Proc. Nati. Acad. Sci. USAVol. 89, pp. 11683-11687, December 1992Biochemistry

The PR264/c-myb connection: Expression of a splicing factormodulated by a nuclear protooncogene

(splicing factor SC35/transactivation/differentiation/hematopoiesis)

ALAIN SUREAU*, JOHANN SORET*, MICHEL VELLARD*, JANINE CROCHET*, AND BERNARD PERBAL*tt*Laboratoire d'Oncologie Virale et Molculaire, Batiment 110, Institut Curie, Centre Universitaire, 91405 Orsay Cedex, France; and tUniversitd Paris 7 (DenisDiderot), Paris, France

Communicated by Bernard Roizman, August 19, 1992

ABSTRACT We have previously reported that expressionof the c-myb gene in normal avian thymic cells proceedsthrough the intermolecular recombination of ET (thymus-specific) and c-myb coding sequences, thereby generating anovel type of c-myb product. Antisense transcripts expressedfrom the ET locus encode the extremely well-conserved splicingfactor PR264/SC35. We now show that the human PR264promoter sequences contain several myb-recognition elementsthat efficiently interact in vito with the c-myb DNA-bindingdomain. Moreover, expression from the PR264 promoter istransactivated, both in vitro and in cultured cells, by differentc-myb products. Thus, the PR264 gene is most likely a physi-ological target for the c-myb family of transcription factors.

The c-myb protooncogene is preferentially expressed inimmature hematopoietic cells (1), where it is thought toregulate cellular proliferation and differentiation (2) by con-trolling transcription ofdevelopmentally important genes (3).Thus far, several genes have been identified as targets for themyb transactivating properties, including the promyelocyte-specific mim-J gene (4), whose function and role in devel-opment are unknown, the CD4 glycoprotein gene (5), thec-myc protooncogene (6, 7), and c-myb itself (8).We have previously reported that c-myb expression in

avian thymic cells involves the intermolecular recombinationof ET (thymus-specific) and c-myb coding sequences tran-scribed from genetic loci located on distinct chromosomes,both in chicken and in human (9). In both species, the ETregion is bidirectionally transcribed, and the antisensemRNAs code for an extremely well-conserved protein(PR264) representing a member of the arginine/serine-richsplicing factor family (10). We proposed that PR264 couldplay a role in the trans-splicing of ET and c-myb sequences(10). More recently, the characterization of cDNA clonesencoding the mammalian SC35 essential splicing factor,which is required for the first step in the splicing reaction andfor spliceosome assembly, established that SC35 is encodedby the PR264 gene (11).

In chicken, expression of the different PR264 mRNAs isdevelopmentally regulated, and one of the mRNAs is pref-erentially detected in hematopoietic cells (10). To determinethe molecular basis of these regulatory processes, we havecharacterized the various PR264 mRNA species and ana-lyzed the promoter sequences responsible for their expres-sion in human cells.§

MATERIALS AND METHODScDNA Library Screening and Nucleotide Sequencing. The

human bone marrow cDNA library (Clontech) was screenedwith the 32P-labeled H230 genomic probe (9). Dideoxy se-

quencing and sequence data treatments were performed asdescribed (10).

Cell Culture Conditions. HEL-1 (12) and HeLa cells weregrown in Dulbecco's modified Eagle's medium (GIBCO/BRL) supplemented with 10o newborn calf serum and 10%ofetal bovine serum, respectively. HL-60 (ATCC CCL 240)and CCRF-CEM (ATCC CCL 119) cells were grown in RPMI1640 medium (GIBCO/BRL) supplemented as recommendedby the supplier. Differentiation ofHL-60 cells was induced bytreatment with 1.3% (vol/vol) dimethyl sulfoxide (DMSO) for60 hr or 6 nM phorbol 12-myristate 13-acetate ("tetrade-canoylphorbol acetate," TPA) for 36 hr.RNA Purification and Analysis. Thymic mRNAs were

purified from a surgery sample from a 1-week-old girl (10).Polyadenylylated species were selected on mRNA separatorcolumns (Clontech). Northern blotting and hybridizationconditions were as described (10, 13).

