The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic...

The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic Y-STR analysis

Sascha Willuweit & Lutz Roewer

Institut für Rechtsmedizin und Forensische WissenschaftenCharité – Universitätsmedizin Berlin

2000 2004 2008

2014©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Workshop schedule2015, September 1st, 2:30 pm – 6:30 pm

• Different frequency estimation methods implemented in the YHRD

• Mixture analysis using the YHRD• Kinship analysis using the YHRD• Ancestry information retrievable from YHRD• Subpopulation analysis (AMOVA) using YHRD• Discussion of casework examples

©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

YHRD - Increasing numbers

Frequency estimation


Frequency estimation methods

Constant estimators

• Augmented counting (1/n+1)

• Counting with database inflation (Brenner‘s κ)

Variable estimators

• Surveying method (Krawczak)• Coalescence based estimation

(Caliebe)• Discrete Laplace method

(Andersen)


Enabled in YHRD

Frequency estimation for Y-STR profiles



23 loci

17 loci

9 loci

Frequency estimation for rare haplotypes with „Kappa inflation“(0 observations)

Count Singletons with kappa


19.593

71.246 55.675 3.0 x 10-6

19.593 n.a.

125.700 30.450 6.0 x 10-6

K=0.78

K=0.24

(1.4 x 10-5)*

(7.9 x 10-6)*

* counting

1N

1)hS|hT(P̂ 00

k- proportion of singletons estimator of the proportion of not sampled rare haplotypes in the database


Comparison of estimators for rare haplotypes

Discrete Laplace vs. counting, kappa and surveying methods using a simulated population of 1 million, with a database size of 1000 and a kappa proportion of singletons of =0.864


Courtesy of M.M. Andersen (Copenhagen)

Fig. 1 Comparison of (1) the relative frequency of a haplotype (number of times it has been observed divided by the database size) and (2) the estimated haplotype frequency using the discrete Laplace method. Note, that for frequently observed haplotypes, t...

Mikkel Meyer Andersen , Poul Svante Eriksen , Niels Morling

Cluster analysis of European Y-chromosomal STR haplotypes using the discrete Laplace method

Forensic Science International: Genetics, Volume 11, 2014, 182 - 194


Interpretation tools implemented in YHRD

• Mixture analysis (Frequency and LR based)• Kinship calculation (Frequency and LR based)• Population substructure (AMOVA, Fst/Rst, MDS) • Ancestry information (AI)


Mixture analysis


• male mixture (major, minor component)• only component♀

• no admixture in AMELOGENIN♂

Autosomal analysis Y chromosomal analysis

Casework exampleDelict: sexual assault

Evidence: contact stain on clothing


Analyse with Mixture analysis tool (partial Y23 profiles)


Result for PowerPlex Y23 (20 loci)


Reanalysis using reduced PPY12 profiles


Result for PowerPlex Y12 (10 loci)


Reanalysis using further reduced 9-locus minHt profiles


Result for minHt (7 loci)


Kinship


The Y chromosom - a linearly inherited, haploid marker system


For which cases?


Likelihood Calculation (LR) / Brotherhood (Probability for observing the haplotypes given same fathers vs. probability for

observing the haplotypes given different fathers)

L (X) = µ/2 x [f(A) + f(B)]L (Y) = f(A) x f(B)

µ = mutation ratef = haplotype frequency (YHRD)

• Locus-spezific µ for one-step-mutations, see YHRD• For the X hypothesis for each locus the probability of „non-mutation“ (1- µ) is also considered• Rolf et al. (Int J. Legal Med. 2001); Buckleton et al. (CRC Press, 2005)

A B

Same ordifferent fathers?


Brothers?

Related: L(X) = 1.4 x 10-4 x 1 x µ/2 + 2.3 x 10-5 x 1 x µ/2 = 2.9 x 10-7

Unrelated: L(Y) = 1.4 x 10-4 x 2.3 x 10-5 = 3.2 x 10-9

LR (X/Y) = 91

14, 13, 31, 24, 11, 13, 14, 11-11, 14, 13

14, 13, 31, 25, 11, 13, 14, 11-11, 14, 13

µ = 3.6 x 10-3 *

f B = 2.3 x10-5*

Meioses * YHRD

f A = 1.4 x 10-4*

A B

Same ordifferent fathers ?


L(X) = 1.4 x 10-4 x 1 x µ/2 = 1.5 x 10-7

L(Y) = 1.4 x 10-4 x 2.3 x 10-5 = 3.2 x 10-9

LR (X/Y) = 46.8

14, 13, 31, 24, 11, 13, 14, 11-11, 14, 13

14, 13, 31, 24, 11, 14, 14, 11-11, 14, 13

µ = 2.1 x 10-3 (moderate)*

f B = 1.4 x 10-4*

f A = 2.3 x10-5*

* YHRD

B

A

Father – son or unrelated ?

Influence of the local mutation rate on LR


L(X) = 1.4 x 10-4 x 1 x µ/2 = 8.4 x 10-7

L(Y) = 1.4 x 10-4 x 2.3 x 10-5 = 3.2 x 10-9

LR (X/Y) = 262.5

14, 13, 30, 24, 11, 13, 14, 11-12, 14, 13

14, 13, 30, 24, 11, 14, 14, 11-12, 14, 13

µ = 1.2 x 10-2 (rapid)*

B

A

f B = 1.4 x 10-4*

f A = 2.3 x10-5*

* YHRD

Father – son or unrelated ?

Influence of the local mutation rate on LR


Common ancestor?

