THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1957 by The American Society of Biological Chemists, Inc.

Vol. 262, No. 10, Issue of April 5, pp. 47704’777,1957 Printed in U.S.A.

Cloning, Sequencing, in Vivo Promoter Mapping, and Expression in Escherichia coli of the Gene for the HhaI Methyltransferase”

(Received for publication, May 12,1986)

Micaela CasertaH, Wolfgang Zacharias$, Donald Nwankwon((, Geoffrey G. WilsonTi, and Robert D. Wells$ From the $.Department of Biochemistry, Schools of Medicine and Dentistry, University of Alabama at Birmingham, Birmingham, Alabama 35294 and llNew England Biolabs, Beverly, Massachusetts 01915

A 1476-base pair DNA fragment from Haemophilus haemolyticus containing the HhaI methyltransferase gene was isolated from a cell library and cloned into pBR322. The nucleotide sequence of this fragment was determined. The structural gene is 981 nucleotides in length coding for a protein of 327 amino acids (M, 37,000). The translational start signal (ATG) is pre- ceded by the putative ribosome-binding site (TAAG). Recombinant plasmids containing the 1476-basepair fragment are completely methylated when isolated from Escherichia coli, as judged by their insusceptibil- ity to the HhaI restriction endonuclease. However, the presence of an active HhaI methylase gene in certain E. coli strains results in a very poor yield of transform- ants and/or in vivo-originated deletions due to the Rgl functions of these hosts. The in vivo transcription ini- tiation sites have been identified by S1 protection and primer-extension experiments using specific probes with total RNA prepared from E. coli cells (HB101 or RR1) which tolerate the expression of MHhaI.

Type I1 restriction-modification systems consist of two genes, one encoding an endodeoxyribonuclease and the other a methyltransferase. Both enzymes recognize the same spe- cific DNA sequence. The methylase modifies host DNA by the addition of a methyl group at adenines or cytosines in the target site, thus allowing the related endonuclease to selec- tively cleave unmodified foreign DNA (1-5).

Since their discovery, type I1 restriction-modification en- zymes have been employed for common genetic manipulations (1, 6, 7). Recently, however, interest has developed regarding the possibility of analyzing specific protein-DNA interactions, since the two different activities recognize the same DNA sequence (8). In addition, these enzymes were useful for probing chromatin organization (in terms of methylation- demethylation patterns of gene-flanking regions and accessi- bility to nucleases (9, 10)) and, more specifically, DNA con-

* This work was supported by Grants P30 CA 13148 and GM 30822 from the National Institutes of Health, Grant 83-08644 from the National Science Foundation, and Grant IN-66Y from the American Cancer Society. A companion paper (47) describes kinetic and mech- anistic studies on the MHhuI. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisernent” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

to the GenBankTM/EMBL Data Bank with accession numbeds) The nucleotide sequence(s) reported in this paper has been submitted

502677. 5 Present address: Centro di studio per gli Acidi Nucleici, Consiglio

Nazionale delle Ricerche, Universita di Roma “La Sapienza,” Roma, Italy.

(1 Present address: University of Calabar, Calabar, Nigeria.

formational alterations at certain sequences. For example, cruciform formation in supercoiled molecules can be moni- tored by the inhibition of endonuclease cleavage at sites contained in the inverted repeats (11, 12). Also, the effect of left-handed Z-DNA conformations can be analyzed; structural alterations near or at the recognition sites can influence the ability of restriction-modification enzymes to utilize them as substrates (13-16).

In this paper, we report the DNA sequence of the gene coding for the Hhd methylase which recognizes the tetranu- cleotide GCGC and modifies the internal cytosine at position 5 (17). Analysis of the modification pattern of recombinant molecules containing the MHhuI gene demonstrates its expression in Escherichia coli. The transcription initiation sites and the putative ribosome-binding site and promoter sequences were identified. In addition, we find that certain E. coli strains are methylase-sensitive since they are poorly transformed by MHhaI gene-containing plasmids, thus indi- cating a possible deleterious effect of C-methylation.

MATERIALS AND METHODS

Plasmids-Plasmid pNW2801 contains the HhuI methylase gene on a 1476-bp’ fragment cloned into the HindIII site of pBR322 (see below and Fig. 1). pRW951 (not shown) contains the 1476-bp insert cloned into the HindIII site of pRW751 (18), in the opposite orien- tation relative to pNW2801. pRW959 (Fig. 1) harbors the same Haemophilus huemolyticus fragment in the HindIII site of pSP65 (19) (Promega Biotec). pRW962 (Fig. l ) , a derivative of pRW959 obtained as a spontaneous deletion during the course of a cloning procedure, lacks the polylinker region of pSP65 from the BamHI to the HindIII site and the first 382 bp of the H. haemolyticus insert. DNA plasmid isolation, after chloramphenicol amplification, was as described pre- viously (20).

Strains-H. haemolyticus was obtained from the New England Biolabs strain collection; it is also available from the ATCC, strain No. 10014. The E. coli strains, obtained from personal collections, were as follows: RR1 was the original recipient of pNW2801; HBlOl was used as a host for all the other plasmid DNAs; TG1 (a derivative of JM101, kindly provided by J. Engler, this department) harbored all the M13 recombinant phages; DH1 and W3110 were obtained from N. P. Higgins (this department); “294 was a generous gift from A. Shatzman and M. Rosenberg (Smith Kline & French, Inc., Philadelphia).

Enzymes-All enzymes were purchased from Boehringer, New England Biolabs, or Bethesda Research Laboratories. Assay condi- tions were as recommended by the manufacturers.

Purification of H. huemolyticus DNA-10 g of freshly grown H. huemolyticus cells were suspended in 20 ml of 25% sucrose, 50 mM Tris, pH 8.0. 10 ml of 0.25 M EDTA, pH 8.0, and 6 ml of 10 mg/ml lysozyme in 0.25 M Tris, pH 8.0, were added. After 2 h on ice, 24 ml of 1% Triton X-100 in 50 mM Tris, 67 mM EDTA, pH 8.0, and 5 ml of 10% sodium dodecyl sulfate were mixed in to achieve cell lysis. 70 ml of equilibrated phenol were added and the solution was emulsified by shaking. 70 ml of chloroform were added and the solution was

The abbreviation used is: bp, base pair.