Blot Hybridization. The 650-base-pair (bp) PR264-specificprobe obtained by EcoRI-Bgl II digestion of the HPR5 clonecontains the PRE1 (PR264 exon 1) coding sequences and the5'-proximal coding sequences of the PRE2 exon (10). The700-bp EcoRI-EcoRI c-myb-specific probe was derived froma human c-myb cDNA and corresponds to the coding se-quences of the first six c-myb exons. The human glyceral-dehyde-3-phosphate dehydrogenase (G3PDH)-specific probewas purchased from Clontech. Autoradiograms werescanned with an Ultroscan XL densitometer (LKB-Phar-macia).RNase Protection Analyses. The 1.4-kilobase (kb) Nco

I-HindIlI fragment containing the promoter sequences of thehuman PR264 gene was inserted into the pBluescript KS(+)vector (Stratagene). After linearization at the Sma I restric-tion site, in vitro transcription was performed with T7 RNApolymerase (New England Biolabs). Samples of poly(A)+RNA (3 ,ug) were hybridized overnight at 50°C with 3 ng of[a-32P]UTP-labeled probe. RNARNA hybrids were thendigested with RNase A and RNase T1 (14) and analyzed in a6% polyacrylamide sequencing gel.

Transfection and Chloramphenicol Acetyltransferase (CAT)Assays. The pR264cat reporter plasmid was constructed bysubcloning the 1097-bp HindIII-Stu I fragment, which con-tains the PR264 promoter sequences, into the pBL CAT5vector (28). Transfection of HeLa cells (5 x 104 per 35-mmtissue culture dish), extract preparation, and CAT assayswere as described (15, 16). The SVmyb expression vectorwas obtained by subcloning the Xho I-Xho I fragment of thechicken thymic cDNA (17) into the pSVL vector (Pharma-

Abbreviations: CAT, chloramphenicol acetyltransferase; DMSO,dimethyl sulfoxide; TPA, "tetradecanoylphorbol acetate" (phorbol12-myristate 13-acetate); G3PDH, glyceraldehyde-3-phosphate de-hydrogenase; ISRE, interferon stimulation response element; MRE,myb-recognition element.tTo whom reprint requests should be addressed.§The sequence reported in this paper has been deposited in theGenBank data base (L03693).

11683

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Proc. Natl. Acad. Sci. USA 89 (1992)

A

HindIII J

K C

-924

-804

-684

SmaICCTCCCAGCCTGACTCACTGCGGCCAGGCGACCGGGTCACCTGACCGCAGCCGCGGCGCCGGCCGC TCGGCCCGCTGGGAAACGTAGTCCCGGGTGACCTGGCACGCGCAAGCGCTCGGCGGAGGGTCGGACTGAGTGACGCCGGTCCGC TGGCCCAGTGGACTGGCGTCGGCGCCGCGGCCGGCGAGCCGGGCGACCCTTTGCATCAGGGCCCACTGGACCGTGCGCGTTCGCGAGCCG

-524

GGGGAGTCCCCACCGCCAGGACGCAGAGCC GACGGAGCTCTCGGGCTCTGGCGAAAGGGGGTTGGGAAGCGGACTCCGGC GAAGAGCAGTCAGGAACGGCTGGACGGGGCCGAGAGACGACCCCTCAGGGGTGGCGGTCCTGCGTCTCGGCTGCCTCGAGAGCCCGAGACCGCTTTCCCCCAACCCTTCGCCTGAGGCCGCTTCTCGTCAGTCCTTGCCGACCTGCCCCGGCTC TCTGCT

ICGCAGCGGAGTCTGAGGGGGCCGGGGTCACAGGGAGAGGCAAATGAGGGCAGAAGCACTCTTCAGACGGAGACGGG _ AAA GACMWATTGGCGCGTCGCCTCAGACTCCCCCGGCCCCAGTGTCCCTCTCCGTTTACTCCCGTCTTCGTGAGAAGTCTGCCTCTGCCCCGACTGCCGACTC =I CmkC2a="CATAACCG

11 B

G~~~~~~ATGAAAAAAAGGTGGGGGCCCAGATGGGGAGCACC TCCTCTTCCTCCTGCCCAATCGCGATCGTCCGGCCTCCCAGG GGGOCICCC2h==TACTTTTTTTCCACCCCCGGGTCTACCCCTCGTGGAGGAGAAGGAGGACGGGTTAGCGCTAGCAGGCCGGAGGGTCC cc AA=

