soluble extract from isolated mammalian nuclei. Nucleic AcidsRes. 11:1475-1489.

14. Dubin, R. A., R. Gopal-Srivastava, E. F. Wawrousek, and J.Piatigorsky. 1991. Expression of murine aB-crystallin gene inlens and skeletal muscle: identification of a muscle-preferredenhancer. Mol. Cell. Biol. 9:4340-4349.

15. Dubin, R. A., E. F. Wawrousek, and J. Piatigorsky. 1989.Expression of the murine aB-crystallin gene is not restricted tothe lens. Mol. Cell. Biol. 9:1083-1091.

16. Duguid, J. R., R. G. Rohwer, and B. Seed. 1988. Isolation ofcDNAs of scrapie-modulated RNAs by subtractive hybridiza-tion of a cDNA library. Proc. Natl. Acad. Sci. USA 85:5738-5742.

17. Earle, W. R., E. L. Schilling, T. H. Stark, N. P. Straus, M. F.Brown, and E. Shelton. 1943. Production of malignancy in vitro.The mouse fibroblast cultures and changes seen in the livingcells. J. Natl. Cancer Inst. 4:165-212.

18. Ephrussi, A., G. M. Church, S. Tonegawa, and W. Gilbert. 1985.B-lineage specific interaction of an immunoglobulin enhancerwith cellular factors in vivo. Science 227:134-140.

19. Gopal-Srivastava, R., and J. Piatigorsky. 1993. Functional anal-ysis of murine aB-crystallin enhancer. Invest. Ophthalmol.Visual Sci. 34:1456.

20. Horwitz, J. 1992. a-Crystallin can function as a molecularchaperone. Proc. Natl. Acad. Sci. USA 89:10449-10453.

21. Imagawa, M., R. Chiu, and M. Karin. 1987. Transcription factorAP-2 mediates induction by two different signal-transductionpathways: protein kinase C and cAMP. Cell 51:251-260.

22. Ingolia, T. D., and E. A. Craig. 1982. Four small Drosophilaheat shock proteins are related to each other and to mammaliana-crystallins. Proc. Natl. Acad. Sci. USA 79:2360-2364.

23. Iwaki, T., A. Kume-Iwaki, and J. E. Goldman. 1990. Cellular

distribution of aB-crystallin in non lenticular tissues. J. His-tochem. Cytochem. 38:31-39.

24. Iwaki, T., A. Kume-Iwaki, R. K. Liem, and J. E. Goldman. 1989.aB-crystallin is expressed in non lenticular tissues and accumu-lates in Alexander's disease brain. Cell 57:71-78.

25. Kantorow, M., A. Cvekl, C. M. Sax, and J. Piatigorsky. 1993.Protein-DNA interactions of the mouse aA-crystallin controlregions: differences between expressing and non-expressingcells. J. Mol. Biol. 230:425-435.

26. Kato, K., H. Shinohara, N. Kurobe, S. Goto, Y. Inaguma, and K.Ohshima. 1991. Immunoreactive aA-crystallin in rat nonlentic-ular tissues detected with a sensitive immunoassay method.Biochim. Biophys. Acta 1080:173-180.

27. Klemenz, R., E. Frohli, A. Aoyama, S. Hoffmann, R. J. Simpson,R. L. Moritz, and R. Shafer. 1991. aB-crystallin accumulation isa specific response to Ha-ras and v-mos oncogene expression inmouse NIH 3T3 fibroblasts. Mol. Cell. Biol. 11:803-812.

28. Klemenz, R., E. FrohHl, R. H. Steiger, R. Schafer, and A.Aoyama. 1991. aB-crystallin is a small heat shock protein. Proc.Natl. Acad. Sci. USA 88:3652-3656.

29. Klemenz, R., S. Hoffman, R. Jaggi, and A. K. Werenskiold.1989. The v-mos and c-Ha-ras oncoproteins exert similar effectson the pattern of protein synthesis. Oncogene 4:799-803.

30. Lassar, A. B., J. N. Buskin, D. Lockshon, R. L. Davis, S. Apone,S. D. Hauschka, and H. Weintraub. 1989. MyoD is a sequencespecific DNA binding protein requiring a region of myc homol-ogy to bind to the muscle creatine kinase enhancer. Cell58:823-831.

31. Lin, H., K. E. Yutzey, and G. M. Rubin. 1991. Muscle-specificexpression of the troponin I gene requires interaction betweenhelix-loop-helix muscle regulatory factors and ubiquitous tran-scription factors. Mol. Cell. Biol. 11:267-280.

32. Lowe, J., M. Landon, I. Pike, I. Spendlove, H. McDermott, andR. J. Mayer. 1990. Dementia with ,B-amyloid deposition: in-volvement of aB-crystallin supports two main diseases. Lancet336:515-516.

33. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1989. Molecularcloning: a laboratory manual, 2nd ed., p. 16.21. Cold SpringHarbor Laboratory, Cold Spring Harbor, N.Y.

34. Mitchell, P. J., and R. Tjian. 1989. Transcriptional regulation inmammalian cells by sequence specific DNA binding proteins.Science 245:371-378.

35. Murano, S., R. Thweatt, R. J. Shmookler Reis, R. A. Jones, E. J.Moerman, and S. Goldstein. 1991. Diverse gene sequences areoverexpressed in Werner syndrome fibroblasts undergoing pre-mature replicative senescence. Mol. Cell. Biol. 11:3905-3914.

36. Murre, C., P. S. McCaw, H. Vaessin, M. Caudy, L. Y. Jan, J. N.Bushkin, D. Hauschka, A. B. Lassar, H. Weintraub, and D.Baltimore. 1989. Interaction between heterologous helix-loop-helix proteins generate complexes that bind specifically to acommon DNA sequence. Cell 58:537-544.

37. Overbeek, P. A., A. B. Chepelinsky, J. S. Khillan, J. Piatigorsky,and H. Westphal. 1985. Lens specific expression and develop-mental regulation of the bacterial chloramphenicol acetyl trans-ferase gene driven by the murine aA-crystallin promoter intransgenic mice. Proc. Natl. Acad. Sci. USA 82:7815-7819.

38. Piatigorsky, J. 1992. Lens crystallins: innovations associatedwith changes in gene regulation. J. Biol. Chem. 67:4277-4280.

39. Piatigorsky, J., and G. Wistow. 1989. Enzyme/crystallins: genesharing as an evolutionary strategy. Cell 57:197-199.

40. Reddan, J. R., A. B. Chepelinsky, D. C. Dziedzic, J. Piatigorsky,and E. M. Goldenberg. 1986. Retention of lens specificity in longterm cultures of diploid rabbit lens epithelial cells. Differentia-tion 33:168-174.

41. Renkawek, K., W. W. de Jong, K. B. Merck, C. W. G. M.Frenfen, F. P. A. van Workum, and G. J. C. G. M. Bosman.1992. aB crystallin is present in reactive glia in CreutzfeldtJacob disease. Acta Neuropathol. 83:324-327.

42. Rosenthal, N., E. B. Berglund, B. M. Wentworth, M. Donoghue,B. Winter, E. Bober, T. Brown, and H. H. Arnold. 1990. Ahighly conserved enhancer downstream of the human HLC1/3locus is a target for multiple myogenic determination factors.Nucleic Acids Res. 18:6239-6246.

VOL. 13, 1993

7152 GOPAL-SRIVASTAVA AND PIATIGORSKY

43. Srinivasan, A. N., C. N. Nagineni, and S. P. Bhat. 1992.aA-crystallin is expressed in non-ocular tissues. J. Biol. Chem..267:23337-23341.

44. Tanguay, R. M. 1988. Transcriptional activation of heat shockgenes in eukaryotes. Biochem. Cell Biol. 66:584-593.

45. van der Ouderaa, F. J., W. W. de Jong, A. Helderink, and H.Bloemendal. 1974. The amino acid sequence of the alpha B2chain of bovine a-crystallin. Eur. J. Biochem. 49:157-168.

46. Wawrousek, E. F., A. B. Chepelinsky, J. B. McDermott, and J.Piatigorsky. 1990. Regulation of the murine aA-crystallin pro-moter in transgenic mouse. Dev. Biol. 137:68-76.

47. Weintraub, H., R. Davis, D. Lockshon, and A. Lassar. 1991.MyoD binds cooperatively to two sites in a target enhancersequence: occupancy of two sites is required for activation.

MOL. CELL. BIOL.

Proc. Natl. Acad. Sci. USA 87:5623-5627.48. Wistow, G., and J. Piatigorsky. 1988. The lens crystallins:

evolution and expression of proteins for a highly specializedtissue. Annu. Rev. Biochem. 57:479-504.

49. Wright, W. E., D. A. Sassoon, and V. K. Lin. 1989. Myogenin,a factor regulating myogene, has a domain homologous toMyoD. Cell 58:607-617.

50. Yamada, T., T. Nakamura, H. Westphal, and P. Russell. 1989.Synthesis of a-crystallin by a cell line derived from a lens of atransgenic animal. Curr. Eye Res. 9:31-37.

51. Yutzey, K. E., S. J. Rhodes, and S. F. Conieczny. 1990. Differ-ential trans activation associated with mouse regulatory factorsMyoDl, myogenin and MRF4. Mol. Cell. Biol. 10:3934-3944.