4770

Sequence and Expression of HhaI Methylase 4771

again emulsified. The mixture was centrifuged at 10,000 rpm for 30 min and the upper layer was re-extracted with equal volumes of phenol and chloroform. The upper layer was dialyzed against four changes of 10 mM Tris, pH 8.0,l mM EDTA, and then digested with RNase at 100 pg/ml for 1 h at 37 "C. NaCl was added to 0.4 M and 0.55 volume of isopropyl alcohol was layered on top of the solution. The DNA was spooled out, air-dried, and redissolved in 12 ml of 10 mM Tris, pH 8.0, 1 mM EDTA.

Preparation of the H. huemolyticus Library-H. huemolyticus DNA was digested partially with HindIII, ligated into HindIII-cut and dephosphorylated pBR322, and transformed into E. coli RR1. 10-pg aliquots of DNA at 100 pg/ml in 10 mM Tris, pH 7.5, 10 mM MgClz, 50 mM NaCl, 10 mM mercaptoethanol, 0.005% Triton X-100 were digested with nine 2-fold serial dilutions of HindIII (ranging from 2 to 0.008 units of enzyme/pg of DNA). The tubes were incubated for 1 h at 37 "C and heated for 15 min at 72 "C to stop the reactions, and 10 pl from each were analyzed by agarose gel electrophoresis. Tubes in which moderate, but incomplete, digestion had occurred were combined. 40 p1 (4 pg) of the combined solution were mixed with 10 pl of HindIII-cleaved and dephosphorylated pBR322 (2 pg). After addition of ligase buffer plus 250 units of T4 DNA ligase and incu- bation for 4 h at 16 "C, the mixture was transformed into 2 ml of E. coli RR1, made competent by calcium treatment (21). The trans- formed cells were grown to saturation in 50 ml of Luria broth, centrifuged, and resuspended in a volume of 2.5 ml, and 250-pl quantities were plated onto Luria agar plates containing 50 pg/ml ampicillin. After incubation at 37 "C, the plates were each flooded with 3 ml of 10 mM Tris, pH 7.5, 10 mM MgCl,, and the transformed colonies were scraped together and combined to form the cell library.

Selection of HhaZ Modification Clones-3 ml of the cell library were inoculated into 500 ml of Luria broth containing 50 pg/ml ampicillin and grown to saturation without chloramphenicol amplification. Plas- mid DNA was prepared from this culture by cesium chloride/ethidium bromide banding (22), dialysis, and isopropyl alcohol precipitation.

300 pl of purified plasmid DNA at 50 pg/ml in 50 mM Tris, pH 8.0, 5 mM MgClz, 0.5 mM dithiothreitol, were prepared, dispensed into five tubes, and digested for 1 h at 37 'C with five 2-fold serial dilutions of HhaI (ranging from 20 to 1.25 units of enzyme/pg of DNA). The reactions were terminated by extraction with 20 pl of chloroform and the completeness of digestion was checked by gel electrophoresis. 10 p1 from each tube were transformed into competent E. coli RR1 and the transformed cells were plated onto Luria agar plates containing 50 pg/ml ampicillin. After incubation the plates were examined digestion of the library reduced the number of transformants from each tube by a factor of approximately lo', compared to the undi- gested control. The plasmids harbored by individual transformants were purified by the alkaline sodium dodecyl sulfate miniprep proce- dure (23) and analyzed by restriction endonuclease digestion and gel electrophoresis.

Assay for HhaI Modification Activity-Modification activity was assayed by incubating unmodified DNA with serial dilutions of cell extract prior to digestion with HhaI and gel electrophoresis. 30 ml of a freshly grown culture was harvested by centrifugation at 4,000 rpm, 5 min. The cells were resuspended in 1.5 ml of 10 mM Tris, pH 7.5, 10 mM mercaptoethanol, 1 mM EDTA, 1 mg/ml lysozyme, left on ice for 1 h, and then gently sonicated with two 20-5 pulses. The cell debris was removed by -microcentrifugation for 2 min. 600 pl of 50 pg/ml X DNA in 50 mM Tris, pH 7.5, 10 mM EDTA, 5 mM mercap- toethanol, and 0.1 mM S-adenosylmethionine were prepared, dis- pensed into five tubes, and incubated with five 3-fold serial dilutions of cell supernatant (from 1 to 0.01 pl of extract/pg of DNA). The tubes were incubated at 37 "C for 1 h, and then heated to 72 "C for 10 min to stop the reactions and to denature interfering nucleases. 100 pl of 50 mM Tris, pH 8.0, 40 mM MgCl,, 5 mM mercaptoethanol and 30 units of HhaI (1.5 pl) were added to each tube. The solutions were again incubated at 37 "C for 1 h, and 20 p1 from each were analyzed by gel electrophoresis. Modification was detected by the lack of digestion.

Cloningin M13-Ml3mplOand M13mpll(24) and M13mWB2348 (25) replicative forms were used as vectors for subcloning the HindIII insert of pNW2801; the 1476-bp fragment, purified from the pBR322 vector on a 5% acrylamide, 0.25% N,N'-diallyltartardiamide gel, was digested with Sau3A1, and the mixture was ligated with BamHI- digested M13mplO or BamHI-HindIII-digested Ml3mplO or M13mpll. Alternatively, the same HindIII fragment was cut with RsaI and the mixture was ligated with SmaI-linearized M13mplO. Finally, the entire HindIII insert was cloned in the corresponding site of M13mWB2348. Transformation, phage growth, and single-

stranded DNA isolation was as described (24, 26). Sequencing-Sequence determination for the HindIII fragment

carrying the HhaI methylase gene was essentially according to the dideoxy-chain termination method described by Sanger (27,281. The universal M13 single-stranded primer (Amersham Corp.) was used as well as synthetic oligonucleotides corresponding to internal regions of the HindII.1 insert (Fig. 2). [cu-36S]dATPaS was the labeling deox- ynucleotide. Electrophoresis on denaturing gels was as described (29, 30). After fixation in 10% acetic acid, 10% methanol, the gels were transferred onto 3MM paper (Whatman) and dried. Autoradiography was carried out a t room temperature for 24-48 h with Kodak or Fuji films.

The chemical degradation method was performed according to Maxam and Gilbert (30). Plasmid DNA, digested with appropriate enzymes, was 3' end-labeled with [cu-32P]dNTPs and DNA polymerase (Klenow fragment) or 5' end-labeled with [y3'P]ATP and T4 poly- nucleotide kinase following dephosphorylation.

Deoxy- and dideoxy-NTPs were from New England Biolabs and Amersham Corp. Radioactive nucleotides were from Amersham Corp.