GCTCCCCCTCCCTCCAGCCGTGACTCCGCGCTTTTTGGCCCGCCCGCCGGGCTGTGCGCAGGc GGGCGCGGTGGGCGGAGGTCGGCACTGAGGCGCGAAAAACCGGGCGGGCGGCCCGACACGCG TCCGCGAAGCCCAT -----CCCCGCGCCACCCG

CAAT Box ISRE TATA Box-- -_. .A_ ACAATCAGAAGGTCA2 =GGGTGGCGCGGGCGCCATTTTGTGAG ~:XCGGCTGCCC lC GCGC TAGCCTGCGGAGCCCGGTTAGTCTTCC-:A CCACCGCGCCCGCGGTAAAACACTCClGTTI~ZCCTCTCCGGCCGACGOCOgQAAlWCCACGCGATCGGACGCCTCGGGC

+1StuI B D

TCCGTGCTGTTCTGCGGCAAGGCCTTTCCCAGTGTCCCCACGCG u GCGGCGTCGCACCGCCCAGAGCTGAGGAAGGCCCATC=O=GGGCTCCGGAGGCACGACAAGACGCCGTTCCGGAAAGGG TCACAGGGGTGCGCCTSGTGCGCACTCCGCGCCGCAGCGTGGCGGGTCTCGACTCCTT T=CCCWAACCCCCGAGGCC

GCCGCCACTCAGAGCTA!ISAGCTACGGCCGCCCCCCTCCCGATGTGGAGGGTATGACCTCCCTCAAGGTGGACAACCTGACCTACCGCACCTCGCCCGACACGC TGAGGCGCGTCTTCGACGGCGGTGAGTCTCGATACTCGATGCCGGCGGGGGGAGGGCTACACCTCCCATACTGGAGGGAGTTCCACCTGTTGGACTGGATGGCGTGGAGCGGGCTGTGCGACTCCGCGCAGAAGCT

-444

-324

-204

-84

+37

+157

+277

13

FIG. 1. (A) Nucleotide sequence of the human PR264 promoterregion. The PR264 translation initiation codon is indicated by stars.The general transcription signals (TATA and CAAT) and the inter-feron stimulation response element (ISRE) are indicated in bold. Foreach of the 11 myb-recognition elements (MREs A-K), the consen-sus myb-binding site is underlined and the regions protected infootprint experiments are shown in bold on both strands. Thepotential transcription start sites mapped with RNase protection areoverlined with a dashed line. The arrowhead indicates the transcrip-tion start site identified by primer extension analysis and defines the+ 1 position of nucleotide numbering. (B) RNase mapping of PR264potential transcription start sites. The origin of the RNAs analyzedby RNase protection is indicated. The "RP" and "RD" protectedfragments are represented under the schematic drawing of the PR264promoter. Hinfl-digested pBR322 DNA was end-labeled with T4polynucleotide kinase and used as "molecular weight" markers(MW). Nt, nucleotides.

cia). The Bmyb clone was derived from SVmyb by deletionof the 5'-proximal coding sequences located upstream to theEag I site.

Bandshift Assays and DNase I Footprinting. Bandshift as-

says were performed by incubating the c-myb R2R3 poly-peptide (18) and end-labeled double-stranded oligonucleo-

tides for 10 min at 0°C in 25 ,ul of 20% (vol/vol) glycerol/50mM KCI/20 mM Hepes, pH 7.9/5 mM MgCl2/0.1 mMEDTA/1 mM dithiothreitol with poly(dI-dC) at 40 jg/ml.Complexes were resolved in a 7% polyacrylamide gel run in0.5x TBE (45 mM Tris/45 mM boric acid/1 mM EDTA) andrevealed by autoradiography. DNase I footprinting was per-

I

I

\=

AAGCTTTTTAGATTCCGGGGACATTTTGGCTCAGCTCTGCCGGAGGCAGCAGCCCAGGGCAGTCAGCTCTCCTCGGGGCGAAGCCACTGACAATCCTGGAGAAAGAAhCAruk24902GMTTCGAAAAATCTAAGGCCCCTGTAAAACCGAGTCGAGACGGCCTCCGTCGTCGGGTCCCGTCAGTCGAGAGGAGCCCCGCTTCGGTGACTGTTAGGACCTCTTTCTTTACTCTAM=