L(X) = 1.4 x 10-4 x 7 x µ/2 + 2.3 x 10-5 x 5 x µ/2 = 1.1 x 10-6

L(Y) = 1.4 x 10-4 x 2.3 x 10-5 = 3.2 x 10-9

LR (X/Y) = 343

14, 13, 31, 24, 11, 13, 13, 11-12, 14, 13

14, 13, 31, 24, 11, 14, 13, 11-12, 14, 13

µ = 2.1 x 10-3 (moderate)*

f obs= 1.4 x 10-4*

fobs = 2.3 x10-5*

Meioses * YHRD

A

B

7

5


Common ancestor?

L(X) = 1.4 x 10-4 x 7 x µ/2 + 2.3 x 10-5 x 5 x µ/2 = 6.6 x 10-6

L(Y) = 1.4 x 10-4 x 2.3 x 10-5 = 3.2 x 10-9

LR (X/Y) = 2053

14, 13, 31, 24, 11, 13, 13, 11-12, 14, 13

14, 13, 31, 24, 11, 14, 13, 11-12, 14, 13

µ = 1.2 x 10-2 (rapid)*

f obs= 1.4 x 10-4*

fobs = 2.3 x10-5*

Meioses * YHRD

A

B

7

5


Loci Mutation Rate [95% CI] Meioses Position[MutRate] Group[MutRate]dys438 2,96E-04 10122 1 slowdys392 4,04E-04 14867 2 slowdys393 1,09E-03 13713 3 slowdys437 1,19E-03 10101 4 slowdys448 1,65E-03 6678 5 slowdys390 2,06E-03 15061 6 medium

dys385 mc 2,30E-03 25620 7 mediumdys19 2,32E-03 15539 8 medium

ygatah4 2,47E-03 7709 9 mediumdys391 2,54E-03 14935 10 mediumdys389i 2,68E-03 13788 11 mediumdys635 3,72E-03 7525 12 medium

dys389ii 3,78E-03 13759 13 mediumdys456 4,19E-03 6678 14 mediumdys481 4,97E-03 1744 15 mediumdys533 5.01E-03 1730 16 mediumdys439 5,35E-03 10096 17 mediumdys460 6,22E-03 1717 18 mediumdys458 6,74E-03 6677 19 mediumdys518 1,84E-02 1556 20 fast

dyf387S1ab mc 1,59E-02 1804 21 fastdys576 1,43E-02 1727 22 fastdys570 1,24E-02 1426 23 fastdys627 1,23E-02 1766 24 fastdys449 1,22E-02 1617 25 fast


Ranking of Y-STR mutation rates



D

Af (A) = 1/123*

f (D) = 1/388**

Likelihood Ratio (LR, KI) calculation for Y-STRs

* Program uses counting (Discrete Laplace extrapolation: 1/311)** Program uses counting (Discrete Laplace extrapolation: 1/821)

Population analysis(AMOVA)


YHRD: Test on population substructure (Fst, Rst)(Example: 17,278 Chinese individuals in 52 populations)


Ancestry information


Fast and slowly mutating Y markers

• Y-SNPsµ = 10-9 - 10-12

irreversible stable phylogeny

• Y-STRsµ = 10-3

recurrent networks

TCGAGGTATTAACTCTAGGTATTAACTCGAGGCATTAACTCTAGGTGTTAACTCGAGGTATTAGCTCTAGGTATCAAC * ** * *

17,13,30,25,10,11,13,10-1416,13,30,25,10,11,13,10-1417,13,31,25,10,11,13,10-1417,13,30,24,10,11,13,10-1417,13,30,25,10,11,13,11-1417,13,29,25,10,11,13,10-1517,13,30,26,10,11,13,10-1417,13,30,25,10,11,14,10-1417,13,30,25,11,11,13,10-14

Time

5

2

1

3

2

4


Roewer et al. Hum Genet 2005©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Y-STR gradients (7 loci)

Y-SNP gradients (R1a)

Fechner et al., Am J Phys Anthropology 2008©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

Semino et al. 2004 (n = 2400)

Haplogroup J2a

Haplotype: 14,13,30,22,10,11,12,13-16,...

Is ancestry prediction possible?

Biogeographical analysis using Y doesn‘t predictnationalityresidency orphenotype

Y markers infer very useful information the deep ancestry of a paternal lineage and its proliferation (radiation) over time until today

Skeleton in a trolley, 5g femur extracted©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

37 Y marker analysis (Geppert et al. 2010)


Unknown skeletonized person – extract, type, search and add „ancestry information“


Ancestry information – three features and heat map


Heat Map (searched haplotypes are reduced to the most representatively sampled minHt)


Searched haplotype is compared with a database of STR+SNP typed samples

Hg prediction is prone to IBS errors (as evidenced by YHRD)!Mandatory: Y-SNP analysis using (mini)sequencing

• SNaPshot method (Hierarchical Multiplex Analysis)

Geppert M & Roewer L (2012) SNaPshot® minisequencing analysis of multiple ancestry-informative Y-SNPs using capillary electrophoresis. Methods Mol Biol. 830:127-40.

J2a Turkey, Fertile Crescent, Caucasus,

Mediterranean


„Most frequent neighbour“ - 15,13,29,22,10,11,12,15-16 – 22 matches

15,13,30,22,10,11,12,15-16 – 2 matches to YHRD

Legende: Each dot is one population sample (on average 120 individuals) with matching populations marked in red©Charité – Universitätsmedizin Berlin, Dept. Forensic Genetics 2015

CAVE!

But: SNaPshot analysis

• Haplogroup E-M2• highest frequency in West Africa (~ 80%) and Central Africa (~ 60%), not India• Discrepancy between YSTR and YSNP distribution!


Part II: Casework examples


• Frequency estimation• Mixture• Kinship• Ancestry

Date post:	17-Jan-2016
Category:	Documents
Upload:	noel-freeman
View:	216 times
Download:	0 times

The new Y Chromosome Haplotype Reference Database (YHRD) and optimized approaches for the forensic...

Documents