Primer Extension Analysis-Approximately 200,000 cpm (Ceren- kov counts) of labeled oligonucleotide, purified on a denaturing pol- yacrylamide gel, were hybridized to 20-30 pg of total RNA, isolated from RR1 cells harboring pNW2801, at temperatures ranging from 45 to 30 "C. The conditions for hybridization and reverse transcrip- tase reaction were essentially as described by Townes et al. (31). After phenol/chloroform extractions and ethanol precipitation, the samples were electrophoresed on denaturing polyacrylamide gels in parallel with sequencing ladders obtained with the same oligonucleotide and the relevant M13 clone.

S1 Nuclease Protection Analysis-The conditions were essentially as described by Berk and Sharp (32); 20-30 pg of total RNA, isolated from RR1 cells harboring pNW2801, were hybridized to 100,000 cpm (Cerenkov counts) of 5' end-labeled double-stranded DNA probe for 12 h at 54 "C after denaturing for 10 min at 70 "C. After 20-40 min incubation at room temperature with 130 units of S1 nuclease (Be- thesda Research Laboratories), the samples were phenol/chloroform- extracted, ethanol-precipitated, and analyzed on a denaturing poly- acrylamide gel in parallel with Maxam-Gilbert sequencing ladders of the same probe.

In Vitro Filter Binding Assay-Filter binding experiments were performed on appropriate restriction fragments as described by Krause et al. (33).

Other Methods-Synthetic oligonucleotides were obtained by the phosphoramidite chemical method using an Applied Biosystems Model 380A DNA synthesizer. Computer analyses were performed with a VAX 11/750 computer (J. Engler, this department); software was as described (34). Agarose gel electrophoresis was performed in 40 mM Tris, pH 8.2, 20 mM sodium acetate, 1 mM EDTA, 0.5 pg/ml ethidium bromide. Agarose gels were prepared with the same buffer plus 1% agarose (Bio-Rad).

RESULTS

Isolation of the H h I Modification Gene-Recombinants carrying the HhaI modification gene were isolated by selection as survivors from a library of plasmid clones that had been digested with the H h I restriction endonuclease. A similar approach has been used to isolate clones of the BspRI (35), MspI (36), BsuRI (37), and DdeI' modification genes. The library was prepared by ligating HindIII fragments of H. hemolyticus DNA into pBR322 (39); it was propagated in E. coli RR1 to allow self-modification of molecules carrying the H h I modification gene to occur, then the plasmids were purified, digested with HhaI, and retransformed into RR1. Among the plasmids that survived, many were found to carry a common, 1.5-kilobase pair HindIII fragment. The fragment was judged to encode the HhaI modification gene by three criteria: (a) plasmids carrying the fragment were resistant to digestion by H h I (GCGC) and Hue11 (RGCGCY), yet sensi- tive to digestion by FnuDII (CGCG), Hue111 (GGCC), HpaII (CCGG), and Aha11 (GRCGYC), enzymes that recognize sim- ilar, but distinct sequences; (6) the chromosomal DNAs of the

K. A. Howard, J. S. Benner, H. L. Callahan, C. Card, R. Maunus, K. Silber, G. G . Wilson, and J. E. Brooks, manuscript in preparation.

4772 Sequence and Expression of HhaI Methylase

FIG. 1. Schematic maps of the DNA region coding for MHhaI and I of recombinant plasmids carrying MHhaI activity. pNW2801 contains the sequenced H. haemolyticus DNA (1476 bp fragment, filled segment) in- serted in the HindIII site of pBR322. pRW959 contains the same fragment cloned into the HindIII site of the poly- linker in pSP65 (19). pRW962 was de- rived from pRW959 as described (see "Materials and Methods"). The arrow in each circular map indicates the start and orientation of the MHhaI coding region. Circular maps are not drawn to scale. The linear map shows a partial restric- tion map of the sequenced 1476-bp Hind111 fragment as well as the length and location of the coding region for MHhaI (arrow).

1255

Hindm

Bom H I 1851

5836bp

Avo I 2890

305 492 55 B g l I ATG

pR W 959 4522bp

78 23

1526 pRW962 HindIII 4112bp

M H ha1 ,

0

cells harboring the plasmids were similarly resistant to HhaI and Hue11 yet sensitive to the other enzymes; (c) extracts prepared from cells harboring the plasmids displayed HhaI modification activity in uitro. No restriction endonuclease activity was detected in cell extracts, suggesting that the fragment does not encode the HhaI restriction gene, at least in its entirety. A representative plasmid, pNW2801 (Fig. l), that carried only the 1.5-kilobase pair fragment, was chosen for analysis.

Sequence Determination-The nucleotide sequence of the 1476-bp DNA fragment from pNW2801 (Fig. 1) containing the HhaI DNA methyltransferase gene was determined. The dideoxy-chain termination method (27-29) was employed as well as the Maxam-Gilbert chemical degradation technique (30), when required. More than 90% of the sequence was determined on both strands; portions of the fragment for which data were available from only one of the two strands were sequenced several times.

The sequence strategy is shown in Fig. 2; each arrow cor- responds to sequence information derived from a t least two independent experiments. The Sau3AI and RsaI sites are indicated since they were utilized to subclone overlapping segments of the HindIII fragment in the phage vectors M13mplO and Ml3mpll (24) (see "Materials and Methods"). A more detailed restriction map is presented in Fig. 1. In the first set of experiments, the M13 single-stranded universal primer was employed for all the subclones obtained. Since some of the DNA inserts expected from the random subclon- ing were missing, an entire strand of the HindIII fragment was cloned in the phage vector M13mWB2348 (25). This particular phage is less deletion-prone than the other M13 phages of the mp series, thus allowing larger inserts to be stably propagated.