AGATGTAGGAGCCAGG GATCGGAACCCCAGGTTTAGGGCGAAGTTCTCCC CGATACCTCTTCCGTCTACATCCTCGGTCCG ACCTAGCCTTGGGGTCCAAATCCCGCTTCAAGAGGG TCGCTA

r

11684 Biochemistry: Sureau et al.

'. :,

-1 ...i J -----------I

Proc. NatL Acad. Sci. USA 89 (1992) 11685

AMO U

_o

_^ini~R2R3 -! j.T^1iI

abei'ed MR -

camanb e

13

4*0 f In

aw ba

I I I0 is ..,

) X i

--v,15a*a&? _w.wmm

I..^IIA .

I or

Aa

aA

IuW.

K

II

3 I

..... ... ax

.A.

a

8'"a. t

14

~- -

---4241-Ei----

J K C

i)(ll(l 1 i l;o

a .-

I:.:eSacIGi

:jiI

I HB G F A Ef;,t at 1-11LiTit

FIG. 2. (A) Bandshift analysis ofPR264 MREs. Double-stranded oligo-nucleotides containing the A, B, or CMRE were tested in direct bandshiftexperiments (Right) and in competi-tion assays with the strong mim MRE(4) (Left). Foreach experiment, 0.2 ngof labeled oligonucleotide was incu-bated with 0.3 pmol of myb R2R3polypeptide. The molar excess of un-labeled oligonucleotide used in com-

U petition assays is indicated. MREmut, which contained a mutated mybconsensus binding site, was used as anegative control. In the following oli-gonucleotide sequences, only the pos-

A itive strand is shown, and wild-type ormutated myb consensus binding se-quences are in uppercase letters.MRE-A, tcgagctgcccgccCAGTTGt-tacttag; MRE-B, tcgctttcCAAC-TGcccgctaatt; MRE-C, tcgatccccac-cggCAGTTAggatactc; MRE-mim,cacattaTAACOCttttttagc; MRE-mut,cacattaTATGCCacttttttag. (B) Foot-pt analysis of the PR264 promoterregion. Asymmetrically labeledprobes containing the PR264 pro-moter sequences were incubatedwithout (lanes 0) or with 1.6 nM, 16nM, 160 nM, 1.6gM, or 3.2FM R2R3polypeptide and then subjected toDNase I degradation. Sequence lad-ders of the DNA probes (A/G, C/T)were prepared (7). Of the two strandsanalyzed for each DNA probe, onlyone is presented here. Position andlength of the protected regions are

l)} indicated by vertical lines on the rightof each autoradiogram. Nucleotidenumbering is as in Fig. 1A. (C) Sche-matic drawing of the PR264 promoterand summary of bandshift and foot-print analyses. CAAT and TATA

\-1 (; transcription signals are indicated bystippled boxes. Hatched boxes corre-

-fl--- spond to MREs, and the orientationD of the myb consensus binding site is

N (; shown by arrows. The relative affin-ity of each MRE is indicated by--e+/++/+++ (nt, not tested).

formed essentially as described (7) except that binding reac-

tions were performed with 15-25 ng of the end-labeled DNAfragment (1-3 x 105 cpm) and variable amounts of R2R3protein in 50 1.l of 10%6 glycerol/50 mM NaCl/20 mMTris HCI, pH 8.0/5 mM MgCl2/0.1 mM EDTA/1 mM dithio-threitol with poly(dI-dC) at 2.5 ,ug/ml. Reaction mixtureswere incubated for 30 min at 0C and digested with 25 ng ofDNase I for 1 min at 20TC.

RESULTS

Ch n of PR264 Promoter Sequences. Sequenc-ing of the human genomic region located upstream of thetranslation initiation codon identified in PREl sequences

allowed us to recognize potential transcription signals (Fig.1). Interestingly, an ISRE, located between the CAAT andTATA motifs in human sequences, was found to be con-served in the corresponding chicken region (data not shown).ISREs have been identified in the promoter regions of severalgenes whose expression is regulated by interferons in re-sponse to inducers such as viral infection or double-strandedRNA (19).Aside from these transcription signals, several MREs were

also identified, suggesting that PR264 expression might beregulated by c-myb proteins. RNase protection assays per-formed with mRNAs purified from various human cellsallowed us to identify two major potential transcription startsites within a 30-bp region located downstream of the TATA

Biochemistry: Sureau et al.

i--.

1.

li

.ow

Proc. Nati. Acad Sci. USA 89 (1992)

I,

a

FIG. 3. Transactivation analysis ofthe PR264 promoter. Cotrans-fection and CAT assays were performed with the reporter plasmidpR264cat and with the effector vectors SVmyb and Bmyb, express-ing the ET-containing and the ET-lacking c-myb product respec-tively. In each case, 3 Ug of the indicated plasmid DNA wastransfected in the presence of 10 .tg of carrier DNA and 2 MLg ofplasmid pRSV-,B-Gal (8-galactosidase vector, used as an internalcontrol to normalize for variations in transfection efficiency). pCATOand pRSV-CAT were used as negative and positive control, respec-tively. Radioactivity was determined by liquid scintillation countingand chloramphenicol conversion is given as fold stimulation.

box (Fig. 1). PR264 mRNAs expressed in HL-60 and normalthymic hematopoietic cells predominantly protected the RDfragment, suggesting that they were initiated at the distaltranscription start site (25-30 bp downstream of the TATAbox). The opposite situation was observed with PR264 tran-scripts expressed in HEL embryonic lung cells. In that case,only the proximal, RP fragment was detected, indicating that

PR264

\., I) .X )1

C-NTYB

I

tiI S .- 1-

\0 \~\

the PR264 transcription principally occurred at the potentialupstream start site (5-10 bp downstream of the TATA box).The use of a shorter probe (Nhe I-Nco I) confirmed thatprotected mRNAs differed at their 5' ends (data not shown).In CCRF-CEM cells, PR264 transcripts containing both typesof 5'-proximal sequences were identified. Preliminary primerextension experiments (data not shown) have confirmed thatthe distal initiation region mapped with the PR264 mRNAsexpressed in hematopoietic cells contains an accurate tran-scription start site (Fig. 1A).PR264 MREs Efficiently Interact with the c-myb DNA-

Binding Domain. Among the several potential MREs identi-fied in the human PR264 promoter, three of them (MREs A,B, and C in Fig. 1A) were tested for their ability to formcomplexes with the c-myb R2R3 polypeptide, which has beenshown to interact specifically with myb-binding sites (18).Results from either direct bandshift or competition assaysindicate that these MREs specifically interact, albeit withdifferent affinities, with the c-myb DNA-binding domain(Fig. 2A). DNase I footprinting analysis ofa 1200-bp genomicregion located upstream of the PR264 translation start codonallowed us to identify eight additional MREs (D-K) locatedon both sides of the TATA box (Fig. 1A and Fig. 2 B and C).Interestingly, the binding affinity of the different MREs wascorrelated neither with the length of the protected region norwith the extent of homology with the previously publishedmyb binding consensus (7, 20-22). In addition, the colocal-ization of the TATA box and MRE F might be of significancefor the regulation of PR264 expression.c-myb Proteins Tractivate the PR264 Promoter. Binding

of the c-myb R2R3 polypeptide to the PR264 promotersequences prompted us to determine whether myb productsmight play a role in the expression ofthe PR264 gene. To testthis possibility, HeLa cells were cotransfected with thePR264-CAT recombinant plasmid and with either the SVmyb-or the Bmyb clone, which express the c-myb protein con-

13

10 -

8

.0

@'..1,1_ o . q

I(l.ti 8))1 ).zom '

2,0 kb

C-MYB PR 264

FIG. 4. (A) Northern blot analysis of PR264 and c-myb expression in HL-60 cells upon chemically induced differentiation. Poly(A)+ mRNAsamples (3 MLg) purified from untreated and chemically (DMSO or TPA) treated HL-60 cells were hybridized to the indicated probe. (B) c-myband PR264 mRNA levels before and after induction ofdifferentiation. Variations ofthe PR264 1.7-kb and 2.0-kb mRNA levels have been includedin the same bars because the corresponding bands were too close to be integrated separately. G3PDH was used as an internal control to normalizefor variations in RNA amounts.