Six oligonucleotides, ranging in size from 15 to 17 bases, were synthesized and used as specific primers; four were complementary to internal regions of the top strand of the HindIII fragment and the other two to part of the bottom strand of the 635-bp RsaI segment. Dotted lines in Fig. 2 indicate the portion of data obtained by this approach. The chemical degradation method was employed essentially to cover regions of the sequence for which only one strand was available. In addition, this technique was necessary, coupled with the use of a 20% denaturing acrylamide gel, to resolve a region complicated by secondary structure formation. Indeed, the sequence data revealed the presence of a perfect inverted

0.5 1.0 kb - - I .... * m . . . *

"""" """" - L ~

HlndUI RroI RsoI BplU R s a I m R S O I R ~ ~ I B H , ~ ~ ~ I 1 I I 1 I I 1i I I

1 Sou3AI Sau3AiI Sou3AI 1476

c ~ "" *"_ "".

m- . . . m -. .. I , I

0

ci OIkb

FIG. 2. Sequencing strategy. Each portion of the sequence is represented by horizontal lines above and below the schematic map of the 1476-bp fragment. The three types of lines indicate sequence information obtained from different strategies using the dideoxy- chain termination method Sau3AI subcloning (solid lines), RsaI subcloning (dashed lines), and synthetic oligodeoxynucleotide primed sequencing (primers are represented by filled boxes) (dotted lines). Open boxes indicate information derived by the chemical degradation method (30). The ATG and the TAA of the gene are shown.

repeat with a 7-bp stem and with 3 nucleotides in the potential loops, situated 5 bases downstream from the termination codon of the HhaI methylase gene (Fig. 3).

MHhnI Structural Gene and Ribosome-binding Site-The 1476-bp sequence was searched for all possible reading frames in both strands. Only one of the six frames has an open region large enough to code for the MHhaI gene. Since some of the genes for restriction-modification systems are organized in pairs with a small untranslated region in between (37, 40-46), we looked for at least part of a second open reading frame, which could code for the HhaI restriction enzyme. No other suitable open reading frame is present upstream from the methylase gene. It is still possible that the endonuclease gene starts somewhere downstream from the methylase termina- tion signal, although the short segment of H. huemolyticus DNA at the 3' end of the gene does not allow any conclusions.

The nucleotide and amino acid sequences corresponding to the HhaI methylase are presented in Fig. 3. The first A of the left HindIII site is position 1 on the sequence. Starting from the ATG at position 437 and ending at position 1418, the gene extends for 981 nucleotides, thus coding for a protein of 327 amino acids. The molecular weight deduced from the predicted amino acid composition is 37,002, in excellent agree- ment with the size of the purified protein (37,000, as isolated from E. coli transformed with pNW2801 (47)). Furthermore, a Pro-Cys doublet, which rarely occurs in proteins, found at position 674-679 on the DNA sequence, is proposed to form

Sequence and Expression of HhaI Methylase 4773

I

61

1 2 1

181

241

301

361

421

48 1

541

601

661

721

781

84 I

90 1

961

1021

1081

1141

I201

1261

1 3 2 1

1381

1441

AAGCTTGCTTATAATGGCGGTGTGAAAGAGGCAATTTCGAGATATTATTCGATAGA + 6 0

GATTGTTAGGTTTACATAAATGTAGGACGAAGTGTTGAGCTTGGTCCTTTTTTATCGT + + + + 120

A C A C A T T C C A G A A T T T C A G A T A T C A C A A T C T T G C A C A + + 180

TCTGTTGTCACATTTTCGTTATTTCGTAATTTAT~TGTACTCTTGCTGATCCCCGAT + + + 240

AAGAGTATTACATCTTTGTGCTTCATTTCTCTATCGATAAGT~TTTCCATAACTTTTTG + + 300

T A G C A T A G T G T C A T T A T C T A T C C T T T T A A A A C C A G A A A C T T T T + + 360

v TTCATATAATUCATC-TTTATAGATGTATTGT-ATATATACA

V I

+ + + 420

ATTTTTTAAGATTCT-TTGAAATAAAAGATAAACAGCTCACAGGATTACGCTTTAT MetI leCluI leLysAspLysGlnLeuThrGlyLeuArgPh~l l~

"'I + 480

TGACCTTTTTGCAGGATTAGGTGGCTTTAGACTTGCTTTAGAATCTTGCGGTGCTGAGTG A s p L e u P h e A l a G l y L e u G l y G l y ~ h ~ A ~ g L e u A l a L e u G l ~ S ~ ~ C y ~ G l y A ~ a G l ~ C y ~

+ + 540

CGTTTATTCTAATGAATGGGATATATGCACAAGAAGTATATGAGATGAATTTTGGTGA V a l T y r S e r A s n C l u T r p A s p L y s T y r A l a G l n G l u V a l T y ~ G l ~ M ~ c A ~ ~ P h ~ G l y G l ~

+ 600

AAAGCCTGAGCCCGACATTACCCAAGTATGAGAAAACCATTCCATTCCTGATCACGACATTTT LysPr~luGlyAspIleThrGlnValAsnGluLysThrIleProAspHisAspIleLeu

+ 660

ATCTGCAGGGTTTCCGTGCCAAGCGTTTTCTATTAGTGGAAAAC~GGATTCGAGGA CysAlaGlyPheProCysGlnftlaPheSerIleSerGlyLysGlnLysGiyPheGluAsp

+ 720

CAGCAGAGGTACGCTCTTTTTTGATATTGCACGTATTGTCCGTGAAAAAAAACGT S e r A r g G l y T h r L e u P h e P h e A s p I l e A l a A r g I l e V a l A ~ g G ~ ~ L y ~ L y ~ P ~ o L y ~ V ~ l

+ + + 780

+ 840

T G T A A T A C A A T G M T G A T T G G A C T A T T C T T T T C A T G C T A A A G T A T T ~ T G C T T T V a ~ L Y s A s n T h r M e t A s n G 1 u L e u A s p T y r S e r P h e H i s A l a L y s V a l ~ e u A s n ~ l a ~ e u

+ 900

C A A T A T P C A A A A T T T C C M T T T C C A A A A C C T T T T G A G C T T A A T T T A s n I l e G i n A s n P h e G l n P h e P r o L y s P r o P h ~ G l ~ L e u A ~ " T h ~ P h ~ V ~ 1 L y ~ A ~ ~ L ~ ~

+ + + 1020

GTTATTACCTGATAGCGACGTGGAACACTTAGTTATTGATAGAAAAGATTTGGTAATGAC L e u L e u P r ~ A s p S e r G l u V a l G l u H i s L e u V a l I l e A s p A ~ g L y ~ A ~ p L ~ ~ V ~ l M ~ t T h ~

+ + 1080

AAACCAAGAAATTGAGCAAACAACCCCCAAAACAGTTCGACTTGGTATTGTAGGAAAAGG A s n G l n G l u I l e G l u G l n T h r T h r P r o L y s T h r V a l A r g L e u G l y I l e V a l G l y L y s G l y

+ + + 1140

T G G C G G C A T T T T C G C T A A G A C A G G G G G A T A T T T A G T A A A C T T A C A GlyGlyI lePheAlaLysThrGlyGlyTyrLeuVa1AsnGlyLysThrA~gLysLe"Hi~