-10 ,

G3PDH s_ _

1.3 kb 3,0 kb

11686 Biochemistry: Sureau et al.

.AP 4D 40 0

Proc. Natl. Acad. Sci. USA 89 (1992) 11687

taining or deprived of the ET domain, respectively. Muchhigher transactivation ofCAT expression was observed whenHeLa cells were cotransfected with the Bmyb expressionvector (Fig. 3). This suggested that, under the experimentalconditions that we used, and as previously reported in yeast(23), the ET-containing c-myb protein is a weaker transacti-vator than its truncated counterpart. To assess the biologicalsignificance of these observations, we took advantage of thefact that c-myb expression is considerably reduced in thepromyelocytic HL-60 cells upon DMSO- or TPA-induceddifferentiation (24). Northern blot analysis of PR264 andc-myb mRNAs before and after chemical treatment ofHL-60cells revealed that three major PR264 transcripts (2.0, 1.7,and 1.3 kb) decreased concomitantly with the c-myb mRNA(Fig. 4). Interestingly, the relative amount of the 3.0-kbPR264-specific mRNA increased upon differentiation, sug-gesting that expression of this messenger is not under thecontrol of the promoter sequences identified in this work.Since our preliminary observations suggest that the level ofPR264 mRNA is not directly affected by TPA treatment (datanot shown), the observed decrease in PR264 expression ismost certainly related to the reduced expression of c-myb atthe onset of differentiation.

DISCUSSIONAnalysis of the PR264 promoter region allowed us to identifyseveral MREs that specifically interact with the c-myb R2R3binding domain. Using in vitro and cell culture experiments,we have studied the biological significance of these interac-tions and shown that c-myb products might regulate PR264expression. In promyelocytic HL-60 cells induced to differ-entiate, a 3- to 5-fold reduction in the expression of threePR264 mRNAs (2.0, 1.7, and 1.3 kb) occurs concomitantlywith either the reduction or the extinction of c-myb expres-sion. Moreover, a 2-fold reduction or extinction of c-mybexpression results in the same quantitative decrease ofPR264expression, therefore suggesting that a c-myb threshold ex-pression level is required to transactivate PR264 transcrip-tion. Surprisingly, expression of the other major PR264mRNA (3.0 kb) was unaffected or even increased followingDMSO or TPA treatment, respectively. These observationssuggest the existence of an additional promoter region whichwould control the expression of the 3.0-kb transcript inHL-60 and hematopoietic cells. This promoter, being regu-lated in a myb-independent way, could also control PR264transcription in HEL cells, which contain fairly high levels ofPR264 transcripts (3.0, 2.0, and 1.3 kb) but no detectablec-myb mRNA (data not shown). This possibility is supportedby RNase protection experiments which indicate that most ofthe PR264 transcripts are initiated at different sites in HL-60and HEL cells (Fig. 1).The combined use of alternative promoters, 3'-proximal

noncoding exons, and polyadenylylation sites could be es-sential for the fine tuning ofPR264 synthesis at specific stagesofthe cellular proliferation and differentiation processes. Thecovariant relationship between PR264 and c-myb expressionsuggests that the activity ofthe PR264 promoter is modulatedby myb proteins. We speculate that PR264 expression may bedifferentially modulated by the different c-myb products thatare expressed throughout hematopoiesis. The existencewithin the PR264 promoter of at least 11 MREs differing intheir relative affinity would then provide a greater flexibilityin response to c-myb proteins exhibiting different transacti-vating properties.Our data indicate that the expression of an essential

splicing factor can be transactivated by the products of anuclear protooncogene. The differential regulation of thePR264 promoter by c-myb proteins containing distinct aminotermini fit into our model suggesting that the PR264/SC35

splicing factor is directly or indirectly involved in the trans-splicing of ET and c-myb sequences (25, 26). We speculatethat the trans-splicing of ET, which modulates the biologicalactivity of the c-myb product, is mediated by PR264/SC35,whose relative amount is itself controlled by c-myb productsin hematopoietic cells. As the tra and tra-2 factors governingsexual determination in Drosophila (27), the PR264 splicingregulator could turn out to be a key element ofthe mechanismby which the c-myb protooncogene controls hematopoieticdifferentiation.

Thanks are due to Drs. A. Pierani, 0. Gabrielsen and R. Bosselutfor helpful advice and gifts ofmaterial. We thank Dr. A. Sentenac forcritical reading of the manuscript and Dr. C. White for grammarcorrections. M.V. and A.S. were recipients of a fellowship from theLigue Nationale Contre le Cancer and from the French Ministere dela Recherche et de la Technologie, respectively. This work wassupported by grants from Association pour la Recherche contre leCancer, Fondation pour la Recherche M6dicale, and Ligue NationaleContre le Cancer.