+ + 1260

CAGCCAAGCATATAAACAATTTGGTAACTCAGTTGTTATC~TGTACTTCAATATATTGC S e r G l n A l a T y r L y s G l n P h e G l y A s n S e r V a l V a l I l e A s n V ~ l L ~ ~ G l n T y r ~ l ~ A ~ ~

+ 1380

TTATAACATTGGTTCATCATTAAATTTCACCATA~TTGAGGGGCATAGCCCC TyrAsnIleGlySerSerLeuAsnPheLysProTyr

+ + - 1440

- TTAGCAATTATAAAGAAATAGCTGCCTCAAAAGCTT + 1416

the active site of the MHhaI protein (47). The putative ribosome-binding site TAAG, indicated in

Fig. 3, is 5 nucleotides away from the ATG. Although it appears to be a weak site for translation in E. coli, we showed that pNW2801 does indeed express a methylase activity when E. coli RR1 and HBlOl are the recipient strains (see below).

Transcription Signals and Expression in E. coli-MHhaI activity in E. coli was detected by testing purified DNA for insusceptibility to HhaI endonuclease cleavage. pNW2801 was undigested following a 2-h incubation with the HhaI restric- tion enzyme, whereas an unmethylated internal control DNA (pRW451 (18)) was completely digested (data not shown). pRW951, in which the Hind111 insert was inverted relative to pNW2801 (see "Materials and Methods"), shares the same full methylation pattern; this in uivo methylase activity in either orientation was the first indication for the presence of a MHhaI promoter on the 1476-bp fragment. Moreover, this fragment retains methylase activity when cloned in either orientation in both vectors pSP65 and pACYC184. Also, the replicative form of M13mWB2348 with the 1476-bp insert in one orientation was found to be methylated.

Another method for testing in vivo expression of MHhaI was used. Purified pRW951 was reacted in vitro with [methyl- 3H]AdoMet and MHhaI as described previously (14). No significant incorporation (less than 0.2 sites per molecule) was detected relative to an unmethylated control DNA, thus indicating that all the HhaI sites were indeed modified in uiuo (data not shown).

In order to identify sequences required to promote the transcription of the MHhaI gene, we carried out primer- extension experiments to map at the nucleotide level the 5' end of the mRNA produced in uiuo. For this purpose, two out of the six synthetic oligonucleotides utilized for sequencing were selected; the primers, a 17-mer and a 15-mer, are com- plementary to portions of the sequence located 12 and 229 nucleotides, respectively, downstream from the ATG (Fig. 2). Total RNA from E. coli RR1 carrying pNW2801 was isolated since we found that the plasmid purified from this strain is completely methylated at the HhaI sites. The RNA was hybridized to each of the two 5' end-labeled oligonucleotides as described (31) with some modification. The temperature was varied from 45 to 30 "C in order to obtain the most stable hybrids under these conditions. Both primers showed an optimum a t 37 "C. Fig. 4 shows the sizes of the cDNAs synthesized by reverse transcriptase in parallel with dideoxy- sequencing ladders obtained with the same primers. The hybridization temperatures were 30 "C (lanes I and 3 ) and 37 "C (lanes 2 and 4 ) . With both primers the major products of the reverse transcriptase reactions reveal that the 5' end of the in uiuo mRNA synthesized from the MHhaI gene corresponds to positions 415 (T) and 416 (A) on the MHhaI sequence in Fig. 3.

To confirm this result, we also performed S1 nuclease protection experiments. Fig. 5 shows the results obtained using a probe extending from the MstII site (position 606) to the RsaI site (position 404) and the same total RNA prepa- ration as above. These experiments confirmed that transcrip- tion initiates 21-22 nucleotides upstream from the ATG and ruled out the possibility of a premature termination of reverse transcriptase. The -10 and -35 consensus sequences consti- tuting this promoter region are underlined in Fig. 3.

Two additional lines of evidence support the finding that

FIG. 3. Nucleotide and amino acid sequence of the 1476-bp ~~ ~~ ~~ ~~

HindIIIfragmentcontainingtheHhaImethylasegene.TheATG -10 and the -35 regions are underlined. A solid triangle designates and the TAA are boxed. The ribosome-binding site is indicated by the 3' end of the deletion in pRW962. The inverted repeat at the end dots. The transcription start sites are shown by two arrowheads. The of the gene is indicated by facing arrows.

4774

A C 1 2 G T

-d 400- “ st-

416- 415- P- E

Sequence and Expression of HhaI Methylase

A C 3 4 G T

415-. 4 16-

500-

600- at c

1, r c

I

5 FIG. 4. Pr imer ex tens ion ana lyses for mapping the t r an -

scription start sites f o r t h e MHhaI gene. The reverse transcrip- tase products were obtained with the oligonucleotide proximal to the ATG (lanes I and 2) and with the distal one ([ones 3 and 4 ) . The two oligomers are shown as filled boxes in Fig. 2. Hybridization tempera- tures were 30 “C (lanes I and 3 ) and 37 “C (lunes 2 and 4 ) . Dideoxy- sequencing markers were obtained with the corresponding primers. The numbers refer to the positions on the sequence (Fig. 3).

these sequences are indeed required to promote the transcrip- tion of the HhaI methylase gene. First, during the course of a subcloning procedure using pRW959 (Fig. l ) , . we found a spontaneous deletion which lacks most of the sequence pre- ceding the MHhaI ATG but still retains methylase expression in E. coli. This molecule, pRW962 (Fig. l), was further char- acterized through restriction analyses and sequencing around the relevant region. The deletion extends from the 3’ end of the SmaI site in the polylinker region to position 382 in the MHhaI gene insert (solid triangle in Fig. 3; see also “Materials and Methods”). The sequence of the new -35 element is GGGATT. Therefore, a region of 53 nucleotides upstream from the ATG contains all the necessary information to promote MHhaI expression. Second, in vitro filter binding experiments, using E. coli RNA polymerase and different sets of restriction fragments derived from the 1476-bp Hind111 insert, revealed preferential retention of the 130-bp TaqI-RsaI segment (Fig. l ) , located just upstream from the ATG of the MHhaI gene and containing the -35 and -10 regions (data not shown).

Base Composition and Codon Usage-An analysis of the base composition for the sequence shown in Fig. 3 reveals a high A+T content (65%), directly influencing the gene codon frequency. A and U are usually preferred bases in the third

G G + A 1 2 C+T C r r . i

465-

I !!

FIG. 5. S1 nuclease mapping of the transcription start sites f o r the MHhaI gene. Lanes I and 2 indicate the portion of the 202- bp RsaI-MstII probe protected from S1 nuclease digestion for 20 (lane I ) and 40 min (lane 2). Maxam-Gilbert sequencing markers were obtained with the same probe. The numbers refer to the positions on the sequence (Fig. 3). The S1-resistant bands (which contain 3”OH ends) a t positions 415 and 416 are displaced approximately 1.5 residues upwards from the corresponding bands in the sequencing ladders (which contain 3”phosphate ends).

position of synonymous codons and, when there is a choice, also in the first position. The sequences of the only other two genes from the same organism which were reported, the H h I I restriction endonuclease and methyltransferase, also have a high A+T content of 68 and 65%, respectively (43). However, if this feature is not a general characteristic for H. haemoly- ticus DNA, a regulatory mechanism at the level of translation could be implicated, as suggested in the case of the EcoRI restriction-modification system (42).

Comparison of Protein Sequence with Other Methylases- The predicted amino acid sequence of MHhaI was compared with those of the SPR, BspRI, and BsuRI methylases (37,49) which are also C-methylases with exclusively GC base pairs in their recognition sequences. The MALIGN program was used to search for segments of identity and optimal alignment among these sequences, taking two residues as the minimum length of identity. The MHhaI protein sequence could thus

Sequence and Expression of HhuI Methylase 4775

be aligned to 27.2% to MSPR, 18.7% to MBspRI, and 21.4% to MBsuRI, whereas the randomly scrambled sequences of M H h I a n d MSPR gave an optimal alignment of only 14.4% of MHhaI. With the DFASTP program it was found that M H h I shares identity with MSPR to 38.9% over a region of 190 residues, with MBspRI to 26.4% over 178 residues, and with MBsuRI to 22.7% over 286 residues. When conservative amino acid replacements were included in this comparison in addition to identical residues, the homology of MHhaI in- creased to 79.5, 74.2, and 66.8%, respectively.

Several regions are strikingly similar in all four protein sequences. 4 out of 6 residues are identical in a region con- taining the Pro-Cys unit, which is proposed to form the active site of M H h I (47). In addition, a region of 4 out of 4 and 7 out of 14 amino acids, located a t residues 118-121 and 151- 164 of MHhaI, are identical. Altogether, a total of 15 clustered and 10 single invariants were found to be present in all four protein sequences.

H h I Methylase Sensitivity of Certain E. coli Strains- Attempts to transform pNW2801 into a number of laboratory strains of E. coli met with unexpected difficulty. Some strains, notably RR1, MC1061, and K802, were permissive for trans- formation and accepted pNW2801 at the same frequency that they accepted pBR322 (efficiency = lo6 transformants/pg of plasmid DNA). Other strains such as DHI, "294, C600, Hfr H, W3110, and wild-type K12, were transformed very poorly by pNW2801 (efficiency <102/pg), or other plasmids containing a functional MHhaI gene, even though they ac- cepted pBR322 with normal efficiency. Conversely, plasmids carrying artificially created or spontaneously occurring dele- tions that affect MHhaI expression could transform those strains with an efficiency equivalent to pBR322 used as a control. E. coli strains HB101 and RR1 were found to tolerate HhaI methylase activity, although the growth rate of the transformants was severalfold slower compared to pBR322 containing cells. TG1 cells were transformed by pNW2801, but the morphology of the colonies appeared to be quite different compared to the control (irregular uersus rounded shape).

The "sensitive" behavior of these strains is in agreement with observations reported by other groups (37, 38,40) work- ing with plasmids which code for cytosine methyltransferases. It has been analyzed in detail using a variety of cloned modification genes and using pBR322 modified i n uitro with purified modification enzymes. The analysis indicates that inefficient transformation is the result of restriction of meth- ylcytosine-containing DNA by the E. coli Rgl functions: in- efficient transformation occurs only when the transforming DNA is modified a t cytosine residues and the bacterial strain is Rgl-proficient (38).

DISCUSSION

The DNA sequence of the HhaI methyltransferase gene reveals a coding region of 981 nucleotides which predicts a protein of 327 amino acids ( M , 37,002) in excellent agreement with the size of the protein purified from E. coli (M, 37,000 (47)). Each of the restriction-modification systems that have recently been cloned has a characteristic organization of the genes coding for the two related proteins. For the EcoRI and BsuRI systems, both enzymes are coded by the same DNA strand and the endonuclease gene precedes the methylase gene (37, 41, 42). For HhaII and PaeR7, the two genes are colinear, but the methylase is located upstream from the endonuclease (43, 46). However, the PuuII, PstI, and EcoRV systems consist of two divergently arranged coding regions (40,44,45). The nucleotide sequence flanking the HhaI meth-

ylase structural gene does not reveal any other open reading frame suitable for coding for the HhaI restriction endonucle- ase. The sequence of the 436 nucleotides preceding the MHhaI gene shows several translation termination signals in all pos- sible frames, whereas the region separating the end of the gene from the end of the cloned fragment contains no start codons.

Little is known regarding control mechanisms for the expression of the two related genes inside the cell. A colinear arrangement of the coding regions, with the methylase up- stream, appears to be the most simple way to ensure a delay in the endonuclease synthesis. Alternatively, a difference in the strength of promoter or ribosome-binding site could reg- ulate the transcription and/or translation efficiency (37, 44). Folding of the mRNA in a particular secondary structure could also affect protein synthesis (45). Compartmentaliza- tion, differential ion requirements, and stability of the protein itself could also be involved in controlling enzymatic activity. In this regard we have observed that E. coli HB101, carrying an active MHhaI gene on pNW2801, contains fully methyl- ated plasmid DNA when grown to saturation, even at higher temperatures (40 and 43 "C).

We were interested in defining the sequences promoting transcription and translation of the MHhaI gene in order to obtain regulated expression of this enzyme in E. coli under the control of a different promoter. The nucleotide sequence determination, in combination with transcription mapping experiments, was essential in identifying those regions of interest. We localized the coding region and the orientation of the gene on the basis of the longest open reading frame. The first ATG of this open reading frame appears a t position 437 on the Hind111 fragment; the putative ribosome binding site (TAAG), is situated 5 nucleotides upstream. An identical sequence exists 7 nucleotides upstream from the start codon of the MHhaII gene.3

We have searched for other potential fMet codons of the MHhaI gene. A GTG and an ATG triplet are present at position 308 and 587, respectively, in the same open reading frame. We believe that neither of them is the true start codon since the size of the protein would be too large or too small, respectively, compared to the established M , (47), and the transcriptional start sites at positions 415 and 416 automati- cally rule out the GTG triplet.