1. Westin, E. H., Gallo, R. C., Arya, S. K., Eva, A., Souza,L. M., Baluda, M. A., Aaronson, S. A. & Wong-Staal, F.(1982) Proc. Natl. Acad. Sci. USA 79, 2194-2198.

2. Shen-Ong, G. L. C. (1990) Biochim. Biophys. Acta 1032, 39-52.

3. Weston, K. & Bishop, J. M. (1989) Cell 58, 85-93.4. Ness, S. A., Marknell, A. & Graf, T. (1987) Cell 59, 1115-1125.5. Siu, G., Wurster, A. L., Lipsick, J. S. & Hedrick, S. M. (1992)

Mol. Cell. Biol. 12, 1592-1604.6. Evans, J. L., Morre, T. L., Kuehl, W. M., Bender, T. &

Pan-Yun Ting, J. (1990) Mol. Cell. Biol. 10, 5747-5752.7. Zobel, A., Kalkbrenner, F., Guehmann, S., Nawarath, M.,

Vorbrueggen, G. & Moelling, K. (1991) Oncogene 6, 1397-1407.

8. Nicolaides, N. C., Gualdi, R., Casadevall, C., Manzella, L. &Calabretta, B. (1991) Mol. Cell. Biol. 11, 6166-6176.

9. Vellard, M., Soret, J., Viegas-Pequignot, E., Galibert, F.,Nguyen, V. C., Dutrillaux, B. & Perbal, B. (1991) Oncogene 6,505-514.

10. Vellard, M., Sureau, A., Soret, J., Martinerie, C. & Perbal, B.(1992) Proc. Nad. Acad. Sci. USA 89, 2511-2515.

11. Fu, X. D. & Maniatis, T. (1992) Science 256, 535-538.12. Azzarone, B., Malpiece, Y., Zaech, P., Moretta, L., Fauci, A.

& Suirez, H. (1985) Exp. Cell Res. 159, 451-462.13. Perbal, B. (1988) A Practical Guide to Molecular Cloning

(Wiley, New York), 2nd Ed.14. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular

Cloning:A Laboratory Manual (Cold Spring Harbor Lab., ColdSpring Harbor, NY), 2nd Ed.

15. Bosselut, R., Duvall, J. F., G6gonne, A., Bailly, M., Hemar,A., Brady, J. & Ghysdael, J. (1990) EMBO J. 9, 3137-3144.

16. Gorman, C. M., Moffat, L. F. & Howard, B. M. (1982) Mol.Cell. Biol. 2, 1044-1051.

17. Rosson, D. & Reddy, E. P. (1986) Nature (London) 319,604-606.

18. Gabrielsen, 0. C., Sentenac, A. & Fromageot, P. (1991) Sci-ence 253, 1140-1143.

19. Hug, H., Costas, M., Staeheli, P., Aebi, M. & Weissmann, C.(1988) Mol. Cell. Biol. 8, 3065-3079.

20. Biedenkapp, H., Borgmeyer, U., Sippel, A. E. & Klempnauer,K. N. (1988) Nature (London) 335, 835-837.

21. Nakagoshi, H., Nagase, T., Ueno, Y. & Ishii, S. (1989) NucleicAcids Res. 17, 7315-7324.

22. Howe, K. M. & Watson, R. J. (1991) Nucleic Acids Res. 19,3913-3919.

23. Punyammalee, B., Crabeel, D., de Lannoy, C., Perbal, B. &Glansdorff, N. (1991) Oncogene 6, 11-16.

24. Craig, R. W. & Bloch, A. (1984) Cancer Res. 44, 442-446.25. Perbal, B. & Vellard, M. (1990) C.R. Acad. Sci. (Paris) 311,

467-472.26. Perbal, B. (1992) Med. Sci. 8, 548-561.27. Maniatis, T. (1991) Science 251, 33-34.28. Stein, B., Rahmsdorf, H. J., Steffen, A., Litfin, M. & Herrlich,

P. (1989) Mol. Cell. Biol. 9, 5169-5181.

Biochemistry: Sureau et aL