The end of the gene is marked by a TAA codon followed by a perfect inverted repeat 7 nucleotides further downstream. This inverted repeat (AAGGGGCATAGCCCCTT) predicts a hairpin with 7 nucleotides in the stem and 3 in the loon A

~ ~~~

hairpin structure at the 3' end of some bacterial mRNAs-has been suggested as a transcription termination signal for RNA polymerase to release the DNA coding strand (48).

The transcriptional start sites were located at positions 415 and 416 through S1 protection and primer extension experi- ments using total RNA isolated from E. coli RR1 harboring pNW2801. The -10 and -35 consensus sequences are indi- cated in Fig. 3. We do not know whether any of these se- quences are utilized by H. huemolyticus for the transcription of the M H h I gene; nevertheless, they are recognized in E. coli. Moreover, i n uitro filter binding experiments, using the E. coli RNA polymerase and pNW2801 digested with different restriction enzymes, have shown preferential retention of the 130 bp RsaI-Tag1 fragment upstream from the mRNA start sites.

The -10 region (TACTGT) close to the RsaI site a t position 404 shows little similarity to the usual Pribnow box found in E. coli promoters (TATATT). The sequence TTGATT occurs

H. 0. Smith, personal communication.

4776 Sequence and Expression of HhaI Methylase

around position -35 with a spacing of 17 nucleotides from the -10 region. Only part of this sequence (GATT) is still present in the -35 region (GGGATT) of the deleted plasmid pRW962 that, nevertheless, was isolated as a fully methylated DNA.

An interesting characteristic of the MHhaI gene sequence is the absence of HhaI sites (GCGC), frequently found in most other DNAs. An obvious speculation would be to propose the existence of selective pressure during evolution to preserve the integrity of the gene and therefore its essential function in the presence of the related endonuclease. Alternatively, an overall high A+T content (65%) could be responsible for this feature.

The comparison of the predicted amino acid sequence of " L a 1 with other cytosine methylases revealed extensive homologies among these proteins which are derived from different systems but catalyze the same chemical modification reaction. Sequence homologies between the procaryotic meth- ylase of BsuRI and the phage methylase of SPR and the potential origin of their similarities have been discussed in detail elsewhere (49 and references therein).

Finally, we find that several E. coli strains do not tolerate expression of the MHhaI gene; they are poorly transformed by plasmids carrying an active gene and most of the trans- formants have lost HhaI methylase activity following exten- sive deletions. Other groups have observed the same phenom- enon in E. coli with other cytosine methylases (37, 40). A more detailed analysis indicates that the function responsible for this sensitive phenotype is located in the RglB locus, presumably coding for an unidentified restriction system (38). The RglA and RglB functions were originally identified by their ability to restrict nonglucosylated T-even bacteriophages (reviewed in Refs. 50 and 51) that contain hydroxymethylcy- tosine in their DNA (52, 53). It has been generally assumed that Rgl recognizes only 5-hydroxymethylcytosine-containing DNA but this is evidently not so. In light of this observation, investigators might find it prudent to use only Rgl-deficient strains of E. coli, such as K802, for the primary cloning of prokaryotic and eukaryotic DNA that contains 5-methylcy- tosine. Moreover, it may be legitimate to speculate that the correlation between the methylation state of the DNA and gene expression, well known in eukaryotic systems, may also apply to prokaryotes.

Acknowledgments-We thank Drs. J. Engler, N. P. Higgins, and T. M. Townes for helpful advice and A. Shatzman and M. Rosenberg for gifts of plasmids and bacterial strains. We also thank Drs. J. C . Wu and D. V. Santi for performing the homology searches with the protein sequences.

REFERENCES

1. Modrich, P., and Roberts, R. J. (1982) in Nucleases (Linn, S. M., and Roberts, R. J., eds) pp. 109-154, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York

2. Kruger, D. H., and Bickle, T. A. (1983) Microbiol. Reu. 47, 345-360 3. Smith, H. O., and Kelly, S. V. (1984) in DNA Methylntiont Biochemistry

and Biobgicaf Signcficance (Razin, A,, Cedar, H., and Rig@, A. D., e&) pp, 39-71, Springer-Verlag, New York

4. Yuan, R., and Smith, H. 0. (1984) in DNA Methylation: Biochemistry and Bio~ogical Significance (Razin, A,, Cedar, H., and Riggs, A. D., eds) pp.

5. Marinus, M. G. (1984) in DNA Methylation: Biochemistry and Biobgical 73-80, Springer-Verlag, New York

6.

7.

8.

9.

IO. 11.

12. 13.

14.

15.

16.

17.

18.

19.

20.

21. 22.

24. 23.

25.

26.

27.

28. 29. 30. 31.

32. 33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

44. 43.

45.

46.

47. 48. 49.

50.

51. 52. 53.

Significance (Razin, A,, Cedar, H., and Riggs, A. D., eds) pp. 81-108, Springer-Verlag, New York

Malcom, A. D. B. (1981) in Genetic Engineering (Williamson, R., ed) Vol. 2, pp. 129-173, Academic Press, Inc., London, Ltd., London

Wells, R. D., Klein, R. D., and Singleton, C. K. (1981) in The Enzymes (Boyer, P. D., ed) 3rd Ed., Vol. 14, pp. 157-191, Academic Press, Inc.,

Frederick, C. A,, Grable, J., Melia, M., Samudzi, C., Jen-Jacobson, L., New York

Wang, B. C., Greene, P., Boyer, H. W., and Rosenberg, J. M. (1984) Nature 3 0 9 , 327-331

Langner, K. D., Vardimon, L., Renz, D., and Doerfler, W. (1984) Proc. Natl. Acad. Sci. U. S. A. 8 1 , 2950-2954

Wolf, S. F., and Migeon, B. R. (1985) Nature 314 , 467-469 Mizuuchi, K., Mizuuchi, M., and Gellert, M. (1982) J. Mol. Biol. 156 , 229-

Lilley, D. M. J., and Markham, A. F. (1983) EMBO J. 2,527-533 Singleton, C. K., Kilpatrick, M. W., and Wells, R. D. (1983) Proc. Natl.

Acad. Sei. U. S. A. 80,2447-2451 Zacharias, W., Larson, J. E., Kilpatrick, M. W., and Wells, R. D. (1984)

Nucleic Acrds Res. 12, 7677-7692 Azorin, F., Hahn, R., and Rich, A. (1984) Proc. Natl. Acad. Sci. U. S. A.

81,5714-5718 Vardimon, L., and Rich, A. (1984) Proc. Natl. Acad. Sci. U. S. A. 81,3268-

3272 Mann, M. B., and Smith, H. 0. (1979) in Transmethylation (Usdin, E.,

Borchardt, R. T., and Creveling, C. R., eds) pp. 483-492, Elsevier Sci-

Klysik, J., Stirdivant, S. M., Larson, J. E., Hart, P. A,, and Wells, R. D. entific Publishing Co., NY

Melton, D. A., Krieg, P. A., Rebagliati, M. R., Maniatis, T., Zinn, K., and (1981) Nature 290,672-677

Hardies S. C., Patient R. K., Klein R. D., Ho, F. Reznikoff, W. S., and Green, M. R. (1984) Nucleic Acids Res. 12 , 7035-7056

Mandel, M., and Higa, A. (1970) J. Mol. Biol. 5 3 , 159-162 Wells: R. D. (1979) i. Biol. Chem. 254,5527-5534

Clewell, D. B., and Helinskl, D. R. (1969) Proc. Natl. Acad. Sci. U. S. A.

Messing, J., and Vieira, J. (1982) Gene (Amst.) 19, 269-276 Birnboim, H. C., and Doly, J. (1979) Nucleic Acids Res. 7, 1513-1523

Barnes, W. M., Bevan, M., and Son, P. (1983) Methods Enzymol. 101,98-

Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Gene (Amst.) 33,

Saneer. F.. Nicklen. S.. and Coulson. A. R. (1977) Proc. Natl. Acad. Sci. (1.

243

6 2 , 1159-1166

122

103-119

S-A,' 74,5463-5467 Sanger, F. (1981) Science 214,1205-1210 Sanger, F., and Coulson, A. R. (1978) FEBS Letters 87, 107-110

Townes, T. M., Lingrel, J . B., Chen, H. Y., Brinster, R. L., and Palmiter, Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 65,499-560

Berk, A. J., and Sharp, P. A. (1977) Cell 1 2 , 721-732 Krause, H. M., Rothwell, M. R., and Higgins, N. P. (1983) Nucleic Acids

Devereux, J., Hoeberli, P., and Smithies, 0. (1984) Nucleic Acids Res. 12 ,

Smzolanyi, E., Kiss, A., and Venetianer, P. (1980) Gene (Amst.) 10,219-

R. D. (1985) EMBOJ. 4 , 1715-1723

Res. 11,5483-5495

387-395

Walder, R. Y., Langtimm, C. J., Chattejee, R., and Walder, J. A. (1983) J .

Kiss, A., Posfai, G., Keller, C. C., Venetianer, P., and Roberts, R. J. (1985)

Raleigh, E. A,, and Wilson, G. (1986) Proc. Natl. Acad. Sci. U. S. A. 8 3 ,

ZZD

Biol. Chem. 2 5 8 , 1235-1241

Nucleic Aclds Res. 13,6403-6421

Bolivar, F., Rodriguez, R. L., Greene, P. J., Betlach, M. C., Heyneker, H. 9070-9074

95-113 L., Boyer, H. W., Crosa, J. H., and Falkow, S. (1977) Gene (Amst.) 2 ,

Blumenthal, R. M., Gregory, S. A., and Cooperider, J. S. (1985) J. Bacteriol. 164,501-509

Newman, A. K., Ruhin, R. A., Kim, S.-H., and Modrich, P. (1981) J . Biol. Chem. 256,2131-2139

Greene, P. J., Gupta, M., Boyer, H. W., Brown, W. E., and Rosenberg, J. M. (1981) J. Bid. Chem. 256,2143-2153

Schoner, B., Kelly, S., and Smith, H. 0. (1983) Gene (Amst.) 24,227-236 Walder, R. Y.. Walder. J. A., and Donelson, J. E. (1984) J . Biol. Chem.

Bougueleret, .L., Schwarzstein, M., Tsugita, A., and Zaheau, M. (1984) 259,'8015-8026

Theriault, G., Roy, P. H., Howard, K. A., Benner, J. S., Brooks, J. E., Nucleic Aczds Res. 12,3659-3676

Waters, A. F., and Gingeras, T. R. (1985) Nucleic Acids Res. 13, 8441-

Wu, J. C., and Santi, D. V. (1987) J. Biol. Chem. 262,4778-4786 Rosenberg, M., and Court, D. (1979) Annu. Reu. Genet. 13 , 319-353 Noyer-Weidner, M., Jentsch, S., Kupsch, J., Bergbauer, M., and Trautner,

Revel, H. R. (1983) in Bacteriophage T4 (Mosig, G., Mathews,,C., Berget, T. A. (1985) Gene (Amst.) 35, 143-150

P.. and Kutter. E.. eds) DD. 156-165. Amerlcan Society for Mlcrobiolom,

8461

Washington, D. C: ' . . Revel, H. R., and Luria, S. E. (1970) Annu. Reu. Genet. 4 , 177-192 Wyatt, G. R., and Cohen, S. S. (1953) Biochem. J . 55 , 774-782 Lehman, I. R., and Pratt, E. A. (1960) J. Biol. Chem. 235 , 3254-3259

Sequence and Expression of HhaI Methylase

APPENDIX e e Trial Presentation of the MHhal DNA Sequence with Anno-

tations in a Computer-readable Format The sequence of the 1476-bp Hind111 fragment containing

the MHhaI gene is presented in Softstrip data strips for a Cauzin strip reader. This softstrip was prepared with a Macintosh Plus computer using the Microsoft Word (Version 1.05) and the Cauzin Systems Stripper program. The data in this strip can be read directly into Apple Macintosh, IBM PC, or Apple I1 desk-top computers that are equipped with a strip reader. Both the strip reader and the necessary software programs can be obtained at nominal cost from Cauzin Sys- tems, Inc., 835 South Main Street, Waterbury, CT 06706.

This figure is being reproduced as an experiment to test the feasibility of publishing nucleotide sequences in computer- readable form. Written comments from readers are invited, and should be sent to the Journal editorial office, 9650 Rock- ville Pike, Bethesda, MD 20814.

4777